sbuild (Debian sbuild) 0.91.10 (27 June 2026) on carme.larted.org.uk +==============================================================================+ | bioperl 1.7.8-4 (amd64) Sat, 11 Jul 2026 16:10:24 +0000 | +==============================================================================+ Package: bioperl Version: 1.7.8-4 Source Version: 1.7.8-4 Distribution: perl-5.44-throwaway Machine Architecture: amd64 Host Architecture: amd64 Build Architecture: amd64 Build Type: full I: Setting up the chroot... I: Creating chroot session... I: Setting up log color... +------------------------------------------------------------------------------+ | Chroot Setup Commands Sat, 11 Jul 2026 16:10:25 +0000 | +------------------------------------------------------------------------------+ /usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup bioperl_1.7.8-4 perl-5.44-throwaway amd64 ---------------------------------------------------------------------------------------------------------------- I: Finished running '/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup bioperl_1.7.8-4 perl-5.44-throwaway amd64'. Finished processing commands. -------------------------------------------------------------------------------- I: Setting up apt archive... +------------------------------------------------------------------------------+ | Update chroot Sat, 11 Jul 2026 16:10:25 +0000 | +------------------------------------------------------------------------------+ Get:1 file:/srv/reprepro perl-5.44 InRelease [3039 B] Get:1 file:/srv/reprepro perl-5.44 InRelease [3039 B] Hit:2 http://deb.debian.org/debian unstable InRelease Hit:3 http://deb.debian.org/debian sid InRelease Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. +------------------------------------------------------------------------------+ | Fetch source files Sat, 11 Jul 2026 16:10:31 +0000 | +------------------------------------------------------------------------------+ Local sources ------------- /srv/debomatic/incoming/bioperl_1.7.8-4.dsc exists in /srv/debomatic/incoming; copying to chroot +------------------------------------------------------------------------------+ | Install package build dependencies Sat, 11 Jul 2026 16:10:31 +0000 | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libmodule-build-perl, build-essential, perl, rename, libio-string-perl, libdata-stag-perl, libtest-most-perl, libbio-alignio-stockholm-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libbio-samtools-perl, libclass-unload-perl, libcgi-pm-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpath-class-perl, libperlio-eol-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, libtest-differences-perl, libtest-exception-perl, libtest-memory-cycle-perl, libtest-pod-perl, libtest-weaken-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-twig-perl, libxml-simple-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl, libyaml-perl, libtest-requiresinternet-perl, libxml-sax-expatxs-perl Filtered Build-Depends: debhelper-compat (= 13), libmodule-build-perl, build-essential, perl, rename, libio-string-perl, libdata-stag-perl, libtest-most-perl, libbio-alignio-stockholm-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libbio-samtools-perl, libclass-unload-perl, libcgi-pm-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpath-class-perl, libperlio-eol-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, libtest-differences-perl, libtest-exception-perl, libtest-memory-cycle-perl, libtest-pod-perl, libtest-weaken-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-twig-perl, libxml-simple-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl, libyaml-perl, libtest-requiresinternet-perl, libxml-sax-expatxs-perl dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive/sbuild-build-depends-main-dummy.deb'. Ign:1 copy:/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive ./ InRelease Get:2 copy:/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive ./ Release [615 B] Ign:3 copy:/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive ./ Release.gpg Get:4 copy:/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive ./ Sources [1712 B] Get:5 copy:/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive ./ Packages [1729 B] Fetched 4056 B in 0s (0 B/s) Reading package lists... Reading package lists... Install main build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... Solving dependencies... The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils ca-certificates debhelper dh-autoreconf dh-strip-nondeterminism dwz file fontconfig fontconfig-config fonts-dejavu-core fonts-dejavu-mono gettext gettext-base graphviz graphviz-tools groff-base intltool-debian libabsl20260107 libace-perl libalgorithm-diff-perl libalgorithm-munkres-perl libann0 libaom3 libarchive-zip-perl libarray-compare-perl libavif16 libb-hooks-op-check-perl libb2-1 libbio-alignio-stockholm-perl libbio-asn1-entrezgene-perl libbio-cluster-perl libbio-perl-perl libbio-samtools-perl libbio-variation-perl libbrotli1 libbsd0 libcache-cache-perl libcairo2 libcapture-tiny-perl libcdt6 libcgi-pm-perl libcgraph8 libclass-data-inheritable-perl libclass-inspector-perl libclass-method-modifiers-perl libclass-unload-perl libclass-xsaccessor-perl libclone-perl libcom-err2 libconvert-binary-c-perl libconvert-binhex-perl libcrypt-rc4-perl libdata-stag-perl libdatrie1 libdav1d7 libdbd-mysql-perl libdbd-pg-perl libdbd-sqlite3-perl libdbi-perl libdbus-1-3 libde265-0 libdebhelper-perl libdeflate0 libdevel-callchecker-perl libdevel-cycle-perl libdevel-stacktrace-perl libdigest-perl-md5-perl libdouble-conversion3 libdrm-amdgpu1 libdrm-common libdrm-intel1 libdrm2 libdynaloader-functions-perl libedit2 libegl-mesa0 libegl1 libelf1t64 libencode-locale-perl liberror-perl libevdev2 libexception-class-perl libexpat1 libexporter-tiny-perl libfcgi-perl libfcgi0t64 libfile-listing-perl libfile-slurper-perl libfile-stripnondeterminism-perl libfontconfig1 libfreetype6 libfribidi0 libgav1-2 libgbm1 libgd3 libgl1-mesa-dri libglib2.0-0t64 libglvnd0 libglx-mesa0 libglx0 libgraph-perl libgraphite2-3 libgraphviz-perl libgssapi-krb5-2 libgts-0.7-5t64 libgudev-1.0-0 libgvc7 libgvplugin-gd8 libgvplugin-neato-layout8 libgvplugin-pango8 libgvpr2 libharfbuzz0b libheap-perl libheif-plugin-dav1d libheif-plugin-libde265 libheif1 libhtml-parser-perl libhtml-tableextract-perl libhtml-tagset-perl libhtml-tree-perl libhttp-cookies-perl libhttp-daemon-perl libhttp-date-perl libhttp-message-perl libhttp-negotiate-perl libice6 libicu78 libimagequant0 libimport-into-perl libinput-bin libinput10 libio-html-perl libio-pty-perl libio-sessiondata-perl libio-socket-ssl-perl libio-string-perl libio-stringy-perl libipc-run-perl libipc-sharelite-perl libjbig0 libjcode-pm-perl libjpeg62-turbo libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 liblerc4 liblist-moreutils-perl liblist-moreutils-xs-perl libllvm21 libltdl7 liblwp-mediatypes-perl liblwp-protocol-https-perl libmagic-mgc libmagic1t64 libmailtools-perl libmariadb3 libmath-derivative-perl libmath-spline-perl libmd4c0 libmime-tools-perl libmodule-build-perl libmodule-runtime-perl libmoo-perl libmtdev1t64 libnet-http-perl libnet-smtp-ssl-perl libnet-ssleay-perl libole-storage-lite-perl libopengl0 libpadwalker-perl libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libparams-classify-perl libparse-recdescent-perl libpath-class-perl libpathplan4 libpciaccess0 libpcre2-16-0 libperlio-eol-perl libpipeline1 libpixman-1-0 libpng16-16t64 libpostscript-perl libpq5 libproc2-1 libqt6core6t64 libqt6dbus6 libqt6gui6 libqt6widgets6 librav1e0.8 librole-tiny-perl libsensors-config libsensors5 libset-object-perl libset-scalar-perl libsharpyuv0 libsm6 libsoap-lite-perl libsort-naturally-perl libspreadsheet-parseexcel-perl libspreadsheet-writeexcel-perl libstatistics-descriptive-perl libsub-quote-perl libsub-uplevel-perl libsvg-graph-perl libsvg-perl libsvtav1enc4 libtask-weaken-perl libtest-deep-perl libtest-differences-perl libtest-exception-perl libtest-memory-cycle-perl libtest-most-perl libtest-pod-perl libtest-requiresinternet-perl libtest-warn-perl libtest-weaken-perl libtext-charwidth-perl libtext-diff-perl libtext-wrapi18n-perl libthai-data libthai0 libtiff6 libtimedate-perl libtool libtree-dagnode-perl libtry-tiny-perl libts0t64 libtype-tiny-perl libuchardet0 libunicode-map-perl liburi-perl libvulkan1 libwacom-common libwacom9 libwayland-client0 libwebp7 libwww-perl libwww-robotrules-perl libx11-6 libx11-data libx11-xcb1 libxau6 libxcb-cursor0 libxcb-dri3-0 libxcb-glx0 libxcb-icccm4 libxcb-image0 libxcb-keysyms1 libxcb-present0 libxcb-randr0 libxcb-render-util0 libxcb-render0 libxcb-shape0 libxcb-shm0 libxcb-sync1 libxcb-util1 libxcb-xfixes0 libxcb-xinput0 libxcb-xkb1 libxcb1 libxdmcp6 libxdot4 libxext6 libxkbcommon-x11-0 libxkbcommon0 libxml-dom-perl libxml-dom-xpath-perl libxml-filter-buffertext-perl libxml-libxml-perl libxml-namespacesupport-perl libxml-parser-perl libxml-perl libxml-regexp-perl libxml-sax-base-perl libxml-sax-expatxs-perl libxml-sax-perl libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl libxml-writer-perl libxml-xpath-perl libxml-xpathengine-perl libxml2-16 libxpm4 libxrender1 libxshmfence1 libxxf86vm1 libyaml-perl libyuv0 libz3-4 m4 man-db mariadb-common mesa-libgallium mysql-common netbase openssl pci.ids perl-openssl-defaults po-debconf procps rename sensible-utils shared-mime-info ucf x11-common xkb-data Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev gnulib-l10n gsfonts graphviz-doc groff bioperl libmldbm-perl libnet-daemon-perl libsql-statement-perl libgd-tools low-memory-monitor krb5-doc krb5-user libheif-plugin-ffmpegdec libheif-plugin-jpegdec libheif-plugin-jpegenc libheif-plugin-j2kdec libheif-plugin-j2kenc libheif-plugin-kvazaar libheif-plugin-rav1e libheif-plugin-svtenc libdata-dump-perl libhtml-element-extended-perl libcrypt-ssleay-perl libscalar-number-perl libpq-oauth lm-sensors libapache2-mod-perl2 libmime-lite-perl libnet-jabber-perl libtool-doc gfortran | fortran95-compiler libsub-name-perl libdevel-lexalias-perl libbusiness-isbn-perl libmime-base32-perl libregexp-ipv6-perl libwacom-bin libauthen-ntlm-perl libunicode-map8-perl libunicode-string-perl xml-twig-tools libyaml-shell-perl m4-doc apparmor less www-browser libmail-box-perl Recommended packages: curl | wget | lynx python3:any fonts-liberation libgd-perl libalgorithm-diff-xs-perl bioperl-run | libbio-perl-run-perl libcgi-fast-perl libtie-hash-indexed-perl | libtie-ixhash-perl libmldbm-perl libxml-libxslt-perl perl-tk libfcgi-bin libperlio-utf8-strict-perl libarchive-cpio-perl libglib2.0-data xdg-user-dirs libgts-bin libheif-plugin-x265 libheif-plugin-aomenc libhtml-format-perl libio-compress-brotli-perl krb5-locales libmodule-signature-perl libpod-readme-perl libsoftware-license-perl libnamespace-clean-perl libauthen-sasl-perl ghostscript qt6-translations-l10n qt6-gtk-platformtheme qt6-qpa-plugins qt6-svg-plugins qt6-wayland libxmlrpc-lite-perl libdate-calc-perl libdate-manip-perl libxstring-perl libltdl-dev libref-util-perl libtype-tiny-xs-perl mesa-vulkan-drivers | vulkan-icd libdata-dump-perl libhtml-form-perl libxml-sax-expat-perl libtext-iconv-perl libtie-ixhash-perl libyaml-libyaml-perl | libyaml-syck-perl libmail-sendmail-perl psmisc linux-sysctl-defaults The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils ca-certificates debhelper dh-autoreconf dh-strip-nondeterminism dwz file fontconfig fontconfig-config fonts-dejavu-core fonts-dejavu-mono gettext gettext-base graphviz graphviz-tools groff-base intltool-debian libabsl20260107 libace-perl libalgorithm-diff-perl libalgorithm-munkres-perl libann0 libaom3 libarchive-zip-perl libarray-compare-perl libavif16 libb-hooks-op-check-perl libb2-1 libbio-alignio-stockholm-perl libbio-asn1-entrezgene-perl libbio-cluster-perl libbio-perl-perl libbio-samtools-perl libbio-variation-perl libbrotli1 libbsd0 libcache-cache-perl libcairo2 libcapture-tiny-perl libcdt6 libcgi-pm-perl libcgraph8 libclass-data-inheritable-perl libclass-inspector-perl libclass-method-modifiers-perl libclass-unload-perl libclass-xsaccessor-perl libclone-perl libcom-err2 libconvert-binary-c-perl libconvert-binhex-perl libcrypt-rc4-perl libdata-stag-perl libdatrie1 libdav1d7 libdbd-mysql-perl libdbd-pg-perl libdbd-sqlite3-perl libdbi-perl libdbus-1-3 libde265-0 libdebhelper-perl libdeflate0 libdevel-callchecker-perl libdevel-cycle-perl libdevel-stacktrace-perl libdigest-perl-md5-perl libdouble-conversion3 libdrm-amdgpu1 libdrm-common libdrm-intel1 libdrm2 libdynaloader-functions-perl libedit2 libegl-mesa0 libegl1 libelf1t64 libencode-locale-perl liberror-perl libevdev2 libexception-class-perl libexpat1 libexporter-tiny-perl libfcgi-perl libfcgi0t64 libfile-listing-perl libfile-slurper-perl libfile-stripnondeterminism-perl libfontconfig1 libfreetype6 libfribidi0 libgav1-2 libgbm1 libgd3 libgl1-mesa-dri libglib2.0-0t64 libglvnd0 libglx-mesa0 libglx0 libgraph-perl libgraphite2-3 libgraphviz-perl libgssapi-krb5-2 libgts-0.7-5t64 libgudev-1.0-0 libgvc7 libgvplugin-gd8 libgvplugin-neato-layout8 libgvplugin-pango8 libgvpr2 libharfbuzz0b libheap-perl libheif-plugin-dav1d libheif-plugin-libde265 libheif1 libhtml-parser-perl libhtml-tableextract-perl libhtml-tagset-perl libhtml-tree-perl libhttp-cookies-perl libhttp-daemon-perl libhttp-date-perl libhttp-message-perl libhttp-negotiate-perl libice6 libicu78 libimagequant0 libimport-into-perl libinput-bin libinput10 libio-html-perl libio-pty-perl libio-sessiondata-perl libio-socket-ssl-perl libio-string-perl libio-stringy-perl libipc-run-perl libipc-sharelite-perl libjbig0 libjcode-pm-perl libjpeg62-turbo libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 liblerc4 liblist-moreutils-perl liblist-moreutils-xs-perl libllvm21 libltdl7 liblwp-mediatypes-perl liblwp-protocol-https-perl libmagic-mgc libmagic1t64 libmailtools-perl libmariadb3 libmath-derivative-perl libmath-spline-perl libmd4c0 libmime-tools-perl libmodule-build-perl libmodule-runtime-perl libmoo-perl libmtdev1t64 libnet-http-perl libnet-smtp-ssl-perl libnet-ssleay-perl libole-storage-lite-perl libopengl0 libpadwalker-perl libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libparams-classify-perl libparse-recdescent-perl libpath-class-perl libpathplan4 libpciaccess0 libpcre2-16-0 libperlio-eol-perl libpipeline1 libpixman-1-0 libpng16-16t64 libpostscript-perl libpq5 libproc2-1 libqt6core6t64 libqt6dbus6 libqt6gui6 libqt6widgets6 librav1e0.8 librole-tiny-perl libsensors-config libsensors5 libset-object-perl libset-scalar-perl libsharpyuv0 libsm6 libsoap-lite-perl libsort-naturally-perl libspreadsheet-parseexcel-perl libspreadsheet-writeexcel-perl libstatistics-descriptive-perl libsub-quote-perl libsub-uplevel-perl libsvg-graph-perl libsvg-perl libsvtav1enc4 libtask-weaken-perl libtest-deep-perl libtest-differences-perl libtest-exception-perl libtest-memory-cycle-perl libtest-most-perl libtest-pod-perl libtest-requiresinternet-perl libtest-warn-perl libtest-weaken-perl libtext-charwidth-perl libtext-diff-perl libtext-wrapi18n-perl libthai-data libthai0 libtiff6 libtimedate-perl libtool libtree-dagnode-perl libtry-tiny-perl libts0t64 libtype-tiny-perl libuchardet0 libunicode-map-perl liburi-perl libvulkan1 libwacom-common libwacom9 libwayland-client0 libwebp7 libwww-perl libwww-robotrules-perl libx11-6 libx11-data libx11-xcb1 libxau6 libxcb-cursor0 libxcb-dri3-0 libxcb-glx0 libxcb-icccm4 libxcb-image0 libxcb-keysyms1 libxcb-present0 libxcb-randr0 libxcb-render-util0 libxcb-render0 libxcb-shape0 libxcb-shm0 libxcb-sync1 libxcb-util1 libxcb-xfixes0 libxcb-xinput0 libxcb-xkb1 libxcb1 libxdmcp6 libxdot4 libxext6 libxkbcommon-x11-0 libxkbcommon0 libxml-dom-perl libxml-dom-xpath-perl libxml-filter-buffertext-perl libxml-libxml-perl libxml-namespacesupport-perl libxml-parser-perl libxml-perl libxml-regexp-perl libxml-sax-base-perl libxml-sax-expatxs-perl libxml-sax-perl libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl libxml-writer-perl libxml-xpath-perl libxml-xpathengine-perl libxml2-16 libxpm4 libxrender1 libxshmfence1 libxxf86vm1 libyaml-perl libyuv0 libz3-4 m4 man-db mariadb-common mesa-libgallium mysql-common netbase openssl pci.ids perl-openssl-defaults po-debconf procps rename sbuild-build-depends-main-dummy sensible-utils shared-mime-info ucf x11-common xkb-data 0 upgraded, 314 newly installed, 0 to remove and 0 not upgraded. Need to get 115 MB/121 MB of archives. After this operation, 481 MB of additional disk space will be used. Get:1 copy:/build/bioperl-QLxev6/resolver-VPL7O2/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [1228 B] Get:2 file:/srv/reprepro perl-5.44/main amd64 libtext-charwidth-perl amd64 0.04-12+b1 [9324 B] Get:3 http://deb.debian.org/debian unstable/main amd64 libexpat1 amd64 2.8.2-1 [121 kB] Get:4 file:/srv/reprepro perl-5.44/main amd64 libcdt6 amd64 14.1.2-1+b3 [18.3 kB] Get:5 http://deb.debian.org/debian unstable/main amd64 netbase all 6.5 [12.4 kB] Get:6 file:/srv/reprepro perl-5.44/main amd64 libcgraph8 amd64 14.1.2-1+b3 [58.5 kB] Get:7 http://deb.debian.org/debian unstable/main amd64 libproc2-1 amd64 2:4.0.6-2 [69.2 kB] Get:8 file:/srv/reprepro perl-5.44/main amd64 libpathplan4 amd64 14.1.2-1+b3 [29.6 kB] Get:9 file:/srv/reprepro perl-5.44/main amd64 libxdot4 amd64 14.1.2-1+b3 [21.5 kB] Get:10 file:/srv/reprepro perl-5.44/main amd64 libgvc7 amd64 14.1.2-1+b3 [375 kB] Get:11 http://deb.debian.org/debian unstable/main amd64 procps amd64 2:4.0.6-2 [983 kB] Get:12 file:/srv/reprepro perl-5.44/main amd64 libgvpr2 amd64 14.1.2-1+b3 [125 kB] Get:13 file:/srv/reprepro perl-5.44/main amd64 libgvplugin-gd8 amd64 14.1.2-1+b3 [26.9 kB] Get:14 http://deb.debian.org/debian unstable/main amd64 sensible-utils all 0.0.26 [27.0 kB] Get:15 http://deb.debian.org/debian unstable/main amd64 openssl amd64 3.6.3-1 [1522 kB] Get:16 file:/srv/reprepro perl-5.44/main amd64 libgvplugin-pango8 amd64 14.1.2-1+b3 [31.2 kB] Get:17 file:/srv/reprepro perl-5.44/main amd64 graphviz amd64 14.1.2-1+b3 [60.2 kB] Get:18 file:/srv/reprepro perl-5.44/main amd64 libgvplugin-neato-layout8 amd64 14.1.2-1+b3 [292 kB] Get:19 file:/srv/reprepro perl-5.44/main amd64 graphviz-tools amd64 14.1.2-1+b3 [665 kB] Get:20 http://deb.debian.org/debian unstable/main amd64 ca-certificates all 20260601 [134 kB] Get:21 http://deb.debian.org/debian unstable/main amd64 libmagic-mgc amd64 1:5.47-4 [345 kB] Get:22 file:/srv/reprepro perl-5.44/main amd64 libipc-sharelite-perl amd64 0.17-5+b4 [23.2 kB] Get:23 file:/srv/reprepro perl-5.44/main amd64 libace-perl amd64 1.92-14+b1 [275 kB] Get:24 http://deb.debian.org/debian unstable/main amd64 libmagic1t64 amd64 1:5.47-4 [111 kB] Get:25 http://deb.debian.org/debian unstable/main amd64 file amd64 1:5.47-4 [43.0 kB] Get:26 http://deb.debian.org/debian unstable/main amd64 gettext-base amd64 1.0-3 [332 kB] Get:27 file:/srv/reprepro perl-5.44/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b6 [36.4 kB] Get:28 file:/srv/reprepro perl-5.44/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b5 [10.6 kB] Get:29 file:/srv/reprepro perl-5.44/main amd64 libdevel-callchecker-perl amd64 0.009-3+b1 [15.7 kB] Get:30 file:/srv/reprepro perl-5.44/main amd64 libparams-classify-perl amd64 0.015-2+b6 [22.5 kB] Get:31 file:/srv/reprepro perl-5.44/main amd64 libhtml-parser-perl amd64 3.83-2+b1 [99.4 kB] Get:32 http://deb.debian.org/debian unstable/main amd64 libuchardet0 amd64 0.0.8-2+b2 [69.0 kB] Get:33 file:/srv/reprepro perl-5.44/main amd64 libclone-perl amd64 0.50-1+b1 [21.8 kB] Get:34 file:/srv/reprepro perl-5.44/main amd64 libnet-ssleay-perl amd64 1.96-1+b1 [345 kB] Get:35 http://deb.debian.org/debian unstable/main amd64 groff-base amd64 1.24.1-1 [1336 kB] Get:36 file:/srv/reprepro perl-5.44/main amd64 libxml-parser-perl amd64 2.47-2+b1 [198 kB] Get:37 file:/srv/reprepro perl-5.44/main amd64 libbio-samtools-perl amd64 1.43-5+b2 [182 kB] Get:38 file:/srv/reprepro perl-5.44/main amd64 libconvert-binary-c-perl amd64 0.86-1+b1 [274 kB] Get:39 file:/srv/reprepro perl-5.44/main amd64 libdbi-perl amd64 1.650-1+b1 [867 kB] Get:40 http://deb.debian.org/debian unstable/main amd64 bsdextrautils amd64 2.42.2-1 [100.0 kB] Get:41 http://deb.debian.org/debian unstable/main amd64 libpipeline1 amd64 1.5.8-3 [49.2 kB] Get:42 http://deb.debian.org/debian unstable/main amd64 man-db amd64 2.13.1-1 [1469 kB] Get:43 file:/srv/reprepro perl-5.44/main amd64 libdbd-mysql-perl amd64 4.055-1+b1 [113 kB] Get:44 file:/srv/reprepro perl-5.44/main amd64 libpq5 amd64 18.4-1+b2 [259 kB] Get:45 file:/srv/reprepro perl-5.44/main amd64 libdbd-pg-perl amd64 3.20.2-1+b1 [221 kB] Get:46 http://deb.debian.org/debian unstable/main amd64 libtext-wrapi18n-perl all 0.06-11 [7788 B] Get:47 http://deb.debian.org/debian unstable/main amd64 ucf all 3.0056 [47.1 kB] Get:48 http://deb.debian.org/debian unstable/main amd64 m4 amd64 1.4.21-1 [332 kB] Get:49 http://deb.debian.org/debian unstable/main amd64 autoconf all 2.73-2 [516 kB] Get:50 file:/srv/reprepro perl-5.44/main amd64 libdbd-sqlite3-perl amd64 1.78-1+b2 [177 kB] Get:51 file:/srv/reprepro perl-5.44/main amd64 libfcgi-perl amd64 0.82+ds-3+b3 [24.8 kB] Get:52 file:/srv/reprepro perl-5.44/main amd64 libset-object-perl amd64 1.43-1+b1 [37.9 kB] Get:53 file:/srv/reprepro perl-5.44/main amd64 libio-pty-perl amd64 1:1.31-1+b1 [38.4 kB] Get:54 file:/srv/reprepro perl-5.44/main amd64 liblist-moreutils-xs-perl amd64 0.430-4+b3 [41.8 kB] Get:55 file:/srv/reprepro perl-5.44/main amd64 libpadwalker-perl amd64 2.5-1+b7 [18.8 kB] Get:56 file:/srv/reprepro perl-5.44/main amd64 libperlio-eol-perl amd64 0.19-1+b4 [15.3 kB] Get:57 file:/srv/reprepro perl-5.44/main amd64 libunicode-map-perl amd64 0.112-13+b6 [144 kB] Get:58 file:/srv/reprepro perl-5.44/main amd64 libxml-libxml-perl amd64 2.0207+dfsg+really+2.0134-8+b1 [314 kB] Get:59 http://deb.debian.org/debian unstable/main amd64 autotools-dev all 20240727.1+nmu1 [60.0 kB] Get:60 http://deb.debian.org/debian unstable/main amd64 automake all 1:1.18.1-4 [877 kB] Get:61 file:/srv/reprepro perl-5.44/main amd64 libxml-sax-expatxs-perl amd64 1.33-3+b5 [116 kB] Get:62 http://deb.debian.org/debian unstable/main amd64 autopoint all 1.0-3 [820 kB] Get:63 http://deb.debian.org/debian unstable/main amd64 libdebhelper-perl all 14.3 [77.3 kB] Get:64 http://deb.debian.org/debian unstable/main amd64 libtool all 2.5.4-11 [539 kB] Get:65 http://deb.debian.org/debian unstable/main amd64 dh-autoreconf all 22 [12.2 kB] Get:66 http://deb.debian.org/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get:67 http://deb.debian.org/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.15.1-1 [17.1 kB] Get:68 http://deb.debian.org/debian unstable/main amd64 dh-strip-nondeterminism all 1.15.1-1 [6020 B] Get:69 http://deb.debian.org/debian unstable/main amd64 libelf1t64 amd64 0.195-1 [58.1 kB] Get:70 http://deb.debian.org/debian unstable/main amd64 dwz amd64 0.16-4 [108 kB] Get:71 http://deb.debian.org/debian unstable/main amd64 libxml2-16 amd64 2.15.3+dfsg-1 [642 kB] Get:72 http://deb.debian.org/debian unstable/main amd64 gettext amd64 1.0-3 [2658 kB] Get:73 http://deb.debian.org/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get:74 http://deb.debian.org/debian unstable/main amd64 po-debconf all 1.0.22 [216 kB] Get:75 http://deb.debian.org/debian unstable/main amd64 debhelper all 14.3 [934 kB] Get:76 http://deb.debian.org/debian unstable/main amd64 libbrotli1 amd64 1.2.0-3 [320 kB] Get:77 http://deb.debian.org/debian unstable/main amd64 libpng16-16t64 amd64 1.6.58-1 [289 kB] Get:78 http://deb.debian.org/debian unstable/main amd64 libfreetype6 amd64 2.14.3+dfsg-1 [493 kB] Get:79 http://deb.debian.org/debian unstable/main amd64 fonts-dejavu-mono all 2.37-9 [488 kB] Get:80 http://deb.debian.org/debian unstable/main amd64 fonts-dejavu-core all 2.37-9 [840 kB] Get:81 http://deb.debian.org/debian unstable/main amd64 fontconfig-config amd64 2.17.1-5 [56.1 kB] Get:82 http://deb.debian.org/debian unstable/main amd64 libfontconfig1 amd64 2.17.1-5 [132 kB] Get:83 http://deb.debian.org/debian unstable/main amd64 fontconfig amd64 2.17.1-5 [191 kB] Get:84 http://deb.debian.org/debian unstable/main amd64 libltdl7 amd64 2.5.4-11 [416 kB] Get:85 http://deb.debian.org/debian unstable/main amd64 libpixman-1-0 amd64 0.46.4-1+b2 [259 kB] Get:86 http://deb.debian.org/debian unstable/main amd64 libxau6 amd64 1:1.0.11-1+b2 [20.7 kB] Get:87 http://deb.debian.org/debian unstable/main amd64 libxdmcp6 amd64 1:1.1.5-2+b1 [28.2 kB] Get:88 http://deb.debian.org/debian unstable/main amd64 libxcb1 amd64 1.17.0-2+b2 [144 kB] Get:89 http://deb.debian.org/debian unstable/main amd64 libx11-data all 2:1.8.13-1 [346 kB] Get:90 http://deb.debian.org/debian unstable/main amd64 libx11-6 amd64 2:1.8.13-1 [829 kB] Get:91 http://deb.debian.org/debian unstable/main amd64 libxcb-render0 amd64 1.17.0-2+b2 [115 kB] Get:92 http://deb.debian.org/debian unstable/main amd64 libxcb-shm0 amd64 1.17.0-2+b2 [105 kB] Get:93 http://deb.debian.org/debian unstable/main amd64 libxext6 amd64 2:1.3.4-1+b4 [50.7 kB] Get:94 http://deb.debian.org/debian unstable/main amd64 libxrender1 amd64 1:0.9.12-1+b2 [27.7 kB] Get:95 http://deb.debian.org/debian unstable/main amd64 libcairo2 amd64 1.18.4-3+b1 [543 kB] Get:96 http://deb.debian.org/debian unstable/main amd64 libaom3 amd64 3.13.1-2+b1 [1904 kB] Get:97 http://deb.debian.org/debian unstable/main amd64 libdav1d7 amd64 1.5.3-1+b2 [563 kB] Get:98 http://deb.debian.org/debian unstable/main amd64 libabsl20260107 amd64 20260107.0-5 [549 kB] Get:99 http://deb.debian.org/debian unstable/main amd64 libgav1-2 amd64 0.20.0-2+b1 [372 kB] Get:100 http://deb.debian.org/debian unstable/main amd64 librav1e0.8 amd64 0.8.1-10 [973 kB] Get:101 http://deb.debian.org/debian unstable/main amd64 libsvtav1enc4 amd64 4.1.0+dfsg-1 [2414 kB] Get:102 http://deb.debian.org/debian unstable/main amd64 libjpeg62-turbo amd64 1:3.1.3-4 [213 kB] Get:103 http://deb.debian.org/debian unstable/main amd64 libyuv0 amd64 0.0.1949.20260706-1 [177 kB] Get:104 http://deb.debian.org/debian unstable/main amd64 libavif16 amd64 1.4.2-1 [147 kB] Get:105 http://deb.debian.org/debian unstable/main amd64 libsharpyuv0 amd64 1.5.0-0.1+b2 [115 kB] Get:106 http://deb.debian.org/debian unstable/main amd64 libde265-0 amd64 1.1.1-1 [201 kB] Get:107 http://deb.debian.org/debian unstable/main amd64 libheif-plugin-libde265 amd64 1.23.1-1 [17.3 kB] Get:108 http://deb.debian.org/debian unstable/main amd64 libheif-plugin-dav1d amd64 1.23.1-1 [19.8 kB] Get:109 http://deb.debian.org/debian unstable/main amd64 libheif1 amd64 1.23.1-1 [761 kB] Get:110 http://deb.debian.org/debian unstable/main amd64 libimagequant0 amd64 4.4.1-1+b2 [255 kB] Get:111 http://deb.debian.org/debian unstable/main amd64 libdeflate0 amd64 1.25-1 [48.0 kB] Get:112 http://deb.debian.org/debian unstable/main amd64 libjbig0 amd64 2.1-6.1+b3 [32.2 kB] Get:113 http://deb.debian.org/debian unstable/main amd64 liblerc4 amd64 4.1.1+ds-1 [199 kB] Get:114 http://deb.debian.org/debian unstable/main amd64 libwebp7 amd64 1.5.0-0.1+b2 [335 kB] Get:115 http://deb.debian.org/debian unstable/main amd64 libtiff6 amd64 4.7.2-1 [383 kB] Get:116 http://deb.debian.org/debian unstable/main amd64 libxpm4 amd64 1:3.5.19-1 [58.9 kB] Get:117 http://deb.debian.org/debian unstable/main amd64 libgd3 amd64 2.3.3-13+b2 [126 kB] Get:118 http://deb.debian.org/debian unstable/main amd64 libglib2.0-0t64 amd64 2.88.2-1 [1536 kB] Get:119 http://deb.debian.org/debian unstable/main amd64 libfribidi0 amd64 1.0.16-5+b1 [26.2 kB] Get:120 http://deb.debian.org/debian unstable/main amd64 libgraphite2-3 amd64 1.3.15-2 [75.8 kB] Get:121 http://deb.debian.org/debian unstable/main amd64 libharfbuzz0b amd64 12.3.2-2+b2 [513 kB] Get:122 http://deb.debian.org/debian unstable/main amd64 libthai-data all 0.1.30-2 [172 kB] Get:123 http://deb.debian.org/debian unstable/main amd64 libdatrie1 amd64 0.2.14-2 [39.1 kB] Get:124 http://deb.debian.org/debian unstable/main amd64 libthai0 amd64 0.1.30-2 [51.8 kB] Get:125 http://deb.debian.org/debian unstable/main amd64 libpango-1.0-0 amd64 1.58.0-1 [225 kB] Get:126 http://deb.debian.org/debian unstable/main amd64 libpangoft2-1.0-0 amd64 1.58.0-1 [53.1 kB] Get:127 http://deb.debian.org/debian unstable/main amd64 libpangocairo-1.0-0 amd64 1.58.0-1 [34.2 kB] Get:128 http://deb.debian.org/debian unstable/main amd64 libann0 amd64 1.1.2+doc-9+b1 [25.1 kB] Get:129 http://deb.debian.org/debian unstable/main amd64 libgts-0.7-5t64 amd64 0.7.6+darcs121130-5.2+b2 [160 kB] Get:130 http://deb.debian.org/debian unstable/main amd64 shared-mime-info amd64 2.4-5+b3 [758 kB] Get:131 http://deb.debian.org/debian unstable/main amd64 libb2-1 amd64 0.98.1-1.1+b3 [42.0 kB] Get:132 http://deb.debian.org/debian unstable/main amd64 libdouble-conversion3 amd64 3.4.0-1+b1 [40.7 kB] Get:133 http://deb.debian.org/debian unstable/main amd64 libicu78 amd64 78.3-2 [10.0 MB] Get:134 http://deb.debian.org/debian unstable/main amd64 libpcre2-16-0 amd64 10.46-1+b2 [280 kB] Get:135 http://deb.debian.org/debian unstable/main amd64 libqt6core6t64 amd64 6.10.2+dfsg-15 [1916 kB] Get:136 http://deb.debian.org/debian unstable/main amd64 libdrm-common all 2.4.134-3 [7860 B] Get:137 http://deb.debian.org/debian unstable/main amd64 libdrm2 amd64 2.4.134-3 [38.5 kB] Get:138 http://deb.debian.org/debian unstable/main amd64 libglvnd0 amd64 1.7.0-3+b1 [54.3 kB] Get:139 http://deb.debian.org/debian unstable/main amd64 libdrm-amdgpu1 amd64 2.4.134-3 [23.3 kB] Get:140 http://deb.debian.org/debian unstable/main amd64 pci.ids all 0.0~2026.07.06-1 [285 kB] Get:141 http://deb.debian.org/debian unstable/main amd64 libpciaccess0 amd64 0.19-2 [18.5 kB] Get:142 http://deb.debian.org/debian unstable/main amd64 libdrm-intel1 amd64 2.4.134-3 [64.2 kB] Get:143 http://deb.debian.org/debian unstable/main amd64 libbsd0 amd64 0.12.2-3 [132 kB] Get:144 http://deb.debian.org/debian unstable/main amd64 libedit2 amd64 3.1-20260512-1 [93.6 kB] Get:145 http://deb.debian.org/debian unstable/main amd64 libz3-4 amd64 4.13.3-1.1 [8644 kB] Get:146 http://deb.debian.org/debian unstable/main amd64 libllvm21 amd64 1:21.1.8-7+b4 [28.2 MB] Get:147 http://deb.debian.org/debian unstable/main amd64 libsensors-config all 1:3.6.2-2 [16.2 kB] Get:148 http://deb.debian.org/debian unstable/main amd64 libsensors5 amd64 1:3.6.2-2+b2 [37.2 kB] Get:149 http://deb.debian.org/debian unstable/main amd64 libx11-xcb1 amd64 2:1.8.13-1 [250 kB] Get:150 http://deb.debian.org/debian unstable/main amd64 libxcb-dri3-0 amd64 1.17.0-2+b2 [107 kB] Get:151 http://deb.debian.org/debian unstable/main amd64 libxcb-present0 amd64 1.17.0-2+b2 [106 kB] Get:152 http://deb.debian.org/debian unstable/main amd64 libxcb-randr0 amd64 1.17.0-2+b2 [117 kB] Get:153 http://deb.debian.org/debian unstable/main amd64 libxcb-sync1 amd64 1.17.0-2+b2 [109 kB] Get:154 http://deb.debian.org/debian unstable/main amd64 libxcb-xfixes0 amd64 1.17.0-2+b2 [109 kB] Get:155 http://deb.debian.org/debian unstable/main amd64 libxshmfence1 amd64 1.3.3-1+b2 [11.2 kB] Get:156 http://deb.debian.org/debian unstable/main amd64 mesa-libgallium amd64 26.1.4-1 [11.2 MB] Get:157 http://deb.debian.org/debian unstable/main amd64 libgbm1 amd64 26.1.4-1 [54.8 kB] Get:158 http://deb.debian.org/debian unstable/main amd64 libwayland-client0 amd64 1.25.0-2 [29.2 kB] Get:159 http://deb.debian.org/debian unstable/main amd64 libegl-mesa0 amd64 26.1.4-1 [133 kB] Get:160 http://deb.debian.org/debian unstable/main amd64 libegl1 amd64 1.7.0-3+b1 [35.0 kB] Get:161 http://deb.debian.org/debian unstable/main amd64 libvulkan1 amd64 1.4.341.0-1 [141 kB] Get:162 http://deb.debian.org/debian unstable/main amd64 libgl1-mesa-dri amd64 26.1.4-1 [44.5 kB] Get:163 http://deb.debian.org/debian unstable/main amd64 libxcb-glx0 amd64 1.17.0-2+b2 [122 kB] Get:164 http://deb.debian.org/debian unstable/main amd64 libxxf86vm1 amd64 1:1.1.4-2+b1 [20.2 kB] Get:165 http://deb.debian.org/debian unstable/main amd64 libglx-mesa0 amd64 26.1.4-1 [125 kB] Get:166 http://deb.debian.org/debian unstable/main amd64 libglx0 amd64 1.7.0-3+b1 [34.9 kB] Get:167 http://deb.debian.org/debian unstable/main amd64 x11-common all 1:7.7+26 [217 kB] Get:168 http://deb.debian.org/debian unstable/main amd64 libice6 amd64 2:1.1.1-1+b2 [66.8 kB] Get:169 http://deb.debian.org/debian unstable/main amd64 libevdev2 amd64 1.13.6+dfsg-3 [31.9 kB] Get:170 http://deb.debian.org/debian unstable/main amd64 libmtdev1t64 amd64 1.1.7-1+b2 [23.2 kB] Get:171 http://deb.debian.org/debian unstable/main amd64 libgudev-1.0-0 amd64 238-7+b2 [14.4 kB] Get:172 http://deb.debian.org/debian unstable/main amd64 libwacom-common all 2.18.0-1 [117 kB] Get:173 http://deb.debian.org/debian unstable/main amd64 libwacom9 amd64 2.18.0-1 [27.0 kB] Get:174 http://deb.debian.org/debian unstable/main amd64 libinput-bin amd64 1.31.3-1 [28.0 kB] Get:175 http://deb.debian.org/debian unstable/main amd64 libinput10 amd64 1.31.3-1 [160 kB] Get:176 http://deb.debian.org/debian unstable/main amd64 libmd4c0 amd64 0.5.3-1 [49.5 kB] Get:177 http://deb.debian.org/debian unstable/main amd64 libopengl0 amd64 1.7.0-3+b1 [30.4 kB] Get:178 http://deb.debian.org/debian unstable/main amd64 libdbus-1-3 amd64 1.16.2-5+b1 [176 kB] Get:179 http://deb.debian.org/debian unstable/main amd64 libqt6dbus6 amd64 6.10.2+dfsg-15 [272 kB] Get:180 http://deb.debian.org/debian unstable/main amd64 libsm6 amd64 2:1.2.6-1+b2 [37.9 kB] Get:181 http://deb.debian.org/debian unstable/main amd64 libts0t64 amd64 1.22-1.1+b2 [61.9 kB] Get:182 http://deb.debian.org/debian unstable/main amd64 libxcb-util1 amd64 0.4.1-1+b2 [23.8 kB] Get:183 http://deb.debian.org/debian unstable/main amd64 libxcb-image0 amd64 0.4.0-2+b3 [22.3 kB] Get:184 http://deb.debian.org/debian unstable/main amd64 libxcb-render-util0 amd64 0.3.10-1+b2 [18.7 kB] Get:185 http://deb.debian.org/debian unstable/main amd64 libxcb-cursor0 amd64 0.1.6-1 [17.8 kB] Get:186 http://deb.debian.org/debian unstable/main amd64 libxcb-icccm4 amd64 0.4.2-1+b2 [27.7 kB] Get:187 http://deb.debian.org/debian unstable/main amd64 libxcb-keysyms1 amd64 0.4.1-1+b2 [17.0 kB] Get:188 http://deb.debian.org/debian unstable/main amd64 libxcb-shape0 amd64 1.17.0-2+b2 [106 kB] Get:189 http://deb.debian.org/debian unstable/main amd64 libxcb-xinput0 amd64 1.17.0-2+b2 [130 kB] Get:190 http://deb.debian.org/debian unstable/main amd64 libxcb-xkb1 amd64 1.17.0-2+b2 [130 kB] Get:191 http://deb.debian.org/debian unstable/main amd64 xkb-data all 2.47-1 [835 kB] Get:192 http://deb.debian.org/debian unstable/main amd64 libxkbcommon0 amd64 1.13.1-1 [148 kB] Get:193 http://deb.debian.org/debian unstable/main amd64 libxkbcommon-x11-0 amd64 1.13.1-1 [21.0 kB] Get:194 http://deb.debian.org/debian unstable/main amd64 libqt6gui6 amd64 6.10.2+dfsg-15 [3307 kB] Get:195 http://deb.debian.org/debian unstable/main amd64 libqt6widgets6 amd64 6.10.2+dfsg-15 [2654 kB] Get:196 http://deb.debian.org/debian unstable/main amd64 liberror-perl all 0.17030-1 [26.9 kB] Get:197 http://deb.debian.org/debian unstable/main amd64 libcache-cache-perl all 1.08-3 [63.4 kB] Get:198 http://deb.debian.org/debian unstable/main amd64 libalgorithm-diff-perl all 1.201-1 [43.3 kB] Get:199 http://deb.debian.org/debian unstable/main amd64 libalgorithm-munkres-perl all 0.08-5 [11.3 kB] Get:200 http://deb.debian.org/debian unstable/main amd64 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] Get:201 http://deb.debian.org/debian unstable/main amd64 libdynaloader-functions-perl all 0.004-2 [12.2 kB] Get:202 http://deb.debian.org/debian unstable/main amd64 libmodule-runtime-perl all 0.018-1 [17.8 kB] Get:203 http://deb.debian.org/debian unstable/main amd64 libimport-into-perl all 1.002005-2 [11.3 kB] Get:204 http://deb.debian.org/debian unstable/main amd64 librole-tiny-perl all 2.002005-1 [19.5 kB] Get:205 http://deb.debian.org/debian unstable/main amd64 libsub-quote-perl all 2.006009-1 [21.3 kB] Get:206 http://deb.debian.org/debian unstable/main amd64 libmoo-perl all 2.005005-1 [58.0 kB] Get:207 http://deb.debian.org/debian unstable/main amd64 libexporter-tiny-perl all 1.006003-1 [37.5 kB] Get:208 http://deb.debian.org/debian unstable/main amd64 libtype-tiny-perl all 2.010001-1 [391 kB] Get:209 http://deb.debian.org/debian unstable/main amd64 libarray-compare-perl all 3.0.8-1 [14.9 kB] Get:210 http://deb.debian.org/debian unstable/main amd64 libio-string-perl all 1.08-4 [12.1 kB] Get:211 http://deb.debian.org/debian unstable/main amd64 libdata-stag-perl all 0.14-4 [440 kB] Get:212 http://deb.debian.org/debian unstable/main amd64 libbio-perl-perl all 1.7.8-4 [2498 kB] Get:213 http://deb.debian.org/debian unstable/main amd64 libbio-alignio-stockholm-perl all 1.7.3-2 [23.1 kB] Get:214 http://deb.debian.org/debian unstable/main amd64 liburi-perl all 5.35-1 [112 kB] Get:215 http://deb.debian.org/debian unstable/main amd64 libencode-locale-perl all 1.05-3 [12.9 kB] Get:216 http://deb.debian.org/debian unstable/main amd64 libtimedate-perl all 2.3500-1 [64.2 kB] Get:217 http://deb.debian.org/debian unstable/main amd64 libhttp-date-perl all 6.08-1 [12.1 kB] Get:218 http://deb.debian.org/debian unstable/main amd64 libfile-listing-perl all 6.16-1 [12.4 kB] Get:219 http://deb.debian.org/debian unstable/main amd64 libhtml-tagset-perl all 3.24-1 [14.7 kB] Get:220 http://deb.debian.org/debian unstable/main amd64 libhtml-tree-perl all 5.07-3 [211 kB] Get:221 http://deb.debian.org/debian unstable/main amd64 libio-html-perl all 1.004-3 [16.2 kB] Get:222 http://deb.debian.org/debian unstable/main amd64 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] Get:223 http://deb.debian.org/debian unstable/main amd64 libhttp-message-perl all 7.02-1 [79.5 kB] Get:224 http://deb.debian.org/debian unstable/main amd64 libhttp-cookies-perl all 6.11-1 [19.1 kB] Get:225 http://deb.debian.org/debian unstable/main amd64 libhttp-negotiate-perl all 6.01-2 [13.1 kB] Get:226 http://deb.debian.org/debian unstable/main amd64 perl-openssl-defaults amd64 7+b2 [6724 B] Get:227 http://deb.debian.org/debian unstable/main amd64 libio-socket-ssl-perl all 2.099-1 [229 kB] Get:228 http://deb.debian.org/debian unstable/main amd64 libnet-http-perl all 6.24-1 [23.2 kB] Get:229 http://deb.debian.org/debian unstable/main amd64 liblwp-protocol-https-perl all 6.15-1 [10.7 kB] Get:230 http://deb.debian.org/debian unstable/main amd64 libtry-tiny-perl all 0.32-1 [22.9 kB] Get:231 http://deb.debian.org/debian unstable/main amd64 libwww-robotrules-perl all 6.03-1 [15.8 kB] Get:232 http://deb.debian.org/debian unstable/main amd64 libwww-perl all 6.83-1 [186 kB] Get:233 http://deb.debian.org/debian unstable/main amd64 libxml-twig-perl all 1:3.54-1 [177 kB] Get:234 http://deb.debian.org/debian unstable/main amd64 libxml-writer-perl all 0.900-2 [26.8 kB] Get:235 http://deb.debian.org/debian unstable/main amd64 libbio-variation-perl all 1.7.5-3 [72.6 kB] Get:236 http://deb.debian.org/debian unstable/main amd64 libxml-namespacesupport-perl all 1.12-2 [15.1 kB] Get:237 http://deb.debian.org/debian unstable/main amd64 libxml-sax-base-perl all 1.09-3 [20.6 kB] Get:238 http://deb.debian.org/debian unstable/main amd64 libxml-sax-perl all 1.02+dfsg-5 [53.6 kB] Get:239 http://deb.debian.org/debian unstable/main amd64 libbio-cluster-perl all 1.7.3-6 [53.3 kB] Get:240 http://deb.debian.org/debian unstable/main amd64 libbio-asn1-entrezgene-perl all 1.730-3 [46.3 kB] Get:241 http://deb.debian.org/debian unstable/main amd64 libcapture-tiny-perl all 0.50-1 [24.6 kB] Get:242 http://deb.debian.org/debian unstable/main amd64 libcgi-pm-perl all 4.72-1 [217 kB] Get:243 http://deb.debian.org/debian unstable/main amd64 libclass-data-inheritable-perl all 0.10-1 [8632 B] Get:244 http://deb.debian.org/debian unstable/main amd64 libclass-inspector-perl all 1.36-3 [17.5 kB] Get:245 http://deb.debian.org/debian unstable/main amd64 libclass-unload-perl all 0.12-1 [5820 B] Get:246 http://deb.debian.org/debian unstable/main amd64 libcom-err2 amd64 1.47.4-1 [19.2 kB] Get:247 http://deb.debian.org/debian unstable/main amd64 libconvert-binhex-perl all 1.125-3 [27.4 kB] Get:248 http://deb.debian.org/debian unstable/main amd64 libcrypt-rc4-perl all 2.02-5 [7480 B] Get:249 http://deb.debian.org/debian unstable/main amd64 mysql-common all 5.8+1.1.1 [6784 B] Get:250 http://deb.debian.org/debian unstable/main amd64 mariadb-common all 1:11.8.8-1 [23.2 kB] Get:251 http://deb.debian.org/debian unstable/main amd64 libmariadb3 amd64 1:11.8.8-1 [176 kB] Get:252 http://deb.debian.org/debian unstable/main amd64 libkrb5support0 amd64 1.22.1-3 [31.1 kB] Get:253 http://deb.debian.org/debian unstable/main amd64 libk5crypto3 amd64 1.22.1-3 [79.0 kB] Get:254 http://deb.debian.org/debian unstable/main amd64 libkeyutils1 amd64 1.6.3-6+b2 [9348 B] Get:255 http://deb.debian.org/debian unstable/main amd64 libkrb5-3 amd64 1.22.1-3 [335 kB] Get:256 http://deb.debian.org/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.22.1-3 [137 kB] Get:257 http://deb.debian.org/debian unstable/main amd64 libdevel-cycle-perl all 1.12-2 [11.9 kB] Get:258 http://deb.debian.org/debian unstable/main amd64 libdevel-stacktrace-perl all 2.0500-1 [26.4 kB] Get:259 http://deb.debian.org/debian unstable/main amd64 libdigest-perl-md5-perl all 1.91-1 [11.8 kB] Get:260 http://deb.debian.org/debian unstable/main amd64 libexception-class-perl all 1.45-1 [34.6 kB] Get:261 http://deb.debian.org/debian unstable/main amd64 libfcgi0t64 amd64 2.4.5-0.1+b2 [25.7 kB] Get:262 http://deb.debian.org/debian unstable/main amd64 libfile-slurper-perl all 0.014-1 [8560 B] Get:263 http://deb.debian.org/debian unstable/main amd64 libheap-perl all 0.80-5 [34.3 kB] Get:264 http://deb.debian.org/debian unstable/main amd64 libgraph-perl all 1:0.9735-1 [111 kB] Get:265 http://deb.debian.org/debian unstable/main amd64 libipc-run-perl all 20260402.0-1 [112 kB] Get:266 http://deb.debian.org/debian unstable/main amd64 libparse-recdescent-perl all 1.967015+dfsg-4 [147 kB] Get:267 http://deb.debian.org/debian unstable/main amd64 libxml-xpath-perl all 1.49-1 [63.5 kB] Get:268 http://deb.debian.org/debian unstable/main amd64 libgraphviz-perl all 2.26-1 [89.3 kB] Get:269 http://deb.debian.org/debian unstable/main amd64 libhtml-tableextract-perl all 2.15-2 [30.6 kB] Get:270 http://deb.debian.org/debian unstable/main amd64 libhttp-daemon-perl all 6.17-1 [24.6 kB] Get:271 http://deb.debian.org/debian unstable/main amd64 libio-sessiondata-perl all 1.03-3 [6316 B] Get:272 http://deb.debian.org/debian unstable/main amd64 libio-stringy-perl all 2.113-2 [48.3 kB] Get:273 http://deb.debian.org/debian unstable/main amd64 libjcode-pm-perl amd64 2.07-1 [28.5 kB] Get:274 http://deb.debian.org/debian unstable/main amd64 liblist-moreutils-perl all 0.430-2 [46.9 kB] Get:275 http://deb.debian.org/debian unstable/main amd64 libnet-smtp-ssl-perl all 1.04-2 [6548 B] Get:276 http://deb.debian.org/debian unstable/main amd64 libmailtools-perl all 2.22-1 [88.8 kB] Get:277 http://deb.debian.org/debian unstable/main amd64 libmath-derivative-perl all 1.01-3 [8060 B] Get:278 http://deb.debian.org/debian unstable/main amd64 libmath-spline-perl all 0.02-4 [6808 B] Get:279 http://deb.debian.org/debian unstable/main amd64 libmime-tools-perl all 5.517-1 [204 kB] Get:280 http://deb.debian.org/debian unstable/main amd64 libmodule-build-perl all 0.423400-3 [234 kB] Get:281 http://deb.debian.org/debian unstable/main amd64 libole-storage-lite-perl all 0.24-1 [22.1 kB] Get:282 http://deb.debian.org/debian unstable/main amd64 libpath-class-perl all 0.37-4 [42.7 kB] Get:283 http://deb.debian.org/debian unstable/main amd64 libpostscript-perl all 0.06-3.1 [26.0 kB] Get:284 http://deb.debian.org/debian unstable/main amd64 libset-scalar-perl all 1.29-3 [32.1 kB] Get:285 http://deb.debian.org/debian unstable/main amd64 libtask-weaken-perl all 1.06-2 [9364 B] Get:286 http://deb.debian.org/debian unstable/main amd64 libsoap-lite-perl all 1.27-3 [239 kB] Get:287 http://deb.debian.org/debian unstable/main amd64 libsort-naturally-perl all 1.03-4 [13.1 kB] Get:288 http://deb.debian.org/debian unstable/main amd64 libspreadsheet-writeexcel-perl all 2.40-4 [503 kB] Get:289 http://deb.debian.org/debian unstable/main amd64 libspreadsheet-parseexcel-perl all 0.6600-1 [126 kB] Get:290 http://deb.debian.org/debian unstable/main amd64 libstatistics-descriptive-perl all 3.0801-1 [62.8 kB] Get:291 http://deb.debian.org/debian unstable/main amd64 libsub-uplevel-perl all 0.2800-3 [14.0 kB] Get:292 http://deb.debian.org/debian unstable/main amd64 libsvg-perl all 2.89-1 [61.7 kB] Get:293 http://deb.debian.org/debian unstable/main amd64 libtree-dagnode-perl all 1.37-1 [62.4 kB] Get:294 http://deb.debian.org/debian unstable/main amd64 libsvg-graph-perl all 0.02-4 [105 kB] Get:295 http://deb.debian.org/debian unstable/main amd64 libtest-deep-perl all 1.205-1 [52.3 kB] Get:296 http://deb.debian.org/debian unstable/main amd64 libtext-diff-perl all 1.45-2 [27.2 kB] Get:297 http://deb.debian.org/debian unstable/main amd64 libtest-differences-perl all 0.72-1 [17.7 kB] Get:298 http://deb.debian.org/debian unstable/main amd64 libtest-exception-perl all 0.43-3 [16.9 kB] Get:299 http://deb.debian.org/debian unstable/main amd64 libtest-memory-cycle-perl all 1.06-2 [11.4 kB] Get:300 http://deb.debian.org/debian unstable/main amd64 libtest-warn-perl all 0.37-2 [14.5 kB] Get:301 http://deb.debian.org/debian unstable/main amd64 libtest-most-perl all 0.42-1 [23.9 kB] Get:302 http://deb.debian.org/debian unstable/main amd64 libtest-pod-perl all 1.52-3 [12.6 kB] Get:303 http://deb.debian.org/debian unstable/main amd64 libtest-requiresinternet-perl all 0.05-4 [6864 B] Get:304 http://deb.debian.org/debian unstable/main amd64 libtest-weaken-perl all 3.022000-2 [35.3 kB] Get:305 http://deb.debian.org/debian unstable/main amd64 libxml-perl all 0.08-4 [93.0 kB] Get:306 http://deb.debian.org/debian unstable/main amd64 libxml-regexp-perl all 0.04-2 [6916 B] Get:307 http://deb.debian.org/debian unstable/main amd64 libxml-dom-perl all 1.46-2 [152 kB] Get:308 http://deb.debian.org/debian unstable/main amd64 libxml-xpathengine-perl all 0.14-2 [33.5 kB] Get:309 http://deb.debian.org/debian unstable/main amd64 libxml-dom-xpath-perl all 0.14-4 [9352 B] Get:310 http://deb.debian.org/debian unstable/main amd64 libxml-filter-buffertext-perl all 1.01-7 [7136 B] Get:311 http://deb.debian.org/debian unstable/main amd64 libxml-sax-writer-perl all 0.57-3 [19.6 kB] Get:312 http://deb.debian.org/debian unstable/main amd64 libxml-simple-perl all 2.25-2 [69.8 kB] Get:313 http://deb.debian.org/debian unstable/main amd64 libyaml-perl all 1.31-1 [64.8 kB] Get:314 http://deb.debian.org/debian unstable/main amd64 rename all 2.02-2 [19.9 kB] Preconfiguring packages ... Fetched 115 MB in 1s (137 MB/s) Selecting previously unselected package libexpat1:amd64. (Reading database ... 15696 files and directories currently installed.) Preparing to unpack .../000-libexpat1_2.8.2-1_amd64.deb ... Unpacking libexpat1:amd64 (2.8.2-1) ... Selecting previously unselected package netbase. Preparing to unpack .../001-netbase_6.5_all.deb ... Unpacking netbase (6.5) ... Selecting previously unselected package libproc2-1:amd64. Preparing to unpack .../002-libproc2-1_2%3a4.0.6-2_amd64.deb ... Unpacking libproc2-1:amd64 (2:4.0.6-2) ... Selecting previously unselected package procps. Preparing to unpack .../003-procps_2%3a4.0.6-2_amd64.deb ... Unpacking procps (2:4.0.6-2) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../004-sensible-utils_0.0.26_all.deb ... Unpacking sensible-utils (0.0.26) ... Selecting previously unselected package openssl. Preparing to unpack .../005-openssl_3.6.3-1_amd64.deb ... Unpacking openssl (3.6.3-1) ... Selecting previously unselected package ca-certificates. Preparing to unpack .../006-ca-certificates_20260601_all.deb ... Unpacking ca-certificates (20260601) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../007-libmagic-mgc_1%3a5.47-4_amd64.deb ... Unpacking libmagic-mgc (1:5.47-4) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../008-libmagic1t64_1%3a5.47-4_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.47-4) ... Selecting previously unselected package file. Preparing to unpack .../009-file_1%3a5.47-4_amd64.deb ... Unpacking file (1:5.47-4) ... Selecting previously unselected package gettext-base. Preparing to unpack .../010-gettext-base_1.0-3_amd64.deb ... Unpacking gettext-base (1.0-3) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../011-libuchardet0_0.0.8-2+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-2+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../012-groff-base_1.24.1-1_amd64.deb ... Unpacking groff-base (1.24.1-1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../013-bsdextrautils_2.42.2-1_amd64.deb ... Unpacking bsdextrautils (2.42.2-1) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../014-libpipeline1_1.5.8-3_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-3) ... Selecting previously unselected package man-db. Preparing to unpack .../015-man-db_2.13.1-1_amd64.deb ... Unpacking man-db (2.13.1-1) ... Selecting previously unselected package libtext-charwidth-perl:amd64. Preparing to unpack .../016-libtext-charwidth-perl_0.04-12+b1_amd64.deb ... Unpacking libtext-charwidth-perl:amd64 (0.04-12+b1) ... Selecting previously unselected package libtext-wrapi18n-perl. Preparing to unpack .../017-libtext-wrapi18n-perl_0.06-11_all.deb ... Unpacking libtext-wrapi18n-perl (0.06-11) ... Selecting previously unselected package ucf. Preparing to unpack .../018-ucf_3.0056_all.deb ... Moving old data out of the way Unpacking ucf (3.0056) ... Selecting previously unselected package m4. Preparing to unpack .../019-m4_1.4.21-1_amd64.deb ... Unpacking m4 (1.4.21-1) ... Selecting previously unselected package autoconf. Preparing to unpack .../020-autoconf_2.73-2_all.deb ... Unpacking autoconf (2.73-2) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../021-autotools-dev_20240727.1+nmu1_all.deb ... Unpacking autotools-dev (20240727.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../022-automake_1%3a1.18.1-4_all.deb ... Unpacking automake (1:1.18.1-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../023-autopoint_1.0-3_all.deb ... Unpacking autopoint (1.0-3) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../024-libdebhelper-perl_14.3_all.deb ... Unpacking libdebhelper-perl (14.3) ... Selecting previously unselected package libtool. Preparing to unpack .../025-libtool_2.5.4-11_all.deb ... Unpacking libtool (2.5.4-11) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../026-dh-autoreconf_22_all.deb ... Unpacking dh-autoreconf (22) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../027-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../028-libfile-stripnondeterminism-perl_1.15.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.15.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../029-dh-strip-nondeterminism_1.15.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.15.1-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../030-libelf1t64_0.195-1_amd64.deb ... Unpacking libelf1t64:amd64 (0.195-1) ... Selecting previously unselected package dwz. Preparing to unpack .../031-dwz_0.16-4_amd64.deb ... Unpacking dwz (0.16-4) ... Selecting previously unselected package libxml2-16:amd64. Preparing to unpack .../032-libxml2-16_2.15.3+dfsg-1_amd64.deb ... Unpacking libxml2-16:amd64 (2.15.3+dfsg-1) ... Selecting previously unselected package gettext. Preparing to unpack .../033-gettext_1.0-3_amd64.deb ... Unpacking gettext (1.0-3) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../034-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../035-po-debconf_1.0.22_all.deb ... Unpacking po-debconf (1.0.22) ... Selecting previously unselected package debhelper. Preparing to unpack .../036-debhelper_14.3_all.deb ... Unpacking debhelper (14.3) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../037-libbrotli1_1.2.0-3_amd64.deb ... Unpacking libbrotli1:amd64 (1.2.0-3) ... Selecting previously unselected package libpng16-16t64:amd64. Preparing to unpack .../038-libpng16-16t64_1.6.58-1_amd64.deb ... Unpacking libpng16-16t64:amd64 (1.6.58-1) ... Selecting previously unselected package libfreetype6:amd64. Preparing to unpack .../039-libfreetype6_2.14.3+dfsg-1_amd64.deb ... Unpacking libfreetype6:amd64 (2.14.3+dfsg-1) ... Selecting previously unselected package fonts-dejavu-mono. Preparing to unpack .../040-fonts-dejavu-mono_2.37-9_all.deb ... Unpacking fonts-dejavu-mono (2.37-9) ... Selecting previously unselected package fonts-dejavu-core. Preparing to unpack .../041-fonts-dejavu-core_2.37-9_all.deb ... Unpacking fonts-dejavu-core (2.37-9) ... Selecting previously unselected package fontconfig-config. Preparing to unpack .../042-fontconfig-config_2.17.1-5_amd64.deb ... Unpacking fontconfig-config (2.17.1-5) ... Selecting previously unselected package libfontconfig1:amd64. Preparing to unpack .../043-libfontconfig1_2.17.1-5_amd64.deb ... Unpacking libfontconfig1:amd64 (2.17.1-5) ... Selecting previously unselected package fontconfig. Preparing to unpack .../044-fontconfig_2.17.1-5_amd64.deb ... Unpacking fontconfig (2.17.1-5) ... Selecting previously unselected package libcdt6:amd64. Preparing to unpack .../045-libcdt6_14.1.2-1+b3_amd64.deb ... Unpacking libcdt6:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libcgraph8:amd64. Preparing to unpack .../046-libcgraph8_14.1.2-1+b3_amd64.deb ... Unpacking libcgraph8:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libltdl7:amd64. Preparing to unpack .../047-libltdl7_2.5.4-11_amd64.deb ... Unpacking libltdl7:amd64 (2.5.4-11) ... Selecting previously unselected package libpathplan4:amd64. Preparing to unpack .../048-libpathplan4_14.1.2-1+b3_amd64.deb ... Unpacking libpathplan4:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libxdot4:amd64. Preparing to unpack .../049-libxdot4_14.1.2-1+b3_amd64.deb ... Unpacking libxdot4:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libgvc7:amd64. Preparing to unpack .../050-libgvc7_14.1.2-1+b3_amd64.deb ... Unpacking libgvc7:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libgvpr2:amd64. Preparing to unpack .../051-libgvpr2_14.1.2-1+b3_amd64.deb ... Unpacking libgvpr2:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libpixman-1-0:amd64. Preparing to unpack .../052-libpixman-1-0_0.46.4-1+b2_amd64.deb ... Unpacking libpixman-1-0:amd64 (0.46.4-1+b2) ... Selecting previously unselected package libxau6:amd64. Preparing to unpack .../053-libxau6_1%3a1.0.11-1+b2_amd64.deb ... Unpacking libxau6:amd64 (1:1.0.11-1+b2) ... Selecting previously unselected package libxdmcp6:amd64. Preparing to unpack .../054-libxdmcp6_1%3a1.1.5-2+b1_amd64.deb ... Unpacking libxdmcp6:amd64 (1:1.1.5-2+b1) ... Selecting previously unselected package libxcb1:amd64. Preparing to unpack .../055-libxcb1_1.17.0-2+b2_amd64.deb ... Unpacking libxcb1:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libx11-data. Preparing to unpack .../056-libx11-data_2%3a1.8.13-1_all.deb ... Unpacking libx11-data (2:1.8.13-1) ... Selecting previously unselected package libx11-6:amd64. Preparing to unpack .../057-libx11-6_2%3a1.8.13-1_amd64.deb ... Unpacking libx11-6:amd64 (2:1.8.13-1) ... Selecting previously unselected package libxcb-render0:amd64. Preparing to unpack .../058-libxcb-render0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-render0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-shm0:amd64. Preparing to unpack .../059-libxcb-shm0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-shm0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxext6:amd64. Preparing to unpack .../060-libxext6_2%3a1.3.4-1+b4_amd64.deb ... Unpacking libxext6:amd64 (2:1.3.4-1+b4) ... Selecting previously unselected package libxrender1:amd64. Preparing to unpack .../061-libxrender1_1%3a0.9.12-1+b2_amd64.deb ... Unpacking libxrender1:amd64 (1:0.9.12-1+b2) ... Selecting previously unselected package libcairo2:amd64. Preparing to unpack .../062-libcairo2_1.18.4-3+b1_amd64.deb ... Unpacking libcairo2:amd64 (1.18.4-3+b1) ... Selecting previously unselected package libaom3:amd64. Preparing to unpack .../063-libaom3_3.13.1-2+b1_amd64.deb ... Unpacking libaom3:amd64 (3.13.1-2+b1) ... Selecting previously unselected package libdav1d7:amd64. Preparing to unpack .../064-libdav1d7_1.5.3-1+b2_amd64.deb ... Unpacking libdav1d7:amd64 (1.5.3-1+b2) ... Selecting previously unselected package libabsl20260107:amd64. Preparing to unpack .../065-libabsl20260107_20260107.0-5_amd64.deb ... Unpacking libabsl20260107:amd64 (20260107.0-5) ... Selecting previously unselected package libgav1-2:amd64. Preparing to unpack .../066-libgav1-2_0.20.0-2+b1_amd64.deb ... Unpacking libgav1-2:amd64 (0.20.0-2+b1) ... Selecting previously unselected package librav1e0.8:amd64. Preparing to unpack .../067-librav1e0.8_0.8.1-10_amd64.deb ... Unpacking librav1e0.8:amd64 (0.8.1-10) ... Selecting previously unselected package libsvtav1enc4:amd64. Preparing to unpack .../068-libsvtav1enc4_4.1.0+dfsg-1_amd64.deb ... Unpacking libsvtav1enc4:amd64 (4.1.0+dfsg-1) ... Selecting previously unselected package libjpeg62-turbo:amd64. Preparing to unpack .../069-libjpeg62-turbo_1%3a3.1.3-4_amd64.deb ... Unpacking libjpeg62-turbo:amd64 (1:3.1.3-4) ... Selecting previously unselected package libyuv0:amd64. Preparing to unpack .../070-libyuv0_0.0.1949.20260706-1_amd64.deb ... Unpacking libyuv0:amd64 (0.0.1949.20260706-1) ... Selecting previously unselected package libavif16:amd64. Preparing to unpack .../071-libavif16_1.4.2-1_amd64.deb ... Unpacking libavif16:amd64 (1.4.2-1) ... Selecting previously unselected package libsharpyuv0:amd64. Preparing to unpack .../072-libsharpyuv0_1.5.0-0.1+b2_amd64.deb ... Unpacking libsharpyuv0:amd64 (1.5.0-0.1+b2) ... Selecting previously unselected package libde265-0:amd64. Preparing to unpack .../073-libde265-0_1.1.1-1_amd64.deb ... Unpacking libde265-0:amd64 (1.1.1-1) ... Selecting previously unselected package libheif-plugin-libde265:amd64. Preparing to unpack .../074-libheif-plugin-libde265_1.23.1-1_amd64.deb ... Unpacking libheif-plugin-libde265:amd64 (1.23.1-1) ... Selecting previously unselected package libheif-plugin-dav1d:amd64. Preparing to unpack .../075-libheif-plugin-dav1d_1.23.1-1_amd64.deb ... Unpacking libheif-plugin-dav1d:amd64 (1.23.1-1) ... Selecting previously unselected package libheif1:amd64. Preparing to unpack .../076-libheif1_1.23.1-1_amd64.deb ... Unpacking libheif1:amd64 (1.23.1-1) ... Selecting previously unselected package libimagequant0:amd64. Preparing to unpack .../077-libimagequant0_4.4.1-1+b2_amd64.deb ... Unpacking libimagequant0:amd64 (4.4.1-1+b2) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../078-libdeflate0_1.25-1_amd64.deb ... Unpacking libdeflate0:amd64 (1.25-1) ... Selecting previously unselected package libjbig0:amd64. Preparing to unpack .../079-libjbig0_2.1-6.1+b3_amd64.deb ... Unpacking libjbig0:amd64 (2.1-6.1+b3) ... Selecting previously unselected package liblerc4:amd64. Preparing to unpack .../080-liblerc4_4.1.1+ds-1_amd64.deb ... Unpacking liblerc4:amd64 (4.1.1+ds-1) ... Selecting previously unselected package libwebp7:amd64. Preparing to unpack .../081-libwebp7_1.5.0-0.1+b2_amd64.deb ... Unpacking libwebp7:amd64 (1.5.0-0.1+b2) ... Selecting previously unselected package libtiff6:amd64. Preparing to unpack .../082-libtiff6_4.7.2-1_amd64.deb ... Unpacking libtiff6:amd64 (4.7.2-1) ... Selecting previously unselected package libxpm4:amd64. Preparing to unpack .../083-libxpm4_1%3a3.5.19-1_amd64.deb ... Unpacking libxpm4:amd64 (1:3.5.19-1) ... Selecting previously unselected package libgd3:amd64. Preparing to unpack .../084-libgd3_2.3.3-13+b2_amd64.deb ... Unpacking libgd3:amd64 (2.3.3-13+b2) ... Selecting previously unselected package libgvplugin-gd8:amd64. Preparing to unpack .../085-libgvplugin-gd8_14.1.2-1+b3_amd64.deb ... Unpacking libgvplugin-gd8:amd64 (14.1.2-1+b3) ... Selecting previously unselected package libglib2.0-0t64:amd64. Preparing to unpack .../086-libglib2.0-0t64_2.88.2-1_amd64.deb ... Unpacking libglib2.0-0t64:amd64 (2.88.2-1) ... Selecting previously unselected package libfribidi0:amd64. Preparing to unpack .../087-libfribidi0_1.0.16-5+b1_amd64.deb ... Unpacking libfribidi0:amd64 (1.0.16-5+b1) ... Selecting previously unselected package libgraphite2-3:amd64. Preparing to unpack .../088-libgraphite2-3_1.3.15-2_amd64.deb ... Unpacking libgraphite2-3:amd64 (1.3.15-2) ... Selecting previously unselected package libharfbuzz0b:amd64. Preparing to unpack .../089-libharfbuzz0b_12.3.2-2+b2_amd64.deb ... Unpacking libharfbuzz0b:amd64 (12.3.2-2+b2) ... Selecting previously unselected package libthai-data. Preparing to unpack .../090-libthai-data_0.1.30-2_all.deb ... Unpacking libthai-data (0.1.30-2) ... Selecting previously unselected package libdatrie1:amd64. Preparing to unpack .../091-libdatrie1_0.2.14-2_amd64.deb ... Unpacking libdatrie1:amd64 (0.2.14-2) ... Selecting previously unselected package libthai0:amd64. Preparing to unpack .../092-libthai0_0.1.30-2_amd64.deb ... Unpacking libthai0:amd64 (0.1.30-2) ... Selecting previously unselected package libpango-1.0-0:amd64. Preparing to unpack .../093-libpango-1.0-0_1.58.0-1_amd64.deb ... Unpacking libpango-1.0-0:amd64 (1.58.0-1) ... Selecting previously unselected package libpangoft2-1.0-0:amd64. Preparing to unpack .../094-libpangoft2-1.0-0_1.58.0-1_amd64.deb ... Unpacking libpangoft2-1.0-0:amd64 (1.58.0-1) ... Selecting previously unselected package libpangocairo-1.0-0:amd64. Preparing to unpack .../095-libpangocairo-1.0-0_1.58.0-1_amd64.deb ... Unpacking libpangocairo-1.0-0:amd64 (1.58.0-1) ... Selecting previously unselected package libgvplugin-pango8:amd64. Preparing to unpack .../096-libgvplugin-pango8_14.1.2-1+b3_amd64.deb ... Unpacking libgvplugin-pango8:amd64 (14.1.2-1+b3) ... Selecting previously unselected package graphviz. Preparing to unpack .../097-graphviz_14.1.2-1+b3_amd64.deb ... Unpacking graphviz (14.1.2-1+b3) ... Selecting previously unselected package libann0. Preparing to unpack .../098-libann0_1.1.2+doc-9+b1_amd64.deb ... Unpacking libann0 (1.1.2+doc-9+b1) ... Selecting previously unselected package libgts-0.7-5t64:amd64. Preparing to unpack .../099-libgts-0.7-5t64_0.7.6+darcs121130-5.2+b2_amd64.deb ... Unpacking libgts-0.7-5t64:amd64 (0.7.6+darcs121130-5.2+b2) ... Selecting previously unselected package libgvplugin-neato-layout8:amd64. Preparing to unpack .../100-libgvplugin-neato-layout8_14.1.2-1+b3_amd64.deb ... Unpacking libgvplugin-neato-layout8:amd64 (14.1.2-1+b3) ... Selecting previously unselected package shared-mime-info. Preparing to unpack .../101-shared-mime-info_2.4-5+b3_amd64.deb ... Unpacking shared-mime-info (2.4-5+b3) ... Selecting previously unselected package libb2-1:amd64. Preparing to unpack .../102-libb2-1_0.98.1-1.1+b3_amd64.deb ... Unpacking libb2-1:amd64 (0.98.1-1.1+b3) ... Selecting previously unselected package libdouble-conversion3:amd64. Preparing to unpack .../103-libdouble-conversion3_3.4.0-1+b1_amd64.deb ... Unpacking libdouble-conversion3:amd64 (3.4.0-1+b1) ... Selecting previously unselected package libicu78:amd64. Preparing to unpack .../104-libicu78_78.3-2_amd64.deb ... Unpacking libicu78:amd64 (78.3-2) ... Selecting previously unselected package libpcre2-16-0:amd64. Preparing to unpack .../105-libpcre2-16-0_10.46-1+b2_amd64.deb ... Unpacking libpcre2-16-0:amd64 (10.46-1+b2) ... Selecting previously unselected package libqt6core6t64:amd64. Preparing to unpack .../106-libqt6core6t64_6.10.2+dfsg-15_amd64.deb ... Unpacking libqt6core6t64:amd64 (6.10.2+dfsg-15) ... Selecting previously unselected package libdrm-common. Preparing to unpack .../107-libdrm-common_2.4.134-3_all.deb ... Unpacking libdrm-common (2.4.134-3) ... Selecting previously unselected package libdrm2:amd64. Preparing to unpack .../108-libdrm2_2.4.134-3_amd64.deb ... Unpacking libdrm2:amd64 (2.4.134-3) ... Selecting previously unselected package libglvnd0:amd64. Preparing to unpack .../109-libglvnd0_1.7.0-3+b1_amd64.deb ... Unpacking libglvnd0:amd64 (1.7.0-3+b1) ... Selecting previously unselected package libdrm-amdgpu1:amd64. Preparing to unpack .../110-libdrm-amdgpu1_2.4.134-3_amd64.deb ... Unpacking libdrm-amdgpu1:amd64 (2.4.134-3) ... Selecting previously unselected package pci.ids. Preparing to unpack .../111-pci.ids_0.0~2026.07.06-1_all.deb ... Unpacking pci.ids (0.0~2026.07.06-1) ... Selecting previously unselected package libpciaccess0:amd64. Preparing to unpack .../112-libpciaccess0_0.19-2_amd64.deb ... Unpacking libpciaccess0:amd64 (0.19-2) ... Selecting previously unselected package libdrm-intel1:amd64. Preparing to unpack .../113-libdrm-intel1_2.4.134-3_amd64.deb ... Unpacking libdrm-intel1:amd64 (2.4.134-3) ... Selecting previously unselected package libbsd0:amd64. Preparing to unpack .../114-libbsd0_0.12.2-3_amd64.deb ... Unpacking libbsd0:amd64 (0.12.2-3) ... Selecting previously unselected package libedit2:amd64. Preparing to unpack .../115-libedit2_3.1-20260512-1_amd64.deb ... Unpacking libedit2:amd64 (3.1-20260512-1) ... Selecting previously unselected package libz3-4:amd64. Preparing to unpack .../116-libz3-4_4.13.3-1.1_amd64.deb ... Unpacking libz3-4:amd64 (4.13.3-1.1) ... Selecting previously unselected package libllvm21:amd64. Preparing to unpack .../117-libllvm21_1%3a21.1.8-7+b4_amd64.deb ... Unpacking libllvm21:amd64 (1:21.1.8-7+b4) ... Selecting previously unselected package libsensors-config. Preparing to unpack .../118-libsensors-config_1%3a3.6.2-2_all.deb ... Unpacking libsensors-config (1:3.6.2-2) ... Selecting previously unselected package libsensors5:amd64. Preparing to unpack .../119-libsensors5_1%3a3.6.2-2+b2_amd64.deb ... Unpacking libsensors5:amd64 (1:3.6.2-2+b2) ... Selecting previously unselected package libx11-xcb1:amd64. Preparing to unpack .../120-libx11-xcb1_2%3a1.8.13-1_amd64.deb ... Unpacking libx11-xcb1:amd64 (2:1.8.13-1) ... Selecting previously unselected package libxcb-dri3-0:amd64. Preparing to unpack .../121-libxcb-dri3-0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-dri3-0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-present0:amd64. Preparing to unpack .../122-libxcb-present0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-present0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-randr0:amd64. Preparing to unpack .../123-libxcb-randr0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-randr0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-sync1:amd64. Preparing to unpack .../124-libxcb-sync1_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-sync1:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-xfixes0:amd64. Preparing to unpack .../125-libxcb-xfixes0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-xfixes0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxshmfence1:amd64. Preparing to unpack .../126-libxshmfence1_1.3.3-1+b2_amd64.deb ... Unpacking libxshmfence1:amd64 (1.3.3-1+b2) ... Selecting previously unselected package mesa-libgallium:amd64. Preparing to unpack .../127-mesa-libgallium_26.1.4-1_amd64.deb ... Unpacking mesa-libgallium:amd64 (26.1.4-1) ... Selecting previously unselected package libgbm1:amd64. Preparing to unpack .../128-libgbm1_26.1.4-1_amd64.deb ... Unpacking libgbm1:amd64 (26.1.4-1) ... Selecting previously unselected package libwayland-client0:amd64. Preparing to unpack .../129-libwayland-client0_1.25.0-2_amd64.deb ... Unpacking libwayland-client0:amd64 (1.25.0-2) ... Selecting previously unselected package libegl-mesa0:amd64. Preparing to unpack .../130-libegl-mesa0_26.1.4-1_amd64.deb ... Unpacking libegl-mesa0:amd64 (26.1.4-1) ... Selecting previously unselected package libegl1:amd64. Preparing to unpack .../131-libegl1_1.7.0-3+b1_amd64.deb ... Unpacking libegl1:amd64 (1.7.0-3+b1) ... Selecting previously unselected package libvulkan1:amd64. Preparing to unpack .../132-libvulkan1_1.4.341.0-1_amd64.deb ... Unpacking libvulkan1:amd64 (1.4.341.0-1) ... Selecting previously unselected package libgl1-mesa-dri:amd64. Preparing to unpack .../133-libgl1-mesa-dri_26.1.4-1_amd64.deb ... Unpacking libgl1-mesa-dri:amd64 (26.1.4-1) ... Selecting previously unselected package libxcb-glx0:amd64. Preparing to unpack .../134-libxcb-glx0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-glx0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxxf86vm1:amd64. Preparing to unpack .../135-libxxf86vm1_1%3a1.1.4-2+b1_amd64.deb ... Unpacking libxxf86vm1:amd64 (1:1.1.4-2+b1) ... Selecting previously unselected package libglx-mesa0:amd64. Preparing to unpack .../136-libglx-mesa0_26.1.4-1_amd64.deb ... Unpacking libglx-mesa0:amd64 (26.1.4-1) ... Selecting previously unselected package libglx0:amd64. Preparing to unpack .../137-libglx0_1.7.0-3+b1_amd64.deb ... Unpacking libglx0:amd64 (1.7.0-3+b1) ... Selecting previously unselected package x11-common. Preparing to unpack .../138-x11-common_1%3a7.7+26_all.deb ... Unpacking x11-common (1:7.7+26) ... Selecting previously unselected package libice6:amd64. Preparing to unpack .../139-libice6_2%3a1.1.1-1+b2_amd64.deb ... Unpacking libice6:amd64 (2:1.1.1-1+b2) ... Selecting previously unselected package libevdev2:amd64. Preparing to unpack .../140-libevdev2_1.13.6+dfsg-3_amd64.deb ... Unpacking libevdev2:amd64 (1.13.6+dfsg-3) ... Selecting previously unselected package libmtdev1t64:amd64. Preparing to unpack .../141-libmtdev1t64_1.1.7-1+b2_amd64.deb ... Unpacking libmtdev1t64:amd64 (1.1.7-1+b2) ... Selecting previously unselected package libgudev-1.0-0:amd64. Preparing to unpack .../142-libgudev-1.0-0_238-7+b2_amd64.deb ... Unpacking libgudev-1.0-0:amd64 (238-7+b2) ... Selecting previously unselected package libwacom-common. Preparing to unpack .../143-libwacom-common_2.18.0-1_all.deb ... Unpacking libwacom-common (2.18.0-1) ... Selecting previously unselected package libwacom9:amd64. Preparing to unpack .../144-libwacom9_2.18.0-1_amd64.deb ... Unpacking libwacom9:amd64 (2.18.0-1) ... Selecting previously unselected package libinput-bin. Preparing to unpack .../145-libinput-bin_1.31.3-1_amd64.deb ... Unpacking libinput-bin (1.31.3-1) ... Selecting previously unselected package libinput10:amd64. Preparing to unpack .../146-libinput10_1.31.3-1_amd64.deb ... Unpacking libinput10:amd64 (1.31.3-1) ... Selecting previously unselected package libmd4c0:amd64. Preparing to unpack .../147-libmd4c0_0.5.3-1_amd64.deb ... Unpacking libmd4c0:amd64 (0.5.3-1) ... Selecting previously unselected package libopengl0:amd64. Preparing to unpack .../148-libopengl0_1.7.0-3+b1_amd64.deb ... Unpacking libopengl0:amd64 (1.7.0-3+b1) ... Selecting previously unselected package libdbus-1-3:amd64. Preparing to unpack .../149-libdbus-1-3_1.16.2-5+b1_amd64.deb ... Unpacking libdbus-1-3:amd64 (1.16.2-5+b1) ... Selecting previously unselected package libqt6dbus6:amd64. Preparing to unpack .../150-libqt6dbus6_6.10.2+dfsg-15_amd64.deb ... Unpacking libqt6dbus6:amd64 (6.10.2+dfsg-15) ... Selecting previously unselected package libsm6:amd64. Preparing to unpack .../151-libsm6_2%3a1.2.6-1+b2_amd64.deb ... Unpacking libsm6:amd64 (2:1.2.6-1+b2) ... Selecting previously unselected package libts0t64:amd64. Preparing to unpack .../152-libts0t64_1.22-1.1+b2_amd64.deb ... Unpacking libts0t64:amd64 (1.22-1.1+b2) ... Selecting previously unselected package libxcb-util1:amd64. Preparing to unpack .../153-libxcb-util1_0.4.1-1+b2_amd64.deb ... Unpacking libxcb-util1:amd64 (0.4.1-1+b2) ... Selecting previously unselected package libxcb-image0:amd64. Preparing to unpack .../154-libxcb-image0_0.4.0-2+b3_amd64.deb ... Unpacking libxcb-image0:amd64 (0.4.0-2+b3) ... Selecting previously unselected package libxcb-render-util0:amd64. Preparing to unpack .../155-libxcb-render-util0_0.3.10-1+b2_amd64.deb ... Unpacking libxcb-render-util0:amd64 (0.3.10-1+b2) ... Selecting previously unselected package libxcb-cursor0:amd64. Preparing to unpack .../156-libxcb-cursor0_0.1.6-1_amd64.deb ... Unpacking libxcb-cursor0:amd64 (0.1.6-1) ... Selecting previously unselected package libxcb-icccm4:amd64. Preparing to unpack .../157-libxcb-icccm4_0.4.2-1+b2_amd64.deb ... Unpacking libxcb-icccm4:amd64 (0.4.2-1+b2) ... Selecting previously unselected package libxcb-keysyms1:amd64. Preparing to unpack .../158-libxcb-keysyms1_0.4.1-1+b2_amd64.deb ... Unpacking libxcb-keysyms1:amd64 (0.4.1-1+b2) ... Selecting previously unselected package libxcb-shape0:amd64. Preparing to unpack .../159-libxcb-shape0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-shape0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-xinput0:amd64. Preparing to unpack .../160-libxcb-xinput0_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-xinput0:amd64 (1.17.0-2+b2) ... Selecting previously unselected package libxcb-xkb1:amd64. Preparing to unpack .../161-libxcb-xkb1_1.17.0-2+b2_amd64.deb ... Unpacking libxcb-xkb1:amd64 (1.17.0-2+b2) ... Selecting previously unselected package xkb-data. Preparing to unpack .../162-xkb-data_2.47-1_all.deb ... Unpacking xkb-data (2.47-1) ... Selecting previously unselected package libxkbcommon0:amd64. Preparing to unpack .../163-libxkbcommon0_1.13.1-1_amd64.deb ... Unpacking libxkbcommon0:amd64 (1.13.1-1) ... Selecting previously unselected package libxkbcommon-x11-0:amd64. Preparing to unpack .../164-libxkbcommon-x11-0_1.13.1-1_amd64.deb ... Unpacking libxkbcommon-x11-0:amd64 (1.13.1-1) ... Selecting previously unselected package libqt6gui6:amd64. Preparing to unpack .../165-libqt6gui6_6.10.2+dfsg-15_amd64.deb ... Unpacking libqt6gui6:amd64 (6.10.2+dfsg-15) ... Selecting previously unselected package libqt6widgets6:amd64. Preparing to unpack .../166-libqt6widgets6_6.10.2+dfsg-15_amd64.deb ... Unpacking libqt6widgets6:amd64 (6.10.2+dfsg-15) ... Selecting previously unselected package graphviz-tools. Preparing to unpack .../167-graphviz-tools_14.1.2-1+b3_amd64.deb ... Unpacking graphviz-tools (14.1.2-1+b3) ... Selecting previously unselected package liberror-perl. Preparing to unpack .../168-liberror-perl_0.17030-1_all.deb ... Unpacking liberror-perl (0.17030-1) ... Selecting previously unselected package libipc-sharelite-perl. Preparing to unpack .../169-libipc-sharelite-perl_0.17-5+b4_amd64.deb ... Unpacking libipc-sharelite-perl (0.17-5+b4) ... Selecting previously unselected package libcache-cache-perl. Preparing to unpack .../170-libcache-cache-perl_1.08-3_all.deb ... Unpacking libcache-cache-perl (1.08-3) ... Selecting previously unselected package libace-perl. Preparing to unpack .../171-libace-perl_1.92-14+b1_amd64.deb ... Unpacking libace-perl (1.92-14+b1) ... Selecting previously unselected package libalgorithm-diff-perl. Preparing to unpack .../172-libalgorithm-diff-perl_1.201-1_all.deb ... Unpacking libalgorithm-diff-perl (1.201-1) ... Selecting previously unselected package libalgorithm-munkres-perl. Preparing to unpack .../173-libalgorithm-munkres-perl_0.08-5_all.deb ... Unpacking libalgorithm-munkres-perl (0.08-5) ... Selecting previously unselected package libclass-method-modifiers-perl. Preparing to unpack .../174-libclass-method-modifiers-perl_2.15-1_all.deb ... Unpacking libclass-method-modifiers-perl (2.15-1) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../175-libclass-xsaccessor-perl_1.19-4+b6_amd64.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b6) ... Selecting previously unselected package libb-hooks-op-check-perl:amd64. Preparing to unpack .../176-libb-hooks-op-check-perl_0.22-3+b5_amd64.deb ... Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b5) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../177-libdynaloader-functions-perl_0.004-2_all.deb ... Unpacking libdynaloader-functions-perl (0.004-2) ... Selecting previously unselected package libdevel-callchecker-perl:amd64. Preparing to unpack .../178-libdevel-callchecker-perl_0.009-3+b1_amd64.deb ... Unpacking libdevel-callchecker-perl:amd64 (0.009-3+b1) ... Selecting previously unselected package libparams-classify-perl:amd64. Preparing to unpack .../179-libparams-classify-perl_0.015-2+b6_amd64.deb ... Unpacking libparams-classify-perl:amd64 (0.015-2+b6) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../180-libmodule-runtime-perl_0.018-1_all.deb ... Unpacking libmodule-runtime-perl (0.018-1) ... Selecting previously unselected package libimport-into-perl. Preparing to unpack .../181-libimport-into-perl_1.002005-2_all.deb ... Unpacking libimport-into-perl (1.002005-2) ... Selecting previously unselected package librole-tiny-perl. Preparing to unpack .../182-librole-tiny-perl_2.002005-1_all.deb ... Unpacking librole-tiny-perl (2.002005-1) ... Selecting previously unselected package libsub-quote-perl. Preparing to unpack .../183-libsub-quote-perl_2.006009-1_all.deb ... Unpacking libsub-quote-perl (2.006009-1) ... Selecting previously unselected package libmoo-perl. Preparing to unpack .../184-libmoo-perl_2.005005-1_all.deb ... Unpacking libmoo-perl (2.005005-1) ... Selecting previously unselected package libexporter-tiny-perl. Preparing to unpack .../185-libexporter-tiny-perl_1.006003-1_all.deb ... Unpacking libexporter-tiny-perl (1.006003-1) ... Selecting previously unselected package libtype-tiny-perl. Preparing to unpack .../186-libtype-tiny-perl_2.010001-1_all.deb ... Unpacking libtype-tiny-perl (2.010001-1) ... Selecting previously unselected package libarray-compare-perl. Preparing to unpack .../187-libarray-compare-perl_3.0.8-1_all.deb ... Unpacking libarray-compare-perl (3.0.8-1) ... Selecting previously unselected package libio-string-perl. Preparing to unpack .../188-libio-string-perl_1.08-4_all.deb ... Unpacking libio-string-perl (1.08-4) ... Selecting previously unselected package libdata-stag-perl. Preparing to unpack .../189-libdata-stag-perl_0.14-4_all.deb ... Unpacking libdata-stag-perl (0.14-4) ... Selecting previously unselected package libbio-perl-perl. Preparing to unpack .../190-libbio-perl-perl_1.7.8-4_all.deb ... Unpacking libbio-perl-perl (1.7.8-4) ... Selecting previously unselected package libbio-alignio-stockholm-perl. Preparing to unpack .../191-libbio-alignio-stockholm-perl_1.7.3-2_all.deb ... Unpacking libbio-alignio-stockholm-perl (1.7.3-2) ... Selecting previously unselected package liburi-perl. Preparing to unpack .../192-liburi-perl_5.35-1_all.deb ... Unpacking liburi-perl (5.35-1) ... Selecting previously unselected package libencode-locale-perl. Preparing to unpack .../193-libencode-locale-perl_1.05-3_all.deb ... Unpacking libencode-locale-perl (1.05-3) ... Selecting previously unselected package libtimedate-perl. Preparing to unpack .../194-libtimedate-perl_2.3500-1_all.deb ... Unpacking libtimedate-perl (2.3500-1) ... Selecting previously unselected package libhttp-date-perl. Preparing to unpack .../195-libhttp-date-perl_6.08-1_all.deb ... Unpacking libhttp-date-perl (6.08-1) ... Selecting previously unselected package libfile-listing-perl. Preparing to unpack .../196-libfile-listing-perl_6.16-1_all.deb ... Unpacking libfile-listing-perl (6.16-1) ... Selecting previously unselected package libhtml-tagset-perl. Preparing to unpack .../197-libhtml-tagset-perl_3.24-1_all.deb ... Unpacking libhtml-tagset-perl (3.24-1) ... Selecting previously unselected package libhtml-parser-perl:amd64. Preparing to unpack .../198-libhtml-parser-perl_3.83-2+b1_amd64.deb ... Unpacking libhtml-parser-perl:amd64 (3.83-2+b1) ... Selecting previously unselected package libhtml-tree-perl. Preparing to unpack .../199-libhtml-tree-perl_5.07-3_all.deb ... Unpacking libhtml-tree-perl (5.07-3) ... Selecting previously unselected package libclone-perl:amd64. Preparing to unpack .../200-libclone-perl_0.50-1+b1_amd64.deb ... Unpacking libclone-perl:amd64 (0.50-1+b1) ... Selecting previously unselected package libio-html-perl. Preparing to unpack .../201-libio-html-perl_1.004-3_all.deb ... Unpacking libio-html-perl (1.004-3) ... Selecting previously unselected package liblwp-mediatypes-perl. Preparing to unpack .../202-liblwp-mediatypes-perl_6.04-2_all.deb ... Unpacking liblwp-mediatypes-perl (6.04-2) ... Selecting previously unselected package libhttp-message-perl. Preparing to unpack .../203-libhttp-message-perl_7.02-1_all.deb ... Unpacking libhttp-message-perl (7.02-1) ... Selecting previously unselected package libhttp-cookies-perl. Preparing to unpack .../204-libhttp-cookies-perl_6.11-1_all.deb ... Unpacking libhttp-cookies-perl (6.11-1) ... Selecting previously unselected package libhttp-negotiate-perl. Preparing to unpack .../205-libhttp-negotiate-perl_6.01-2_all.deb ... Unpacking libhttp-negotiate-perl (6.01-2) ... Selecting previously unselected package perl-openssl-defaults:amd64. Preparing to unpack .../206-perl-openssl-defaults_7+b2_amd64.deb ... Unpacking perl-openssl-defaults:amd64 (7+b2) ... Selecting previously unselected package libnet-ssleay-perl:amd64. Preparing to unpack .../207-libnet-ssleay-perl_1.96-1+b1_amd64.deb ... Unpacking libnet-ssleay-perl:amd64 (1.96-1+b1) ... Selecting previously unselected package libio-socket-ssl-perl. Preparing to unpack .../208-libio-socket-ssl-perl_2.099-1_all.deb ... Unpacking libio-socket-ssl-perl (2.099-1) ... Selecting previously unselected package libnet-http-perl. Preparing to unpack .../209-libnet-http-perl_6.24-1_all.deb ... Unpacking libnet-http-perl (6.24-1) ... Selecting previously unselected package liblwp-protocol-https-perl. Preparing to unpack .../210-liblwp-protocol-https-perl_6.15-1_all.deb ... Unpacking liblwp-protocol-https-perl (6.15-1) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../211-libtry-tiny-perl_0.32-1_all.deb ... Unpacking libtry-tiny-perl (0.32-1) ... Selecting previously unselected package libwww-robotrules-perl. Preparing to unpack .../212-libwww-robotrules-perl_6.03-1_all.deb ... Unpacking libwww-robotrules-perl (6.03-1) ... Selecting previously unselected package libwww-perl. Preparing to unpack .../213-libwww-perl_6.83-1_all.deb ... Unpacking libwww-perl (6.83-1) ... Selecting previously unselected package libxml-parser-perl. Preparing to unpack .../214-libxml-parser-perl_2.47-2+b1_amd64.deb ... Unpacking libxml-parser-perl (2.47-2+b1) ... Selecting previously unselected package libxml-twig-perl. Preparing to unpack .../215-libxml-twig-perl_1%3a3.54-1_all.deb ... Unpacking libxml-twig-perl (1:3.54-1) ... Selecting previously unselected package libxml-writer-perl. Preparing to unpack .../216-libxml-writer-perl_0.900-2_all.deb ... Unpacking libxml-writer-perl (0.900-2) ... Selecting previously unselected package libbio-variation-perl. Preparing to unpack .../217-libbio-variation-perl_1.7.5-3_all.deb ... Unpacking libbio-variation-perl (1.7.5-3) ... Selecting previously unselected package libxml-namespacesupport-perl. Preparing to unpack .../218-libxml-namespacesupport-perl_1.12-2_all.deb ... Unpacking libxml-namespacesupport-perl (1.12-2) ... Selecting previously unselected package libxml-sax-base-perl. Preparing to unpack .../219-libxml-sax-base-perl_1.09-3_all.deb ... Unpacking libxml-sax-base-perl (1.09-3) ... Selecting previously unselected package libxml-sax-perl. Preparing to unpack .../220-libxml-sax-perl_1.02+dfsg-5_all.deb ... Unpacking libxml-sax-perl (1.02+dfsg-5) ... Selecting previously unselected package libbio-cluster-perl. Preparing to unpack .../221-libbio-cluster-perl_1.7.3-6_all.deb ... Unpacking libbio-cluster-perl (1.7.3-6) ... Selecting previously unselected package libbio-asn1-entrezgene-perl. Preparing to unpack .../222-libbio-asn1-entrezgene-perl_1.730-3_all.deb ... Unpacking libbio-asn1-entrezgene-perl (1.730-3) ... Selecting previously unselected package libbio-samtools-perl. Preparing to unpack .../223-libbio-samtools-perl_1.43-5+b2_amd64.deb ... Unpacking libbio-samtools-perl (1.43-5+b2) ... Selecting previously unselected package libcapture-tiny-perl. Preparing to unpack .../224-libcapture-tiny-perl_0.50-1_all.deb ... Unpacking libcapture-tiny-perl (0.50-1) ... Selecting previously unselected package libcgi-pm-perl. Preparing to unpack .../225-libcgi-pm-perl_4.72-1_all.deb ... Unpacking libcgi-pm-perl (4.72-1) ... Selecting previously unselected package libclass-data-inheritable-perl. Preparing to unpack .../226-libclass-data-inheritable-perl_0.10-1_all.deb ... Unpacking libclass-data-inheritable-perl (0.10-1) ... Selecting previously unselected package libclass-inspector-perl. Preparing to unpack .../227-libclass-inspector-perl_1.36-3_all.deb ... Unpacking libclass-inspector-perl (1.36-3) ... Selecting previously unselected package libclass-unload-perl. Preparing to unpack .../228-libclass-unload-perl_0.12-1_all.deb ... Unpacking libclass-unload-perl (0.12-1) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../229-libcom-err2_1.47.4-1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.4-1) ... Selecting previously unselected package libconvert-binary-c-perl. Preparing to unpack .../230-libconvert-binary-c-perl_0.86-1+b1_amd64.deb ... Unpacking libconvert-binary-c-perl (0.86-1+b1) ... Selecting previously unselected package libconvert-binhex-perl. Preparing to unpack .../231-libconvert-binhex-perl_1.125-3_all.deb ... Unpacking libconvert-binhex-perl (1.125-3) ... Selecting previously unselected package libcrypt-rc4-perl. Preparing to unpack .../232-libcrypt-rc4-perl_2.02-5_all.deb ... Unpacking libcrypt-rc4-perl (2.02-5) ... Selecting previously unselected package libdbi-perl:amd64. Preparing to unpack .../233-libdbi-perl_1.650-1+b1_amd64.deb ... Unpacking libdbi-perl:amd64 (1.650-1+b1) ... Selecting previously unselected package mysql-common. Preparing to unpack .../234-mysql-common_5.8+1.1.1_all.deb ... Unpacking mysql-common (5.8+1.1.1) ... Selecting previously unselected package mariadb-common. Preparing to unpack .../235-mariadb-common_1%3a11.8.8-1_all.deb ... Unpacking mariadb-common (1:11.8.8-1) ... Selecting previously unselected package libmariadb3:amd64. Preparing to unpack .../236-libmariadb3_1%3a11.8.8-1_amd64.deb ... Unpacking libmariadb3:amd64 (1:11.8.8-1) ... Selecting previously unselected package libdbd-mysql-perl:amd64. Preparing to unpack .../237-libdbd-mysql-perl_4.055-1+b1_amd64.deb ... Unpacking libdbd-mysql-perl:amd64 (4.055-1+b1) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../238-libkrb5support0_1.22.1-3_amd64.deb ... Unpacking libkrb5support0:amd64 (1.22.1-3) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../239-libk5crypto3_1.22.1-3_amd64.deb ... Unpacking libk5crypto3:amd64 (1.22.1-3) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../240-libkeyutils1_1.6.3-6+b2_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-6+b2) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../241-libkrb5-3_1.22.1-3_amd64.deb ... Unpacking libkrb5-3:amd64 (1.22.1-3) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../242-libgssapi-krb5-2_1.22.1-3_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.22.1-3) ... Selecting previously unselected package libpq5:amd64. Preparing to unpack .../243-libpq5_18.4-1+b2_amd64.deb ... Unpacking libpq5:amd64 (18.4-1+b2) ... Selecting previously unselected package libdbd-pg-perl. Preparing to unpack .../244-libdbd-pg-perl_3.20.2-1+b1_amd64.deb ... Unpacking libdbd-pg-perl (3.20.2-1+b1) ... Selecting previously unselected package libdbd-sqlite3-perl:amd64. Preparing to unpack .../245-libdbd-sqlite3-perl_1.78-1+b2_amd64.deb ... Unpacking libdbd-sqlite3-perl:amd64 (1.78-1+b2) ... Selecting previously unselected package libdevel-cycle-perl. Preparing to unpack .../246-libdevel-cycle-perl_1.12-2_all.deb ... Unpacking libdevel-cycle-perl (1.12-2) ... Selecting previously unselected package libdevel-stacktrace-perl. Preparing to unpack .../247-libdevel-stacktrace-perl_2.0500-1_all.deb ... Unpacking libdevel-stacktrace-perl (2.0500-1) ... Selecting previously unselected package libdigest-perl-md5-perl. Preparing to unpack .../248-libdigest-perl-md5-perl_1.91-1_all.deb ... Unpacking libdigest-perl-md5-perl (1.91-1) ... Selecting previously unselected package libexception-class-perl. Preparing to unpack .../249-libexception-class-perl_1.45-1_all.deb ... Unpacking libexception-class-perl (1.45-1) ... Selecting previously unselected package libfcgi0t64:amd64. Preparing to unpack .../250-libfcgi0t64_2.4.5-0.1+b2_amd64.deb ... Unpacking libfcgi0t64:amd64 (2.4.5-0.1+b2) ... Selecting previously unselected package libfcgi-perl. Preparing to unpack .../251-libfcgi-perl_0.82+ds-3+b3_amd64.deb ... Unpacking libfcgi-perl (0.82+ds-3+b3) ... Selecting previously unselected package libfile-slurper-perl. Preparing to unpack .../252-libfile-slurper-perl_0.014-1_all.deb ... Unpacking libfile-slurper-perl (0.014-1) ... Selecting previously unselected package libheap-perl. Preparing to unpack .../253-libheap-perl_0.80-5_all.deb ... Unpacking libheap-perl (0.80-5) ... Selecting previously unselected package libset-object-perl. Preparing to unpack .../254-libset-object-perl_1.43-1+b1_amd64.deb ... Unpacking libset-object-perl (1.43-1+b1) ... Selecting previously unselected package libgraph-perl. Preparing to unpack .../255-libgraph-perl_1%3a0.9735-1_all.deb ... Unpacking libgraph-perl (1:0.9735-1) ... Selecting previously unselected package libio-pty-perl. Preparing to unpack .../256-libio-pty-perl_1.31-1+b1_amd64.deb ... Unpacking libio-pty-perl (1:1.31-1+b1) ... Selecting previously unselected package libipc-run-perl. Preparing to unpack .../257-libipc-run-perl_20260402.0-1_all.deb ... Unpacking libipc-run-perl (20260402.0-1) ... Selecting previously unselected package libparse-recdescent-perl. Preparing to unpack .../258-libparse-recdescent-perl_1.967015+dfsg-4_all.deb ... Unpacking libparse-recdescent-perl (1.967015+dfsg-4) ... Selecting previously unselected package libxml-xpath-perl. Preparing to unpack .../259-libxml-xpath-perl_1.49-1_all.deb ... Unpacking libxml-xpath-perl (1.49-1) ... Selecting previously unselected package libgraphviz-perl. Preparing to unpack .../260-libgraphviz-perl_2.26-1_all.deb ... Unpacking libgraphviz-perl (2.26-1) ... Selecting previously unselected package libhtml-tableextract-perl. Preparing to unpack .../261-libhtml-tableextract-perl_2.15-2_all.deb ... Unpacking libhtml-tableextract-perl (2.15-2) ... Selecting previously unselected package libhttp-daemon-perl. Preparing to unpack .../262-libhttp-daemon-perl_6.17-1_all.deb ... Unpacking libhttp-daemon-perl (6.17-1) ... Selecting previously unselected package libio-sessiondata-perl. Preparing to unpack .../263-libio-sessiondata-perl_1.03-3_all.deb ... Unpacking libio-sessiondata-perl (1.03-3) ... Selecting previously unselected package libio-stringy-perl. Preparing to unpack .../264-libio-stringy-perl_2.113-2_all.deb ... Unpacking libio-stringy-perl (2.113-2) ... Selecting previously unselected package libjcode-pm-perl. Preparing to unpack .../265-libjcode-pm-perl_2.07-1_amd64.deb ... Unpacking libjcode-pm-perl (2.07-1) ... Selecting previously unselected package liblist-moreutils-xs-perl. Preparing to unpack .../266-liblist-moreutils-xs-perl_0.430-4+b3_amd64.deb ... Unpacking liblist-moreutils-xs-perl (0.430-4+b3) ... Selecting previously unselected package liblist-moreutils-perl. Preparing to unpack .../267-liblist-moreutils-perl_0.430-2_all.deb ... Unpacking liblist-moreutils-perl (0.430-2) ... Selecting previously unselected package libnet-smtp-ssl-perl. Preparing to unpack .../268-libnet-smtp-ssl-perl_1.04-2_all.deb ... Unpacking libnet-smtp-ssl-perl (1.04-2) ... Selecting previously unselected package libmailtools-perl. Preparing to unpack .../269-libmailtools-perl_2.22-1_all.deb ... Unpacking libmailtools-perl (2.22-1) ... Selecting previously unselected package libmath-derivative-perl. Preparing to unpack .../270-libmath-derivative-perl_1.01-3_all.deb ... Unpacking libmath-derivative-perl (1.01-3) ... Selecting previously unselected package libmath-spline-perl. Preparing to unpack .../271-libmath-spline-perl_0.02-4_all.deb ... Unpacking libmath-spline-perl (0.02-4) ... Selecting previously unselected package libmime-tools-perl. Preparing to unpack .../272-libmime-tools-perl_5.517-1_all.deb ... Unpacking libmime-tools-perl (5.517-1) ... Selecting previously unselected package libmodule-build-perl. Preparing to unpack .../273-libmodule-build-perl_0.423400-3_all.deb ... Adding 'diversion of /usr/bin/config_data to /usr/bin/config_data.diverted by libmodule-build-perl' Adding 'diversion of /usr/share/man/man1/config_data.1.gz to /usr/share/man/man1/config_data.diverted.1.gz by libmodule-build-perl' Unpacking libmodule-build-perl (0.423400-3) ... Selecting previously unselected package libole-storage-lite-perl. Preparing to unpack .../274-libole-storage-lite-perl_0.24-1_all.deb ... Unpacking libole-storage-lite-perl (0.24-1) ... Selecting previously unselected package libpadwalker-perl. Preparing to unpack .../275-libpadwalker-perl_2.5-1+b7_amd64.deb ... Unpacking libpadwalker-perl (2.5-1+b7) ... Selecting previously unselected package libpath-class-perl. Preparing to unpack .../276-libpath-class-perl_0.37-4_all.deb ... Unpacking libpath-class-perl (0.37-4) ... Selecting previously unselected package libperlio-eol-perl. Preparing to unpack .../277-libperlio-eol-perl_0.19-1+b4_amd64.deb ... Unpacking libperlio-eol-perl (0.19-1+b4) ... Selecting previously unselected package libpostscript-perl. Preparing to unpack .../278-libpostscript-perl_0.06-3.1_all.deb ... Unpacking libpostscript-perl (0.06-3.1) ... Selecting previously unselected package libset-scalar-perl. Preparing to unpack .../279-libset-scalar-perl_1.29-3_all.deb ... Unpacking libset-scalar-perl (1.29-3) ... Selecting previously unselected package libtask-weaken-perl. Preparing to unpack .../280-libtask-weaken-perl_1.06-2_all.deb ... Unpacking libtask-weaken-perl (1.06-2) ... Selecting previously unselected package libsoap-lite-perl. Preparing to unpack .../281-libsoap-lite-perl_1.27-3_all.deb ... Unpacking libsoap-lite-perl (1.27-3) ... Selecting previously unselected package libsort-naturally-perl. Preparing to unpack .../282-libsort-naturally-perl_1.03-4_all.deb ... Unpacking libsort-naturally-perl (1.03-4) ... Selecting previously unselected package libspreadsheet-writeexcel-perl. Preparing to unpack .../283-libspreadsheet-writeexcel-perl_2.40-4_all.deb ... Unpacking libspreadsheet-writeexcel-perl (2.40-4) ... Selecting previously unselected package libunicode-map-perl. Preparing to unpack .../284-libunicode-map-perl_0.112-13+b6_amd64.deb ... Unpacking libunicode-map-perl (0.112-13+b6) ... Selecting previously unselected package libspreadsheet-parseexcel-perl. Preparing to unpack .../285-libspreadsheet-parseexcel-perl_0.6600-1_all.deb ... Unpacking libspreadsheet-parseexcel-perl (0.6600-1) ... Selecting previously unselected package libstatistics-descriptive-perl. Preparing to unpack .../286-libstatistics-descriptive-perl_3.0801-1_all.deb ... Unpacking libstatistics-descriptive-perl (3.0801-1) ... Selecting previously unselected package libsub-uplevel-perl. Preparing to unpack .../287-libsub-uplevel-perl_0.2800-3_all.deb ... Unpacking libsub-uplevel-perl (0.2800-3) ... Selecting previously unselected package libsvg-perl. Preparing to unpack .../288-libsvg-perl_2.89-1_all.deb ... Unpacking libsvg-perl (2.89-1) ... Selecting previously unselected package libtree-dagnode-perl. Preparing to unpack .../289-libtree-dagnode-perl_1.37-1_all.deb ... Unpacking libtree-dagnode-perl (1.37-1) ... Selecting previously unselected package libsvg-graph-perl. Preparing to unpack .../290-libsvg-graph-perl_0.02-4_all.deb ... Unpacking libsvg-graph-perl (0.02-4) ... Selecting previously unselected package libtest-deep-perl. Preparing to unpack .../291-libtest-deep-perl_1.205-1_all.deb ... Unpacking libtest-deep-perl (1.205-1) ... Selecting previously unselected package libtext-diff-perl. Preparing to unpack .../292-libtext-diff-perl_1.45-2_all.deb ... Unpacking libtext-diff-perl (1.45-2) ... Selecting previously unselected package libtest-differences-perl. Preparing to unpack .../293-libtest-differences-perl_0.72-1_all.deb ... Unpacking libtest-differences-perl (0.72-1) ... Selecting previously unselected package libtest-exception-perl. Preparing to unpack .../294-libtest-exception-perl_0.43-3_all.deb ... Unpacking libtest-exception-perl (0.43-3) ... Selecting previously unselected package libtest-memory-cycle-perl. Preparing to unpack .../295-libtest-memory-cycle-perl_1.06-2_all.deb ... Unpacking libtest-memory-cycle-perl (1.06-2) ... Selecting previously unselected package libtest-warn-perl. Preparing to unpack .../296-libtest-warn-perl_0.37-2_all.deb ... Unpacking libtest-warn-perl (0.37-2) ... Selecting previously unselected package libtest-most-perl. Preparing to unpack .../297-libtest-most-perl_0.42-1_all.deb ... Unpacking libtest-most-perl (0.42-1) ... Selecting previously unselected package libtest-pod-perl. Preparing to unpack .../298-libtest-pod-perl_1.52-3_all.deb ... Unpacking libtest-pod-perl (1.52-3) ... Selecting previously unselected package libtest-requiresinternet-perl. Preparing to unpack .../299-libtest-requiresinternet-perl_0.05-4_all.deb ... Unpacking libtest-requiresinternet-perl (0.05-4) ... Selecting previously unselected package libtest-weaken-perl. Preparing to unpack .../300-libtest-weaken-perl_3.022000-2_all.deb ... Unpacking libtest-weaken-perl (3.022000-2) ... Selecting previously unselected package libxml-perl. Preparing to unpack .../301-libxml-perl_0.08-4_all.deb ... Unpacking libxml-perl (0.08-4) ... Selecting previously unselected package libxml-regexp-perl. Preparing to unpack .../302-libxml-regexp-perl_0.04-2_all.deb ... Unpacking libxml-regexp-perl (0.04-2) ... Selecting previously unselected package libxml-dom-perl. Preparing to unpack .../303-libxml-dom-perl_1.46-2_all.deb ... Unpacking libxml-dom-perl (1.46-2) ... Selecting previously unselected package libxml-xpathengine-perl. Preparing to unpack .../304-libxml-xpathengine-perl_0.14-2_all.deb ... Unpacking libxml-xpathengine-perl (0.14-2) ... Selecting previously unselected package libxml-dom-xpath-perl. Preparing to unpack .../305-libxml-dom-xpath-perl_0.14-4_all.deb ... Unpacking libxml-dom-xpath-perl (0.14-4) ... Selecting previously unselected package libxml-filter-buffertext-perl. Preparing to unpack .../306-libxml-filter-buffertext-perl_1.01-7_all.deb ... Unpacking libxml-filter-buffertext-perl (1.01-7) ... Selecting previously unselected package libxml-libxml-perl. Preparing to unpack .../307-libxml-libxml-perl_2.0207+dfsg+really+2.0134-8+b1_amd64.deb ... Unpacking libxml-libxml-perl (2.0207+dfsg+really+2.0134-8+b1) ... Selecting previously unselected package libxml-sax-expatxs-perl. Preparing to unpack .../308-libxml-sax-expatxs-perl_1.33-3+b5_amd64.deb ... Unpacking libxml-sax-expatxs-perl (1.33-3+b5) ... Selecting previously unselected package libxml-sax-writer-perl. Preparing to unpack .../309-libxml-sax-writer-perl_0.57-3_all.deb ... Unpacking libxml-sax-writer-perl (0.57-3) ... Selecting previously unselected package libxml-simple-perl. Preparing to unpack .../310-libxml-simple-perl_2.25-2_all.deb ... Unpacking libxml-simple-perl (2.25-2) ... Selecting previously unselected package libyaml-perl. Preparing to unpack .../311-libyaml-perl_1.31-1_all.deb ... Unpacking libyaml-perl (1.31-1) ... Selecting previously unselected package rename. Preparing to unpack .../312-rename_2.02-2_all.deb ... Unpacking rename (2.02-2) ... Selecting previously unselected package sbuild-build-depends-main-dummy. Preparing to unpack .../313-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ... Setting up libexpat1:amd64 (2.8.2-1) ... Setting up libb2-1:amd64 (0.98.1-1.1+b3) ... Setting up libjcode-pm-perl (2.07-1) ... Setting up libpipeline1:amd64 (1.5.8-3) ... Setting up libio-sessiondata-perl (1.03-3) ... Setting up libxdot4:amd64 (14.1.2-1+b3) ... Setting up libgraphite2-3:amd64 (1.3.15-2) ... Setting up libcdt6:amd64 (14.1.2-1+b3) ... Setting up libpixman-1-0:amd64 (0.46.4-1+b2) ... Setting up libperlio-eol-perl (0.19-1+b4) ... Setting up libtext-charwidth-perl:amd64 (0.04-12+b1) ... Setting up libsharpyuv0:amd64 (1.5.0-0.1+b2) ... Setting up libdevel-cycle-perl (1.12-2) ... Setting up libaom3:amd64 (3.13.1-2+b1) ... Setting up libfile-slurper-perl (0.014-1) ... Setting up mysql-common (5.8+1.1.1) ... update-alternatives: using /etc/mysql/my.cnf.fallback to provide /etc/mysql/my.cnf (my.cnf) in auto mode Setting up libxau6:amd64 (1:1.0.11-1+b2) ... Setting up libxdmcp6:amd64 (1:1.1.5-2+b1) ... Setting up libdouble-conversion3:amd64 (3.4.0-1+b1) ... Setting up libkeyutils1:amd64 (1.6.3-6+b2) ... Setting up pci.ids (0.0~2026.07.06-1) ... Setting up libxcb1:amd64 (1.17.0-2+b2) ... Setting up libtask-weaken-perl (1.06-2) ... Setting up libxcb-xfixes0:amd64 (1.17.0-2+b2) ... Setting up liblerc4:amd64 (4.1.1+ds-1) ... Setting up bsdextrautils (2.42.2-1) ... Setting up libconvert-binary-c-perl (0.86-1+b1) ... Setting up libclass-inspector-perl (1.36-3) ... Setting up libxcb-xinput0:amd64 (1.17.0-2+b2) ... Setting up libdynaloader-functions-perl (0.004-2) ... Setting up libdatrie1:amd64 (0.2.14-2) ... Setting up libtest-deep-perl (1.205-1) ... Setting up libclass-method-modifiers-perl (2.15-1) ... Setting up libxml-regexp-perl (0.04-2) ... Setting up libalgorithm-munkres-perl (0.08-5) ... Setting up libio-pty-perl (1:1.31-1+b1) ... Setting up libmagic-mgc (1:5.47-4) ... Setting up libpath-class-perl (0.37-4) ... Setting up libxcb-render0:amd64 (1.17.0-2+b2) ... Setting up libclone-perl:amd64 (0.50-1+b1) ... Setting up libalgorithm-diff-perl (1.201-1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libfcgi0t64:amd64 (2.4.5-0.1+b2) ... Setting up libglvnd0:amd64 (1.7.0-3+b1) ... Setting up libxml2-16:amd64 (2.15.3+dfsg-1) ... Setting up libio-stringy-perl (2.113-2) ... Setting up libhtml-tagset-perl (3.24-1) ... Setting up libts0t64:amd64 (1.22-1.1+b2) ... Setting up libxcb-glx0:amd64 (1.17.0-2+b2) ... Setting up libdebhelper-perl (14.3) ... Setting up libbrotli1:amd64 (1.2.0-3) ... Setting up libipc-sharelite-perl (0.17-5+b4) ... Setting up libconvert-binhex-perl (1.125-3) ... Setting up libheap-perl (0.80-5) ... Setting up liblwp-mediatypes-perl (6.04-2) ... Setting up libmagic1t64:amd64 (1:5.47-4) ... Setting up libtest-weaken-perl (3.022000-2) ... Setting up libxcb-keysyms1:amd64 (0.4.1-1+b2) ... Setting up libxcb-shape0:amd64 (1.17.0-2+b2) ... Setting up libclass-unload-perl (0.12-1) ... Setting up x11-common (1:7.7+26) ... invoke-rc.d: could not determine current runlevel invoke-rc.d: WARNING: No init system and policy-rc.d missing! Defaulting to block. Setting up libtest-pod-perl (1.52-3) ... Setting up libtry-tiny-perl (0.32-1) ... Setting up libsensors-config (1:3.6.2-2) ... Setting up libdeflate0:amd64 (1.25-1) ... Setting up perl-openssl-defaults:amd64 (7+b2) ... Setting up libxml-namespacesupport-perl (1.12-2) ... Setting up libsvg-perl (2.89-1) ... Setting up gettext-base (1.0-3) ... Setting up m4 (1.4.21-1) ... Setting up libxcb-render-util0:amd64 (0.3.10-1+b2) ... Setting up xkb-data (2.47-1) ... Setting up libpadwalker-perl (2.5-1+b7) ... Setting up libencode-locale-perl (1.05-3) ... Setting up rename (2.02-2) ... update-alternatives: using /usr/bin/file-rename to provide /usr/bin/rename (rename) in auto mode Setting up libxcb-shm0:amd64 (1.17.0-2+b2) ... Setting up libxcb-icccm4:amd64 (0.4.2-1+b2) ... Setting up libcom-err2:amd64 (1.47.4-1) ... Setting up file (1:5.47-4) ... Setting up libyaml-perl (1.31-1) ... Setting up libtext-wrapi18n-perl (0.06-11) ... Setting up libjbig0:amd64 (2.1-6.1+b3) ... Setting up libpcre2-16-0:amd64 (10.46-1+b2) ... Setting up libopengl0:amd64 (1.7.0-3+b1) ... Setting up libelf1t64:amd64 (0.195-1) ... Setting up libxcb-util1:amd64 (0.4.1-1+b2) ... Setting up libmodule-build-perl (0.423400-3) ... Setting up libxcb-xkb1:amd64 (1.17.0-2+b2) ... Setting up libxcb-image0:amd64 (0.4.0-2+b3) ... Setting up libkrb5support0:amd64 (1.22.1-3) ... Setting up librav1e0.8:amd64 (0.8.1-10) ... Setting up libicu78:amd64 (78.3-2) ... Setting up libxcb-present0:amd64 (1.17.0-2+b2) ... Setting up liberror-perl (0.17030-1) ... Setting up mariadb-common (1:11.8.8-1) ... update-alternatives: using /etc/mysql/mariadb.cnf to provide /etc/mysql/my.cnf (my.cnf) in auto mode Setting up libdigest-perl-md5-perl (1.91-1) ... Setting up libxml-sax-base-perl (1.09-3) ... Setting up libio-string-perl (1.08-4) ... Setting up libunicode-map-perl (0.112-13+b6) ... Setting up libtest-memory-cycle-perl (1.06-2) ... Setting up autotools-dev (20240727.1+nmu1) ... Setting up libz3-4:amd64 (4.13.3-1.1) ... Setting up libglib2.0-0t64:amd64 (2.88.2-1) ... No schema files found: doing nothing. Setting up libclass-data-inheritable-perl (0.10-1) ... Setting up libset-object-perl (1.43-1+b1) ... Setting up libjpeg62-turbo:amd64 (1:3.1.3-4) ... Setting up libproc2-1:amd64 (2:4.0.6-2) ... Setting up libx11-data (2:1.8.13-1) ... Setting up libtext-diff-perl (1.45-2) ... Setting up libxcb-sync1:amd64 (1.17.0-2+b2) ... Setting up libxml-xpathengine-perl (0.14-2) ... Setting up libpathplan4:amd64 (14.1.2-1+b3) ... Setting up libxcb-cursor0:amd64 (0.1.6-1) ... Setting up libxml-writer-perl (0.900-2) ... Setting up libann0 (1.1.2+doc-9+b1) ... Setting up libdbus-1-3:amd64 (1.16.2-5+b1) ... Setting up libfribidi0:amd64 (1.0.16-5+b1) ... Setting up shared-mime-info (2.4-5+b3) ... Setting up libimagequant0:amd64 (4.4.1-1+b2) ... Setting up libcrypt-rc4-perl (2.02-5) ... Setting up fonts-dejavu-mono (2.37-9) ... Setting up libpng16-16t64:amd64 (1.6.58-1) ... Setting up libio-html-perl (1.004-3) ... Setting up autopoint (1.0-3) ... Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b5) ... Setting up libmariadb3:amd64 (1:11.8.8-1) ... Setting up fonts-dejavu-core (2.37-9) ... Setting up libipc-run-perl (20260402.0-1) ... Setting up liblist-moreutils-xs-perl (0.430-4+b3) ... Setting up libsensors5:amd64 (1:3.6.2-2+b2) ... Setting up libmath-derivative-perl (1.01-3) ... Setting up libk5crypto3:amd64 (1.22.1-3) ... Setting up libltdl7:amd64 (2.5.4-11) ... Setting up libsvtav1enc4:amd64 (4.1.0+dfsg-1) ... Setting up libvulkan1:amd64 (1.4.341.0-1) ... Setting up autoconf (2.73-2) ... Setting up libcgraph8:amd64 (14.1.2-1+b3) ... Setting up libwebp7:amd64 (1.5.0-0.1+b2) ... Setting up libcapture-tiny-perl (0.50-1) ... Setting up libtimedate-perl (2.3500-1) ... Setting up libset-scalar-perl (1.29-3) ... Setting up libole-storage-lite-perl (0.24-1) ... Setting up libgvpr2:amd64 (14.1.2-1+b3) ... Setting up libtree-dagnode-perl (1.37-1) ... Setting up dwz (0.16-4) ... Setting up libdata-stag-perl (0.14-4) ... Setting up libparse-recdescent-perl (1.967015+dfsg-4) ... Setting up libdav1d7:amd64 (1.5.3-1+b2) ... Setting up libmtdev1t64:amd64 (1.1.7-1+b2) ... Setting up sensible-utils (0.0.26) ... Setting up libxshmfence1:amd64 (1.3.3-1+b2) ... Setting up libtiff6:amd64 (4.7.2-1) ... Setting up libxcb-randr0:amd64 (1.17.0-2+b2) ... Setting up libuchardet0:amd64 (0.0.8-2+b2) ... Setting up procps (2:4.0.6-2) ... Setting up librole-tiny-perl (2.002005-1) ... Setting up libmd4c0:amd64 (0.5.3-1) ... Setting up libfcgi-perl (0.82+ds-3+b3) ... Setting up libsub-uplevel-perl (0.2800-3) ... Setting up libx11-6:amd64 (2:1.8.13-1) ... Setting up libthai-data (0.1.30-2) ... Setting up libabsl20260107:amd64 (20260107.0-5) ... Setting up netbase (6.5) ... Setting up libgts-0.7-5t64:amd64 (0.7.6+darcs121130-5.2+b2) ... Setting up libsub-quote-perl (2.006009-1) ... Setting up libdevel-stacktrace-perl (2.0500-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b6) ... Setting up libkrb5-3:amd64 (1.22.1-3) ... Setting up libbio-perl-perl (1.7.8-4) ... Setting up libexporter-tiny-perl (1.006003-1) ... Setting up libde265-0:amd64 (1.1.1-1) ... Setting up openssl (3.6.3-1) ... Setting up libbsd0:amd64 (0.12.2-3) ... Setting up libdrm-common (2.4.134-3) ... Setting up libyuv0:amd64 (0.0.1949.20260706-1) ... Setting up libpostscript-perl (0.06-3.1) ... Setting up libevdev2:amd64 (1.13.6+dfsg-3) ... Setting up libsort-naturally-perl (1.03-4) ... Setting up liburi-perl (5.35-1) ... Setting up libgudev-1.0-0:amd64 (238-7+b2) ... Setting up libdbi-perl:amd64 (1.650-1+b1) ... Setting up libwacom-common (2.18.0-1) ... Setting up libxkbcommon0:amd64 (1.13.1-1) ... Setting up libwayland-client0:amd64 (1.25.0-2) ... Setting up libnet-ssleay-perl:amd64 (1.96-1+b1) ... Setting up libmath-spline-perl (0.02-4) ... Setting up automake (1:1.18.1-4) ... update-alternatives: using /usr/bin/automake-1.18 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.15.1-1) ... Setting up libxcb-dri3-0:amd64 (1.17.0-2+b2) ... Setting up libbio-alignio-stockholm-perl (1.7.3-2) ... Setting up libx11-xcb1:amd64 (2:1.8.13-1) ... Setting up libice6:amd64 (2:1.1.1-1+b2) ... Setting up libqt6core6t64:amd64 (6.10.2+dfsg-15) ... Setting up libpciaccess0:amd64 (0.19-2) ... Setting up libhttp-date-perl (6.08-1) ... Setting up gettext (1.0-3) ... Setting up libfile-listing-perl (6.16-1) ... Setting up libxpm4:amd64 (1:3.5.19-1) ... Setting up libtest-requiresinternet-perl (0.05-4) ... Setting up libcache-cache-perl (1.08-3) ... Setting up libxrender1:amd64 (1:0.9.12-1+b2) ... Setting up libtool (2.5.4-11) ... Setting up libwacom9:amd64 (2.18.0-1) ... Setting up fontconfig-config (2.17.1-5) ... Setting up liblist-moreutils-perl (0.430-2) ... Setting up libtest-warn-perl (0.37-2) ... Setting up libedit2:amd64 (3.1-20260512-1) ... Setting up libtype-tiny-perl (2.010001-1) ... Setting up libtest-differences-perl (0.72-1) ... Setting up libxext6:amd64 (2:1.3.4-1+b4) ... Setting up libnet-http-perl (6.24-1) ... Setting up libexception-class-perl (1.45-1) ... Setting up libgraph-perl (1:0.9735-1) ... Setting up libdevel-callchecker-perl:amd64 (0.009-3+b1) ... Setting up libspreadsheet-writeexcel-perl (2.40-4) ... Setting up libxxf86vm1:amd64 (1:1.1.4-2+b1) ... Setting up libinput-bin (1.31.3-1) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (22) ... Setting up libthai0:amd64 (0.1.30-2) ... Setting up ca-certificates (20260601) ... Updating certificates in /etc/ssl/certs... 121 added, 0 removed; done. Setting up libtest-exception-perl (0.43-3) ... Setting up libbio-samtools-perl (1.43-5+b2) ... Setting up libfreetype6:amd64 (2.14.3+dfsg-1) ... Setting up libllvm21:amd64 (1:21.1.8-7+b4) ... Setting up libxkbcommon-x11-0:amd64 (1.13.1-1) ... Setting up libgssapi-krb5-2:amd64 (1.22.1-3) ... Setting up libdbd-mysql-perl:amd64 (4.055-1+b1) ... Setting up libace-perl (1.92-14+b1) ... Setting up ucf (3.0056) ... Setting up libgvc7:amd64 (14.1.2-1+b3) ... Setting up libspreadsheet-parseexcel-perl (0.6600-1) ... Setting up dh-strip-nondeterminism (1.15.1-1) ... Setting up libwww-robotrules-perl (6.03-1) ... Setting up libgav1-2:amd64 (0.20.0-2+b1) ... Setting up libdrm2:amd64 (2.4.134-3) ... Setting up groff-base (1.24.1-1) ... Setting up libhtml-parser-perl:amd64 (3.83-2+b1) ... Setting up libharfbuzz0b:amd64 (12.3.2-2+b2) ... Setting up libdbd-sqlite3-perl:amd64 (1.78-1+b2) ... Setting up libfontconfig1:amd64 (2.17.1-5) ... Setting up libsm6:amd64 (2:1.2.6-1+b2) ... Setting up libio-socket-ssl-perl (2.099-1) ... Setting up libqt6dbus6:amd64 (6.10.2+dfsg-15) ... Setting up libhttp-message-perl (7.02-1) ... Setting up libdrm-amdgpu1:amd64 (2.4.134-3) ... Setting up libinput10:amd64 (1.31.3-1) ... Setting up libhttp-negotiate-perl (6.01-2) ... Setting up fontconfig (2.17.1-5) ... Regenerating fonts cache... done. Setting up libavif16:amd64 (1.4.2-1) ... Setting up libstatistics-descriptive-perl (3.0801-1) ... Setting up libhttp-cookies-perl (6.11-1) ... Setting up libtest-most-perl (0.42-1) ... Setting up po-debconf (1.0.22) ... Setting up libhtml-tree-perl (5.07-3) ... Setting up libparams-classify-perl:amd64 (0.015-2+b6) ... Setting up libpango-1.0-0:amd64 (1.58.0-1) ... Setting up libdrm-intel1:amd64 (2.4.134-3) ... Setting up libcgi-pm-perl (4.72-1) ... Setting up libpq5:amd64 (18.4-1+b2) ... Setting up libdbd-pg-perl (3.20.2-1+b1) ... Setting up man-db (2.13.1-1) ... Not building database; man-db/auto-update is not 'true'. Created symlink '/etc/systemd/system/timers.target.wants/man-db.timer' → '/usr/lib/systemd/system/man-db.timer'. Setting up libxml-sax-perl (1.02+dfsg-5) ... update-perl-sax-parsers: Registering Perl SAX parser XML::SAX::PurePerl with priority 10... update-perl-sax-parsers: Updating overall Perl SAX parser modules info file... Creating config file /etc/perl/XML/SAX/ParserDetails.ini with new version Setting up libcairo2:amd64 (1.18.4-3+b1) ... Setting up libnet-smtp-ssl-perl (1.04-2) ... Setting up libmodule-runtime-perl (0.018-1) ... Setting up libmailtools-perl (2.22-1) ... Setting up libxml-filter-buffertext-perl (1.01-7) ... Setting up libxml-libxml-perl (2.0207+dfsg+really+2.0134-8+b1) ... update-perl-sax-parsers: Registering Perl SAX parser XML::LibXML::SAX::Parser with priority 50... update-perl-sax-parsers: Registering Perl SAX parser XML::LibXML::SAX with priority 50... update-perl-sax-parsers: Updating overall Perl SAX parser modules info file... Setting up libhtml-tableextract-perl (2.15-2) ... Setting up libhttp-daemon-perl (6.17-1) ... Setting up libpangoft2-1.0-0:amd64 (1.58.0-1) ... Setting up libpangocairo-1.0-0:amd64 (1.58.0-1) ... Setting up libxml-sax-writer-perl (0.57-3) ... Setting up libsvg-graph-perl (0.02-4) ... Setting up mesa-libgallium:amd64 (26.1.4-1) ... Setting up libxml-sax-expatxs-perl (1.33-3+b5) ... update-perl-sax-parsers: Registering Perl SAX parser XML::SAX::ExpatXS with priority 50... update-perl-sax-parsers: Updating overall Perl SAX parser modules info file... Setting up libgbm1:amd64 (26.1.4-1) ... Setting up libimport-into-perl (1.002005-2) ... Setting up libmoo-perl (2.005005-1) ... Setting up libgl1-mesa-dri:amd64 (26.1.4-1) ... Setting up libgvplugin-pango8:amd64 (14.1.2-1+b3) ... Setting up debhelper (14.3) ... Setting up libmime-tools-perl (5.517-1) ... Setting up libarray-compare-perl (3.0.8-1) ... Setting up libegl-mesa0:amd64 (26.1.4-1) ... Setting up libxml-simple-perl (2.25-2) ... Setting up libegl1:amd64 (1.7.0-3+b1) ... Setting up libglx-mesa0:amd64 (26.1.4-1) ... Setting up libglx0:amd64 (1.7.0-3+b1) ... Setting up libqt6gui6:amd64 (6.10.2+dfsg-15) ... Setting up libqt6widgets6:amd64 (6.10.2+dfsg-15) ... Setting up libheif-plugin-dav1d:amd64 (1.23.1-1) ... Setting up libheif-plugin-libde265:amd64 (1.23.1-1) ... Setting up libwww-perl (6.83-1) ... Setting up libheif1:amd64 (1.23.1-1) ... Setting up libgd3:amd64 (2.3.3-13+b2) ... Setting up liblwp-protocol-https-perl (6.15-1) ... Setting up libxml-parser-perl (2.47-2+b1) ... Setting up libxml-twig-perl (1:3.54-1) ... Setting up libgvplugin-gd8:amd64 (14.1.2-1+b3) ... Setting up libxml-xpath-perl (1.49-1) ... Setting up libbio-variation-perl (1.7.5-3) ... Setting up libxml-perl (0.08-4) ... Setting up libsoap-lite-perl (1.27-3) ... Setting up graphviz (14.1.2-1+b3) ... Setting up libbio-cluster-perl (1.7.3-6) ... Setting up libxml-dom-perl (1.46-2) ... Setting up libbio-asn1-entrezgene-perl (1.730-3) ... Setting up libxml-dom-xpath-perl (0.14-4) ... Setting up libgvplugin-neato-layout8:amd64 (14.1.2-1+b3) ... Setting up graphviz-tools (14.1.2-1+b3) ... Setting up libgraphviz-perl (2.26-1) ... Setting up sbuild-build-depends-main-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.42-17) ... Processing triggers for ca-certificates (20260601) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. +------------------------------------------------------------------------------+ | Check architectures Sat, 11 Jul 2026 16:10:57 +0000 | +------------------------------------------------------------------------------+ Arch check ok (amd64 included in all) +------------------------------------------------------------------------------+ | Build environment Sat, 11 Jul 2026 16:10:57 +0000 | +------------------------------------------------------------------------------+ Kernel: Linux 7.0.10+deb14-amd64 #1 SMP PREEMPT_DYNAMIC Debian 7.0.10-1 (2026-05-27) amd64 (x86_64) Toolchain package versions: binutils_2.46.50.20260617-1 dpkg-dev_1.23.7 g++-15_15.3.0-1 gcc-15_15.3.0-1 libc6-dev_2.42-17 libstdc++-15-dev_15.3.0-1 libstdc++6_16.1.0-2 linux-libc-dev_7.1.3-1 Package versions: apt_3.3.1 autoconf_2.73-2 automake_1:1.18.1-4 autopoint_1.0-3 autotools-dev_20240727.1+nmu1 base-files_14.2 base-passwd_3.6.8 bash_5.3-3 binutils_2.46.50.20260617-1 binutils-common_2.46.50.20260617-1 binutils-x86-64-linux-gnu_2.46.50.20260617-1 bsdextrautils_2.42.2-1 build-essential_12.12 bzip2_1.0.8-6+b2 ca-certificates_20260601 coreutils_9.10-1 cpp_4:15.2.0-5+b1 cpp-15_15.3.0-1 cpp-15-x86-64-linux-gnu_15.3.0-1 cpp-x86-64-linux-gnu_4:15.2.0-5+b1 dash_0.5.12-12 debconf_1.5.92 debhelper_14.3 debian-archive-keyring_2025.1 debianutils_5.23.2 dh-autoreconf_22 dh-strip-nondeterminism_1.15.1-1 diffutils_1:3.12-1 dirmngr_2.4.9-5 dpkg_1.23.7 dpkg-dev_1.23.7 dwz_0.16-4 eatmydata_131-2 file_1:5.47-4 findutils_4.10.0-4 fontconfig_2.17.1-5 fontconfig-config_2.17.1-5 fonts-dejavu-core_2.37-9 fonts-dejavu-mono_2.37-9 g++_4:15.2.0-5+b1 g++-15_15.3.0-1 g++-15-x86-64-linux-gnu_15.3.0-1 g++-x86-64-linux-gnu_4:15.2.0-5+b1 gcc_4:15.2.0-5+b1 gcc-15_15.3.0-1 gcc-15-base_15.3.0-1 gcc-15-x86-64-linux-gnu_15.3.0-1 gcc-16-base_16.1.0-2 gcc-x86-64-linux-gnu_4:15.2.0-5+b1 gettext_1.0-3 gettext-base_1.0-3 gnupg_2.4.9-5 gnupg-l10n_2.4.9-5 gpg_2.4.9-5 gpg-agent_2.4.9-5 gpgconf_2.4.9-5 gpgsm_2.4.9-5 graphviz_14.1.2-1+b3 graphviz-tools_14.1.2-1+b3 grep_3.12-1 groff-base_1.24.1-1 gzip_1.13-1 hostname_3.25 init-system-helpers_1.69 intltool-debian_0.35.0+20060710.6 libabsl20260107_20260107.0-5 libace-perl_1.92-14+b1 libacl1_2.4.0-1 libalgorithm-diff-perl_1.201-1 libalgorithm-munkres-perl_0.08-5 libann0_1.1.2+doc-9+b1 libaom3_3.13.1-2+b1 libapt-pkg7.0_3.3.1 libarchive-zip-perl_1.68-1 libarray-compare-perl_3.0.8-1 libasan8_16.1.0-2 libassuan9_3.0.2-2+b2 libatomic1_16.1.0-2 libattr1_1:2.6.0-1 libaudit-common_1:4.1.2-1 libaudit1_1:4.1.2-1+b1 libavif16_1.4.2-1 libb-hooks-op-check-perl_0.22-3+b5 libb2-1_0.98.1-1.1+b3 libbinutils_2.46.50.20260617-1 libbio-alignio-stockholm-perl_1.7.3-2 libbio-asn1-entrezgene-perl_1.730-3 libbio-cluster-perl_1.7.3-6 libbio-perl-perl_1.7.8-4 libbio-samtools-perl_1.43-5+b2 libbio-variation-perl_1.7.5-3 libblkid1_2.42.2-1 libbrotli1_1.2.0-3 libbsd0_0.12.2-3 libbz2-1.0_1.0.8-6+b2 libc-bin_2.42-17 libc-dev-bin_2.42-17 libc-gconv-modules-extra_2.42-17 libc6_2.42-17 libc6-dev_2.42-17 libcache-cache-perl_1.08-3 libcairo2_1.18.4-3+b1 libcap-ng0_0.9.3-1+b1 libcapture-tiny-perl_0.50-1 libcc1-0_16.1.0-2 libcdt6_14.1.2-1+b3 libcgi-pm-perl_4.72-1 libcgraph8_14.1.2-1+b3 libclass-data-inheritable-perl_0.10-1 libclass-inspector-perl_1.36-3 libclass-method-modifiers-perl_2.15-1 libclass-unload-perl_0.12-1 libclass-xsaccessor-perl_1.19-4+b6 libclone-perl_0.50-1+b1 libcom-err2_1.47.4-1 libconvert-binary-c-perl_0.86-1+b1 libconvert-binhex-perl_1.125-3 libcrypt-rc4-perl_2.02-5 libcrypt1_1:4.5.1-1+b1 libctf-nobfd0_2.46.50.20260617-1 libctf0_2.46.50.20260617-1 libdata-stag-perl_0.14-4 libdatrie1_0.2.14-2 libdav1d7_1.5.3-1+b2 libdb5.3t64_5.3.28+dfsg2-11+b1 libdbd-mysql-perl_4.055-1+b1 libdbd-pg-perl_3.20.2-1+b1 libdbd-sqlite3-perl_1.78-1+b2 libdbi-perl_1.650-1+b1 libdbus-1-3_1.16.2-5+b1 libde265-0_1.1.1-1 libdebconfclient0_0.283 libdebhelper-perl_14.3 libdeflate0_1.25-1 libdevel-callchecker-perl_0.009-3+b1 libdevel-cycle-perl_1.12-2 libdevel-stacktrace-perl_2.0500-1 libdigest-perl-md5-perl_1.91-1 libdouble-conversion3_3.4.0-1+b1 libdpkg-perl_1.23.7 libdrm-amdgpu1_2.4.134-3 libdrm-common_2.4.134-3 libdrm-intel1_2.4.134-3 libdrm2_2.4.134-3 libdynaloader-functions-perl_0.004-2 libeatmydata1_131-2+b2 libedit2_3.1-20260512-1 libegl-mesa0_26.1.4-1 libegl1_1.7.0-3+b1 libelf1t64_0.195-1 libencode-locale-perl_1.05-3 liberror-perl_0.17030-1 libevdev2_1.13.6+dfsg-3 libexception-class-perl_1.45-1 libexpat1_2.8.2-1 libexporter-tiny-perl_1.006003-1 libfcgi-perl_0.82+ds-3+b3 libfcgi0t64_2.4.5-0.1+b2 libffi8_3.5.2-4 libfile-listing-perl_6.16-1 libfile-slurper-perl_0.014-1 libfile-stripnondeterminism-perl_1.15.1-1 libfontconfig1_2.17.1-5 libfreetype6_2.14.3+dfsg-1 libfribidi0_1.0.16-5+b1 libgav1-2_0.20.0-2+b1 libgbm1_26.1.4-1 libgcc-15-dev_15.3.0-1 libgcc-s1_16.1.0-2 libgcrypt20_1.12.2-1 libgd3_2.3.3-13+b2 libgdbm-compat4t64_1.26-1+b2 libgdbm6t64_1.26-1+b2 libgl1-mesa-dri_26.1.4-1 libglib2.0-0t64_2.88.2-1 libglvnd0_1.7.0-3+b1 libglx-mesa0_26.1.4-1 libglx0_1.7.0-3+b1 libgmp10_2:6.3.0+dfsg-5+b2 libgnutls30t64_3.8.13-1 libgomp1_16.1.0-2 libgpg-error0_1.61-3 libgprofng0_2.46.50.20260617-1 libgraph-perl_1:0.9735-1 libgraphite2-3_1.3.15-2 libgraphviz-perl_2.26-1 libgssapi-krb5-2_1.22.1-3 libgts-0.7-5t64_0.7.6+darcs121130-5.2+b2 libgudev-1.0-0_238-7+b2 libgvc7_14.1.2-1+b3 libgvplugin-gd8_14.1.2-1+b3 libgvplugin-neato-layout8_14.1.2-1+b3 libgvplugin-pango8_14.1.2-1+b3 libgvpr2_14.1.2-1+b3 libharfbuzz0b_12.3.2-2+b2 libheap-perl_0.80-5 libheif-plugin-dav1d_1.23.1-1 libheif-plugin-libde265_1.23.1-1 libheif1_1.23.1-1 libhogweed6t64_3.10.2-1+b1 libhtml-parser-perl_3.83-2+b1 libhtml-tableextract-perl_2.15-2 libhtml-tagset-perl_3.24-1 libhtml-tree-perl_5.07-3 libhttp-cookies-perl_6.11-1 libhttp-daemon-perl_6.17-1 libhttp-date-perl_6.08-1 libhttp-message-perl_7.02-1 libhttp-negotiate-perl_6.01-2 libhwasan0_16.1.0-2 libice6_2:1.1.1-1+b2 libicu78_78.3-2 libidn2-0_2.3.8-5 libimagequant0_4.4.1-1+b2 libimport-into-perl_1.002005-2 libinput-bin_1.31.3-1 libinput10_1.31.3-1 libio-html-perl_1.004-3 libio-pty-perl_1:1.31-1+b1 libio-sessiondata-perl_1.03-3 libio-socket-ssl-perl_2.099-1 libio-string-perl_1.08-4 libio-stringy-perl_2.113-2 libipc-run-perl_20260402.0-1 libipc-sharelite-perl_0.17-5+b4 libisl23_0.27-2 libitm1_16.1.0-2 libjansson4_2.15.1-1 libjbig0_2.1-6.1+b3 libjcode-pm-perl_2.07-1 libjpeg62-turbo_1:3.1.3-4 libk5crypto3_1.22.1-3 libkeyutils1_1.6.3-6+b2 libkrb5-3_1.22.1-3 libkrb5support0_1.22.1-3 libksba8_1.8.0-3 libldap2_2.6.13+dfsg-1+b1 liblerc4_4.1.1+ds-1 liblist-moreutils-perl_0.430-2 liblist-moreutils-xs-perl_0.430-4+b3 libllvm21_1:21.1.8-7+b4 liblsan0_16.1.0-2 libltdl7_2.5.4-11 liblwp-mediatypes-perl_6.04-2 liblwp-protocol-https-perl_6.15-1 liblz4-1_1.10.0-10 liblzma5_5.8.3-1 libmagic-mgc_1:5.47-4 libmagic1t64_1:5.47-4 libmailtools-perl_2.22-1 libmariadb3_1:11.8.8-1 libmath-derivative-perl_1.01-3 libmath-spline-perl_0.02-4 libmd0_1.2.0-2 libmd4c0_0.5.3-1 libmime-tools-perl_5.517-1 libmodule-build-perl_0.423400-3 libmodule-runtime-perl_0.018-1 libmoo-perl_2.005005-1 libmount1_2.42.2-1 libmpc3_1.3.1-3 libmpfr6_4.2.2-3 libmtdev1t64_1.1.7-1+b2 libncursesw6_6.6+20260608-2 libnet-http-perl_6.24-1 libnet-smtp-ssl-perl_1.04-2 libnet-ssleay-perl_1.96-1+b1 libnettle8t64_3.10.2-1+b1 libnpth0t64_1.8-3+b2 libole-storage-lite-perl_0.24-1 libopengl0_1.7.0-3+b1 libp11-kit0_0.26.2-3 libpadwalker-perl_2.5-1+b7 libpam-modules_1.7.0-8 libpam-modules-bin_1.7.0-8 libpam-runtime_1.7.0-8 libpam0g_1.7.0-8 libpango-1.0-0_1.58.0-1 libpangocairo-1.0-0_1.58.0-1 libpangoft2-1.0-0_1.58.0-1 libparams-classify-perl_0.015-2+b6 libparse-recdescent-perl_1.967015+dfsg-4 libpath-class-perl_0.37-4 libpathplan4_14.1.2-1+b3 libpciaccess0_0.19-2 libpcre2-16-0_10.46-1+b2 libpcre2-8-0_10.46-1+b2 libperl5.40_5.40.1-8 libperl5.44_5.44.0~rc2-1 libperlio-eol-perl_0.19-1+b4 libpipeline1_1.5.8-3 libpixman-1-0_0.46.4-1+b2 libpng16-16t64_1.6.58-1 libpostscript-perl_0.06-3.1 libpq5_18.4-1+b2 libproc2-1_2:4.0.6-2 libqt6core6t64_6.10.2+dfsg-15 libqt6dbus6_6.10.2+dfsg-15 libqt6gui6_6.10.2+dfsg-15 libqt6widgets6_6.10.2+dfsg-15 libquadmath0_16.1.0-2 librav1e0.8_0.8.1-10 libreadline8t64_8.3-4 librole-tiny-perl_2.002005-1 libsasl2-2_2.1.28+dfsg1-11 libsasl2-modules-db_2.1.28+dfsg1-11 libseccomp2_2.6.1-1 libselinux1_3.11-2 libsensors-config_1:3.6.2-2 libsensors5_1:3.6.2-2+b2 libset-object-perl_1.43-1+b1 libset-scalar-perl_1.29-3 libsframe3_2.46.50.20260617-1 libsharpyuv0_1.5.0-0.1+b2 libsm6_2:1.2.6-1+b2 libsmartcols1_2.42.2-1 libsoap-lite-perl_1.27-3 libsort-naturally-perl_1.03-4 libspreadsheet-parseexcel-perl_0.6600-1 libspreadsheet-writeexcel-perl_2.40-4 libsqlite3-0_3.53.3-1 libssl3t64_3.6.3-1 libstatistics-descriptive-perl_3.0801-1 libstdc++-15-dev_15.3.0-1 libstdc++6_16.1.0-2 libsub-quote-perl_2.006009-1 libsub-uplevel-perl_0.2800-3 libsvg-graph-perl_0.02-4 libsvg-perl_2.89-1 libsvtav1enc4_4.1.0+dfsg-1 libsystemd-shared_261.1-2 libsystemd0_261.1-2 libtask-weaken-perl_1.06-2 libtasn1-6_4.21.0-2+b1 libtest-deep-perl_1.205-1 libtest-differences-perl_0.72-1 libtest-exception-perl_0.43-3 libtest-memory-cycle-perl_1.06-2 libtest-most-perl_0.42-1 libtest-pod-perl_1.52-3 libtest-requiresinternet-perl_0.05-4 libtest-warn-perl_0.37-2 libtest-weaken-perl_3.022000-2 libtext-charwidth-perl_0.04-12+b1 libtext-diff-perl_1.45-2 libtext-wrapi18n-perl_0.06-11 libthai-data_0.1.30-2 libthai0_0.1.30-2 libtiff6_4.7.2-1 libtimedate-perl_2.3500-1 libtinfo6_6.6+20260608-2 libtool_2.5.4-11 libtree-dagnode-perl_1.37-1 libtry-tiny-perl_0.32-1 libts0t64_1.22-1.1+b2 libtsan2_16.1.0-2 libtss2-esys-3.0.2-0t64_4.1.3-6 libtss2-mu-4.0.1-0t64_4.1.3-6 libtss2-rc0t64_4.1.3-6 libtss2-sys1t64_4.1.3-6 libtss2-tcti-cmd0t64_4.1.3-6 libtss2-tcti-device0t64_4.1.3-6 libtss2-tcti-mssim0t64_4.1.3-6 libtss2-tcti-swtpm0t64_4.1.3-6 libtype-tiny-perl_2.010001-1 libubsan1_16.1.0-2 libuchardet0_0.0.8-2+b2 libudev1_261.1-2 libunicode-map-perl_0.112-13+b6 libunistring5_1.4.2-1 liburi-perl_5.35-1 libuuid1_2.42.2-1 libvulkan1_1.4.341.0-1 libwacom-common_2.18.0-1 libwacom9_2.18.0-1 libwayland-client0_1.25.0-2 libwebp7_1.5.0-0.1+b2 libwww-perl_6.83-1 libwww-robotrules-perl_6.03-1 libx11-6_2:1.8.13-1 libx11-data_2:1.8.13-1 libx11-xcb1_2:1.8.13-1 libxau6_1:1.0.11-1+b2 libxcb-cursor0_0.1.6-1 libxcb-dri3-0_1.17.0-2+b2 libxcb-glx0_1.17.0-2+b2 libxcb-icccm4_0.4.2-1+b2 libxcb-image0_0.4.0-2+b3 libxcb-keysyms1_0.4.1-1+b2 libxcb-present0_1.17.0-2+b2 libxcb-randr0_1.17.0-2+b2 libxcb-render-util0_0.3.10-1+b2 libxcb-render0_1.17.0-2+b2 libxcb-shape0_1.17.0-2+b2 libxcb-shm0_1.17.0-2+b2 libxcb-sync1_1.17.0-2+b2 libxcb-util1_0.4.1-1+b2 libxcb-xfixes0_1.17.0-2+b2 libxcb-xinput0_1.17.0-2+b2 libxcb-xkb1_1.17.0-2+b2 libxcb1_1.17.0-2+b2 libxdmcp6_1:1.1.5-2+b1 libxdot4_14.1.2-1+b3 libxext6_2:1.3.4-1+b4 libxkbcommon-x11-0_1.13.1-1 libxkbcommon0_1.13.1-1 libxml-dom-perl_1.46-2 libxml-dom-xpath-perl_0.14-4 libxml-filter-buffertext-perl_1.01-7 libxml-libxml-perl_2.0207+dfsg+really+2.0134-8+b1 libxml-namespacesupport-perl_1.12-2 libxml-parser-perl_2.47-2+b1 libxml-perl_0.08-4 libxml-regexp-perl_0.04-2 libxml-sax-base-perl_1.09-3 libxml-sax-expatxs-perl_1.33-3+b5 libxml-sax-perl_1.02+dfsg-5 libxml-sax-writer-perl_0.57-3 libxml-simple-perl_2.25-2 libxml-twig-perl_1:3.54-1 libxml-writer-perl_0.900-2 libxml-xpath-perl_1.49-1 libxml-xpathengine-perl_0.14-2 libxml2-16_2.15.3+dfsg-1 libxpm4_1:3.5.19-1 libxrender1_1:0.9.12-1+b2 libxshmfence1_1.3.3-1+b2 libxxf86vm1_1:1.1.4-2+b1 libxxhash0_0.8.3-2+b2 libyaml-perl_1.31-1 libyuv0_0.0.1949.20260706-1 libz3-4_4.13.3-1.1 libzstd1_1.5.7+dfsg-3+b2 linux-libc-dev_7.1.3-1 m4_1.4.21-1 make_4.4.1-3 man-db_2.13.1-1 mariadb-common_1:11.8.8-1 mawk_1.3.4.20260302-1 mesa-libgallium_26.1.4-1 mount_2.42.2-1 mysql-common_5.8+1.1.1 ncurses-base_6.6+20260608-2 ncurses-bin_6.6+20260608-2 netbase_6.5 openssl_3.6.3-1 openssl-provider-legacy_3.6.3-1 patch_2.8-2 pci.ids_0.0~2026.07.06-1 perl_5.44.0~rc2-1 perl-base_5.44.0~rc2-1 perl-modules-5.40_5.40.1-8 perl-modules-5.44_5.44.0~rc2-1 perl-openssl-defaults_7+b2 pinentry-curses_1.3.2-4 po-debconf_1.0.22 procps_2:4.0.6-2 readline-common_8.3-4 rename_2.02-2 rpcsvc-proto_1.4.4-1 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-3 sensible-utils_0.0.26 shared-mime-info_2.4-5+b3 sqv_1.4.0-1 systemd_261.1-2 systemd-tpm_261.1-2 sysvinit-utils_3.18-1 tar_1.35+dfsg-4 tpm-udev_4.1.3-6 ucf_3.0056 util-linux_2.42.2-1 x11-common_1:7.7+26 xkb-data_2.47-1 xz-utils_5.8.3-1 zlib1g_1:1.3.dfsg+really1.3.2-3 +------------------------------------------------------------------------------+ | Build Sat, 11 Jul 2026 16:10:57 +0000 | +------------------------------------------------------------------------------+ Unpack source ------------- -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: bioperl Binary: bioperl, libbio-perl-perl Architecture: all Version: 1.7.8-4 Maintainer: Debian Med Packaging Team Uploaders: Charles Plessy , Steffen Moeller , Andreas Tille , Olivier Sallou , Étienne Mollier Homepage: http://www.bioperl.org/ Standards-Version: 4.7.4 Vcs-Browser: https://salsa.debian.org/med-team/bioperl Vcs-Git: https://salsa.debian.org/med-team/bioperl.git Testsuite: autopkgtest-pkg-perl Build-Depends: debhelper-compat (= 13), libmodule-build-perl Build-Depends-Indep: perl, rename, libio-string-perl, libdata-stag-perl, libtest-most-perl, libbio-alignio-stockholm-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libbio-samtools-perl, libclass-unload-perl, libcgi-pm-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpath-class-perl, libperlio-eol-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, libtest-differences-perl, libtest-exception-perl, libtest-memory-cycle-perl, libtest-pod-perl, libtest-weaken-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-twig-perl, libxml-simple-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl, libyaml-perl, libtest-requiresinternet-perl, libxml-sax-expatxs-perl Package-List: bioperl deb science optional arch=all libbio-perl-perl deb perl optional arch=all Checksums-Sha1: f8997b7a920c1dbb58936e63ba994b62b8794114 7527658 bioperl_1.7.8.orig.tar.gz 81605d15ceb72ac662363236696a4dd3cb2c06e3 13504 bioperl_1.7.8-4.debian.tar.xz Checksums-Sha256: c490a3be7715ea6e4305efd9710e5edab82dabc55fd786b6505b550a30d71738 7527658 bioperl_1.7.8.orig.tar.gz 73e2081569c512d55a3d148d450ff6a7b8645619fec20956b478a5924a00e2d2 13504 bioperl_1.7.8-4.debian.tar.xz Files: 8164ac52f37bc6355ec1b69633ac795f 7527658 bioperl_1.7.8.orig.tar.gz 5871051d9aade24952c96fd4aa54fd32 13504 bioperl_1.7.8-4.debian.tar.xz Dgit: 875f343f7e14dda57197b2bd39ae2d9f0f00fc59 debian archive/debian/1.7.8-4 https://git.dgit.debian.org/bioperl -----BEGIN PGP SIGNATURE----- iQJIBAEBCgAyFiEEj5GyJ8fW8rGUjII2eTz2fo8NEdoFAmo4UVwUHGVtb2xsaWVy QGRlYmlhbi5vcmcACgkQeTz2fo8NEdqPdxAAqNaQPjXWNR/+gv5kQTLyTVUjw39F cERkqYmYvpuT+PkSdu+Cvw4iF65cbZxBSaEq74dxIDCngnYnpx1BmszAiaZxbswx p6VyoeHdmSHfwPH29jmRDn+P7bsq5JTOiTpiLjoez32twEP5Ta6x+2+T3sf0r5Dz UtnCEEyxuZx7onjXSmI8gVZjiejw0pmLRPwXOc0xz1Q/F09XqN62HhD2eHiD0H1D +0zzGP0ZTrR+6Ouefr7eZQjU/C0+0FehFRzAKm+ul8VE6MKuUrKBQcCCp1NuHO5g BSJvCQr+WomN7L8fIfA4EZTSg6he5VQiP+IBT4MqguGrVns0nNKKOSUaZzREXOwH ExUPOksERATv0OdxvKbaE63fBxk/mdRXjEeRVKxIFQ6tkxklFXUjtkuIPVLQRI5/ axI8uVgAdBI5evelzZuKi6OH/yhYGripC1ERLNtHtnMK6ZwvN1GdDd4K8yvAP0Dp QAPt1cQWBQ8MitLQ6OJgKpewsuOkNrQAzv83mbVo3YxarYp69oGJEQ7QSsfBVx5T L4Fs7KCaFsi9WAJR+LlL/s0BdtXjJBD2uHWZj7p/QsvwJeV2qwCqMaYqUkXBNOV5 RyEjK4lwcvWf1kKhGkAU4/vjbli4ZDQOOTPe3mdkKEG9UUPDyPmr8eCACtX7Vmqz PL4WQ+8Y6EfCcEQ= =euTk -----END PGP SIGNATURE----- dpkg-source: warning: cannot verify inline signature for ./bioperl_1.7.8-4.dsc: missing OpenPGP keyrings dpkg-source: info: verifying ./bioperl_1.7.8-4.dsc dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-keyring.pgp dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-tag2upload.pgp dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-nonupload.pgp dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-maintainers.pgp dpkg-source: info: extracting bioperl in /build/bioperl-QLxev6/bioperl-1.7.8 dpkg-source: info: unpacking bioperl_1.7.8.orig.tar.gz dpkg-source: info: unpacking bioperl_1.7.8-4.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-fix-error-popping-up-with-latest-perl-releases-a80e8a655a953301f71538f9088a613eb63d5a73.patch dpkg-source: info: applying 0001-fix-error-popping-up-with-latest-perl-releases-01ba1a675c80e7f8b77e05be9055d1208f246083.patch dpkg-source: info: applying perl-5.42-precedence.patch dpkg-source: info: applying fix-missing-Test-modules.patch clean up apt cache ------------------ Check disk space ---------------- Sufficient free space for build +------------------------------------------------------------------------------+ | Starting Time Build Commands Sat, 11 Jul 2026 16:10:58 +0000 | +------------------------------------------------------------------------------+ /usr/share/debomatic/sbuildcommands/starting-build-commands/no-network bioperl_1.7.8-4 perl-5.44-throwaway amd64 ---------------------------------------------------------------------------------------------------------------- I: Finished running '/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network bioperl_1.7.8-4 perl-5.44-throwaway amd64'. Finished processing commands. -------------------------------------------------------------------------------- User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf HOME=/sbuild-nonexistent LANGUAGE=en_GB:en LC_ALL=C.UTF-8 LD_LIBRARY_PATH=/usr/lib/libeatmydata LD_PRELOAD=libeatmydata.so LOGNAME=debomatic PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games PWD=/build/bioperl-QLxev6/bioperl-1.7.8 SCHROOT_ALIAS_NAME=perl-5.44-throwaway-amd64-debomatic SCHROOT_CHROOT_NAME=perl-5.44-amd64-debomatic SCHROOT_COMMAND=env SCHROOT_GID=110 SCHROOT_GROUP=sbuild SCHROOT_SESSION_ID=perl-5.44-amd64-debomatic-93bb26a3-a999-45db-be90-d957100b556a SCHROOT_UID=1002 SCHROOT_USER=debomatic SHELL=/bin/sh USER=debomatic dpkg-buildpackage ----------------- Command: dpkg-buildpackage --sanitize-env -us -uc -Zxz dpkg-buildpackage: info: source package bioperl dpkg-buildpackage: info: source version 1.7.8-4 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Étienne Mollier dpkg-source -Zxz --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_clean dpkg-source -Zxz -b . dpkg-source: info: using source format '3.0 (quilt)' dpkg-source: info: building bioperl using existing ../bioperl_1.7.8.orig.tar.gz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: building bioperl in ../bioperl_1.7.8-4.debian.tar.xz dpkg-source: info: building bioperl in ../bioperl_1.7.8-4.dsc debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/bioperl-QLxev6/bioperl-1.7.8' dh_auto_configure -- /usr/bin/perl Makefile.PL INSTALLDIRS=vendor OPTIMIZE="-g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/bioperl-QLxev6/bioperl-1.7.8=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2" LD="x86_64-linux-gnu-gcc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/bioperl-QLxev6/bioperl-1.7.8=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wl,-z,relro" Checking if your kit is complete... Looks good Generating a Unix-style Makefile Writing Makefile for BioPerl Writing MYMETA.yml and MYMETA.json make[1]: Leaving directory '/build/bioperl-QLxev6/bioperl-1.7.8' dh_auto_build make -j2 make[1]: Entering directory '/build/bioperl-QLxev6/bioperl-1.7.8' cp lib/Bio/AlignIO/bl2seq.pm blib/lib/Bio/AlignIO/bl2seq.pm cp lib/Bio/AnalysisI.pm blib/lib/Bio/AnalysisI.pm cp lib/Bio/Align/StatisticsI.pm blib/lib/Bio/Align/StatisticsI.pm cp lib/Bio/AlignIO/psi.pm blib/lib/Bio/AlignIO/psi.pm cp lib/Bio/AlignIO/maf.pm blib/lib/Bio/AlignIO/maf.pm cp lib/Bio/AlignIO/mega.pm blib/lib/Bio/AlignIO/mega.pm cp lib/Bio/AlignIO/selex.pm blib/lib/Bio/AlignIO/selex.pm cp lib/Bio/AlignIO/meme.pm blib/lib/Bio/AlignIO/meme.pm cp lib/Bio/AnalysisResultI.pm blib/lib/Bio/AnalysisResultI.pm cp lib/Bio/Align/ProteinStatistics.pm blib/lib/Bio/Align/ProteinStatistics.pm cp lib/Bio/Align/AlignI.pm blib/lib/Bio/Align/AlignI.pm cp lib/Bio/AlignIO.pm blib/lib/Bio/AlignIO.pm cp lib/Bio/AlignIO/po.pm blib/lib/Bio/AlignIO/po.pm cp lib/Bio/AlignIO/Handler/GenericAlignHandler.pm blib/lib/Bio/AlignIO/Handler/GenericAlignHandler.pm cp lib/Bio/AnalysisParserI.pm blib/lib/Bio/AnalysisParserI.pm cp lib/Bio/Annotation/AnnotationFactory.pm blib/lib/Bio/Annotation/AnnotationFactory.pm cp lib/Bio/AlignIO/xmfa.pm blib/lib/Bio/AlignIO/xmfa.pm cp lib/Bio/AlignIO/msf.pm blib/lib/Bio/AlignIO/msf.pm cp lib/Bio/AlignIO/nexus.pm blib/lib/Bio/AlignIO/nexus.pm cp lib/Bio/AlignIO/clustalw.pm blib/lib/Bio/AlignIO/clustalw.pm cp lib/Bio/AlignIO/phylip.pm blib/lib/Bio/AlignIO/phylip.pm cp lib/Bio/AlignIO/arp.pm blib/lib/Bio/AlignIO/arp.pm cp lib/Bio/AlignIO/largemultifasta.pm blib/lib/Bio/AlignIO/largemultifasta.pm cp lib/Bio/Annotation/Comment.pm blib/lib/Bio/Annotation/Comment.pm cp lib/Bio/AlignIO/prodom.pm blib/lib/Bio/AlignIO/prodom.pm cp lib/Bio/Align/DNAStatistics.pm blib/lib/Bio/Align/DNAStatistics.pm cp lib/Bio/AnnotatableI.pm blib/lib/Bio/AnnotatableI.pm cp lib/Bio/AlignIO/metafasta.pm blib/lib/Bio/AlignIO/metafasta.pm cp lib/Bio/Align/Utilities.pm blib/lib/Bio/Align/Utilities.pm cp lib/Bio/Annotation/Collection.pm blib/lib/Bio/Annotation/Collection.pm cp lib/Bio/AlignIO/emboss.pm blib/lib/Bio/AlignIO/emboss.pm cp lib/Bio/AlignIO/fasta.pm blib/lib/Bio/AlignIO/fasta.pm cp lib/Bio/AlignIO/mase.pm blib/lib/Bio/AlignIO/mase.pm cp lib/Bio/AlignIO/pfam.pm blib/lib/Bio/AlignIO/pfam.pm cp lib/Bio/Align/PairwiseStatistics.pm blib/lib/Bio/Align/PairwiseStatistics.pm cp lib/Bio/AlignIO/proda.pm blib/lib/Bio/AlignIO/proda.pm cp lib/Bio/DB/Flat/BDB/embl.pm blib/lib/Bio/DB/Flat/BDB/embl.pm cp lib/Bio/DB/Flat.pm blib/lib/Bio/DB/Flat.pm cp lib/Bio/DB/QueryI.pm blib/lib/Bio/DB/QueryI.pm cp lib/Bio/DB/Failover.pm blib/lib/Bio/DB/Failover.pm cp lib/Bio/DB/Flat/BDB/genbank.pm blib/lib/Bio/DB/Flat/BDB/genbank.pm cp lib/Bio/Annotation/Reference.pm blib/lib/Bio/Annotation/Reference.pm cp lib/Bio/DB/Fasta.pm blib/lib/Bio/DB/Fasta.pm cp lib/Bio/Annotation/Target.pm blib/lib/Bio/Annotation/Target.pm cp lib/Bio/CodonUsage/Table.pm blib/lib/Bio/CodonUsage/Table.pm cp lib/Bio/DB/IndexedBase.pm blib/lib/Bio/DB/IndexedBase.pm cp lib/Bio/AnnotationI.pm blib/lib/Bio/AnnotationI.pm cp lib/Bio/DB/Flat/BDB.pm blib/lib/Bio/DB/Flat/BDB.pm cp lib/Bio/CodonUsage/IO.pm blib/lib/Bio/CodonUsage/IO.pm cp lib/Bio/DB/Flat/BDB/fasta.pm blib/lib/Bio/DB/Flat/BDB/fasta.pm cp lib/Bio/DB/GFF/Util/Binning.pm blib/lib/Bio/DB/GFF/Util/Binning.pm cp lib/Bio/Annotation/TagTree.pm blib/lib/Bio/Annotation/TagTree.pm cp lib/Bio/DB/Qual.pm blib/lib/Bio/DB/Qual.pm cp lib/Bio/DB/InMemoryCache.pm blib/lib/Bio/DB/InMemoryCache.pm cp lib/Bio/DB/Flat/BDB/swiss.pm blib/lib/Bio/DB/Flat/BDB/swiss.pm cp lib/Bio/DB/GFF/Util/Rearrange.pm blib/lib/Bio/DB/GFF/Util/Rearrange.pm cp lib/Bio/DB/RandomAccessI.pm blib/lib/Bio/DB/RandomAccessI.pm cp lib/Bio/DB/FileCache.pm blib/lib/Bio/DB/FileCache.pm cp lib/Bio/DB/Query/WebQuery.pm blib/lib/Bio/DB/Query/WebQuery.pm cp lib/Bio/DB/Flat/BinarySearch.pm blib/lib/Bio/DB/Flat/BinarySearch.pm cp lib/Bio/Annotation/OntologyTerm.pm blib/lib/Bio/Annotation/OntologyTerm.pm cp lib/Bio/Annotation/SimpleValue.pm blib/lib/Bio/Annotation/SimpleValue.pm cp lib/Bio/Annotation/Relation.pm blib/lib/Bio/Annotation/Relation.pm cp lib/Bio/AnnotationCollectionI.pm blib/lib/Bio/AnnotationCollectionI.pm cp lib/Bio/DB/ReferenceI.pm blib/lib/Bio/DB/ReferenceI.pm cp lib/Bio/Annotation/TypeManager.pm blib/lib/Bio/Annotation/TypeManager.pm cp lib/Bio/DB/GenericWebAgent.pm blib/lib/Bio/DB/GenericWebAgent.pm cp lib/Bio/DB/DBFetch.pm blib/lib/Bio/DB/DBFetch.pm cp lib/Bio/Annotation/Tree.pm blib/lib/Bio/Annotation/Tree.pm cp lib/Bio/Annotation/StructuredValue.pm blib/lib/Bio/Annotation/StructuredValue.pm cp lib/Bio/Annotation/DBLink.pm blib/lib/Bio/Annotation/DBLink.pm cp lib/Bio/DB/LocationI.pm blib/lib/Bio/DB/LocationI.pm cp lib/Bio/DB/Taxonomy/flatfile.pm blib/lib/Bio/DB/Taxonomy/flatfile.pm cp lib/Bio/Factory/ObjectFactoryI.pm blib/lib/Bio/Factory/ObjectFactoryI.pm cp lib/Bio/DB/SeqI.pm blib/lib/Bio/DB/SeqI.pm cp lib/Bio/DB/WebDBSeqI.pm blib/lib/Bio/DB/WebDBSeqI.pm cp lib/Bio/DB/UpdateableSeqI.pm blib/lib/Bio/DB/UpdateableSeqI.pm cp lib/Bio/Factory/ObjectBuilderI.pm blib/lib/Bio/Factory/ObjectBuilderI.pm cp lib/Bio/Event/EventGeneratorI.pm blib/lib/Bio/Event/EventGeneratorI.pm cp lib/Bio/DBLinkContainerI.pm blib/lib/Bio/DBLinkContainerI.pm cp lib/Bio/Factory/SeqAnalysisParserFactoryI.pm blib/lib/Bio/Factory/SeqAnalysisParserFactoryI.pm cp lib/Bio/Factory/DriverFactory.pm blib/lib/Bio/Factory/DriverFactory.pm cp lib/Bio/Das/SegmentI.pm blib/lib/Bio/Das/SegmentI.pm cp lib/Bio/IdCollectionI.pm blib/lib/Bio/IdCollectionI.pm cp lib/Bio/Factory/SequenceProcessorI.pm blib/lib/Bio/Factory/SequenceProcessorI.pm cp lib/Bio/DasI.pm blib/lib/Bio/DasI.pm cp lib/Bio/Das/FeatureTypeI.pm blib/lib/Bio/Das/FeatureTypeI.pm cp lib/Bio/DB/Taxonomy/silva.pm blib/lib/Bio/DB/Taxonomy/silva.pm cp lib/Bio/Factory/SequenceFactoryI.pm blib/lib/Bio/Factory/SequenceFactoryI.pm cp lib/Bio/Factory/ObjectFactory.pm blib/lib/Bio/Factory/ObjectFactory.pm cp lib/Bio/DB/Taxonomy/list.pm blib/lib/Bio/DB/Taxonomy/list.pm cp lib/Bio/Factory/ApplicationFactoryI.pm blib/lib/Bio/Factory/ApplicationFactoryI.pm cp lib/Bio/DB/Taxonomy.pm blib/lib/Bio/DB/Taxonomy.pm cp lib/Bio/Factory/FTLocationFactory.pm blib/lib/Bio/Factory/FTLocationFactory.pm cp lib/Bio/Factory/SequenceStreamI.pm blib/lib/Bio/Factory/SequenceStreamI.pm cp lib/Bio/Factory/AnalysisI.pm blib/lib/Bio/Factory/AnalysisI.pm cp lib/Bio/Factory/SeqAnalysisParserFactory.pm blib/lib/Bio/Factory/SeqAnalysisParserFactory.pm cp lib/Bio/DescribableI.pm blib/lib/Bio/DescribableI.pm cp lib/Bio/DB/Taxonomy/greengenes.pm blib/lib/Bio/DB/Taxonomy/greengenes.pm cp lib/Bio/Factory/LocationFactoryI.pm blib/lib/Bio/Factory/LocationFactoryI.pm cp lib/Bio/HandlerBaseI.pm blib/lib/Bio/HandlerBaseI.pm cp lib/Bio/Event/EventHandlerI.pm blib/lib/Bio/Event/EventHandlerI.pm cp lib/Bio/FeatureHolderI.pm blib/lib/Bio/FeatureHolderI.pm cp lib/Bio/DB/Registry.pm blib/lib/Bio/DB/Registry.pm cp lib/Bio/Factory/TreeFactoryI.pm blib/lib/Bio/Factory/TreeFactoryI.pm cp lib/Bio/Matrix/MatrixI.pm blib/lib/Bio/Matrix/MatrixI.pm cp lib/Bio/Location/CoordinatePolicyI.pm blib/lib/Bio/Location/CoordinatePolicyI.pm cp lib/Bio/Location/NarrowestCoordPolicy.pm blib/lib/Bio/Location/NarrowestCoordPolicy.pm cp lib/Bio/Matrix/IO/mlagan.pm blib/lib/Bio/Matrix/IO/mlagan.pm cp lib/Bio/Location/Split.pm blib/lib/Bio/Location/Split.pm cp lib/Bio/Location/SplitLocationI.pm blib/lib/Bio/Location/SplitLocationI.pm cp lib/Bio/Matrix/IO/phylip.pm blib/lib/Bio/Matrix/IO/phylip.pm cp lib/Bio/Matrix/PSM/IO/meme.pm blib/lib/Bio/Matrix/PSM/IO/meme.pm cp lib/Bio/Index/SwissPfam.pm blib/lib/Bio/Index/SwissPfam.pm cp lib/Bio/Index/GenBank.pm blib/lib/Bio/Index/GenBank.pm cp lib/Bio/Matrix/PSM/IO.pm blib/lib/Bio/Matrix/PSM/IO.pm cp lib/Bio/Location/WidestCoordPolicy.pm blib/lib/Bio/Location/WidestCoordPolicy.pm cp lib/Bio/Location/FuzzyLocationI.pm blib/lib/Bio/Location/FuzzyLocationI.pm cp lib/Bio/Matrix/Mlagan.pm blib/lib/Bio/Matrix/Mlagan.pm cp lib/Bio/Matrix/PSM/IO/masta.pm blib/lib/Bio/Matrix/PSM/IO/masta.pm cp lib/Bio/Index/Fastq.pm blib/lib/Bio/Index/Fastq.pm cp lib/Bio/LocationI.pm blib/lib/Bio/LocationI.pm cp lib/Bio/Index/Swissprot.pm blib/lib/Bio/Index/Swissprot.pm cp lib/Bio/Index/Qual.pm blib/lib/Bio/Index/Qual.pm cp lib/Bio/IdentifiableI.pm blib/lib/Bio/IdentifiableI.pm cp lib/Bio/Location/Atomic.pm blib/lib/Bio/Location/Atomic.pm cp lib/Bio/Matrix/IO.pm blib/lib/Bio/Matrix/IO.pm cp lib/Bio/Location/Simple.pm blib/lib/Bio/Location/Simple.pm cp lib/Bio/Index/Abstract.pm blib/lib/Bio/Index/Abstract.pm cp lib/Bio/Matrix/PSM/IO/mast.pm blib/lib/Bio/Matrix/PSM/IO/mast.pm cp lib/Bio/Index/EMBL.pm blib/lib/Bio/Index/EMBL.pm cp lib/Bio/Index/BlastTable.pm blib/lib/Bio/Index/BlastTable.pm cp lib/Bio/Index/AbstractSeq.pm blib/lib/Bio/Index/AbstractSeq.pm cp lib/Bio/Matrix/Generic.pm blib/lib/Bio/Matrix/Generic.pm cp lib/Bio/Location/AvWithinCoordPolicy.pm blib/lib/Bio/Location/AvWithinCoordPolicy.pm cp lib/Bio/LocatableSeq.pm blib/lib/Bio/LocatableSeq.pm cp lib/Bio/Index/Fasta.pm blib/lib/Bio/Index/Fasta.pm cp lib/Bio/Index/Blast.pm blib/lib/Bio/Index/Blast.pm cp lib/Bio/Matrix/IO/scoring.pm blib/lib/Bio/Matrix/IO/scoring.pm cp lib/Bio/Location/Fuzzy.pm blib/lib/Bio/Location/Fuzzy.pm cp lib/Bio/Matrix/PSM/Psm.pm blib/lib/Bio/Matrix/PSM/Psm.pm cp lib/Bio/Ontology/GOterm.pm blib/lib/Bio/Ontology/GOterm.pm cp lib/Bio/Ontology/RelationshipType.pm blib/lib/Bio/Ontology/RelationshipType.pm cp lib/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm blib/lib/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm cp lib/Bio/Ontology/OBOEngine.pm blib/lib/Bio/Ontology/OBOEngine.pm cp lib/Bio/Matrix/PSM/PsmHeader.pm blib/lib/Bio/Matrix/PSM/PsmHeader.pm cp lib/Bio/Ontology/Path.pm blib/lib/Bio/Ontology/Path.pm cp lib/Bio/Ontology/RelationshipFactory.pm blib/lib/Bio/Ontology/RelationshipFactory.pm cp lib/Bio/Ontology/SimpleOntologyEngine.pm blib/lib/Bio/Ontology/SimpleOntologyEngine.pm cp lib/Bio/Ontology/InterProTerm.pm blib/lib/Bio/Ontology/InterProTerm.pm cp lib/Bio/Ontology/OBOterm.pm blib/lib/Bio/Ontology/OBOterm.pm cp lib/Bio/Matrix/PSM/ProtPsm.pm blib/lib/Bio/Matrix/PSM/ProtPsm.pm cp lib/Bio/Ontology/OntologyStore.pm blib/lib/Bio/Ontology/OntologyStore.pm cp lib/Bio/Ontology/PathI.pm blib/lib/Bio/Ontology/PathI.pm cp lib/Bio/Ontology/DocumentRegistry.pm blib/lib/Bio/Ontology/DocumentRegistry.pm cp lib/Bio/Ontology/Ontology.pm blib/lib/Bio/Ontology/Ontology.pm cp lib/Bio/Matrix/PSM/InstanceSiteI.pm blib/lib/Bio/Matrix/PSM/InstanceSiteI.pm cp lib/Bio/Matrix/PSM/SiteMatrixI.pm blib/lib/Bio/Matrix/PSM/SiteMatrixI.pm cp lib/Bio/Ontology/OntologyEngineI.pm blib/lib/Bio/Ontology/OntologyEngineI.pm cp lib/Bio/Matrix/PSM/PsmI.pm blib/lib/Bio/Matrix/PSM/PsmI.pm cp lib/Bio/Ontology/RelationshipI.pm blib/lib/Bio/Ontology/RelationshipI.pm cp lib/Bio/Ontology/OntologyI.pm blib/lib/Bio/Ontology/OntologyI.pm cp lib/Bio/Matrix/PSM/ProtMatrix.pm blib/lib/Bio/Matrix/PSM/ProtMatrix.pm cp lib/Bio/Matrix/PSM/IO/transfac.pm blib/lib/Bio/Matrix/PSM/IO/transfac.pm cp lib/Bio/Matrix/PSM/SiteMatrix.pm blib/lib/Bio/Matrix/PSM/SiteMatrix.pm cp lib/Bio/Matrix/PSM/IO/psiblast.pm blib/lib/Bio/Matrix/PSM/IO/psiblast.pm cp lib/Bio/Matrix/Scoring.pm blib/lib/Bio/Matrix/Scoring.pm cp lib/Bio/Matrix/PSM/InstanceSite.pm blib/lib/Bio/Matrix/PSM/InstanceSite.pm cp lib/Bio/Matrix/PhylipDist.pm blib/lib/Bio/Matrix/PhylipDist.pm cp lib/Bio/Ontology/Relationship.pm blib/lib/Bio/Ontology/Relationship.pm cp lib/Bio/Matrix/PSM/PsmHeaderI.pm blib/lib/Bio/Matrix/PSM/PsmHeaderI.pm cp lib/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm blib/lib/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm cp lib/Bio/OntologyIO/simplehierarchy.pm blib/lib/Bio/OntologyIO/simplehierarchy.pm cp lib/Bio/Root/Version.pm blib/lib/Bio/Root/Version.pm cp lib/Bio/Root/Test.pm blib/lib/Bio/Root/Test.pm cp lib/Bio/PrimarySeqI.pm blib/lib/Bio/PrimarySeqI.pm cp lib/Bio/Root/IO.pm blib/lib/Bio/Root/IO.pm cp lib/Bio/Root/TestObject.pm blib/lib/Bio/Root/TestObject.pm cp lib/Bio/OntologyIO/obo.pm blib/lib/Bio/OntologyIO/obo.pm cp lib/Bio/Search/GenericDatabase.pm blib/lib/Bio/Search/GenericDatabase.pm cp lib/Bio/Range.pm blib/lib/Bio/Range.pm cp lib/Bio/ParameterBaseI.pm blib/lib/Bio/ParameterBaseI.pm cp lib/Bio/PrimarySeq.pm blib/lib/Bio/PrimarySeq.pm cp lib/Bio/Search/GenericStatistics.pm blib/lib/Bio/Search/GenericStatistics.pm cp lib/Bio/OntologyIO/Handlers/InterProHandler.pm blib/lib/Bio/OntologyIO/Handlers/InterProHandler.pm cp lib/Bio/OntologyIO/Handlers/BaseSAXHandler.pm blib/lib/Bio/OntologyIO/Handlers/BaseSAXHandler.pm cp lib/Bio/Ontology/TermI.pm blib/lib/Bio/Ontology/TermI.pm cp lib/Bio/Ontology/TermFactory.pm blib/lib/Bio/Ontology/TermFactory.pm cp lib/Bio/Ontology/Term.pm blib/lib/Bio/Ontology/Term.pm cp lib/Bio/OntologyIO/soflat.pm blib/lib/Bio/OntologyIO/soflat.pm cp lib/Bio/Root/RootI.pm blib/lib/Bio/Root/RootI.pm cp lib/Bio/Root/Storable.pm blib/lib/Bio/Root/Storable.pm cp lib/Bio/PullParserI.pm blib/lib/Bio/PullParserI.pm cp lib/Bio/Root/HTTPget.pm blib/lib/Bio/Root/HTTPget.pm cp lib/Bio/Root/Utilities.pm blib/lib/Bio/Root/Utilities.pm cp lib/Bio/Search/BlastStatistics.pm blib/lib/Bio/Search/BlastStatistics.pm cp lib/Bio/Search/HSP/BlastHSP.pm blib/lib/Bio/Search/HSP/BlastHSP.pm cp lib/Bio/OntologyIO/InterProParser.pm blib/lib/Bio/OntologyIO/InterProParser.pm cp lib/Bio/Root/Root.pm blib/lib/Bio/Root/Root.pm cp lib/Bio/Search/BlastUtils.pm blib/lib/Bio/Search/BlastUtils.pm cp lib/Bio/OntologyIO/goflat.pm blib/lib/Bio/OntologyIO/goflat.pm cp lib/Bio/Root/Exception.pm blib/lib/Bio/Root/Exception.pm cp lib/Bio/OntologyIO.pm blib/lib/Bio/OntologyIO.pm cp lib/Bio/OntologyIO/dagflat.pm blib/lib/Bio/OntologyIO/dagflat.pm cp lib/Bio/Search/DatabaseI.pm blib/lib/Bio/Search/DatabaseI.pm cp lib/Bio/RangeI.pm blib/lib/Bio/RangeI.pm cp lib/Bio/Search/HSP/PullHSPI.pm blib/lib/Bio/Search/HSP/PullHSPI.pm cp lib/Bio/Search/HSP/WABAHSP.pm blib/lib/Bio/Search/HSP/WABAHSP.pm cp lib/Bio/Search/Hit/PullHitI.pm blib/lib/Bio/Search/Hit/PullHitI.pm cp lib/Bio/Search/HSP/PSLHSP.pm blib/lib/Bio/Search/HSP/PSLHSP.pm cp lib/Bio/Search/HSP/HSPI.pm blib/lib/Bio/Search/HSP/HSPI.pm cp lib/Bio/Search/Result/GenericResult.pm blib/lib/Bio/Search/Result/GenericResult.pm cp lib/Bio/Search/Hit/BlastPullHit.pm blib/lib/Bio/Search/Hit/BlastPullHit.pm cp lib/Bio/Search/Iteration/IterationI.pm blib/lib/Bio/Search/Iteration/IterationI.pm cp lib/Bio/Search/HSP/FastaHSP.pm blib/lib/Bio/Search/HSP/FastaHSP.pm cp lib/Bio/Search/HSP/GenericHSP.pm blib/lib/Bio/Search/HSP/GenericHSP.pm cp lib/Bio/Search/Hit/HitFactory.pm blib/lib/Bio/Search/Hit/HitFactory.pm cp lib/Bio/Search/Hit/PsiBlastHit.pm blib/lib/Bio/Search/Hit/PsiBlastHit.pm cp lib/Bio/Search/Result/PullResultI.pm blib/lib/Bio/Search/Result/PullResultI.pm cp lib/Bio/Search/Result/CrossMatchResult.pm blib/lib/Bio/Search/Result/CrossMatchResult.pm cp lib/Bio/Search/Result/BlastResult.pm blib/lib/Bio/Search/Result/BlastResult.pm cp lib/Bio/Search/Result/INFERNALResult.pm blib/lib/Bio/Search/Result/INFERNALResult.pm cp lib/Bio/Search/HSP/PsiBlastHSP.pm blib/lib/Bio/Search/HSP/PsiBlastHSP.pm cp lib/Bio/Search/HSP/ModelHSP.pm blib/lib/Bio/Search/HSP/ModelHSP.pm cp lib/Bio/Search/Result/ResultI.pm blib/lib/Bio/Search/Result/ResultI.pm cp lib/Bio/Search/Hit/Fasta.pm blib/lib/Bio/Search/Hit/Fasta.pm cp lib/Bio/Search/HSP/BlastPullHSP.pm blib/lib/Bio/Search/HSP/BlastPullHSP.pm cp lib/Bio/Search/Hit/GenericHit.pm blib/lib/Bio/Search/Hit/GenericHit.pm cp lib/Bio/Search/Result/BlastPullResult.pm blib/lib/Bio/Search/Result/BlastPullResult.pm cp lib/Bio/Search/Hit/ModelHit.pm blib/lib/Bio/Search/Hit/ModelHit.pm cp lib/Bio/Search/Hit/BlastHit.pm blib/lib/Bio/Search/Hit/BlastHit.pm cp lib/Bio/Search/Hit/HitI.pm blib/lib/Bio/Search/Hit/HitI.pm cp lib/Bio/Search/Result/ResultFactory.pm blib/lib/Bio/Search/Result/ResultFactory.pm cp lib/Bio/Search/Iteration/GenericIteration.pm blib/lib/Bio/Search/Iteration/GenericIteration.pm cp lib/Bio/Search/Processor.pm blib/lib/Bio/Search/Processor.pm cp lib/Bio/Search/HSP/HSPFactory.pm blib/lib/Bio/Search/HSP/HSPFactory.pm cp lib/Bio/SearchIO/Writer/GbrowseGFF.pm blib/lib/Bio/SearchIO/Writer/GbrowseGFF.pm cp lib/Bio/Search/Tiling/TilingI.pm blib/lib/Bio/Search/Tiling/TilingI.pm cp lib/Bio/SearchIO/megablast.pm blib/lib/Bio/SearchIO/megablast.pm cp lib/Bio/SearchIO/blast_pull.pm blib/lib/Bio/SearchIO/blast_pull.pm cp lib/Bio/SearchIO/SearchResultEventBuilder.pm blib/lib/Bio/SearchIO/SearchResultEventBuilder.pm cp lib/Bio/SearchIO/axt.pm blib/lib/Bio/SearchIO/axt.pm cp lib/Bio/SearchIO/Writer/HitTableWriter.pm blib/lib/Bio/SearchIO/Writer/HitTableWriter.pm cp lib/Bio/SearchIO.pm blib/lib/Bio/SearchIO.pm cp lib/Bio/SearchIO/gmap_f9.pm blib/lib/Bio/SearchIO/gmap_f9.pm cp lib/Bio/SearchIO/Writer/TextResultWriter.pm blib/lib/Bio/SearchIO/Writer/TextResultWriter.pm cp lib/Bio/SearchIO/fasta.pm blib/lib/Bio/SearchIO/fasta.pm cp lib/Bio/Search/StatisticsI.pm blib/lib/Bio/Search/StatisticsI.pm cp lib/Bio/SearchIO/cross_match.pm blib/lib/Bio/SearchIO/cross_match.pm cp lib/Bio/SearchIO/FastHitEventBuilder.pm blib/lib/Bio/SearchIO/FastHitEventBuilder.pm cp lib/Bio/SearchIO/erpin.pm blib/lib/Bio/SearchIO/erpin.pm cp lib/Bio/Search/Tiling/MapTileUtils.pm blib/lib/Bio/Search/Tiling/MapTileUtils.pm cp lib/Bio/SearchIO/EventHandlerI.pm blib/lib/Bio/SearchIO/EventHandlerI.pm cp lib/Bio/Search/Result/WABAResult.pm blib/lib/Bio/Search/Result/WABAResult.pm cp lib/Bio/Search/Tiling/MapTiling.pm blib/lib/Bio/Search/Tiling/MapTiling.pm cp lib/Bio/SearchIO/blasttable.pm blib/lib/Bio/SearchIO/blasttable.pm cp lib/Bio/SearchIO/SearchWriterI.pm blib/lib/Bio/SearchIO/SearchWriterI.pm cp lib/Bio/Search/SearchUtils.pm blib/lib/Bio/Search/SearchUtils.pm cp lib/Bio/SearchIO/psl.pm blib/lib/Bio/SearchIO/psl.pm cp lib/Bio/SearchIO/Writer/HSPTableWriter.pm blib/lib/Bio/SearchIO/Writer/HSPTableWriter.pm cp lib/Bio/SearchIO/blast.pm blib/lib/Bio/SearchIO/blast.pm cp lib/Bio/SearchIO/Writer/HTMLResultWriter.pm blib/lib/Bio/SearchIO/Writer/HTMLResultWriter.pm cp lib/Bio/SearchIO/Writer/ResultTableWriter.pm blib/lib/Bio/SearchIO/Writer/ResultTableWriter.pm cp lib/Bio/SearchIO/infernal.pm blib/lib/Bio/SearchIO/infernal.pm cp lib/Bio/SearchIO/IteratedSearchResultEventBuilder.pm blib/lib/Bio/SearchIO/IteratedSearchResultEventBuilder.pm cp lib/Bio/SearchIO/exonerate.pm blib/lib/Bio/SearchIO/exonerate.pm cp lib/Bio/SearchIO/rnamotif.pm blib/lib/Bio/SearchIO/rnamotif.pm cp lib/Bio/Seq/EncodedSeq.pm blib/lib/Bio/Seq/EncodedSeq.pm cp lib/Bio/Seq/MetaI.pm blib/lib/Bio/Seq/MetaI.pm cp lib/Bio/Seq/LargeSeqI.pm blib/lib/Bio/Seq/LargeSeqI.pm cp lib/Bio/Seq/PrimaryQual.pm blib/lib/Bio/Seq/PrimaryQual.pm cp lib/Bio/SeqFeature/Collection.pm blib/lib/Bio/SeqFeature/Collection.pm cp lib/Bio/SearchIO/sim4.pm blib/lib/Bio/SearchIO/sim4.pm cp lib/Bio/Seq/TraceI.pm blib/lib/Bio/Seq/TraceI.pm cp lib/Bio/Seq/SeqFastaSpeedFactory.pm blib/lib/Bio/Seq/SeqFastaSpeedFactory.pm cp lib/Bio/Seq/SimulatedRead.pm blib/lib/Bio/Seq/SimulatedRead.pm cp lib/Bio/SearchIO/wise.pm blib/lib/Bio/SearchIO/wise.pm cp lib/Bio/Seq/LargePrimarySeq.pm blib/lib/Bio/Seq/LargePrimarySeq.pm cp lib/Bio/SeqFeature/Computation.pm blib/lib/Bio/SeqFeature/Computation.pm cp lib/Bio/Seq/RichSeqI.pm blib/lib/Bio/Seq/RichSeqI.pm cp lib/Bio/Seq/LargeLocatableSeq.pm blib/lib/Bio/Seq/LargeLocatableSeq.pm cp lib/Bio/Seq/Meta.pm blib/lib/Bio/Seq/Meta.pm cp lib/Bio/SeqFeature/Gene/ExonI.pm blib/lib/Bio/SeqFeature/Gene/ExonI.pm cp lib/Bio/SeqFeature/AnnotationAdaptor.pm blib/lib/Bio/SeqFeature/AnnotationAdaptor.pm cp lib/Bio/SeqFeature/Gene/Exon.pm blib/lib/Bio/SeqFeature/Gene/Exon.pm cp lib/Bio/Seq/QualI.pm blib/lib/Bio/Seq/QualI.pm cp lib/Bio/SeqFeature/Amplicon.pm blib/lib/Bio/SeqFeature/Amplicon.pm cp lib/Bio/Seq/SeqBuilder.pm blib/lib/Bio/Seq/SeqBuilder.pm cp lib/Bio/Seq.pm blib/lib/Bio/Seq.pm cp lib/Bio/SeqAnalysisParserI.pm blib/lib/Bio/SeqAnalysisParserI.pm cp lib/Bio/Seq/BaseSeqProcessor.pm blib/lib/Bio/Seq/BaseSeqProcessor.pm cp lib/Bio/Seq/RichSeq.pm blib/lib/Bio/Seq/RichSeq.pm cp lib/Bio/Seq/Meta/Array.pm blib/lib/Bio/Seq/Meta/Array.pm cp lib/Bio/SeqFeature/CollectionI.pm blib/lib/Bio/SeqFeature/CollectionI.pm cp lib/Bio/Seq/SeqFactory.pm blib/lib/Bio/Seq/SeqFactory.pm cp lib/Bio/Seq/PrimedSeq.pm blib/lib/Bio/Seq/PrimedSeq.pm cp lib/Bio/Seq/Quality.pm blib/lib/Bio/Seq/Quality.pm cp lib/Bio/SearchIO/waba.pm blib/lib/Bio/SearchIO/waba.pm cp lib/Bio/SeqFeature/FeaturePair.pm blib/lib/Bio/SeqFeature/FeaturePair.pm cp lib/Bio/Seq/LargeSeq.pm blib/lib/Bio/Seq/LargeSeq.pm cp lib/Bio/Seq/SequenceTrace.pm blib/lib/Bio/Seq/SequenceTrace.pm cp lib/Bio/SeqI.pm blib/lib/Bio/SeqI.pm cp lib/Bio/SeqFeature/Gene/UTR.pm blib/lib/Bio/SeqFeature/Gene/UTR.pm cp lib/Bio/SeqFeature/Tools/TypeMapper.pm blib/lib/Bio/SeqFeature/Tools/TypeMapper.pm cp lib/Bio/SeqFeature/Gene/Promoter.pm blib/lib/Bio/SeqFeature/Gene/Promoter.pm cp lib/Bio/SeqFeature/Gene/GeneStructure.pm blib/lib/Bio/SeqFeature/Gene/GeneStructure.pm cp lib/Bio/SeqIO/embl.pm blib/lib/Bio/SeqIO/embl.pm cp lib/Bio/SeqFeature/PositionProxy.pm blib/lib/Bio/SeqFeature/PositionProxy.pm cp lib/Bio/SeqFeature/Gene/GeneStructureI.pm blib/lib/Bio/SeqFeature/Gene/GeneStructureI.pm cp lib/Bio/SeqIO/FTHelper.pm blib/lib/Bio/SeqIO/FTHelper.pm cp lib/Bio/SeqFeature/Gene/Poly_A_site.pm blib/lib/Bio/SeqFeature/Gene/Poly_A_site.pm cp lib/Bio/SeqFeature/Gene/TranscriptI.pm blib/lib/Bio/SeqFeature/Gene/TranscriptI.pm cp lib/Bio/SeqFeature/SubSeq.pm blib/lib/Bio/SeqFeature/SubSeq.pm cp lib/Bio/SeqIO/Handler/GenericRichSeqHandler.pm blib/lib/Bio/SeqIO/Handler/GenericRichSeqHandler.pm cp lib/Bio/SeqFeature/SimilarityPair.pm blib/lib/Bio/SeqFeature/SimilarityPair.pm cp lib/Bio/SeqFeature/Gene/NC_Feature.pm blib/lib/Bio/SeqFeature/Gene/NC_Feature.pm cp lib/Bio/SeqFeature/Tools/IDHandler.pm blib/lib/Bio/SeqFeature/Tools/IDHandler.pm cp lib/Bio/SeqFeature/Tools/FeatureNamer.pm blib/lib/Bio/SeqFeature/Tools/FeatureNamer.pm cp lib/Bio/SeqFeatureI.pm blib/lib/Bio/SeqFeatureI.pm cp lib/Bio/SeqFeature/Lite.pm blib/lib/Bio/SeqFeature/Lite.pm cp lib/Bio/SeqIO/bsml.pm blib/lib/Bio/SeqIO/bsml.pm cp lib/Bio/SeqIO/ace.pm blib/lib/Bio/SeqIO/ace.pm cp lib/Bio/SeqFeature/Similarity.pm blib/lib/Bio/SeqFeature/Similarity.pm cp lib/Bio/SeqFeature/Primer.pm blib/lib/Bio/SeqFeature/Primer.pm cp lib/Bio/SeqIO/asciitree.pm blib/lib/Bio/SeqIO/asciitree.pm cp lib/Bio/SeqIO/bsml_sax.pm blib/lib/Bio/SeqIO/bsml_sax.pm cp lib/Bio/SeqFeature/TypedSeqFeatureI.pm blib/lib/Bio/SeqFeature/TypedSeqFeatureI.pm cp lib/Bio/SeqFeature/Generic.pm blib/lib/Bio/SeqFeature/Generic.pm cp lib/Bio/SeqIO/MultiFile.pm blib/lib/Bio/SeqIO/MultiFile.pm cp lib/Bio/SeqFeature/Gene/Transcript.pm blib/lib/Bio/SeqFeature/Gene/Transcript.pm cp lib/Bio/SeqIO.pm blib/lib/Bio/SeqIO.pm cp lib/Bio/SeqFeature/Gene/Intron.pm blib/lib/Bio/SeqFeature/Gene/Intron.pm cp lib/Bio/SeqFeature/Tools/Unflattener.pm blib/lib/Bio/SeqFeature/Tools/Unflattener.pm cp lib/Bio/SeqIO/mbsout.pm blib/lib/Bio/SeqIO/mbsout.pm cp lib/Bio/SeqIO/gcg.pm blib/lib/Bio/SeqIO/gcg.pm cp lib/Bio/SeqIO/gbxml.pm blib/lib/Bio/SeqIO/gbxml.pm cp lib/Bio/SimpleAlign.pm blib/lib/Bio/SimpleAlign.pm cp lib/Bio/SeqIO/fastq.pm blib/lib/Bio/SeqIO/fastq.pm cp lib/Bio/SeqIO/game/gameWriter.pm blib/lib/Bio/SeqIO/game/gameWriter.pm cp lib/Bio/SeqIO/pir.pm blib/lib/Bio/SeqIO/pir.pm cp lib/Bio/SeqIO/seqxml.pm blib/lib/Bio/SeqIO/seqxml.pm cp lib/Bio/SeqIO/scf.pm blib/lib/Bio/SeqIO/scf.pm cp lib/Bio/SeqUtils.pm blib/lib/Bio/SeqUtils.pm cp lib/Bio/SeqIO/qual.pm blib/lib/Bio/SeqIO/qual.pm cp lib/Bio/SeqIO/tinyseq/tinyseqHandler.pm blib/lib/Bio/SeqIO/tinyseq/tinyseqHandler.pm cp lib/Bio/SeqIO/kegg.pm blib/lib/Bio/SeqIO/kegg.pm cp lib/Bio/SeqIO/embldriver.pm blib/lib/Bio/SeqIO/embldriver.pm cp lib/Bio/SeqIO/msout.pm blib/lib/Bio/SeqIO/msout.pm cp lib/Bio/SeqIO/tab.pm blib/lib/Bio/SeqIO/tab.pm cp lib/Bio/SeqIO/largefasta.pm blib/lib/Bio/SeqIO/largefasta.pm cp lib/Bio/SeqIO/genbank.pm blib/lib/Bio/SeqIO/genbank.pm cp lib/Bio/SeqIO/table.pm blib/lib/Bio/SeqIO/table.pm cp lib/Bio/SeqIO/tigr.pm blib/lib/Bio/SeqIO/tigr.pm cp lib/Bio/SeqIO/phd.pm blib/lib/Bio/SeqIO/phd.pm cp lib/Bio/SeqIO/swiss.pm blib/lib/Bio/SeqIO/swiss.pm cp lib/Bio/SeqIO/swissdriver.pm blib/lib/Bio/SeqIO/swissdriver.pm cp lib/Bio/Tools/Alignment/Consed.pm blib/lib/Bio/Tools/Alignment/Consed.pm cp lib/Bio/SeqIO/fasta.pm blib/lib/Bio/SeqIO/fasta.pm cp lib/Bio/SeqIO/tinyseq.pm blib/lib/Bio/SeqIO/tinyseq.pm cp lib/Bio/Species.pm blib/lib/Bio/Species.pm cp lib/Bio/SeqIO/game/gameSubs.pm blib/lib/Bio/SeqIO/game/gameSubs.pm cp lib/Bio/SeqIO/gbdriver.pm blib/lib/Bio/SeqIO/gbdriver.pm cp lib/Bio/SeqIO/locuslink.pm blib/lib/Bio/SeqIO/locuslink.pm cp lib/Bio/SeqIO/game/gameHandler.pm blib/lib/Bio/SeqIO/game/gameHandler.pm cp lib/Bio/SeqIO/game.pm blib/lib/Bio/SeqIO/game.pm cp lib/Bio/SeqIO/game/featHandler.pm blib/lib/Bio/SeqIO/game/featHandler.pm cp lib/Bio/SeqIO/game/seqHandler.pm blib/lib/Bio/SeqIO/game/seqHandler.pm cp lib/Bio/SimpleAnalysisI.pm blib/lib/Bio/SimpleAnalysisI.pm cp lib/Bio/SeqIO/metafasta.pm blib/lib/Bio/SeqIO/metafasta.pm cp lib/Bio/SeqIO/raw.pm blib/lib/Bio/SeqIO/raw.pm cp lib/Bio/Taxon.pm blib/lib/Bio/Taxon.pm cp lib/Bio/SeqIO/tigrxml.pm blib/lib/Bio/SeqIO/tigrxml.pm cp lib/Bio/Tools/MZEF.pm blib/lib/Bio/Tools/MZEF.pm cp lib/Bio/Tools/Grail.pm blib/lib/Bio/Tools/Grail.pm cp lib/Bio/Tools/Coil.pm blib/lib/Bio/Tools/Coil.pm cp lib/Bio/Tools/Genewise.pm blib/lib/Bio/Tools/Genewise.pm cp lib/Bio/Tools/IUPAC.pm blib/lib/Bio/Tools/IUPAC.pm cp lib/Bio/Tools/Phylo/Phylip/ProtDist.pm blib/lib/Bio/Tools/Phylo/Phylip/ProtDist.pm cp lib/Bio/Tools/Phylo/Molphy.pm blib/lib/Bio/Tools/Phylo/Molphy.pm cp lib/Bio/Tools/Phylo/Molphy/Result.pm blib/lib/Bio/Tools/Phylo/Molphy/Result.pm cp lib/Bio/Tools/AnalysisResult.pm blib/lib/Bio/Tools/AnalysisResult.pm cp lib/Bio/Tools/OddCodes.pm blib/lib/Bio/Tools/OddCodes.pm cp lib/Bio/Tools/GuessSeqFormat.pm blib/lib/Bio/Tools/GuessSeqFormat.pm cp lib/Bio/Tools/Phylo/Gerp.pm blib/lib/Bio/Tools/Phylo/Gerp.pm cp lib/Bio/Tools/EMBOSS/Palindrome.pm blib/lib/Bio/Tools/EMBOSS/Palindrome.pm cp lib/Bio/Tools/Eponine.pm blib/lib/Bio/Tools/Eponine.pm cp lib/Bio/Tools/EPCR.pm blib/lib/Bio/Tools/EPCR.pm cp lib/Bio/Tools/Genemark.pm blib/lib/Bio/Tools/Genemark.pm cp lib/Bio/Tools/FootPrinter.pm blib/lib/Bio/Tools/FootPrinter.pm cp lib/Bio/Tools/AmpliconSearch.pm blib/lib/Bio/Tools/AmpliconSearch.pm cp lib/Bio/Tools/ECnumber.pm blib/lib/Bio/Tools/ECnumber.pm cp lib/Bio/Tools/Lucy.pm blib/lib/Bio/Tools/Lucy.pm cp lib/Bio/Tools/Blat.pm blib/lib/Bio/Tools/Blat.pm cp lib/Bio/Tools/GFF.pm blib/lib/Bio/Tools/GFF.pm cp lib/Bio/Tools/Genomewise.pm blib/lib/Bio/Tools/Genomewise.pm cp lib/Bio/Tools/Match.pm blib/lib/Bio/Tools/Match.pm cp lib/Bio/Tools/Geneid.pm blib/lib/Bio/Tools/Geneid.pm cp lib/Bio/Tools/ESTScan.pm blib/lib/Bio/Tools/ESTScan.pm cp lib/Bio/Tools/Fgenesh.pm blib/lib/Bio/Tools/Fgenesh.pm cp lib/Bio/Tools/Prediction/Exon.pm blib/lib/Bio/Tools/Prediction/Exon.pm cp lib/Bio/Tools/Prediction/Gene.pm blib/lib/Bio/Tools/Prediction/Gene.pm cp lib/Bio/Tools/Est2Genome.pm blib/lib/Bio/Tools/Est2Genome.pm cp lib/Bio/Tools/Analysis/SimpleAnalysisBase.pm blib/lib/Bio/Tools/Analysis/SimpleAnalysisBase.pm cp lib/Bio/Tools/Alignment/Trim.pm blib/lib/Bio/Tools/Alignment/Trim.pm cp lib/Bio/Tools/Glimmer.pm blib/lib/Bio/Tools/Glimmer.pm cp lib/Bio/Tools/Genscan.pm blib/lib/Bio/Tools/Genscan.pm cp lib/Bio/Tools/CodonTable.pm blib/lib/Bio/Tools/CodonTable.pm cp lib/Bio/Tools/RepeatMasker.pm blib/lib/Bio/Tools/RepeatMasker.pm cp lib/Bio/Tools/SeqWords.pm blib/lib/Bio/Tools/SeqWords.pm cp lib/Bio/Tools/SeqPattern/Backtranslate.pm blib/lib/Bio/Tools/SeqPattern/Backtranslate.pm cp lib/Bio/Tools/Primer/Pair.pm blib/lib/Bio/Tools/Primer/Pair.pm cp lib/Bio/Tools/Seg.pm blib/lib/Bio/Tools/Seg.pm cp lib/Bio/Tools/Run/AnalysisFactory.pm blib/lib/Bio/Tools/Run/AnalysisFactory.pm cp lib/Bio/Tools/Spidey/Exon.pm blib/lib/Bio/Tools/Spidey/Exon.pm cp lib/Bio/Tools/Signalp/ExtendedSignalp.pm blib/lib/Bio/Tools/Signalp/ExtendedSignalp.pm cp lib/Bio/Tools/Spidey/Results.pm blib/lib/Bio/Tools/Spidey/Results.pm cp lib/Bio/Tools/Run/Analysis.pm blib/lib/Bio/Tools/Run/Analysis.pm cp lib/Bio/Tools/Profile.pm blib/lib/Bio/Tools/Profile.pm cp lib/Bio/Tools/TandemRepeatsFinder.pm blib/lib/Bio/Tools/TandemRepeatsFinder.pm cp lib/Bio/Tools/PrositeScan.pm blib/lib/Bio/Tools/PrositeScan.pm cp lib/Bio/Tools/Prints.pm blib/lib/Bio/Tools/Prints.pm cp lib/Bio/Tools/Sim4/Exon.pm blib/lib/Bio/Tools/Sim4/Exon.pm cp lib/Bio/Tools/Promoterwise.pm blib/lib/Bio/Tools/Promoterwise.pm cp lib/Bio/Tools/Signalp.pm blib/lib/Bio/Tools/Signalp.pm cp lib/Bio/Tools/Primer/Assessor/Base.pm blib/lib/Bio/Tools/Primer/Assessor/Base.pm cp lib/Bio/Tools/Run/Phylo/PhyloBase.pm blib/lib/Bio/Tools/Run/Phylo/PhyloBase.pm cp lib/Bio/Tools/Run/WrapperBase.pm blib/lib/Bio/Tools/Run/WrapperBase.pm cp lib/Bio/Tools/Sim4/Results.pm blib/lib/Bio/Tools/Sim4/Results.pm cp lib/Bio/Tools/SeqPattern.pm blib/lib/Bio/Tools/SeqPattern.pm cp lib/Bio/Tools/Run/WrapperBase/CommandExts.pm blib/lib/Bio/Tools/Run/WrapperBase/CommandExts.pm cp lib/Bio/Tools/Run/ParametersI.pm blib/lib/Bio/Tools/Run/ParametersI.pm cp lib/Bio/Tools/QRNA.pm blib/lib/Bio/Tools/QRNA.pm cp lib/Bio/Tools/Primer/Feature.pm blib/lib/Bio/Tools/Primer/Feature.pm cp lib/Bio/Tools/Primer/AssessorI.pm blib/lib/Bio/Tools/Primer/AssessorI.pm cp lib/Bio/Tools/Primer3.pm blib/lib/Bio/Tools/Primer3.pm cp lib/Bio/Tools/RandomDistFunctions.pm blib/lib/Bio/Tools/RandomDistFunctions.pm cp lib/Bio/Tools/Pseudowise.pm blib/lib/Bio/Tools/Pseudowise.pm cp lib/Bio/Tools/Run/GenericParameters.pm blib/lib/Bio/Tools/Run/GenericParameters.pm cp lib/Bio/Tools/SeqStats.pm blib/lib/Bio/Tools/SeqStats.pm cp lib/Bio/Tools/Sigcleave.pm blib/lib/Bio/Tools/Sigcleave.pm cp lib/Bio/UpdateableSeqI.pm blib/lib/Bio/UpdateableSeqI.pm cp lib/Bio/TreeIO/NewickParser.pm blib/lib/Bio/TreeIO/NewickParser.pm cp lib/Bio/Tools/Tmhmm.pm blib/lib/Bio/Tools/Tmhmm.pm cp lib/Bio/TreeIO/tabtree.pm blib/lib/Bio/TreeIO/tabtree.pm cp lib/Bio/TreeIO/pag.pm blib/lib/Bio/TreeIO/pag.pm cp lib/Bio/Tree/Node.pm blib/lib/Bio/Tree/Node.pm cp lib/Bio/TreeIO/cluster.pm blib/lib/Bio/TreeIO/cluster.pm cp lib/Bio/TreeIO/lintree.pm blib/lib/Bio/TreeIO/lintree.pm cp lib/Bio/Tree/RandomFactory.pm blib/lib/Bio/Tree/RandomFactory.pm cp lib/Bio/TreeIO/nhx.pm blib/lib/Bio/TreeIO/nhx.pm cp lib/Bio/Tree/TreeI.pm blib/lib/Bio/Tree/TreeI.pm cp lib/Bio/WebAgent.pm blib/lib/Bio/WebAgent.pm cp lib/Bio/Tools/isPcr.pm blib/lib/Bio/Tools/isPcr.pm cp lib/Bio/Tree/Statistics.pm blib/lib/Bio/Tree/Statistics.pm cp lib/Bio/Tree/TreeFunctionsI.pm blib/lib/Bio/Tree/TreeFunctionsI.pm cp lib/BioPerl.pm blib/lib/BioPerl.pm cp lib/Bio/Tools/pICalculator.pm blib/lib/Bio/Tools/pICalculator.pm cp lib/Bio/Tree/NodeI.pm blib/lib/Bio/Tree/NodeI.pm cp lib/Bio/Tools/TargetP.pm blib/lib/Bio/Tools/TargetP.pm cp lib/Bio/Tree/Compatible.pm blib/lib/Bio/Tree/Compatible.pm cp lib/Bio/Tree/AnnotatableNode.pm blib/lib/Bio/Tree/AnnotatableNode.pm cp lib/Bio/Tools/ipcress.pm blib/lib/Bio/Tools/ipcress.pm cp lib/Bio/Tools/tRNAscanSE.pm blib/lib/Bio/Tools/tRNAscanSE.pm cp lib/Bio/Tree/NodeNHX.pm blib/lib/Bio/Tree/NodeNHX.pm cp lib/Bio/Tree/DistanceFactory.pm blib/lib/Bio/Tree/DistanceFactory.pm cp lib/Bio/TreeIO/nexus.pm blib/lib/Bio/TreeIO/nexus.pm cp lib/Bio/TreeIO/newick.pm blib/lib/Bio/TreeIO/newick.pm cp lib/Bio/TreeIO/phyloxml.pm blib/lib/Bio/TreeIO/phyloxml.pm cp lib/Bio/TreeIO.pm blib/lib/Bio/TreeIO.pm cp lib/Bio/Tree/Tree.pm blib/lib/Bio/Tree/Tree.pm cp lib/Bio/TreeIO/TreeEventBuilder.pm blib/lib/Bio/TreeIO/TreeEventBuilder.pm cp bin/bp_aacomp blib/script/bp_aacomp cp bin/bp_bioflat_index blib/script/bp_bioflat_index "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_aacomp "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_bioflat_index cp bin/bp_biogetseq blib/script/bp_biogetseq "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_biogetseq cp bin/bp_dbsplit blib/script/bp_dbsplit "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_dbsplit cp bin/bp_extract_feature_seq blib/script/bp_extract_feature_seq cp bin/bp_fastam9_to_table blib/script/bp_fastam9_to_table "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_extract_feature_seq "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_fastam9_to_table cp bin/bp_fetch blib/script/bp_fetch "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_fetch cp bin/bp_filter_search blib/script/bp_filter_search "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_filter_search cp bin/bp_find-blast-matches blib/script/bp_find-blast-matches "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_find-blast-matches cp bin/bp_gccalc blib/script/bp_gccalc "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_gccalc cp bin/bp_genbank2gff3 blib/script/bp_genbank2gff3 "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_genbank2gff3 cp bin/bp_index blib/script/bp_index "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_index cp bin/bp_local_taxonomydb_query blib/script/bp_local_taxonomydb_query "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_local_taxonomydb_query cp bin/bp_make_mrna_protein blib/script/bp_make_mrna_protein "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_make_mrna_protein cp bin/bp_mask_by_search blib/script/bp_mask_by_search "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_mask_by_search cp bin/bp_mrtrans blib/script/bp_mrtrans "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_mrtrans cp bin/bp_mutate blib/script/bp_mutate "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_mutate cp bin/bp_nexus2nh blib/script/bp_nexus2nh "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_nexus2nh cp bin/bp_nrdb blib/script/bp_nrdb "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_nrdb cp bin/bp_oligo_count blib/script/bp_oligo_count cp bin/bp_process_gadfly blib/script/bp_process_gadfly "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_oligo_count "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_process_gadfly cp bin/bp_process_sgd blib/script/bp_process_sgd "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_process_sgd cp bin/bp_revtrans-motif blib/script/bp_revtrans-motif "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_revtrans-motif cp bin/bp_search2alnblocks blib/script/bp_search2alnblocks "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2alnblocks cp bin/bp_search2gff blib/script/bp_search2gff "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2gff cp bin/bp_search2table blib/script/bp_search2table "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2table cp bin/bp_search2tribe blib/script/bp_search2tribe "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2tribe cp bin/bp_seq_length blib/script/bp_seq_length "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seq_length cp bin/bp_seqconvert blib/script/bp_seqconvert cp bin/bp_seqcut blib/script/bp_seqcut "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqconvert "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqcut cp bin/bp_seqpart blib/script/bp_seqpart "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqpart cp bin/bp_seqret blib/script/bp_seqret "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqret cp bin/bp_seqretsplit blib/script/bp_seqretsplit "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqretsplit cp bin/bp_split_seq blib/script/bp_split_seq "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_split_seq cp bin/bp_sreformat blib/script/bp_sreformat "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_sreformat cp bin/bp_taxid4species blib/script/bp_taxid4species "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_taxid4species cp bin/bp_taxonomy2tree blib/script/bp_taxonomy2tree "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_taxonomy2tree cp bin/bp_translate_seq blib/script/bp_translate_seq "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_translate_seq cp bin/bp_tree2pag blib/script/bp_tree2pag "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_tree2pag cp bin/bp_unflatten_seq blib/script/bp_unflatten_seq "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_unflatten_seq Manifying 40 pod documents Manifying 35 pod documents Manifying 33 pod documents Manifying 32 pod documents Manifying 34 pod documents Manifying 32 pod documents Manifying 32 pod documents Manifying 30 pod documents Manifying 27 pod documents Manifying 35 pod documents Manifying 29 pod documents Manifying 35 pod documents Manifying 36 pod documents Manifying 33 pod documents Manifying 33 pod documents Manifying 15 pod documents make[1]: Leaving directory '/build/bioperl-QLxev6/bioperl-1.7.8' dh_auto_test make -j2 test TEST_VERBOSE=1 make[1]: Entering directory '/build/bioperl-QLxev6/bioperl-1.7.8' PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/Align/*.t t/AlignIO/*.t t/Annotation/*.t t/LocalDB/*.t t/LocalDB/Index/*.t t/LocalDB/Taxonomy/*.t t/Matrix/*.t t/Matrix/IO/*.t t/Ontology/*.t t/Ontology/IO/*.t t/RemoteDB/*.t t/Root/*.t t/SearchIO/*.t t/SearchIO/Writer/*.t t/Seq/*.t t/SeqFeature/*.t t/SeqIO/*.t t/SeqTools/*.t t/Tools/*.t t/Tools/Alignment/*.t t/Tools/EMBOSS/*.t t/Tools/Phylo/*.t t/Tools/Phylo/Phylip/*.t t/Tools/Signalp/*.t t/Tools/Spidey/*.t t/Tree/*.t t/Tree/TreeIO/*.t t/00-compile.t ...................... 1..511 ok 1 - Bio/Align/AlignI.pm loaded ok ok 2 - Bio/Align/DNAStatistics.pm loaded ok ok 3 - Bio/Align/PairwiseStatistics.pm loaded ok ok 4 - Bio/Align/ProteinStatistics.pm loaded ok ok 5 - Bio/Align/StatisticsI.pm loaded ok ok 6 - Bio/Align/Utilities.pm loaded ok ok 7 - Bio/AlignIO.pm loaded ok ok 8 - Bio/AlignIO/Handler/GenericAlignHandler.pm loaded ok ok 9 - Bio/AlignIO/arp.pm loaded ok ok 10 - Bio/AlignIO/bl2seq.pm loaded ok ok 11 - Bio/AlignIO/clustalw.pm loaded ok ok 12 - Bio/AlignIO/emboss.pm loaded ok ok 13 - Bio/AlignIO/fasta.pm loaded ok ok 14 - Bio/AlignIO/largemultifasta.pm loaded ok ok 15 - Bio/AlignIO/maf.pm loaded ok ok 16 - Bio/AlignIO/mase.pm loaded ok ok 17 - Bio/AlignIO/mega.pm loaded ok ok 18 - Bio/AlignIO/meme.pm loaded ok ok 19 - Bio/AlignIO/metafasta.pm loaded ok ok 20 - Bio/AlignIO/msf.pm loaded ok ok 21 - Bio/AlignIO/nexus.pm loaded ok ok 22 - Bio/AlignIO/pfam.pm loaded ok ok 23 - Bio/AlignIO/phylip.pm loaded ok ok 24 - Bio/AlignIO/po.pm loaded ok ok 25 - Bio/AlignIO/proda.pm loaded ok ok 26 - Bio/AlignIO/prodom.pm loaded ok ok 27 - Bio/AlignIO/psi.pm loaded ok ok 28 - Bio/AlignIO/selex.pm loaded ok ok 29 - Bio/AlignIO/xmfa.pm loaded ok ok 30 - Bio/AnalysisI.pm loaded ok ok 31 - Bio/AnalysisParserI.pm loaded ok ok 32 - Bio/AnalysisResultI.pm loaded ok ok 33 - Bio/AnnotatableI.pm loaded ok ok 34 - Bio/Annotation/AnnotationFactory.pm loaded ok ok 35 - Bio/Annotation/Collection.pm loaded ok ok 36 - Bio/Annotation/Comment.pm loaded ok ok 37 - Bio/Annotation/DBLink.pm loaded ok ok 38 - Bio/Annotation/OntologyTerm.pm loaded ok ok 39 - Bio/Annotation/Reference.pm loaded ok ok 40 - Bio/Annotation/Relation.pm loaded ok ok 41 - Bio/Annotation/SimpleValue.pm loaded ok ok 42 - Bio/Annotation/StructuredValue.pm loaded ok ok 43 - Bio/Annotation/TagTree.pm loaded ok ok 44 - Bio/Annotation/Target.pm loaded ok ok 45 - Bio/Annotation/Tree.pm loaded ok ok 46 - Bio/Annotation/TypeManager.pm loaded ok ok 47 - Bio/AnnotationCollectionI.pm loaded ok ok 48 - Bio/AnnotationI.pm loaded ok ok 49 - Bio/CodonUsage/IO.pm loaded ok ok 50 - Bio/CodonUsage/Table.pm loaded ok ok 51 - Bio/DB/DBFetch.pm loaded ok ok 52 - Bio/DB/Failover.pm loaded ok ok 53 - Bio/DB/Fasta.pm loaded ok ok 54 - Bio/DB/FileCache.pm loaded ok ok 55 - Bio/DB/Flat.pm loaded ok ok 56 - Bio/DB/Flat/BDB.pm loaded ok ok 57 - Bio/DB/Flat/BDB/embl.pm loaded ok ok 58 - Bio/DB/Flat/BDB/fasta.pm loaded ok ok 59 - Bio/DB/Flat/BDB/genbank.pm loaded ok ok 60 - Bio/DB/Flat/BDB/swiss.pm loaded ok ok 61 - Bio/DB/Flat/BinarySearch.pm loaded ok ok 62 - Bio/DB/GFF/Util/Binning.pm loaded ok ok 63 - Bio/DB/GFF/Util/Rearrange.pm loaded ok ok 64 - Bio/DB/GenericWebAgent.pm loaded ok ok 65 - Bio/DB/InMemoryCache.pm loaded ok ok 66 - Bio/DB/IndexedBase.pm loaded ok ok 67 - Bio/DB/LocationI.pm loaded ok ok 68 - Bio/DB/Qual.pm loaded ok ok 69 - Bio/DB/Query/WebQuery.pm loaded ok ok 70 - Bio/DB/QueryI.pm loaded ok ok 71 - Bio/DB/RandomAccessI.pm loaded ok ok 72 - Bio/DB/ReferenceI.pm loaded ok ok 73 - Bio/DB/Registry.pm loaded ok ok 74 - Bio/DB/SeqI.pm loaded ok ok 75 - Bio/DB/Taxonomy.pm loaded ok ok 76 - Bio/DB/Taxonomy/flatfile.pm loaded ok ok 77 - Bio/DB/Taxonomy/greengenes.pm loaded ok ok 78 - Bio/DB/Taxonomy/list.pm loaded ok ok 79 - Bio/DB/Taxonomy/silva.pm loaded ok ok 80 - Bio/DB/UpdateableSeqI.pm loaded ok ok 81 - Bio/DB/WebDBSeqI.pm loaded ok ok 82 - Bio/DBLinkContainerI.pm loaded ok ok 83 - Bio/Das/FeatureTypeI.pm loaded ok ok 84 - Bio/Das/SegmentI.pm loaded ok ok 85 - Bio/DasI.pm loaded ok ok 86 - Bio/DescribableI.pm loaded ok ok 87 - Bio/Event/EventGeneratorI.pm loaded ok ok 88 - Bio/Event/EventHandlerI.pm loaded ok ok 89 - Bio/Factory/AnalysisI.pm loaded ok ok 90 - Bio/Factory/ApplicationFactoryI.pm loaded ok ok 91 - Bio/Factory/DriverFactory.pm loaded ok ok 92 - Bio/Factory/FTLocationFactory.pm loaded ok ok 93 - Bio/Factory/LocationFactoryI.pm loaded ok ok 94 - Bio/Factory/ObjectBuilderI.pm loaded ok ok 95 - Bio/Factory/ObjectFactory.pm loaded ok ok 96 - Bio/Factory/ObjectFactoryI.pm loaded ok ok 97 - Bio/Factory/SeqAnalysisParserFactory.pm loaded ok ok 98 - Bio/Factory/SeqAnalysisParserFactoryI.pm loaded ok ok 99 - Bio/Factory/SequenceFactoryI.pm loaded ok ok 100 - Bio/Factory/SequenceProcessorI.pm loaded ok ok 101 - Bio/Factory/SequenceStreamI.pm loaded ok ok 102 - Bio/Factory/TreeFactoryI.pm loaded ok ok 103 - Bio/FeatureHolderI.pm loaded ok ok 104 - Bio/HandlerBaseI.pm loaded ok ok 105 - Bio/IdCollectionI.pm loaded ok ok 106 - Bio/IdentifiableI.pm loaded ok ok 107 - Bio/Index/Abstract.pm loaded ok ok 108 - Bio/Index/AbstractSeq.pm loaded ok ok 109 - Bio/Index/Blast.pm loaded ok ok 110 - Bio/Index/BlastTable.pm loaded ok ok 111 - Bio/Index/EMBL.pm loaded ok ok 112 - Bio/Index/Fasta.pm loaded ok ok 113 - Bio/Index/Fastq.pm loaded ok ok 114 - Bio/Index/GenBank.pm loaded ok ok 115 - Bio/Index/Qual.pm loaded ok ok 116 - Bio/Index/SwissPfam.pm loaded ok ok 117 - Bio/Index/Swissprot.pm loaded ok ok 118 - Bio/LocatableSeq.pm loaded ok ok 119 - Bio/Location/Atomic.pm loaded ok ok 120 - Bio/Location/AvWithinCoordPolicy.pm loaded ok ok 121 - Bio/Location/CoordinatePolicyI.pm loaded ok ok 122 - Bio/Location/Fuzzy.pm loaded ok ok 123 - Bio/Location/FuzzyLocationI.pm loaded ok ok 124 - Bio/Location/NarrowestCoordPolicy.pm loaded ok ok 125 - Bio/Location/Simple.pm loaded ok ok 126 - Bio/Location/Split.pm loaded ok ok 127 - Bio/Location/SplitLocationI.pm loaded ok ok 128 - Bio/Location/WidestCoordPolicy.pm loaded ok ok 129 - Bio/LocationI.pm loaded ok ok 130 - Bio/Matrix/Generic.pm loaded ok ok 131 - Bio/Matrix/IO.pm loaded ok ok 132 - Bio/Matrix/IO/mlagan.pm loaded ok ok 133 - Bio/Matrix/IO/phylip.pm loaded ok ok 134 - Bio/Matrix/IO/scoring.pm loaded ok ok 135 - Bio/Matrix/MatrixI.pm loaded ok ok 136 - Bio/Matrix/Mlagan.pm loaded ok ok 137 - Bio/Matrix/PSM/IO.pm loaded ok ok 138 - Bio/Matrix/PSM/IO/mast.pm loaded ok ok 139 - Bio/Matrix/PSM/IO/masta.pm loaded ok ok 140 - Bio/Matrix/PSM/IO/meme.pm loaded ok ok 141 - Bio/Matrix/PSM/IO/psiblast.pm loaded ok ok 142 - Bio/Matrix/PSM/IO/transfac.pm loaded ok ok 143 - Bio/Matrix/PSM/InstanceSite.pm loaded ok ok 144 - Bio/Matrix/PSM/InstanceSiteI.pm loaded ok ok 145 - Bio/Matrix/PSM/ProtMatrix.pm loaded ok ok 146 - Bio/Matrix/PSM/ProtPsm.pm loaded ok ok 147 - Bio/Matrix/PSM/Psm.pm loaded ok ok 148 - Bio/Matrix/PSM/PsmHeader.pm loaded ok ok 149 - Bio/Matrix/PSM/PsmHeaderI.pm loaded ok ok 150 - Bio/Matrix/PSM/PsmI.pm loaded ok ok 151 - Bio/Matrix/PSM/SiteMatrix.pm loaded ok ok 152 - Bio/Matrix/PSM/SiteMatrixI.pm loaded ok ok 153 - Bio/Matrix/PhylipDist.pm loaded ok ok 154 - Bio/Matrix/Scoring.pm loaded ok ok 155 - Bio/Ontology/DocumentRegistry.pm loaded ok ok 156 - Bio/Ontology/GOterm.pm loaded ok ok 157 - Bio/Ontology/InterProTerm.pm loaded ok ok 158 - Bio/Ontology/OBOEngine.pm loaded ok ok 159 - Bio/Ontology/OBOterm.pm loaded ok ok 160 - Bio/Ontology/Ontology.pm loaded ok ok 161 - Bio/Ontology/OntologyEngineI.pm loaded ok ok 162 - Bio/Ontology/OntologyI.pm loaded ok ok 163 - Bio/Ontology/OntologyStore.pm loaded ok ok 164 - Bio/Ontology/Path.pm loaded ok ok 165 - Bio/Ontology/PathI.pm loaded ok ok 166 - Bio/Ontology/Relationship.pm loaded ok ok 167 - Bio/Ontology/RelationshipFactory.pm loaded ok ok 168 - Bio/Ontology/RelationshipI.pm loaded ok ok 169 - Bio/Ontology/RelationshipType.pm loaded ok ok 170 - Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm loaded ok ok 171 - Bio/Ontology/SimpleOntologyEngine.pm loaded ok ok 172 - Bio/Ontology/Term.pm loaded ok ok 173 - Bio/Ontology/TermFactory.pm loaded ok ok 174 - Bio/Ontology/TermI.pm loaded ok ok 175 - Bio/OntologyIO.pm loaded ok ok 176 - Bio/OntologyIO/Handlers/BaseSAXHandler.pm loaded ok ok 177 - Bio/OntologyIO/Handlers/InterProHandler.pm loaded ok ok 178 - Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm loaded ok ok 179 - Bio/OntologyIO/InterProParser.pm loaded ok ok 180 - Bio/OntologyIO/dagflat.pm loaded ok ok 181 - Bio/OntologyIO/goflat.pm loaded ok ok 182 - Bio/OntologyIO/obo.pm loaded ok ok 183 - Bio/OntologyIO/simplehierarchy.pm loaded ok ok 184 - Bio/OntologyIO/soflat.pm loaded ok ok 185 - Bio/ParameterBaseI.pm loaded ok ok 186 - Bio/PrimarySeq.pm loaded ok ok 187 - Bio/PrimarySeqI.pm loaded ok ok 188 - Bio/PullParserI.pm loaded ok ok 189 - Bio/Range.pm loaded ok ok 190 - Bio/RangeI.pm loaded ok ok 191 - Bio/Root/Exception.pm loaded ok ok 192 - Bio/Root/HTTPget.pm loaded ok ok 193 - Bio/Root/IO.pm loaded ok ok 194 - Bio/Root/Root.pm loaded ok ok 195 - Bio/Root/RootI.pm loaded ok ok 196 - Bio/Root/Storable.pm loaded ok ok 197 - Bio/Root/Test.pm loaded ok ok 198 - Bio/Root/TestObject.pm loaded ok ok 199 - Bio/Root/Utilities.pm loaded ok ok 200 - Bio/Root/Version.pm loaded ok ok 201 - Bio/Search/BlastStatistics.pm loaded ok ok 202 - Bio/Search/BlastUtils.pm loaded ok ok 203 - Bio/Search/DatabaseI.pm loaded ok ok 204 - Bio/Search/GenericDatabase.pm loaded ok ok 205 - Bio/Search/GenericStatistics.pm loaded ok ok 206 - Bio/Search/HSP/BlastHSP.pm loaded ok ok 207 - Bio/Search/HSP/BlastPullHSP.pm loaded ok ok 208 - Bio/Search/HSP/FastaHSP.pm loaded ok ok 209 - Bio/Search/HSP/GenericHSP.pm loaded ok ok 210 - Bio/Search/HSP/HSPFactory.pm loaded ok ok 211 - Bio/Search/HSP/HSPI.pm loaded ok ok 212 - Bio/Search/HSP/ModelHSP.pm loaded ok ok 213 - Bio/Search/HSP/PSLHSP.pm loaded ok ok 214 - Bio/Search/HSP/PsiBlastHSP.pm loaded ok ok 215 - Bio/Search/HSP/PullHSPI.pm loaded ok ok 216 - Bio/Search/HSP/WABAHSP.pm loaded ok ok 217 - Bio/Search/Hit/BlastHit.pm loaded ok ok 218 - Bio/Search/Hit/BlastPullHit.pm loaded ok ok 219 - Bio/Search/Hit/Fasta.pm loaded ok ok 220 - Bio/Search/Hit/GenericHit.pm loaded ok ok 221 - Bio/Search/Hit/HitFactory.pm loaded ok ok 222 - Bio/Search/Hit/HitI.pm loaded ok ok 223 - Bio/Search/Hit/ModelHit.pm loaded ok ok 224 - Bio/Search/Hit/PsiBlastHit.pm loaded ok ok 225 - Bio/Search/Hit/PullHitI.pm loaded ok ok 226 - Bio/Search/Iteration/GenericIteration.pm loaded ok ok 227 - Bio/Search/Iteration/IterationI.pm loaded ok ok 228 - Bio/Search/Processor.pm loaded ok ok 229 - Bio/Search/Result/BlastPullResult.pm loaded ok ok 230 - Bio/Search/Result/BlastResult.pm loaded ok ok 231 - Bio/Search/Result/CrossMatchResult.pm loaded ok ok 232 - Bio/Search/Result/GenericResult.pm loaded ok ok 233 - Bio/Search/Result/INFERNALResult.pm loaded ok ok 234 - Bio/Search/Result/PullResultI.pm loaded ok ok 235 - Bio/Search/Result/ResultFactory.pm loaded ok ok 236 - Bio/Search/Result/ResultI.pm loaded ok ok 237 - Bio/Search/Result/WABAResult.pm loaded ok ok 238 - Bio/Search/SearchUtils.pm loaded ok ok 239 - Bio/Search/StatisticsI.pm loaded ok ok 240 - Bio/Search/Tiling/MapTileUtils.pm loaded ok ok 241 - Bio/Search/Tiling/MapTiling.pm loaded ok ok 242 - Bio/Search/Tiling/TilingI.pm loaded ok ok 243 - Bio/SearchIO.pm loaded ok ok 244 - Bio/SearchIO/EventHandlerI.pm loaded ok ok 245 - Bio/SearchIO/FastHitEventBuilder.pm loaded ok ok 246 - Bio/SearchIO/IteratedSearchResultEventBuilder.pm loaded ok ok 247 - Bio/SearchIO/SearchResultEventBuilder.pm loaded ok ok 248 - Bio/SearchIO/SearchWriterI.pm loaded ok ok 249 - Bio/SearchIO/Writer/GbrowseGFF.pm loaded ok ok 250 - Bio/SearchIO/Writer/HSPTableWriter.pm loaded ok ok 251 - Bio/SearchIO/Writer/HTMLResultWriter.pm loaded ok ok 252 - Bio/SearchIO/Writer/HitTableWriter.pm loaded ok ok 253 - Bio/SearchIO/Writer/ResultTableWriter.pm loaded ok ok 254 - Bio/SearchIO/Writer/TextResultWriter.pm loaded ok ok 255 - Bio/SearchIO/axt.pm loaded ok ok 256 - Bio/SearchIO/blast.pm loaded ok ok 257 - Bio/SearchIO/blast_pull.pm loaded ok ok 258 - Bio/SearchIO/blasttable.pm loaded ok ok 259 - Bio/SearchIO/cross_match.pm loaded ok ok 260 - Bio/SearchIO/erpin.pm loaded ok ok 261 - Bio/SearchIO/exonerate.pm loaded ok ok 262 - Bio/SearchIO/fasta.pm loaded ok ok 263 - Bio/SearchIO/gmap_f9.pm loaded ok ok 264 - Bio/SearchIO/infernal.pm loaded ok ok 265 - Bio/SearchIO/megablast.pm loaded ok ok 266 - Bio/SearchIO/psl.pm loaded ok ok 267 - Bio/SearchIO/rnamotif.pm loaded ok ok 268 - Bio/SearchIO/sim4.pm loaded ok ok 269 - Bio/SearchIO/waba.pm loaded ok ok 270 - Bio/SearchIO/wise.pm loaded ok ok 271 - Bio/Seq.pm loaded ok ok 272 - Bio/Seq/BaseSeqProcessor.pm loaded ok ok 273 - Bio/Seq/EncodedSeq.pm loaded ok ok 274 - Bio/Seq/LargeLocatableSeq.pm loaded ok ok 275 - Bio/Seq/LargePrimarySeq.pm loaded ok ok 276 - Bio/Seq/LargeSeq.pm loaded ok ok 277 - Bio/Seq/LargeSeqI.pm loaded ok ok 278 - Bio/Seq/Meta.pm loaded ok ok 279 - Bio/Seq/Meta/Array.pm loaded ok ok 280 - Bio/Seq/MetaI.pm loaded ok ok 281 - Bio/Seq/PrimaryQual.pm loaded ok ok 282 - Bio/Seq/PrimedSeq.pm loaded ok ok 283 - Bio/Seq/QualI.pm loaded ok ok 284 - Bio/Seq/Quality.pm loaded ok ok 285 - Bio/Seq/RichSeq.pm loaded ok ok 286 - Bio/Seq/RichSeqI.pm loaded ok ok 287 - Bio/Seq/SeqBuilder.pm loaded ok ok 288 - Bio/Seq/SeqFactory.pm loaded ok ok 289 - Bio/Seq/SeqFastaSpeedFactory.pm loaded ok ok 290 - Bio/Seq/SequenceTrace.pm loaded ok ok 291 - Bio/Seq/SimulatedRead.pm loaded ok ok 292 - Bio/Seq/TraceI.pm loaded ok ok 293 - Bio/SeqAnalysisParserI.pm loaded ok ok 294 - Bio/SeqFeature/Amplicon.pm loaded ok ok 295 - Bio/SeqFeature/AnnotationAdaptor.pm loaded ok ok 296 - Bio/SeqFeature/Collection.pm loaded ok ok 297 - Bio/SeqFeature/CollectionI.pm loaded ok ok 298 - Bio/SeqFeature/Computation.pm loaded ok ok 299 - Bio/SeqFeature/FeaturePair.pm loaded ok ok 300 - Bio/SeqFeature/Gene/Exon.pm loaded ok ok 301 - Bio/SeqFeature/Gene/ExonI.pm loaded ok ok 302 - Bio/SeqFeature/Gene/GeneStructure.pm loaded ok ok 303 - Bio/SeqFeature/Gene/GeneStructureI.pm loaded ok ok 304 - Bio/SeqFeature/Gene/Intron.pm loaded ok ok 305 - Bio/SeqFeature/Gene/NC_Feature.pm loaded ok ok 306 - Bio/SeqFeature/Gene/Poly_A_site.pm loaded ok ok 307 - Bio/SeqFeature/Gene/Promoter.pm loaded ok ok 308 - Bio/SeqFeature/Gene/Transcript.pm loaded ok ok 309 - Bio/SeqFeature/Gene/TranscriptI.pm loaded ok ok 310 - Bio/SeqFeature/Gene/UTR.pm loaded ok ok 311 - Bio/SeqFeature/Generic.pm loaded ok ok 312 - Bio/SeqFeature/Lite.pm loaded ok ok 313 - Bio/SeqFeature/PositionProxy.pm loaded ok ok 314 - Bio/SeqFeature/Primer.pm loaded ok ok 315 - Bio/SeqFeature/Similarity.pm loaded ok ok 316 - Bio/SeqFeature/SimilarityPair.pm loaded ok ok 317 - Bio/SeqFeature/SubSeq.pm loaded ok ok 318 - Bio/SeqFeature/Tools/FeatureNamer.pm loaded ok ok 319 - Bio/SeqFeature/Tools/IDHandler.pm loaded ok ok 320 - Bio/SeqFeature/Tools/TypeMapper.pm loaded ok ok 321 - Bio/SeqFeature/Tools/Unflattener.pm loaded ok ok 322 - Bio/SeqFeature/TypedSeqFeatureI.pm loaded ok ok 323 - Bio/SeqFeatureI.pm loaded ok ok 324 - Bio/SeqI.pm loaded ok ok 325 - Bio/SeqIO.pm loaded ok ok 326 - Bio/SeqIO/FTHelper.pm loaded ok ok 327 - Bio/SeqIO/Handler/GenericRichSeqHandler.pm loaded ok ok 328 - Bio/SeqIO/MultiFile.pm loaded ok ok 329 - Bio/SeqIO/ace.pm loaded ok ok 330 - Bio/SeqIO/asciitree.pm loaded ok ok 331 - Bio/SeqIO/bsml.pm loaded ok ok 332 - Bio/SeqIO/bsml_sax.pm loaded ok ok 333 - Bio/SeqIO/embl.pm loaded ok ok 334 - Bio/SeqIO/embldriver.pm loaded ok ok 335 - Bio/SeqIO/fasta.pm loaded ok ok 336 - Bio/SeqIO/fastq.pm loaded ok ok 337 - Bio/SeqIO/game.pm loaded ok ok 338 - Bio/SeqIO/game/featHandler.pm loaded ok ok 339 - Bio/SeqIO/game/gameHandler.pm loaded ok ok 340 - Bio/SeqIO/game/gameSubs.pm loaded ok ok 341 - Bio/SeqIO/game/gameWriter.pm loaded ok ok 342 - Bio/SeqIO/game/seqHandler.pm loaded ok ok 343 - Bio/SeqIO/gbdriver.pm loaded ok ok 344 - Bio/SeqIO/gbxml.pm loaded ok ok 345 - Bio/SeqIO/gcg.pm loaded ok ok 346 - Bio/SeqIO/genbank.pm loaded ok ok 347 - Bio/SeqIO/kegg.pm loaded ok ok 348 - Bio/SeqIO/largefasta.pm loaded ok ok 349 - Bio/SeqIO/locuslink.pm loaded ok ok 350 - Bio/SeqIO/mbsout.pm loaded ok ok 351 - Bio/SeqIO/metafasta.pm loaded ok ok 352 - Bio/SeqIO/msout.pm loaded ok ok 353 - Bio/SeqIO/phd.pm loaded ok ok 354 - Bio/SeqIO/pir.pm loaded ok ok 355 - Bio/SeqIO/qual.pm loaded ok ok 356 - Bio/SeqIO/raw.pm loaded ok ok 357 - Bio/SeqIO/scf.pm loaded ok ok 358 - Bio/SeqIO/seqxml.pm loaded ok ok 359 - Bio/SeqIO/swiss.pm loaded ok ok 360 - Bio/SeqIO/swissdriver.pm loaded ok ok 361 - Bio/SeqIO/tab.pm loaded ok ok 362 - Bio/SeqIO/table.pm loaded ok ok 363 - Bio/SeqIO/tigr.pm loaded ok ok 364 - Bio/SeqIO/tigrxml.pm loaded ok ok 365 - Bio/SeqIO/tinyseq.pm loaded ok ok 366 - Bio/SeqIO/tinyseq/tinyseqHandler.pm loaded ok ok 367 - Bio/SeqUtils.pm loaded ok ok 368 - Bio/SimpleAlign.pm loaded ok ok 369 - Bio/SimpleAnalysisI.pm loaded ok ok 370 - Bio/Species.pm loaded ok ok 371 - Bio/Taxon.pm loaded ok ok 372 - Bio/Tools/Alignment/Consed.pm loaded ok ok 373 - Bio/Tools/Alignment/Trim.pm loaded ok ok 374 - Bio/Tools/AmpliconSearch.pm loaded ok ok 375 - Bio/Tools/Analysis/SimpleAnalysisBase.pm loaded ok ok 376 - Bio/Tools/AnalysisResult.pm loaded ok ok 377 - Bio/Tools/Blat.pm loaded ok ok 378 - Bio/Tools/CodonTable.pm loaded ok ok 379 - Bio/Tools/Coil.pm loaded ok ok 380 - Bio/Tools/ECnumber.pm loaded ok ok 381 - Bio/Tools/EMBOSS/Palindrome.pm loaded ok ok 382 - Bio/Tools/EPCR.pm loaded ok ok 383 - Bio/Tools/ESTScan.pm loaded ok ok 384 - Bio/Tools/Eponine.pm loaded ok ok 385 - Bio/Tools/Est2Genome.pm loaded ok ok 386 - Bio/Tools/Fgenesh.pm loaded ok ok 387 - Bio/Tools/FootPrinter.pm loaded ok ok 388 - Bio/Tools/GFF.pm loaded ok ok 389 - Bio/Tools/Geneid.pm loaded ok ok 390 - Bio/Tools/Genemark.pm loaded ok ok 391 - Bio/Tools/Genewise.pm loaded ok ok 392 - Bio/Tools/Genomewise.pm loaded ok ok 393 - Bio/Tools/Genscan.pm loaded ok ok 394 - Bio/Tools/Glimmer.pm loaded ok ok 395 - Bio/Tools/Grail.pm loaded ok ok 396 - Bio/Tools/GuessSeqFormat.pm loaded ok ok 397 - Bio/Tools/IUPAC.pm loaded ok ok 398 - Bio/Tools/Lucy.pm loaded ok ok 399 - Bio/Tools/MZEF.pm loaded ok ok 400 - Bio/Tools/Match.pm loaded ok ok 401 - Bio/Tools/OddCodes.pm loaded ok ok 402 - Bio/Tools/Phylo/Gerp.pm loaded ok ok 403 - Bio/Tools/Phylo/Molphy.pm loaded ok ok 404 - Bio/Tools/Phylo/Molphy/Result.pm loaded ok ok 405 - Bio/Tools/Phylo/Phylip/ProtDist.pm loaded ok ok 406 - Bio/Tools/Prediction/Exon.pm loaded ok ok 407 - Bio/Tools/Prediction/Gene.pm loaded ok ok 408 - Bio/Tools/Primer/Assessor/Base.pm loaded ok ok 409 - Bio/Tools/Primer/AssessorI.pm loaded ok ok 410 - Bio/Tools/Primer/Feature.pm loaded ok ok 411 - Bio/Tools/Primer/Pair.pm loaded ok ok 412 - Bio/Tools/Primer3.pm loaded ok ok 413 - Bio/Tools/Prints.pm loaded ok ok 414 - Bio/Tools/Profile.pm loaded ok ok 415 - Bio/Tools/Promoterwise.pm loaded ok ok 416 - Bio/Tools/PrositeScan.pm loaded ok ok 417 - Bio/Tools/Pseudowise.pm loaded ok ok 418 - Bio/Tools/QRNA.pm loaded ok ok 419 - Bio/Tools/RandomDistFunctions.pm loaded ok ok 420 - Bio/Tools/RepeatMasker.pm loaded ok ok 421 - Bio/Tools/Run/Analysis.pm loaded ok ok 422 - Bio/Tools/Run/AnalysisFactory.pm loaded ok ok 423 - Bio/Tools/Run/GenericParameters.pm loaded ok ok 424 - Bio/Tools/Run/ParametersI.pm loaded ok ok 425 - Bio/Tools/Run/Phylo/PhyloBase.pm loaded ok ok 426 - Bio/Tools/Run/WrapperBase.pm loaded ok ok 427 - Bio/Tools/Run/WrapperBase/CommandExts.pm loaded ok ok 428 - Bio/Tools/Seg.pm loaded ok ok 429 - Bio/Tools/SeqPattern.pm loaded ok ok 430 - Bio/Tools/SeqPattern/Backtranslate.pm loaded ok ok 431 - Bio/Tools/SeqStats.pm loaded ok ok 432 - Bio/Tools/SeqWords.pm loaded ok ok 433 - Bio/Tools/Sigcleave.pm loaded ok ok 434 - Bio/Tools/Signalp.pm loaded ok ok 435 - Bio/Tools/Signalp/ExtendedSignalp.pm loaded ok ok 436 - Bio/Tools/Sim4/Exon.pm loaded ok ok 437 - Bio/Tools/Sim4/Results.pm loaded ok ok 438 - Bio/Tools/Spidey/Exon.pm loaded ok ok 439 - Bio/Tools/Spidey/Results.pm loaded ok ok 440 - Bio/Tools/TandemRepeatsFinder.pm loaded ok ok 441 - Bio/Tools/TargetP.pm loaded ok ok 442 - Bio/Tools/Tmhmm.pm loaded ok ok 443 - Bio/Tools/ipcress.pm loaded ok ok 444 - Bio/Tools/isPcr.pm loaded ok ok 445 - Bio/Tools/pICalculator.pm loaded ok ok 446 - Bio/Tools/tRNAscanSE.pm loaded ok ok 447 - Bio/Tree/AnnotatableNode.pm loaded ok ok 448 - Bio/Tree/Compatible.pm loaded ok ok 449 - Bio/Tree/DistanceFactory.pm loaded ok ok 450 - Bio/Tree/Node.pm loaded ok ok 451 - Bio/Tree/NodeI.pm loaded ok ok 452 - Bio/Tree/NodeNHX.pm loaded ok ok 453 - Bio/Tree/RandomFactory.pm loaded ok ok 454 - Bio/Tree/Statistics.pm loaded ok ok 455 - Bio/Tree/Tree.pm loaded ok ok 456 - Bio/Tree/TreeFunctionsI.pm loaded ok ok 457 - Bio/Tree/TreeI.pm loaded ok ok 458 - Bio/TreeIO.pm loaded ok ok 459 - Bio/TreeIO/NewickParser.pm loaded ok ok 460 - Bio/TreeIO/TreeEventBuilder.pm loaded ok ok 461 - Bio/TreeIO/cluster.pm loaded ok ok 462 - Bio/TreeIO/lintree.pm loaded ok ok 463 - Bio/TreeIO/newick.pm loaded ok ok 464 - Bio/TreeIO/nexus.pm loaded ok ok 465 - Bio/TreeIO/nhx.pm loaded ok ok 466 - Bio/TreeIO/pag.pm loaded ok ok 467 - Bio/TreeIO/phyloxml.pm loaded ok ok 468 - Bio/TreeIO/tabtree.pm loaded ok ok 469 - Bio/UpdateableSeqI.pm loaded ok ok 470 - Bio/WebAgent.pm loaded ok ok 471 - BioPerl.pm loaded ok ok 472 - bin/bp_aacomp compiled ok ok 473 - bin/bp_bioflat_index compiled ok ok 474 - bin/bp_biogetseq compiled ok ok 475 - bin/bp_dbsplit compiled ok ok 476 - bin/bp_extract_feature_seq compiled ok ok 477 - bin/bp_fastam9_to_table compiled ok ok 478 - bin/bp_fetch compiled ok ok 479 - bin/bp_filter_search compiled ok ok 480 - bin/bp_find-blast-matches compiled ok ok 481 - bin/bp_gccalc compiled ok ok 482 - bin/bp_genbank2gff3 compiled ok ok 483 - bin/bp_index compiled ok ok 484 - bin/bp_local_taxonomydb_query compiled ok ok 485 - bin/bp_make_mrna_protein compiled ok ok 486 - bin/bp_mask_by_search compiled ok ok 487 - bin/bp_mrtrans compiled ok ok 488 - bin/bp_mutate compiled ok ok 489 - bin/bp_nexus2nh compiled ok ok 490 - bin/bp_nrdb compiled ok ok 491 - bin/bp_oligo_count compiled ok ok 492 - bin/bp_process_gadfly compiled ok ok 493 - bin/bp_process_sgd compiled ok ok 494 - bin/bp_revtrans-motif compiled ok ok 495 - bin/bp_search2alnblocks compiled ok ok 496 - bin/bp_search2gff compiled ok ok 497 - bin/bp_search2table compiled ok ok 498 - bin/bp_search2tribe compiled ok ok 499 - bin/bp_seq_length compiled ok ok 500 - bin/bp_seqconvert compiled ok ok 501 - bin/bp_seqcut compiled ok ok 502 - bin/bp_seqpart compiled ok ok 503 - bin/bp_seqret compiled ok ok 504 - bin/bp_seqretsplit compiled ok ok 505 - bin/bp_split_seq compiled ok ok 506 - bin/bp_sreformat compiled ok ok 507 - bin/bp_taxid4species compiled ok ok 508 - bin/bp_taxonomy2tree compiled ok ok 509 - bin/bp_translate_seq compiled ok ok 510 - bin/bp_tree2pag compiled ok ok 511 - bin/bp_unflatten_seq compiled ok ok t/Align/AlignStats.t ................ 1..45 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::AlignIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::Matrix::PhylipDist' isa 'Bio::Matrix::PhylipDist' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 43 ok 44 - Warn if seqs don't overlap ok 45 ok t/Align/AlignUtil.t ................. 1..47 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/Align/SimpleAlign.t ............... 1..206 ok 1 - use Bio::SimpleAlign; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Location::Simple; ok 5 - use Bio::Location::Split; ok 6 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 7 - pfam input test ok 8 - match_line ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - num_sequences ok 11 - num_sequences ok 12 - select_noncont ok 13 - select_noncont ok 14 - num_sequences ok 15 - select_noncont ok 16 - select_noncont ok 17 - select_noncont_by_name ok 18 - select_noncont_by_name ok 19 - select_noncont_by_name ok 20 - select_noncont_by_name ok 21 - each_seq ok 22 - get_nse ok 23 - id ok 24 - num_gaps ok 25 - each_alphabetically ok 26 - column_from_residue_number ok 27 - display_name get/set ok 28 - display_name get ok 29 - consensus_string ok 30 - consensus_string ok 31 - consensus_string ok 32 ok 33 - each_seq_with_id ok 34 - is_flush ok 35 - id get/set ok 36 - length ok 37 - num_residues ok 38 - num_sequences ok 39 - overall_percentage_identity ok 40 - overall_percentage_identity (align) ok 41 - overall_percentage_identity (short) ok 42 - overall_percentage_identity (long) ok 43 - average_percentage_identity ok 44 ok 45 - set_displayname_count ok 46 ok 47 - set_displayname_flat ok 48 ok 49 - set_displayname_normal ok 50 ok 51 ok 52 - uppercase, map_chars ok 53 - match_line ok 54 - remove_seqs ok 55 - remove_seqs ok 56 - add_seq ok 57 - add_seq ok 58 - get_seq_by_pos ok 59 - get_seq_by_pos ok 60 ok 61 ok 62 ok 63 - purge ok 64 - purge ok 65 - IO::String consensus_iupac ok 66 - IO::String write_aln normal ok 67 - IO::String write_aln slice ok 68 - IO::String write_aln slice ok 69 - IO::String write_aln slice ok 70 - IO::String write_aln slice ok 71 - IO::String write_aln slice ok 72 ok 73 - remove_columns by position ok 74 - remove_columns by position (wrong order) ok 75 - cigar_line ok 76 - cigar_line ok 77 - cigar_line ok 78 - cigar_line ok 79 - sort_alphabetically - before ok 80 ok 81 - sort_alphabetically - after ok 82 - remove_gaps ok 83 - remove_gaps all_gaps_only ok 84 - set_new_reference ok 85 - set_new_reference ok 86 - uniq_seq ok 87 - bug 2099 ok 88 - bug 2099 ok 89 - bug 2793 ok 90 - bug 2793 ok 91 - bug 2793 ok 92 - bug 2793 ok 93 - Bad sequence, bad! ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 95 - added 3 seqs ok 96 - first 2 features added ok 97 - 3rd feature added ok 98 ok 99 - slice 1 len ok 100 - correct masked seq ok 101 - correct masked seq ok 102 - correct masked seq ok 103 ok 104 - slice 2 len ok 105 - correct masked seq ok 106 - correct masked seq ok 107 - correct masked seq ok 108 ok 109 - slice 3 len ok 110 - correct masked seq ok 111 - correct masked seq ok 112 - correct masked seq ok 113 ok 114 - slice 4 len ok 115 - correct masked seq ok 116 - correct masked seq ok 117 - correct masked seq ok 118 - initial display id ok ok 119 - safe display id ok ok 120 - restored display id ok ok 121 - sort by list ok ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 - BIC:GGATCCATT[C/C]CTACT ok 129 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT ok 130 - BIC:G[G/C]ATCCATT[C/G]CTACT ok 131 - BIC:GGATCCATT[C/G]CTACT ok 132 - BIC:GGATCCATT[C/G]CTAC[T/A] ok 133 - BIC:GGATCCATT[C/G]CTA[C/G][T/A] ok 134 - BIC:GGATCCATT[C/G]CTACT ok 135 - BIC:GGATCCATT{C.C}CTACT ok 136 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT ok 137 - BIC:G{G.C}ATCCATT{C.G}CTACT ok 138 - BIC:GGATCCATT{C.G}CTACT ok 139 - BIC:GGATCCATT{C.G}CTAC{T.A} ok 140 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A} ok 141 - BIC:GGATCCATT{C.G}CTACT ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 200 - consensus string looks ok ok 201 - conservation length ok 202 - conservation scores ok 203 - looks like correct unmasked alignment (from clustalw) ok 204 - looks like correct masked alignment (from clustalw) ok 205 ok 206 - align after looks ok ok t/Align/TreeBuild.t ................. 1..13 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::Align::Utilities; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Tree::DistanceFactory; ok 6 - use Bio::TreeIO; ok 7 - 'SimpleAlign object parsed out' isa 'Bio::SimpleAlign' ok 8 - 'Protein distance matrix retrieved' isa 'Bio::Matrix::MatrixI' ok 9 - 'Tree object gotten back' isa 'Bio::Tree::TreeI' ok 10 - NJ calculated Branch length ok 11 - NJ calculated Branch length ok 12 - Make sure two nodes are sister ok 13 - 10 replicates formulated ok t/Align/Utilities.t ................. 1..14 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::SimpleAlign; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::AlignIO; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/AlignIO/AlignIO.t ................. 1..27 ok 1 - use Bio::AlignIO; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 3 - input filehandle method test : metafasta ok 4 - input filehandle method test : prodom ok 5 - input filehandle method test : selex ok 6 - input filehandle method test : clustalw ok 7 - input filehandle method test : arp ok 8 - input filehandle method test : pfam ok 9 - input filehandle method test : po ok 10 - input filehandle method test : mase ok 11 - input filehandle method test : psi ok 12 - input filehandle method test : msf ok 13 - input filehandle method test : phylip ok 14 - input filehandle method test : xmfa ok 15 - input filehandle method test : nexus ok 16 - input filehandle method test : fasta ok 17 - filehandle output test : metafasta ok 18 - filehandle output test : selex ok 19 - filehandle output test : clustalw ok 20 - filehandle output test : pfam ok 21 - filehandle output test : po ok 22 - filehandle output test : psi ok 23 - filehandle output test : msf ok 24 - filehandle output test : phylip ok 25 - filehandle output test : xmfa ok 26 - filehandle output test : nexus ok 27 - filehandle output test : fasta ok t/AlignIO/arp.t ..................... 1..48 ok 1 - use Bio::AlignIO::arp; ok 2 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 - ARP get_nse() ok 5 ok 6 - ARP num_sequences() ok 7 - ARP id() ok 8 - ARP description() ok 9 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 10 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 - ARP get_nse() ok 18 - ARP num_sequences() ok 19 - ARP id() ok 20 - ARP description() ok 21 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 22 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 23 ok 24 ok 25 ok 26 ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - ARP get_nse() ok 29 - ARP num_sequences() ok 30 - ARP id() ok 31 - ARP description() ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 33 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 34 ok 35 ok 36 ok 37 ok 38 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 39 - ARP get_nse() ok 40 - ARP num_sequences() ok 41 - ARP id() ok 42 - ARP description() ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 44 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 45 ok 46 ok 47 ok 48 ok t/AlignIO/bl2seq.t .................. 1..7 ok 1 - use Bio::AlignIO::bl2seq; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - BLAST bl2seq format test ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok t/AlignIO/clustalw.t ................ 1..6 ok 1 - use Bio::AlignIO::clustalw; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - clustalw consensus_string test ok 4 - clustalw output test ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - clustalw input test ok t/AlignIO/emboss.t .................. 1..37 ok 1 - use Bio::AlignIO::emboss; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 19 ok 20 ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 33 ok 34 ok 35 ok 36 ok 37 ok t/AlignIO/fasta.t ................... 1..12 ok 1 - use Bio::AlignIO::fasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test ok 5 - fasta input test for description ok 6 - fasta input test for id ok 7 - fasta input test, captures formatted start/end ok 8 - fasta input test for end ok 9 - fasta input test for description ok 10 - fasta output test ok 11 - filehandle input test ok 12 - filehandle output test ok t/AlignIO/largemultifasta.t ......... 1..7 ok 1 - use Bio::AlignIO::largemultifasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for description ok 7 - fasta output test ok t/AlignIO/maf.t ..................... 1..11 ok 1 - use Bio::AlignIO::maf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - maf input test ok 4 ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - maf input test ok 7 ok 8 - maf input test ok 9 ok 10 - maf input test ok 11 ok t/AlignIO/mase.t .................... 1..3 ok 1 - use Bio::AlignIO::mase; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - mase input test ok t/AlignIO/mega.t .................... 1..6 ok 1 - use Bio::AlignIO::mega; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 - mega output test ok t/AlignIO/meme.t .................... 1..20 ok 1 - use Bio::AlignIO::meme; ok 2 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 ok 18 ok 19 ok 20 ok t/AlignIO/metafasta.t ............... 1..4 ok 1 - use Bio::AlignIO::metafasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - consensus_string on metafasta ok 4 - symbol_chars() using metafasta ok t/AlignIO/msf.t ..................... 1..4 ok 1 - use Bio::AlignIO::msf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - msf input test ok 4 - msf output test ok t/AlignIO/nexus.t ................... 1..43 ok 1 - use Bio::AlignIO::nexus; ok 2 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - nexus output test ok 6 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 11 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 12 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 15 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 16 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 20 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 23 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 24 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 25 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 26 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 33 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 34 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 35 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 36 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 40 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 41 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 42 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 43 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok t/AlignIO/pfam.t .................... 1..5 ok 1 - use Bio::AlignIO::pfam; ok 2 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - pfam output test ok t/AlignIO/phylip.t .................. 1..20 ok 1 - use Bio::AlignIO::phylip; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 - phylip output test ok 12 ok 13 ok 14 ok 15 not ok 16 # TODO problems with default strand # Failed (TODO) test at t/AlignIO/phylip.t line 77. # got: undef # expected: '0' ok 17 - newline between header and sequences is parsed correctly ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 20 ok t/AlignIO/po.t ...................... 1..11 ok 1 - use Bio::AlignIO::po; ok 2 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 6 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 7 - po output test ok 8 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok t/AlignIO/prodom.t .................. 1..3 ok 1 - use Bio::AlignIO::prodom; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - prodom input test ok t/AlignIO/psi.t ..................... 1..5 ok 1 - use Bio::AlignIO::psi; ok 2 - An object of class 'Bio::AlignIO::psi' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok t/AlignIO/selex.t ................... 1..4 ok 1 - use Bio::AlignIO::selex; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - selex format test ok 4 - selex output test ok t/AlignIO/xmfa.t .................... 1..30 ok 1 - use Bio::AlignIO::xmfa; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - xmfa input test ok 4 - xmfa input test for start ok 5 - xmfa input test for end ok 6 - xmfa strand test ok 7 - xmfa input test for id ok 8 - xmfa input test for id ok 9 - xmfa input test ok 10 - xmfa input test for start ok 11 - xmfa input test for end ok 12 - xmfa strand test ok 13 - xmfa input test for id ok 14 - xmfa input test for id ok 15 - xmfa input test ok 16 - xmfa input test for start ok 17 - xmfa input test for end ok 18 - xmfa strand test ok 19 - xmfa input test for id ok 20 - xmfa input test for id ok 21 - xmfa alignment score ok 22 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 23 - xmfa input test ok 24 - xmfa strand ok 25 - xmfa input test for description ok 26 - xmfa input test for id ok 27 - xmfa input test for end ok 28 - xmfa input test for end ok 29 - xmfa alignment score ok 30 - xmfa output test ok t/Annotation/Annotation.t ........... 1..148 ok 1 - use Bio::Annotation::Collection; ok 2 - use Bio::Annotation::DBLink; ok 3 - use Bio::Annotation::Comment; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Target; ok 7 - use Bio::Annotation::AnnotationFactory; ok 8 - use Bio::Annotation::StructuredValue; ok 9 - use Bio::Annotation::TagTree; ok 10 - use Bio::Annotation::Tree; ok 11 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::AnnotationI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::AnnotationI' ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 23 ok 24 ok 25 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 26 ok 27 - An object of class 'Bio::Annotation::Reference' isa 'Bio::AnnotationI' ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::AnnotationI' ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 66 ok 67 ok 68 ok 69 ok 70 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::Annotation::StructuredValue' ok 71 ok 72 ok 73 ok 74 ok 75 - use Bio::Annotation::OntologyTerm; ok 76 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::Term' ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 - An object of class 'Bio::Annotation::AnnotationFactory' isa 'Bio::Factory::ObjectFactoryI' ok 83 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 84 ok 85 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Annotation::OntologyTerm' ok 86 - Bio::Annotation::Comment ok 87 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 88 ok 89 - Bio::Annotation::Comment ok 90 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 91 - Bio::Annotation::Comment ok 92 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 93 ok 94 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::Target' ok 95 ok 96 ok 97 - An object of class 'Bio::Annotation::Tree' isa 'Bio::AnnotationI' ok 98 - tree_id() ok 99 - tagname() ok 100 ok 101 - add tree to AlignI ok 102 - get seq from node id ok 103 ok 104 - An object of class 'Bio::Annotation::Tree' isa 'Bio::Annotation::Tree' ok 105 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 106 - default itext ok 107 - roundtrip ok 108 - itext ok 109 - spxr ok 110 - indent ok 111 - xml ok 112 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 113 ok 114 - child changes ok 115 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 116 ok 117 - child changes ok 118 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 119 ok 120 - child changes ok 121 - child changes in parent node ok 122 - no tags ok 123 - before Stag node ok 124 - after Stag node ok 125 - both stag nodes ok 126 - different instances ok 127 - before TagTree ok 128 - after TagTree ok 129 - both stag nodes ok 130 - different instances ok 131 - before TagTree ok 132 - after TagTree ok 133 - stag nodes ok 134 - same instance ok 135 - before TagTree ok 136 - after TagTree ok 137 - stag nodes ok 138 - different instance ok 139 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 140 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 141 - child changes ok 142 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 143 - child changes ok 144 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 145 - child changes ok 146 ok 147 ok 148 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::Annotation::TagTree' ok t/Annotation/AnnotationAdaptor.t .... 1..23 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::AnnotationAdaptor; ok 3 - use Bio::Annotation::DBLink; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/author-mojibake.t ................. skipped: these tests are for testing by the author t/author-pod-syntax.t ............... skipped: these tests are for testing by the author Subroutine new redefined at /build/bioperl-QLxev6/bioperl-1.7.8/blib/lib/Bio/DB/IndexedBase.pm line 1121. Subroutine next_seq redefined at /build/bioperl-QLxev6/bioperl-1.7.8/blib/lib/Bio/DB/IndexedBase.pm line 1130. Subroutine TIEHANDLE redefined at /build/bioperl-QLxev6/bioperl-1.7.8/blib/lib/Bio/DB/IndexedBase.pm line 1139. Subroutine READLINE redefined at /build/bioperl-QLxev6/bioperl-1.7.8/blib/lib/Bio/DB/IndexedBase.pm line 1144. t/LocalDB/Fasta.t ................... 1..109 ok 1 - Index a directory ok 2 ok 3 - An object of class 'Bio::DB::Fasta' isa 'Bio::DB::Fasta' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 29 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - bug 3126 ok 38 ok 39 ok 40 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 41 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 46 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 47 ok 48 ok 49 - use Class::Unload; ok 50 - Re-open an existing index ok 51 ok 52 - Tied hash access ok 53 ok 54 ok 55 ok 56 ok 57 - Writing with SeqIO ok 58 ok 59 ok 60 - Index a single file ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 73 ok 74 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - Make single ID ok 91 ok 92 ok 93 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 94 - Make multiple IDs, bug \#3389 ok 95 ok 96 ok 97 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 98 - Index a set of files ok 99 ok 100 ok 101 ok 102 ok 103 - threw Regexp ((?^:FASTA header doesn't match)) ok 104 - threw Regexp ((?^:Blank lines can only precede header lines)) ok 105 ok 106 - length is correct in sequences past spaces ok 107 ok 108 - subseq is correct ok 109 - subseq is correct ok t/LocalDB/Flat.t .................... 1..27 ok 1 - use Bio::DB::Flat; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/LocalDB/Index/Blast.t ............. 1..5 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::Blast; # Subtest: BLASTP 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 4 - BLASTP # Subtest: RPS-BLAST 1..11 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 5 - RPS-BLAST ok t/LocalDB/Index/BlastTable.t ........ 1..27 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::BlastTable; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/LocalDB/Index/Index.t ............. 1..65 ok 1 - use Bio::Index::Fasta; ok 2 - use Bio::Index::Qual; ok 3 - use Bio::Index::SwissPfam; ok 4 - use Bio::Index::EMBL; ok 5 - use Bio::Index::GenBank; ok 6 - use Bio::Index::Swissprot; ok 7 - use Bio::DB::InMemoryCache; ok 8 - use Bio::DB::InMemoryCache; ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 18 ok 19 ok 20 ok 21 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok t/LocalDB/Qual.t .................... 1..56 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 - An object of class 'Bio::DB::Qual' isa 'Bio::DB::Qual' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 23 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 38 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 43 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 49 ok 50 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 51 ok 52 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 53 ok 54 ok 55 ok 56 ok --------------------- WARNING --------------------- MSG: Couldn't load Bio::DB::BioFetch --------------------------------------------------- --------------------- WARNING --------------------- MSG: Couldn't load Bio::DB::BioFetch --------------------------------------------------- t/LocalDB/Registry.t ................ 1..14 ok 1 - use Bio::DB::Registry; ok 2 - use Bio::DB::Flat; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/LocalDB/Taxonomy/greengenes.t ..... 1..38 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::greengenes' ok 5 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/LocalDB/Taxonomy/silva.t .......... 1..42 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::silva' ok 5 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok t/Matrix/InstanceSite.t ............. 1..6 ok 1 - use Bio::Matrix::PSM::InstanceSite; ok 2 ok 3 ok 4 ok 5 ok 6 ok t/Matrix/IO/masta.t ................. 1..16 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/Matrix/IO/psm.t ................... 1..63 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Matrix/Matrix.t ................... 1..77 ok 1 - use Bio::Matrix::Generic; ok 2 - use Bio::Matrix::IO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok t/Matrix/ProtMatrix.t ............... 1..14 ok 1 - use Bio::Matrix::PSM::ProtMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Matrix/ProtPsm.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 # skip TODO: Module incomplete ok 6 # skip TODO: Module incomplete ok 7 # skip TODO: Module incomplete ok 8 # skip TODO: Module incomplete ok 9 # skip TODO: Module incomplete ok 10 # skip TODO: Module incomplete ok 11 # skip TODO: Module incomplete ok 12 # skip TODO: Module incomplete ok 13 # skip TODO: Module incomplete ok 14 # skip TODO: Module incomplete ok t/Matrix/SiteMatrix.t ............... 1..14 ok 1 - use Bio::Matrix::PSM::SiteMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Ontology/GOterm.t ................. 1..62 ok 1 - use Bio::Ontology::GOterm; ok 2 - use Bio::Ontology::Ontology; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok t/Ontology/GraphAdaptor.t ........... 1..28 ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Ontology/IO/go.t .................. 1..102 ok 1 - use Bio::OntologyIO; ok 2 ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::OntologyI' ok 4 ok 5 - An object of class 'Bio::Ontology::OBOEngine' isa 'Bio::Ontology::OntologyEngineI' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/Ontology/IO/interpro.t ............ 1..69 ok 1 - use Bio::OntologyIO; ok 2 - An object of class 'Bio::OntologyIO::InterProParser' isa 'Bio::OntologyIO::InterProParser' ok 3 ok 4 - get_dbxrefs on leaf terms is non-empty ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty ok 11 - get_members on leaf terms is non-empty ok 12 - class_list on leaf terms is non-empty ok 13 - get_examples on leaf terms is non-empty ok 14 - get_external_documents on leaf terms is non-empty ok 15 - get_references on leaf terms is non-empty ok 16 - protein_count on leaf terms is non-empty ok 17 - to_string looks reasonable ok 18 - There are 8 root InterPro terms ok 19 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 20 - term post-translational modification in ontology InterPro ok 21 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 22 - term Repeat in ontology InterPro ok 23 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 24 - term Kringle in ontology InterPro ok 25 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 26 - term Conserved Site in ontology InterPro ok 27 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 28 - term Helix-turn-helix, AraC type in ontology InterPro ok 29 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 30 - term Active Site in ontology InterPro ok 31 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 32 - term Region in ontology InterPro ok 33 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 34 - term Binding Site in ontology InterPro ok 35 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 36 - term Cdc20/Fizzy in ontology InterPro ok 37 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 38 - term Integrins alpha chain in ontology InterPro ok 39 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 40 - term Active Site in ontology InterPro ok 41 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 42 - term Binding Site in ontology InterPro ok 43 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 44 - term Conserved Site in ontology InterPro ok 45 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 46 - term Domain in ontology InterPro ok 47 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 48 - term Family in ontology InterPro ok 49 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 50 - term Region in ontology InterPro ok 51 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 52 - term Repeat in ontology InterPro ok 53 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 54 - term post-translational modification in ontology InterPro ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Kringle term has one parent ok 62 - Kringle term has one ancestor ok 63 - Helix-turn-helix, AraC type term has one parent ok 64 - Helix-turn-helix, AraC type term has one ancestor ok 65 - Cdc20/Fizzy term has one parent ok 66 - Cdc20/Fizzy term has one ancestor ok 67 - Integrins alpha chain term has one parent ok 68 - Integrins alpha chain term has one ancestor ok 69 - secondary accession map has 2 keys ok t/Ontology/IO/obo.t ................. 1..92 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 47 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 48 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 49 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 50 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 51 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 52 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 53 - Gene ontology ok 54 - biological process ok 55 - molecular function ok 56 - Got root ok 57 - Got root ok 58 - Got regulates # from gene_ontology ok 59 - Got # positively regulates from gene_ontology ok 60 - Got # regulates from biological_process ok 61 - Got # positively regulates from biological_process ok 62 - Got predicates for gene_ontology ok 63 - Got predicates for biological_process ok 64 - Got regulates predicate ok 65 - Got positively regulates predicate ok 66 - Got relationships for biological_process ok 67 - Got relationships for molecular_function ok 68 - Got is a relationship from # molecular_function ok 69 - 'Got term object' isa 'Bio::Ontology::Term' ok 70 - Got term id ok 71 - Got term name ok 72 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 73 - Got regulated term1 id ok 74 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 75 - Got back the child ok 76 - 'Got term object' isa 'Bio::Ontology::Term' ok 77 - Got term id ok 78 - Got term name ok 79 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 80 - Got regulated term1 id ok 81 - Got identical regulation ok 82 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 83 - Got back the child ok 84 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok t/Ontology/Ontology.t ............... 1..55 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - Interpro XML file interpro.xml can be parsed ok 54 - Interpro XML file interpro_sample.xml can be parsed ok 55 - Interpro XML file interpro_relationship.xml can be parsed ok t/Ontology/OntologyEngine.t ......... 1..31 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::Relationship; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - use Bio::Ontology::SimpleOntologyEngine; ok 5 - use Bio::Ontology::Ontology; ok 6 - An object of class 'Bio::Ontology::SimpleOntologyEngine' isa 'Bio::Ontology::OntologyEngineI' ok 7 ok 8 - adding a relationship with an undef object term fails ok 9 - adding a relationship with an undef object term fails ok 10 - adding a relationship with an undef subject term fails ok 11 - adding a relationship with an undef subject term fails ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/Ontology/OntologyStore.t .......... 1..6 ok 1 - use Bio::Ontology::OntologyStore; ok 2 ok 3 # skip Couldn't get sequence ontology, network problems? Skipping these tests ok 4 # skip Couldn't get sequence ontology, network problems? Skipping these tests ok 5 # skip Couldn't get sequence ontology, network problems? Skipping these tests ok 6 # skip Couldn't get sequence ontology, network problems? Skipping these tests ok t/Ontology/Relationship.t ........... 1..12 ok 1 - use Bio::Ontology::Relationship; ok 2 - use Bio::Ontology::GOterm; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 5 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 6 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 7 - An object of class 'Bio::Ontology::Relationship' isa 'Bio::Ontology::Relationship' ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Ontology/RelationshipType.t ....... 1..23 ok 1 - use Bio::Ontology::RelationshipType; ok 2 - use Bio::Ontology::Ontology; ok 3 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Ontology/Term.t ................... 1..54 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::TermFactory; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 45 ok 46 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::TermI' ok 47 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Ontology::TermI' ok 51 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::AnnotationI' ok 52 ok 53 ok 54 ok t/RemoteDB/SeqRead_fail.t ........... 1..12 ok 1 # skip failed to use Bio::DB::BioFetch (guessing it's not available) ok 2 # skip failed to use Bio::DB::BioFetch (guessing it's not available) ok 3 # skip failed to use Bio::DB::GenBank (guessing it's not available) ok 4 # skip failed to use Bio::DB::GenBank (guessing it's not available) ok 5 # skip failed to use Bio::DB::GenPept (guessing it's not available) ok 6 # skip failed to use Bio::DB::GenPept (guessing it's not available) ok 7 # skip failed to use Bio::DB::SwissProt (guessing it's not available) ok 8 # skip failed to use Bio::DB::SwissProt (guessing it's not available) ok 9 # skip failed to use Bio::DB::RefSeq (guessing it's not available) ok 10 # skip failed to use Bio::DB::RefSeq (guessing it's not available) ok 11 # skip failed to use Bio::DB::EMBL (guessing it's not available) ok 12 # skip failed to use Bio::DB::EMBL (guessing it's not available) ok t/RemoteDB/Taxonomy.t ............... 1..152 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy::flatfile' ok 5 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy' ok 6 - removal of temporary index files: no -directory ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - removal of temporary index files: test_output_dir() ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - Bio::DB::Taxonomy::flatfile: common names ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy::list' ok 63 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy' ok 64 ok 65 ok 66 ok 67 ok 68 - Ranks ok 69 ok 70 ok 71 - Ranks ok 72 ok 73 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 91 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 92 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 93 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 94 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 95 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 96 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 97 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 98 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 - List context ok 111 - 'Scalar context' isa 'SCALAR' ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 - DB with ambiguous names ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok t/Root/Exception.t .................. 1..7 ok 1 - use Bio::Root::TestObject; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok t/Root/HTTPget.t .................... 1..29 ok 1 - use Bio::Root::HTTPget; ok 2 ok 3 ok 4 ok 5 - An object of class 'IO::Socket::INET' isa 'IO::Socket::INET' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'IO::Socket::INET' isa 'IO::Socket::INET' ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'IO::Socket::INET' isa 'IO::Socket::INET' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok t/Root/IO.t ......................... 1..154 ok 1 - use Bio::Root::IO; ok 2 ok 3 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 4 - Throw ok 5 - threw Regexp ((?^:Testing throw)) ok 6 - Warn ok 7 - threw Regexp ((?^:Testing throw)) ok 8 - Stack trace ok 9 ok 10 - Verbosity ok 11 ok 12 ok 13 ok 14 - executable file ok 15 - non-executable file ok 16 - executable dir ok 17 ok 18 ok 19 ok 20 - Read from file ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - Write to file ok 31 ok 32 ok 33 ok 34 ok 35 - Read+write to file ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - Read from File::Temp handle ok 47 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 48 - is a write handle ok 49 - no warnings in ->close() ok 50 ok 51 - Exclusive arguments ok 52 - threw Regexp ((?^:Input file given twice)) ok 53 - threw Regexp ((?^:File or filehandle provided with -string)) ok 54 - threw Regexp ((?^:Providing both a file and a filehandle for reading)) ok 55 - threw Regexp ((?^:File or filehandle provided with -string)) ok 56 - threw Regexp ((?^:File or filehandle provided with -string)) ok 57 - Same file ok 58 - Pushback ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 - _print ok 72 ok 73 - _insert at middle of file ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - _insert in empty file ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: # ok 110 ok 111 ok 112 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: # ok 113 ok 114 ok 115 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: # ok 116 ok 117 ok 118 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: # ok 119 ok 120 ok 121 ok 122 - Bio::Root::IO->new can handle a Path::Class object ok 123 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 124 - Read string ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 137 - A reference of type 'GLOB' isa 'GLOB' ok 138 ok 139 ok 140 - auto UNLINK => 1 ok 141 ok 142 ok 143 - tempfile deleted ok 144 - A reference of type 'GLOB' isa 'GLOB' ok 145 ok 146 - UNLINK => 0 ok 147 ok 148 ok 149 - A reference of type 'GLOB' isa 'GLOB' ok 150 - tempfile suffix ok 151 ok 152 - A reference of type 'GLOB' isa 'GLOB' ok 153 - tempfile() in scalar context ok 154 ok t/Root/RootI.t ...................... 1..43 ok 1 - use Bio::Root::Root; ok 2 ok 3 - An object of class 'Bio::Root::Root' isa 'Bio::Root::RootI' ok 4 - threw Regexp ((?^:Testing throw)) ok 5 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented)) ok 6 - threw Regexp ((?^:EXCEPTION )) ok 7 - threw Regexp ((?^:Testing throw)) ok 8 ok 9 - threw Regexp ((?^:Testing throw)) ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - arg callable since method was created ok 16 - mal-formed arg callable since method was created with good name ok 17 - Bio::Foo2->can('t3') ok 18 - Methods don't pollute original Bio::Root::Root namespace ok 19 - Bio::Foo2->can('test_4') ok 20 - Methods don't pollute original Bio::Root::Root namespace ok 21 - Bio::Foo3->can('t5') ok 22 - arg not in method list not created ok 23 - Bio::Foo3->can('t5') ok 24 - Methods don't pollute original Bio::Root::Root namespace ok 25 - verbose was set correctly ok 26 - synonym was set correctly ok 27 - real method of synonym was set correctly ok 28 - mal-formed arg correctly resolved to created method ok 29 - synonym of set method was set correctly ok 30 - Bio::Foo4->can('t7') ok 31 - Methods don't pollute original Bio::Root::Root namespace ok 32 - Bio::Foo4->can('test7') ok 33 - Methods don't pollute original Bio::Root::Root namespace ok 34 - Bio::Foo4->can('test_8') ok 35 - Methods don't pollute original Bio::Root::Root namespace ok 36 - Bio::Foo4->can('t8') ok 37 - Methods don't pollute original Bio::Root::Root namespace ok 38 - clone ok 39 - clone ok 40 - clone ok 41 - clone changed, original didn't ok 42 - parameters passed to clone() modify object ok 43 - original is not modified ok t/Root/RootIO.t ..................... 1..3 ok 1 - use Bio::Root::IO; ok 2 - default -url method ok 3 ok t/Root/Storable.t ................... 1..35 ok 1 - use Bio::Root::Storable; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip. --------------------------------------------------- t/Root/Utilities.t .................. 1..56 ok 1 - use Bio::Root::Utilities; ok 2 - An object of class 'Bio::Root::Utilities' isa 'Bio::Root::Utilities' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - file_date() ok 38 - unix (\n or 012 or ^J) ok 39 - date format ok 40 - date format ok 41 - date format ok 42 - date format ok 43 - date format ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok t/SearchIO/axt.t .................... 1..19 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/SearchIO/blast.t .................. 1..1389 ok 1 - use Bio::SearchIO; ok 2 - Bio::SearchIO->new can handle a Path::Class object ok 3 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 4 - Bio::SearchIO->new can handle a Path::Class object ok 5 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 6 ok 7 - database_name() ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 not ok 415 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 667. # '0.852' # > # '0.9' not ok 416 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 668. # '1.599' # <= # '1' ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 - Multiblast query test ok 598 ok 599 - Multiblast query test ok 600 ok 601 - Multiblast query test ok 602 ok 603 - Multiblast query test ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 ok 979 ok 980 ok 981 ok 982 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 ok 1007 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 ok 1055 ok 1056 ok 1057 ok 1058 ok 1059 ok 1060 ok 1061 ok 1062 ok 1063 ok 1064 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1065 ok 1066 ok 1067 ok 1068 ok 1069 ok 1070 ok 1071 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 - blast for f.tblx ok 1084 - blast for filename.bls ok 1085 - fasta for f.m9 ok 1086 - fasta for f.fx ok 1087 - blastxml for f.blastxml ok 1088 - fasta for f.SSEARCH.m9 ok 1089 - blast for f.blx ok 1090 - blast for fast.bls ok 1091 - fasta for f.psearch ok 1092 - exonerate for f.exon ok 1093 - blastxml for f.xml ok 1094 - fasta for f.ssearch ok 1095 - fasta for f.fy ok 1096 - fasta for f.fasta ok 1097 - fasta for f.osearch ok 1098 - fasta for f.fa ok 1099 - exonerate for f.exonerate ok 1100 - blast for filename.blast ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 - full hit name ok 1117 - hit accession ok 1118 ok 1119 ok 1120 - query start ok 1121 - query start ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok 1146 ok 1147 ok 1148 ok 1149 ok 1150 ok 1151 ok 1152 ok 1153 ok 1154 ok 1155 ok 1156 ok 1157 ok 1158 ok 1159 ok 1160 ok 1161 ok 1162 ok 1163 ok 1164 ok 1165 ok 1166 ok 1167 ok 1168 ok 1169 ok 1170 ok 1171 ok 1172 ok 1173 ok 1174 ok 1175 ok 1176 ok 1177 ok 1178 ok 1179 ok 1180 ok 1181 ok 1182 ok 1183 ok 1184 ok 1185 ok 1186 ok 1187 ok 1188 ok 1189 ok 1190 ok 1191 ok 1192 ok 1193 ok 1194 ok 1195 ok 1196 ok 1197 ok 1198 ok 1199 ok 1200 ok 1201 ok 1202 ok 1203 ok 1204 ok 1205 ok 1206 ok 1207 ok 1208 ok 1209 ok 1210 ok 1211 ok 1212 ok 1213 ok 1214 ok 1215 ok 1216 ok 1217 ok 1218 ok 1219 ok 1220 ok 1221 ok 1222 ok 1223 ok 1224 ok 1225 ok 1226 ok 1227 ok 1228 ok 1229 ok 1230 ok 1231 ok 1232 ok 1233 ok 1234 ok 1235 ok 1236 ok 1237 ok 1238 ok 1239 ok 1240 ok 1241 ok 1242 ok 1243 ok 1244 ok 1245 ok 1246 ok 1247 ok 1248 ok 1249 ok 1250 ok 1251 ok 1252 ok 1253 ok 1254 ok 1255 ok 1256 ok 1257 ok 1258 ok 1259 ok 1260 ok 1261 ok 1262 ok 1263 ok 1264 ok 1265 ok 1266 ok 1267 ok 1268 ok 1269 ok 1270 ok 1271 ok 1272 ok 1273 ok 1274 ok 1275 ok 1276 ok 1277 ok 1278 ok 1279 ok 1280 ok 1281 ok 1282 ok 1283 ok 1284 ok 1285 ok 1286 ok 1287 ok 1288 ok 1289 ok 1290 ok 1291 ok 1292 ok 1293 ok 1294 ok 1295 ok 1296 ok 1297 ok 1298 ok 1299 ok 1300 ok 1301 ok 1302 ok 1303 ok 1304 ok 1305 ok 1306 ok 1307 ok 1308 ok 1309 ok 1310 ok 1311 ok 1312 ok 1313 ok 1314 ok 1315 ok 1316 ok 1317 ok 1318 ok 1319 ok 1320 ok 1321 ok 1322 ok 1323 ok 1324 ok 1325 ok 1326 ok 1327 ok 1328 ok 1329 ok 1330 ok 1331 ok 1332 ok 1333 ok 1334 ok 1335 ok 1336 ok 1337 ok 1338 ok 1339 ok 1340 ok 1341 ok 1342 ok 1343 ok 1344 ok 1345 ok 1346 ok 1347 ok 1348 ok 1349 ok 1350 ok 1351 ok 1352 ok 1353 ok 1354 ok 1355 ok 1356 ok 1357 ok 1358 ok 1359 ok 1360 ok 1361 ok 1362 ok 1363 ok 1364 ok 1365 ok 1366 ok 1367 ok 1368 ok 1369 ok 1370 ok 1371 ok 1372 ok 1373 ok 1374 ok 1375 ok 1376 ok 1377 ok 1378 ok 1379 ok 1380 ok 1381 ok 1382 ok 1383 ok 1384 - testing Bug 3298 ok 1385 - testing Bug 3298 ok 1386 - testing Bug 3298 ok 1387 - testing Bug 3251 ok 1388 - testing Bug 3251 ok 1389 - testing Bug 3251 ok t/SearchIO/blast_pull.t ............. 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - database_name() ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 not ok 191 # TODO frac_identical failing! # Failed (TODO) test at t/SearchIO/blast_pull.t line 259. # got: '0.946' # expected: '0.943' ok 192 ok 193 ok 194 ok 195 ok 196 - Multiblast query test ok 197 - Multiblast query test ok 198 - Multiblast query test ok 199 - Multiblast query test ok 200 ok 201 ok 202 ok 203 - full hit name ok 204 - hit accession ok 205 ok 206 - query start ok 207 - query start ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok t/SearchIO/blasttable.t ............. 1..166 ok 1 - use Bio::SearchIO; ok 2 - use Bio::Search::SearchUtils; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 - hit1_bits ok 7 - hit1_name ok 8 - hsp1_bits ok 9 - hsp1_gaps ok 10 - hsp1_he ok 11 - hsp1_hs ok 12 - hsp1_hstr ok 13 - hsp1_qe ok 14 - hsp1_qs ok 15 - hsp1_qstr ok 16 - hsp2_bits ok 17 - hsp2_gaps ok 18 - hsp2_he ok 19 - hsp2_hs ok 20 - hsp2_hstr ok 21 - hsp2_qe ok 22 - hsp2_qs ok 23 - hsp2_qstr ok 24 - hsp3_bits ok 25 - hsp3_gaps ok 26 - hsp3_he ok 27 - hsp3_hs ok 28 - hsp3_hstr ok 29 - hsp3_qe ok 30 - hsp3_qs ok 31 - hsp3_qstr ok 32 - hsp4_bits ok 33 - hsp4_gaps ok 34 - hsp4_he ok 35 - hsp4_hs ok 36 - hsp4_hstr ok 37 - hsp4_qe ok 38 - hsp4_qs ok 39 - hsp4_qstr ok 40 - hsp5_bits ok 41 - hsp5_gaps ok 42 - hsp5_he ok 43 - hsp5_hs ok 44 - hsp5_hstr ok 45 - hsp5_qe ok 46 - hsp5_qs ok 47 - hsp5_qstr ok 48 - hsp6_bits ok 49 - hsp6_gaps ok 50 - hsp6_he ok 51 - hsp6_hs ok 52 - hsp6_hstr ok 53 - hsp6_qe ok 54 - hsp6_qs ok 55 - hsp6_qstr ok 56 - hsp7_bits ok 57 - hsp7_gaps ok 58 - hsp7_he ok 59 - hsp7_hs ok 60 - hsp7_hstr ok 61 - hsp7_qe ok 62 - hsp7_qs ok 63 - hsp7_qstr ok 64 - hsp8_bits ok 65 - hsp8_gaps ok 66 - hsp8_he ok 67 - hsp8_hs ok 68 - hsp8_hstr ok 69 - hsp8_qe ok 70 - hsp8_qs ok 71 - hsp8_qstr ok 72 - query_name ok 73 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 74 ok 75 ok 76 - hit1_bits ok 77 - hit1_name ok 78 - hsp1_bits ok 79 - hsp1_gaps ok 80 - hsp1_he ok 81 - hsp1_hs ok 82 - hsp1_hstr ok 83 - hsp1_qe ok 84 - hsp1_qs ok 85 - hsp1_qstr ok 86 - hsp2_bits ok 87 - hsp2_gaps ok 88 - hsp2_he ok 89 - hsp2_hs ok 90 - hsp2_hstr ok 91 - hsp2_qe ok 92 - hsp2_qs ok 93 - hsp2_qstr ok 94 - hsp3_bits ok 95 - hsp3_gaps ok 96 - hsp3_he ok 97 - hsp3_hs ok 98 - hsp3_hstr ok 99 - hsp3_qe ok 100 - hsp3_qs ok 101 - hsp3_qstr ok 102 - hsp4_bits ok 103 - hsp4_gaps ok 104 - hsp4_he ok 105 - hsp4_hs ok 106 - hsp4_hstr ok 107 - hsp4_qe ok 108 - hsp4_qs ok 109 - hsp4_qstr ok 110 - hsp5_bits ok 111 - hsp5_gaps ok 112 - hsp5_he ok 113 - hsp5_hs ok 114 - hsp5_hstr ok 115 - hsp5_qe ok 116 - hsp5_qs ok 117 - hsp5_qstr ok 118 - hsp6_bits ok 119 - hsp6_gaps ok 120 - hsp6_he ok 121 - hsp6_hs ok 122 - hsp6_hstr ok 123 - hsp6_qe ok 124 - hsp6_qs ok 125 - hsp6_qstr ok 126 - hsp7_bits ok 127 - hsp7_gaps ok 128 - hsp7_he ok 129 - hsp7_hs ok 130 - hsp7_hstr ok 131 - hsp7_qe ok 132 - hsp7_qs ok 133 - hsp7_qstr ok 134 - hsp8_bits ok 135 - hsp8_gaps ok 136 - hsp8_he ok 137 - hsp8_hs ok 138 - hsp8_hstr ok 139 - hsp8_qe ok 140 - hsp8_qs ok 141 - hsp8_qstr ok 142 - query_name ok 143 ok 144 ok 145 ok 146 ok 147 - hit score ok 148 - hit raw_score ok 149 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 - fixed bug 3343 (percent identity) ok 158 - side effect of fixing bug 3343 (number of gaps) ok 159 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 160 ok 161 ok 162 ok 163 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 164 ok 165 ok 166 ok t/SearchIO/CigarString.t ............ 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/cross_match.t ............ 1..15 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SearchIO/erpin.t .................. 1..91 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result ERPIN ok 4 - Result ERPIN reference ok 5 - Result ERPIN version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_name ok 16 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 17 - Hit accession ok 18 - Hit GI ok 19 - Hit algorithm ok 20 - Hit bits ok 21 - Hit description ok 22 - Hit length ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit overlap ok 28 - Hit query_length ok 29 - Hit rank ok 30 - Hit raw_score ok 31 - Hit score ok 32 ok 33 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 34 - HSP algorithm ok 35 ok 36 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 37 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 38 - HSP frame ok 39 - HSP gaps ok 40 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 41 - HSP hit_string ok 42 - HSP homology_string ok 43 - HSP hsp_group ok 44 - HSP hsp_length ok 45 - HSP length ok 46 - HSP links ok 47 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 48 - HSP query_string ok 49 - HSP range ok 50 - HSP rank ok 51 ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 ok 59 ok 60 - HSP strand ok 61 ok 62 ok 63 - ERPIN get_aln warning ok 64 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 65 - HSP algorithm ok 66 ok 67 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 68 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 69 - HSP frame ok 70 - HSP gaps ok 71 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 72 - HSP hit_string ok 73 - HSP homology_string ok 74 - HSP query_string ok 75 - HSP hsp_group ok 76 - HSP hsp_length ok 77 - HSP length ok 78 - HSP links ok 79 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 80 - HSP range ok 81 - HSP rank ok 82 ok 83 - HSP end ok 84 - HSP expect ok 85 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 86 - HSP seq_str ok 87 - HSP start ok 88 - HSP custom_score ok 89 ok 90 ok 91 - HSP strand ok t/SearchIO/exonerate.t .............. 1..52 ok 1 - use Bio::SearchIO; ok 2 ok 3 # skip no query length available in default output ok 4 ok 5 # skip no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # skip no query length available in default output ok 26 ok 27 # skip no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - query_name ok 47 ok 48 - query_name ok 49 ok 50 - query_name ok 51 ok 52 ok t/SearchIO/fasta.t .................. 1..301 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 - TFASTXY ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 - num_identical() ok 287 - num_conserved() ok 288 - bug 2937 and FASTA version 3.5 ok 289 - algorithm version ok 290 - query name ok 291 - query description ok 292 - query length ok 293 - algorithm ok 294 - num_identical() ok 295 - num_conserved() ok 296 - hsp->strand(hit) ok 297 - hsp->hit->strand ok 298 - hsp->strand(query) ok 299 - hsp->query->strand ok 300 - issue 255 ok 301 - issue 255: first hsp score ok t/SearchIO/gmap_f9.t ................ 1..54 ok 1 - use Bio::SearchIO; ok 2 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 3 - Did we get the expected number of hits? ok 4 - Did we get the expected algorithm? ok 5 - Did we get the expected query_name? ok 6 - 'Did we get a Hit?' isa 'Bio::Search::Hit::GenericHit' ok 7 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 8 - Check the name ok 9 - Check the hit length ok 10 - Check the number of hsps ok 11 - Check the query length ok 12 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 13 - Check the algorithm ok 14 - Count gaps in the query ok 15 - Count gaps in the hit ok 16 - Length of the query ok 17 - Length of the hit ok 18 - Query sequence ok 19 - Hit sequence ok 20 - Check query start ok 21 - Check query end ok 22 - Check query end ok 23 - Check the homology string ok 24 - Check seq_inds ok 25 - Check hit start ok 26 - Check hit end ok 27 - Check hit end ok 28 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 29 - Did we get the expected number of hits? ok 30 - Did we get the expected algorithm? ok 31 - Did we get the expected query_name? ok 32 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 33 - Check the name ok 34 - Check the hit length ok 35 - Check the number of hsps ok 36 - Check the query length ok 37 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 38 - Check the algorithm ok 39 - Count gaps in the query ok 40 - Count gaps in the hit ok 41 - Length of the query ok 42 - Length of the hit ok 43 - Query sequence ok 44 - Hit sequence ok 45 - Check query start ok 46 - Check query end ok 47 - Check query end ok 48 - Check the homology string ok 49 - Check seq_inds ok 50 - Check hit start ok 51 - Check hit end ok 52 - Check hit end ok 53 - Can we loop over multiple results properly (expecting 58)? ok 54 - simple query_name now caught, bug 3021 ok t/SearchIO/infernal.t ............... 1..496 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI' ok 3 - Check for the correct Result reference type ok 4 - Check algorithm ok 5 - Check cmsearch algorithm version ok 6 - Check cm_name ok 7 - Check database_name ok 8 - Check database_entries ok 9 - Check database_letters ok 10 - Check query_name ok 11 - Check query_length ok 12 - Check query_accession ok 13 - Check query_description ok 14 - Check num_hits ok 15 - Check for the correct hit reference type ok 16 - Hit algorithm ok 17 - Check hit name ok 18 - Check hit description ok 19 - Check hit length ok 20 - Check hit score ok 21 - Check hit bits ok 22 - Check number of HSPs ok 23 - Check hit significance ok 24 - Check hit rank ok 25 - Check for correct hsp reference type ok 26 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - 'Check for hsp hit isa seqfeature similarity' isa 'Bio::SeqFeature::Similarity' ok 29 - Check for HSP hit seq_id ok 30 - Check for HSP query seq_id ok 31 - Check hsp query start ok 32 - Check hsp query end ok 33 - Check hsp hit start ok 34 - Check hsp hit end ok 35 - Check hsp score ok 36 - Check hsp bits ok 37 - Check hsp evalue ok 38 - Check for hsp query length ok 39 - Check for hsp hit length ok 40 - Check for hsp total length ok 41 - Check for hsp query gaps ok 42 - Check for hsp hit gaps ok 43 - Check for hsp total gaps ok 44 - Check hsp hit strand ok 45 - Check hit name ok 46 - Check hit description ok 47 - Check hit score ok 48 - Check hit raw_score ok 49 - Check hit bits ok 50 - Check hit significance ok 51 - Check hit length ok 52 - Hit rank ok 53 - Check for hit seq_id ok 54 - Check for query seq_id ok 55 - Check hsp query start ok 56 - Check hsp query end ok 57 - Check hsp hit start ok 58 - Check hsp hit end ok 59 - Check hsp score ok 60 - Check hsp bits ok 61 - Check hsp evalue ok 62 - Check for hsp query gaps ok 63 - Check for hsp hit gaps ok 64 - Check for hsp total gaps ok 65 - Check hsp hit strand ok 66 - Check for NC string ok 67 - Check for CS string ok 68 - Check for query string ok 69 - Check for homology string ok 70 - Check for hit string ok 71 - Check for posterior probability string ok 72 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 73 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 74 - Check hsp feature1 get_tag_values ok 75 - Check hsp feature2 get_tag_values ok 76 - Check for undefined result ok 77 - Check result num_hits - multi report ok 78 - Check result query_name - multi report ok 79 - Check hit length - multi report ok 80 - Check result\#2 num_hits - multi report ok 81 - Check result\#2 query_name - multi report ok 82 - Check result\#2 hit length - multi report ok 83 - Check result\#2 hsp hit strand - multi report ok 84 - Check cm_name ok 85 - Check for undefined hit ok 86 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI' ok 87 - Result ok 88 - Result reference ok 89 - Result version ok 90 - Result parameters ok 91 - Result statistics ok 92 - Result entries ok 93 - Result letters ok 94 - Result database_name ok 95 - Result num_hits ok 96 - Result program_reference ok 97 - Result query_accession ok 98 - Result query_description ok 99 - Result query_length ok 100 - Result query_name ok 101 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 102 - Hit GI ok 103 - Hit accession ok 104 - Hit algorithm ok 105 - Hit bits ok 106 - Hit description ok 107 - Hit locus ok 108 - Hit n ok 109 - Hit name ok 110 - Hit num_hsps ok 111 - Hit length_aln() not implemented ok 112 - Hit num_unaligned_hit() not implemented ok 113 - Hit num_unaligned_query() not implemented ok 114 - Hit num_unaligned_sbjct() not implemented ok 115 - Hit start not implemented ok 116 - Hit end not implemented ok 117 - Hit strand not implemented ok 118 - Hit logical_length not implemented ok 119 - Hit frac_aligned_hit not implemented ok 120 - Hit frac_aligned_query not implemented ok 121 - Hit frac_conserved not implemented ok 122 - Hit frac_identical not implemented ok 123 - Hit matches not implemented ok 124 - Hit gaps not implemented ok 125 - Hit frame not implemented ok 126 - Hit range not implemented ok 127 - Hit seq_inds not implemented ok 128 - Hit length ok 129 - Hit overlap ok 130 - Hit query_length ok 131 - Hit rank ok 132 - Hit raw_score ok 133 - Hit score ok 134 - Hit p ok 135 ok 136 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 137 - HSP algorithm ok 138 ok 139 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 140 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 141 ok 142 ok 143 - HSP frame ok 144 - HSP gaps ok 145 - Hit length ok 146 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 147 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 148 - HSP hit_string ok 149 - HSP homology_string ok 150 - HSP hsp_group ok 151 - HSP hsp_length ok 152 - HSP length ok 153 - HSP links ok 154 - HSP n ok 155 - HSP pvalue ok 156 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 157 - HSP query_string ok 158 - HSP range ok 159 - HSP rank ok 160 ok 161 - HSP end ok 162 - HSP expect ok 163 - HSP seq_inds not implemented ok 164 - HSP matches not implemented ok 165 - HSP frac_conserved not implemented ok 166 - HSP frac_identical not implemented ok 167 - HSP num_conserved not implemented ok 168 - HSP num_identical not implemented ok 169 - HSP percent_identity not implemented ok 170 - HSP cigar_string not implemented ok 171 - HSP cigar_string not implemented ok 172 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 173 - HSP seq_str ok 174 - HSP start ok 175 - HSP custom_score ok 176 - HSP meta ok 177 - HSP strand ok 178 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 179 - HSP algorithm ok 180 ok 181 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 182 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 183 - HSP frame ok 184 - HSP gaps ok 185 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 186 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 187 - HSP hit_string ok 188 - HSP homology_string ok 189 - HSP hsp_group ok 190 - HSP hsp_length ok 191 - HSP length ok 192 - HSP links ok 193 - HSP n ok 194 - HSP pvalue ok 195 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 196 - HSP query_string ok 197 - HSP range ok 198 - HSP rank ok 199 ok 200 - HSP end ok 201 - HSP expect ok 202 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 203 - HSP seq_str ok 204 - HSP start ok 205 - HSP custom_score ok 206 - HSP meta ok 207 - HSP strand ok 208 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI' ok 209 - Result CMSEARCH ok 210 - Result CMSEARCH reference ok 211 - Result CMSEARCH version ok 212 - Result parameters ok 213 - Result statistics ok 214 - Result entries ok 215 - Result letters ok 216 - Result database_name ok 217 - Result num_hits ok 218 - Result program_reference ok 219 - Result query_accession ok 220 - Result query_description ok 221 - Result query_length ok 222 - Result query_name ok 223 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 224 - Hit GI ok 225 - Hit accession ok 226 - Hit algorithm ok 227 - Hit bits ok 228 - Hit description ok 229 - Hit locus ok 230 - Hit n ok 231 - Hit name ok 232 - Hit num_hsps ok 233 - No p values ok 234 - Hit length ok 235 - Hit overlap ok 236 - Hit query_length ok 237 - Hit rank ok 238 - Hit raw_score ok 239 - Hit score ok 240 ok 241 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 242 - HSP algorithm ok 243 ok 244 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 245 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 246 ok 247 ok 248 - HSP frame ok 249 - HSP gaps ok 250 - Hit length ok 251 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 252 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 253 - HSP hit_string ok 254 - HSP homology_string ok 255 - HSP hsp_group ok 256 - HSP hsp_length ok 257 - HSP length ok 258 - HSP links ok 259 - HSP n ok 260 - HSP pvalue ok 261 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 262 - HSP query_string ok 263 - HSP range ok 264 - HSP rank ok 265 ok 266 - HSP end ok 267 - HSP expect ok 268 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 269 - HSP seq_str ok 270 - HSP start ok 271 - HSP custom_score ok 272 - HSP meta ok 273 - HSP strand ok 274 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 275 - HSP algorithm ok 276 ok 277 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 278 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 279 - HSP frame ok 280 - HSP gaps ok 281 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 282 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 283 - HSP hit_string ok 284 - HSP homology_string ok 285 - HSP hsp_group ok 286 - HSP hsp_length ok 287 - HSP length ok 288 - HSP links ok 289 - HSP n ok 290 - HSP pvalue ok 291 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 292 - HSP query_string ok 293 - HSP range ok 294 - HSP rank ok 295 ok 296 - HSP end ok 297 - HSP expect ok 298 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 299 - HSP seq_str ok 300 - HSP start ok 301 - HSP custom_score ok 302 - HSP meta ok 303 - HSP strand ok 304 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 305 - Hit accession ok 306 - Hit GI ok 307 - Hit algorithm ok 308 - Hit bits ok 309 - Hit description ok 310 - Hit length ok 311 - Hit locus ok 312 - Hit n ok 313 - Hit name ok 314 - Hit num_hsps ok 315 - Hit overlap ok 316 - Hit query_length ok 317 - Hit rank ok 318 - Hit raw_score ok 319 - Hit score ok 320 ok 321 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 322 - HSP algorithm ok 323 ok 324 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 325 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 326 - HSP frame ok 327 - HSP gaps ok 328 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 329 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 330 - HSP hit_string ok 331 - HSP homology_string ok 332 - HSP hsp_group ok 333 - HSP hsp_length ok 334 - HSP length ok 335 - HSP links ok 336 - HSP n ok 337 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 338 - HSP query_string ok 339 - HSP range ok 340 - HSP rank ok 341 ok 342 - HSP end ok 343 - HSP expect ok 344 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 345 - HSP seq_str ok 346 - HSP start ok 347 - HSP custom_score ok 348 - HSP meta ok 349 - HSP strand ok 350 - HSP meta gap bug ok 351 - HSP meta ok 352 - HSP meta ok 353 ok 354 ok 355 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI' ok 356 - Result CMSEARCH ok 357 - Result CMSEARCH reference ok 358 - Result CMSEARCH version ok 359 - Result parameters ok 360 - Result statistics ok 361 - Result entries ok 362 - Result letters ok 363 - Result database_name ok 364 - Result num_hits ok 365 - Result program_reference ok 366 - Result query_accession ok 367 - Result query_description ok 368 - Result query_length ok 369 - Result query_name ok 370 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 371 - Hit GI ok 372 - Hit accession ok 373 - Hit algorithm ok 374 - Hit bits ok 375 - Hit description ok 376 - Hit locus ok 377 - Hit n ok 378 - Hit name ok 379 - Hit num_hsps ok 380 - No p values ok 381 - Hit length ok 382 - Hit overlap ok 383 - Hit query_length ok 384 - Hit rank ok 385 - Hit raw_score ok 386 - Hit score ok 387 ok 388 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 389 - HSP algorithm ok 390 ok 391 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 392 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 393 ok 394 ok 395 - HSP frame ok 396 - HSP gaps ok 397 - Hit length ok 398 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 399 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 400 - HSP hit_string ok 401 - HSP homology_string ok 402 - HSP hsp_group ok 403 - HSP hsp_length ok 404 - HSP length ok 405 - HSP links ok 406 - HSP n ok 407 - HSP pvalue ok 408 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 409 - HSP query_string ok 410 - HSP range ok 411 - HSP rank ok 412 ok 413 - HSP end ok 414 - HSP expect ok 415 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 416 - HSP seq_str ok 417 - HSP start ok 418 - HSP custom_score ok 419 - HSP meta ok 420 - HSP strand ok 421 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 422 - HSP algorithm ok 423 ok 424 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 425 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 426 - HSP frame ok 427 - HSP gaps ok 428 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 429 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 430 - HSP hit_string ok 431 - HSP homology_string ok 432 - HSP hsp_group ok 433 - HSP hsp_length ok 434 - HSP length ok 435 - HSP links ok 436 - HSP n ok 437 - HSP pvalue ok 438 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 439 - HSP query_string ok 440 - HSP range ok 441 - HSP rank ok 442 ok 443 - HSP end ok 444 - HSP expect ok 445 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 446 - HSP seq_str ok 447 - HSP start ok 448 - HSP custom_score ok 449 - HSP meta ok 450 - HSP strand ok 451 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 452 - Hit accession ok 453 - Hit GI ok 454 - Hit algorithm ok 455 - Hit bits ok 456 - Hit description ok 457 - Hit length ok 458 - Hit locus ok 459 - Hit n ok 460 - Hit name ok 461 - Hit num_hsps ok 462 - Hit overlap ok 463 - Hit query_length ok 464 - Hit rank ok 465 - Hit raw_score ok 466 - Hit score ok 467 ok 468 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 469 - HSP algorithm ok 470 ok 471 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 472 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 473 - HSP frame ok 474 - HSP gaps ok 475 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 476 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 477 - HSP hit_string ok 478 - HSP homology_string ok 479 - HSP hsp_group ok 480 - HSP hsp_length ok 481 - HSP length ok 482 - HSP links ok 483 - HSP n ok 484 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 485 - HSP query_string ok 486 - HSP range ok 487 - HSP rank ok 488 ok 489 - HSP end ok 490 - HSP expect ok 491 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 492 - HSP seq_str ok 493 - HSP start ok 494 - HSP custom_score ok 495 - HSP meta ok 496 - HSP strand ok t/SearchIO/megablast.t .............. 1..31 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/SearchIO/psl.t .................... 1..53 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - next_hsp should be undef ok 51 - next_hit should be undef not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string # Failed (TODO) test 'next_result should be undef' # at t/SearchIO/psl.t line 96. # got: '' # expected: undef ok 53 ok t/SearchIO/rnamotif.t ............... 1..60 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result RNAMOTIF ok 4 - Result RNAMOTIF reference ok 5 - Result RNAMOTIF version ok 6 - Result entries ok 7 - Result letters ok 8 - Result database_name ok 9 - Result num_hits ok 10 - Result program_reference ok 11 - Result query_accession ok 12 - Result query_description ok 13 - Result query_length ok 14 - Result query_name ok 15 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 16 - Hit accession ok 17 - Hit GI ok 18 - Hit algorithm ok 19 - Hit description ok 20 - Hit length ok 21 - Hit locus ok 22 - Hit n ok 23 - Hit name ok 24 - Hit num_hsps ok 25 - Hit overlap ok 26 - Hit rank ok 27 - Hit raw_score ok 28 - Hit score ok 29 ok 30 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 31 - HSP algorithm ok 32 ok 33 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 34 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 35 - HSP frame ok 36 - HSP gaps ok 37 - RNAMotif get_aln warning ok 38 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 39 - HSP hit_string ok 40 - HSP homology_string ok 41 - HSP hsp_group ok 42 - HSP hsp_length ok 43 - HSP length ok 44 - HSP links ok 45 - HSP n ok 46 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 47 - HSP query_string ok 48 - HSP range ok 49 - HSP rank ok 50 ok 51 - HSP end ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 - HSP strand ok 59 ok 60 ok t/SearchIO/SearchIO.t ............... 1..19 ok 1 - use Bio::SearchIO; ok 2 - blast for fast.bls ok 3 - blast for filename.blast ok 4 - fasta for f.SSEARCH.m9 ok 5 - fasta for f.fy ok 6 - fasta for f.ssearch ok 7 - blastxml for f.blastxml ok 8 - fasta for f.fx ok 9 - fasta for f.fa ok 10 - exonerate for f.exonerate ok 11 - blast for f.blx ok 12 - blast for f.tblx ok 13 - fasta for f.fasta ok 14 - fasta for f.osearch ok 15 - blastxml for f.xml ok 16 - fasta for f.psearch ok 17 - fasta for f.m9 ok 18 - exonerate for f.exon ok 19 - blast for filename.bls ok t/SearchIO/sim4.t ................... 1..102 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/SearchIO/SimilarityPair.t ......... 1..12 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SeqIO; ok 3 ok 4 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 5 ok 6 - An object of class 'Bio::SearchIO::blast' isa 'Bio::SearchIO' ok 7 ok 8 - An object of class 'Bio::Search::Hit::BlastHit' isa 'Bio::Search::Hit::HitI' ok 9 ok 10 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 11 ok 12 ok t/SearchIO/Tiling.t ................. 1..1141 ok 1 - use Bio::Search::Tiling::MapTiling; ok 2 - use Bio::Search::Tiling::MapTileUtils; ok 3 - use Bio::SearchIO; ok 4 - use Bio::Search::Hit::BlastHit; ok 5 - use File::Spec; ok 6 - parse data file ok 7 - got test hit ok 8 - create tiling ok 9 - An object of class 'Bio::Search::Tiling::MapTiling' isa 'Bio::Search::Tiling::TilingI' ok 10 - implements 'next_tiling' ok 11 - implements 'rewind_tilings' ok 12 - implements 'identities' ok 13 - implements 'conserved' ok 14 - implements 'length' ok 15 - identities regression test ok 16 - conserved regression test ok 17 - tiling iterator regression test(1) ok 18 - tiling iterator regression test(2) ok 19 - tiling iterator regression test(3, rewind) ok 20 - ecolitst.wublastp ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - dnaEbsub_ecoli.wublastx ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - tricky.wublast ok 37 - tricky.wublast(1) ok 38 - tricky.wublast(2) ok 39 - tricky.wublast(3) ok 40 - tricky.wublast(4) ok 41 - ecolitst.bls ok 42 - tile ecolitst.bls hit 1 \#hsps 1 ok 43 - q id: est (0.98293) = fast (0.98293) ok 44 - q cn: est (0.98293) = fast (0.98293) ok 45 - h id: est (0.98293) = fast (0.98293) ok 46 - h cn: est (0.98293) = fast (0.98293) ok 47 - tile ecolitst.bls hit 2 \#hsps 1 ok 48 - q id: est (0.30074) = fast (0.30074) ok 49 - q cn: est (0.49876) = fast (0.49876) ok 50 - h id: est (0.30759) = fast (0.30759) ok 51 - h cn: est (0.51013) = fast (0.51013) ok 52 - tile ecolitst.bls hit 3 \#hsps 1 ok 53 - q id: est (0.31004) = fast (0.31004) ok 54 - q cn: est (0.49782) = fast (0.49782) ok 55 - h id: est (0.32054) = fast (0.32054) ok 56 - h cn: est (0.51467) = fast (0.51467) ok 57 - tile ecolitst.bls hit 4 \#hsps 1 ok 58 - q id: est (0.30435) = fast (0.30435) ok 59 - q cn: est (0.47826) = fast (0.47826) ok 60 - h id: est (0.29787) = fast (0.29787) ok 61 - h cn: est (0.46809) = fast (0.46809) ok 62 - tricky.wublast ok 63 - tile tricky.wublast hit 1 \#hsps 7 ok 64 - q id: exact (0.22153) ~ est (0.22153) ok 65 - q id: exact (0.22153) <= max (0.22153) ok 66 - q cn: exact (0.42760) ~ est (0.42760) ok 67 - q cn: exact (0.42760) <= max (0.42760) ok 68 - h id: exact (0.22704) ~ est (0.22704) ok 69 - h id: exact (0.22704) <= max (0.22704) ok 70 - h cn: exact (0.43335) ~ est (0.43335) ok 71 - h cn: exact (0.43335) <= max (0.43335) ok 72 - a_thaliana.blastn ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1 ok 74 - q id: est (0.96667) = fast (0.96667) ok 75 - q cn: est (0.96667) = fast (0.96667) ok 76 - h id: est (0.98305) = fast (0.98305) ok 77 - h cn: est (0.98305) = fast (0.98305) ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1 ok 79 - q id: est (0.96667) = fast (0.96667) ok 80 - q cn: est (0.96667) = fast (0.96667) ok 81 - h id: est (0.98305) = fast (0.98305) ok 82 - h cn: est (0.98305) = fast (0.98305) ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1 ok 84 - q id: est (1.00000) = fast (1.00000) ok 85 - q cn: est (1.00000) = fast (1.00000) ok 86 - h id: est (1.00000) = fast (1.00000) ok 87 - h cn: est (1.00000) = fast (1.00000) ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1 ok 89 - q id: est (1.00000) = fast (1.00000) ok 90 - q cn: est (1.00000) = fast (1.00000) ok 91 - h id: est (1.00000) = fast (1.00000) ok 92 - h cn: est (1.00000) = fast (1.00000) ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1 ok 94 - q id: est (0.92308) = fast (0.92308) ok 95 - q cn: est (0.92308) = fast (0.92308) ok 96 - h id: est (0.92308) = fast (0.92308) ok 97 - h cn: est (0.92308) = fast (0.92308) ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1 ok 99 - q id: est (1.00000) = fast (1.00000) ok 100 - q cn: est (1.00000) = fast (1.00000) ok 101 - h id: est (1.00000) = fast (1.00000) ok 102 - h cn: est (1.00000) = fast (1.00000) ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1 ok 104 - q id: est (1.00000) = fast (1.00000) ok 105 - q cn: est (1.00000) = fast (1.00000) ok 106 - h id: est (1.00000) = fast (1.00000) ok 107 - h cn: est (1.00000) = fast (1.00000) ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1 ok 109 - q id: est (1.00000) = fast (1.00000) ok 110 - q cn: est (1.00000) = fast (1.00000) ok 111 - h id: est (1.00000) = fast (1.00000) ok 112 - h cn: est (1.00000) = fast (1.00000) ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1 ok 114 - q id: est (1.00000) = fast (1.00000) ok 115 - q cn: est (1.00000) = fast (1.00000) ok 116 - h id: est (1.00000) = fast (1.00000) ok 117 - h cn: est (1.00000) = fast (1.00000) ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1 ok 119 - q id: est (1.00000) = fast (1.00000) ok 120 - q cn: est (1.00000) = fast (1.00000) ok 121 - h id: est (1.00000) = fast (1.00000) ok 122 - h cn: est (1.00000) = fast (1.00000) ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1 ok 124 - q id: est (1.00000) = fast (1.00000) ok 125 - q cn: est (1.00000) = fast (1.00000) ok 126 - h id: est (1.00000) = fast (1.00000) ok 127 - h cn: est (1.00000) = fast (1.00000) ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1 ok 129 - q id: est (1.00000) = fast (1.00000) ok 130 - q cn: est (1.00000) = fast (1.00000) ok 131 - h id: est (1.00000) = fast (1.00000) ok 132 - h cn: est (1.00000) = fast (1.00000) ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1 ok 134 - q id: est (1.00000) = fast (1.00000) ok 135 - q cn: est (1.00000) = fast (1.00000) ok 136 - h id: est (1.00000) = fast (1.00000) ok 137 - h cn: est (1.00000) = fast (1.00000) ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1 ok 139 - q id: est (1.00000) = fast (1.00000) ok 140 - q cn: est (1.00000) = fast (1.00000) ok 141 - h id: est (1.00000) = fast (1.00000) ok 142 - h cn: est (1.00000) = fast (1.00000) ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1 ok 144 - q id: est (1.00000) = fast (1.00000) ok 145 - q cn: est (1.00000) = fast (1.00000) ok 146 - h id: est (1.00000) = fast (1.00000) ok 147 - h cn: est (1.00000) = fast (1.00000) ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1 ok 149 - q id: est (1.00000) = fast (1.00000) ok 150 - q cn: est (1.00000) = fast (1.00000) ok 151 - h id: est (1.00000) = fast (1.00000) ok 152 - h cn: est (1.00000) = fast (1.00000) ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1 ok 154 - q id: est (1.00000) = fast (1.00000) ok 155 - q cn: est (1.00000) = fast (1.00000) ok 156 - h id: est (1.00000) = fast (1.00000) ok 157 - h cn: est (1.00000) = fast (1.00000) ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1 ok 159 - q id: est (1.00000) = fast (1.00000) ok 160 - q cn: est (1.00000) = fast (1.00000) ok 161 - h id: est (1.00000) = fast (1.00000) ok 162 - h cn: est (1.00000) = fast (1.00000) ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1 ok 164 - q id: est (1.00000) = fast (1.00000) ok 165 - q cn: est (1.00000) = fast (1.00000) ok 166 - h id: est (1.00000) = fast (1.00000) ok 167 - h cn: est (1.00000) = fast (1.00000) ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1 ok 169 - q id: est (0.95238) = fast (0.95238) ok 170 - q cn: est (0.95238) = fast (0.95238) ok 171 - h id: est (0.95238) = fast (0.95238) ok 172 - h cn: est (0.95238) = fast (0.95238) ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1 ok 174 - q id: est (1.00000) = fast (1.00000) ok 175 - q cn: est (1.00000) = fast (1.00000) ok 176 - h id: est (1.00000) = fast (1.00000) ok 177 - h cn: est (1.00000) = fast (1.00000) ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1 ok 179 - q id: est (0.95238) = fast (0.95238) ok 180 - q cn: est (0.95238) = fast (0.95238) ok 181 - h id: est (0.95238) = fast (0.95238) ok 182 - h cn: est (0.95238) = fast (0.95238) ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1 ok 184 - q id: est (1.00000) = fast (1.00000) ok 185 - q cn: est (1.00000) = fast (1.00000) ok 186 - h id: est (1.00000) = fast (1.00000) ok 187 - h cn: est (1.00000) = fast (1.00000) ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1 ok 189 - q id: est (0.95238) = fast (0.95238) ok 190 - q cn: est (0.95238) = fast (0.95238) ok 191 - h id: est (0.95238) = fast (0.95238) ok 192 - h cn: est (0.95238) = fast (0.95238) ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1 ok 194 - q id: est (1.00000) = fast (1.00000) ok 195 - q cn: est (1.00000) = fast (1.00000) ok 196 - h id: est (1.00000) = fast (1.00000) ok 197 - h cn: est (1.00000) = fast (1.00000) ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1 ok 199 - q id: est (1.00000) = fast (1.00000) ok 200 - q cn: est (1.00000) = fast (1.00000) ok 201 - h id: est (1.00000) = fast (1.00000) ok 202 - h cn: est (1.00000) = fast (1.00000) ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1 ok 204 - q id: est (1.00000) = fast (1.00000) ok 205 - q cn: est (1.00000) = fast (1.00000) ok 206 - h id: est (1.00000) = fast (1.00000) ok 207 - h cn: est (1.00000) = fast (1.00000) ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1 ok 209 - q id: est (1.00000) = fast (1.00000) ok 210 - q cn: est (1.00000) = fast (1.00000) ok 211 - h id: est (1.00000) = fast (1.00000) ok 212 - h cn: est (1.00000) = fast (1.00000) ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1 ok 214 - q id: est (1.00000) = fast (1.00000) ok 215 - q cn: est (1.00000) = fast (1.00000) ok 216 - h id: est (1.00000) = fast (1.00000) ok 217 - h cn: est (1.00000) = fast (1.00000) ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1 ok 219 - q id: est (1.00000) = fast (1.00000) ok 220 - q cn: est (1.00000) = fast (1.00000) ok 221 - h id: est (1.00000) = fast (1.00000) ok 222 - h cn: est (1.00000) = fast (1.00000) ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1 ok 224 - q id: est (1.00000) = fast (1.00000) ok 225 - q cn: est (1.00000) = fast (1.00000) ok 226 - h id: est (1.00000) = fast (1.00000) ok 227 - h cn: est (1.00000) = fast (1.00000) ok 228 - brassica_ATH.WUBLASTN ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3 ok 230 - q id: exact (0.82465) ~ est (0.82343) ok 231 - q id: exact (0.82465) <= max (0.83333) ok 232 - q cn: exact (0.85590) ~ est (0.85312) ok 233 - q cn: exact (0.85590) <= max (0.86458) ok 234 - h id: exact (0.83920) ~ est (0.83920) ok 235 - h id: exact (0.83920) <= max (0.83920) ok 236 - h cn: exact (0.86935) ~ est (0.86935) ok 237 - h cn: exact (0.86935) <= max (0.86935) ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2 ok 239 - q id: exact (0.82486) ~ est (0.82486) ok 240 - q id: exact (0.82486) <= max (0.82486) ok 241 - q cn: exact (0.85122) ~ est (0.85122) ok 242 - q cn: exact (0.85122) <= max (0.85122) ok 243 - h id: exact (0.82955) ~ est (0.82955) ok 244 - h id: exact (0.82955) <= max (0.82955) ok 245 - h cn: exact (0.85606) ~ est (0.85606) ok 246 - h cn: exact (0.85606) <= max (0.85606) ok 247 - no_hsps.blastp ok 248 - tile no_hsps.blastp hit 1 \#hsps 0 ok 249 - tile no_hsps.blastp hit 2 \#hsps 0 ok 250 - tile no_hsps.blastp hit 3 \#hsps 0 ok 251 - tile no_hsps.blastp hit 4 \#hsps 0 ok 252 - tile no_hsps.blastp hit 5 \#hsps 0 ok 253 - tile no_hsps.blastp hit 6 \#hsps 0 ok 254 - tile no_hsps.blastp hit 7 \#hsps 0 ok 255 - tile no_hsps.blastp hit 8 \#hsps 0 ok 256 - tile no_hsps.blastp hit 9 \#hsps 0 ok 257 - tile no_hsps.blastp hit 10 \#hsps 0 ok 258 - tile no_hsps.blastp hit 11 \#hsps 0 ok 259 - tile no_hsps.blastp hit 12 \#hsps 0 ok 260 - tile no_hsps.blastp hit 13 \#hsps 0 ok 261 - tile no_hsps.blastp hit 14 \#hsps 0 ok 262 - tile no_hsps.blastp hit 15 \#hsps 0 ok 263 - tile no_hsps.blastp hit 16 \#hsps 0 ok 264 - tile no_hsps.blastp hit 17 \#hsps 0 ok 265 - tile no_hsps.blastp hit 18 \#hsps 0 ok 266 - tile no_hsps.blastp hit 19 \#hsps 0 ok 267 - tile no_hsps.blastp hit 20 \#hsps 0 ok 268 - tile no_hsps.blastp hit 21 \#hsps 0 ok 269 - tile no_hsps.blastp hit 22 \#hsps 0 ok 270 - tile no_hsps.blastp hit 23 \#hsps 0 ok 271 - tile no_hsps.blastp hit 24 \#hsps 0 ok 272 - tile no_hsps.blastp hit 25 \#hsps 0 ok 273 - tile no_hsps.blastp hit 26 \#hsps 0 ok 274 - tile no_hsps.blastp hit 27 \#hsps 0 ok 275 - tile no_hsps.blastp hit 28 \#hsps 0 ok 276 - tile no_hsps.blastp hit 29 \#hsps 0 ok 277 - tile no_hsps.blastp hit 30 \#hsps 0 ok 278 - tile no_hsps.blastp hit 31 \#hsps 0 ok 279 - tile no_hsps.blastp hit 32 \#hsps 0 ok 280 - tile no_hsps.blastp hit 33 \#hsps 0 ok 281 - tile no_hsps.blastp hit 34 \#hsps 0 ok 282 - tile no_hsps.blastp hit 35 \#hsps 0 ok 283 - tile no_hsps.blastp hit 36 \#hsps 0 ok 284 - tile no_hsps.blastp hit 37 \#hsps 0 ok 285 - tile no_hsps.blastp hit 38 \#hsps 0 ok 286 - tile no_hsps.blastp hit 39 \#hsps 0 ok 287 - tile no_hsps.blastp hit 40 \#hsps 0 ok 288 - tile no_hsps.blastp hit 41 \#hsps 0 ok 289 - tile no_hsps.blastp hit 42 \#hsps 0 ok 290 - tile no_hsps.blastp hit 43 \#hsps 0 ok 291 - tile no_hsps.blastp hit 44 \#hsps 0 ok 292 - tile no_hsps.blastp hit 45 \#hsps 0 ok 293 - tile no_hsps.blastp hit 46 \#hsps 0 ok 294 - tile no_hsps.blastp hit 47 \#hsps 0 ok 295 - tile no_hsps.blastp hit 48 \#hsps 0 ok 296 - tile no_hsps.blastp hit 49 \#hsps 0 ok 297 - tile no_hsps.blastp hit 50 \#hsps 0 ok 298 - tile no_hsps.blastp hit 51 \#hsps 0 ok 299 - tile no_hsps.blastp hit 52 \#hsps 0 ok 300 - tile no_hsps.blastp hit 53 \#hsps 0 ok 301 - tile no_hsps.blastp hit 54 \#hsps 0 ok 302 - tile no_hsps.blastp hit 55 \#hsps 0 ok 303 - tile no_hsps.blastp hit 56 \#hsps 0 ok 304 - tile no_hsps.blastp hit 57 \#hsps 0 ok 305 - tile no_hsps.blastp hit 58 \#hsps 0 ok 306 - tile no_hsps.blastp hit 59 \#hsps 0 ok 307 - tile no_hsps.blastp hit 60 \#hsps 0 ok 308 - tile no_hsps.blastp hit 61 \#hsps 0 ok 309 - tile no_hsps.blastp hit 62 \#hsps 0 ok 310 - tile no_hsps.blastp hit 63 \#hsps 0 ok 311 - tile no_hsps.blastp hit 64 \#hsps 0 ok 312 - tile no_hsps.blastp hit 65 \#hsps 0 ok 313 - tile no_hsps.blastp hit 66 \#hsps 0 ok 314 - tile no_hsps.blastp hit 67 \#hsps 0 ok 315 - tile no_hsps.blastp hit 68 \#hsps 0 ok 316 - tile no_hsps.blastp hit 69 \#hsps 0 ok 317 - tile no_hsps.blastp hit 70 \#hsps 0 ok 318 - tile no_hsps.blastp hit 71 \#hsps 0 ok 319 - tile no_hsps.blastp hit 72 \#hsps 0 ok 320 - tile no_hsps.blastp hit 73 \#hsps 0 ok 321 - tile no_hsps.blastp hit 74 \#hsps 0 ok 322 - tile no_hsps.blastp hit 75 \#hsps 0 ok 323 - tile no_hsps.blastp hit 76 \#hsps 0 ok 324 - tile no_hsps.blastp hit 77 \#hsps 0 ok 325 - tile no_hsps.blastp hit 78 \#hsps 0 ok 326 - tile no_hsps.blastp hit 79 \#hsps 0 ok 327 - tile no_hsps.blastp hit 80 \#hsps 0 ok 328 - tile no_hsps.blastp hit 81 \#hsps 0 ok 329 - tile no_hsps.blastp hit 82 \#hsps 0 ok 330 - tile no_hsps.blastp hit 83 \#hsps 0 ok 331 - tile no_hsps.blastp hit 84 \#hsps 0 ok 332 - tile no_hsps.blastp hit 85 \#hsps 0 ok 333 - tile no_hsps.blastp hit 86 \#hsps 0 ok 334 - tile no_hsps.blastp hit 87 \#hsps 0 ok 335 - tile no_hsps.blastp hit 88 \#hsps 0 ok 336 - tile no_hsps.blastp hit 89 \#hsps 0 ok 337 - tile no_hsps.blastp hit 90 \#hsps 0 ok 338 - tile no_hsps.blastp hit 91 \#hsps 0 ok 339 - tile no_hsps.blastp hit 92 \#hsps 0 ok 340 - tile no_hsps.blastp hit 93 \#hsps 0 ok 341 - tile no_hsps.blastp hit 94 \#hsps 0 ok 342 - tile no_hsps.blastp hit 95 \#hsps 0 ok 343 - tile no_hsps.blastp hit 96 \#hsps 0 ok 344 - tile no_hsps.blastp hit 97 \#hsps 0 ok 345 - tile no_hsps.blastp hit 98 \#hsps 0 ok 346 - tile no_hsps.blastp hit 99 \#hsps 0 ok 347 - tile no_hsps.blastp hit 100 \#hsps 0 ok 348 - tile no_hsps.blastp hit 101 \#hsps 0 ok 349 - tile no_hsps.blastp hit 102 \#hsps 0 ok 350 - tile no_hsps.blastp hit 103 \#hsps 0 ok 351 - tile no_hsps.blastp hit 104 \#hsps 0 ok 352 - tile no_hsps.blastp hit 105 \#hsps 0 ok 353 - tile no_hsps.blastp hit 106 \#hsps 0 ok 354 - tile no_hsps.blastp hit 107 \#hsps 0 ok 355 - tile no_hsps.blastp hit 108 \#hsps 0 ok 356 - tile no_hsps.blastp hit 109 \#hsps 0 ok 357 - tile no_hsps.blastp hit 110 \#hsps 0 ok 358 - tile no_hsps.blastp hit 111 \#hsps 0 ok 359 - tile no_hsps.blastp hit 112 \#hsps 0 ok 360 - tile no_hsps.blastp hit 113 \#hsps 0 ok 361 - tile no_hsps.blastp hit 114 \#hsps 0 ok 362 - tile no_hsps.blastp hit 115 \#hsps 0 ok 363 - tile no_hsps.blastp hit 116 \#hsps 0 ok 364 - tile no_hsps.blastp hit 117 \#hsps 0 ok 365 - tile no_hsps.blastp hit 118 \#hsps 0 ok 366 - tile no_hsps.blastp hit 119 \#hsps 0 ok 367 - tile no_hsps.blastp hit 120 \#hsps 0 ok 368 - tile no_hsps.blastp hit 121 \#hsps 0 ok 369 - tile no_hsps.blastp hit 122 \#hsps 0 ok 370 - tile no_hsps.blastp hit 123 \#hsps 0 ok 371 - tile no_hsps.blastp hit 124 \#hsps 0 ok 372 - tile no_hsps.blastp hit 125 \#hsps 0 ok 373 - tile no_hsps.blastp hit 126 \#hsps 0 ok 374 - tile no_hsps.blastp hit 127 \#hsps 0 ok 375 - tile no_hsps.blastp hit 128 \#hsps 0 ok 376 - tile no_hsps.blastp hit 129 \#hsps 0 ok 377 - tile no_hsps.blastp hit 130 \#hsps 0 ok 378 - tile no_hsps.blastp hit 131 \#hsps 0 ok 379 - tile no_hsps.blastp hit 132 \#hsps 0 ok 380 - tile no_hsps.blastp hit 133 \#hsps 0 ok 381 - tile no_hsps.blastp hit 134 \#hsps 0 ok 382 - tile no_hsps.blastp hit 135 \#hsps 0 ok 383 - tile no_hsps.blastp hit 136 \#hsps 0 ok 384 - tile no_hsps.blastp hit 137 \#hsps 0 ok 385 - tile no_hsps.blastp hit 138 \#hsps 0 ok 386 - tile no_hsps.blastp hit 139 \#hsps 0 ok 387 - tile no_hsps.blastp hit 140 \#hsps 0 ok 388 - tile no_hsps.blastp hit 141 \#hsps 0 ok 389 - tile no_hsps.blastp hit 142 \#hsps 0 ok 390 - tile no_hsps.blastp hit 143 \#hsps 0 ok 391 - tile no_hsps.blastp hit 144 \#hsps 0 ok 392 - tile no_hsps.blastp hit 145 \#hsps 0 ok 393 - tile no_hsps.blastp hit 146 \#hsps 0 ok 394 - tile no_hsps.blastp hit 147 \#hsps 0 ok 395 - tile no_hsps.blastp hit 148 \#hsps 0 ok 396 - tile no_hsps.blastp hit 149 \#hsps 0 ok 397 - tile no_hsps.blastp hit 150 \#hsps 0 ok 398 - tile no_hsps.blastp hit 151 \#hsps 0 ok 399 - tile no_hsps.blastp hit 152 \#hsps 0 ok 400 - tile no_hsps.blastp hit 153 \#hsps 0 ok 401 - tile no_hsps.blastp hit 154 \#hsps 0 ok 402 - tile no_hsps.blastp hit 155 \#hsps 0 ok 403 - tile no_hsps.blastp hit 156 \#hsps 0 ok 404 - tile no_hsps.blastp hit 157 \#hsps 0 ok 405 - tile no_hsps.blastp hit 158 \#hsps 0 ok 406 - tile no_hsps.blastp hit 159 \#hsps 0 ok 407 - tile no_hsps.blastp hit 160 \#hsps 0 ok 408 - tile no_hsps.blastp hit 161 \#hsps 0 ok 409 - tile no_hsps.blastp hit 162 \#hsps 0 ok 410 - tile no_hsps.blastp hit 163 \#hsps 0 ok 411 - tile no_hsps.blastp hit 164 \#hsps 0 ok 412 - tile no_hsps.blastp hit 165 \#hsps 0 ok 413 - tile no_hsps.blastp hit 166 \#hsps 0 ok 414 - tile no_hsps.blastp hit 167 \#hsps 0 ok 415 - tile no_hsps.blastp hit 168 \#hsps 0 ok 416 - tile no_hsps.blastp hit 169 \#hsps 0 ok 417 - tile no_hsps.blastp hit 170 \#hsps 0 ok 418 - tile no_hsps.blastp hit 171 \#hsps 0 ok 419 - tile no_hsps.blastp hit 172 \#hsps 0 ok 420 - tile no_hsps.blastp hit 173 \#hsps 0 ok 421 - tile no_hsps.blastp hit 174 \#hsps 0 ok 422 - tile no_hsps.blastp hit 175 \#hsps 0 ok 423 - tile no_hsps.blastp hit 176 \#hsps 0 ok 424 - tile no_hsps.blastp hit 177 \#hsps 0 ok 425 - tile no_hsps.blastp hit 178 \#hsps 0 ok 426 - tile no_hsps.blastp hit 179 \#hsps 0 ok 427 - tile no_hsps.blastp hit 180 \#hsps 0 ok 428 - tile no_hsps.blastp hit 181 \#hsps 0 ok 429 - tile no_hsps.blastp hit 182 \#hsps 0 ok 430 - tile no_hsps.blastp hit 183 \#hsps 0 ok 431 - tile no_hsps.blastp hit 184 \#hsps 0 ok 432 - tile no_hsps.blastp hit 185 \#hsps 0 ok 433 - tile no_hsps.blastp hit 186 \#hsps 0 ok 434 - tile no_hsps.blastp hit 187 \#hsps 0 ok 435 - tile no_hsps.blastp hit 188 \#hsps 0 ok 436 - tile no_hsps.blastp hit 189 \#hsps 0 ok 437 - tile no_hsps.blastp hit 190 \#hsps 0 ok 438 - tile no_hsps.blastp hit 191 \#hsps 0 ok 439 - tile no_hsps.blastp hit 192 \#hsps 0 ok 440 - tile no_hsps.blastp hit 193 \#hsps 0 ok 441 - tile no_hsps.blastp hit 194 \#hsps 0 ok 442 - tile no_hsps.blastp hit 195 \#hsps 0 ok 443 - tile no_hsps.blastp hit 196 \#hsps 0 ok 444 - tile no_hsps.blastp hit 197 \#hsps 0 ok 445 - tile no_hsps.blastp hit 198 \#hsps 0 ok 446 - tile no_hsps.blastp hit 199 \#hsps 0 ok 447 - tile no_hsps.blastp hit 200 \#hsps 0 ok 448 - tile no_hsps.blastp hit 201 \#hsps 0 ok 449 - tile no_hsps.blastp hit 202 \#hsps 0 ok 450 - tile no_hsps.blastp hit 203 \#hsps 0 ok 451 - tile no_hsps.blastp hit 204 \#hsps 0 ok 452 - tile no_hsps.blastp hit 205 \#hsps 0 ok 453 - tile no_hsps.blastp hit 206 \#hsps 0 ok 454 - tile no_hsps.blastp hit 207 \#hsps 0 ok 455 - tile no_hsps.blastp hit 208 \#hsps 0 ok 456 - tile no_hsps.blastp hit 209 \#hsps 0 ok 457 - tile no_hsps.blastp hit 210 \#hsps 0 ok 458 - tile no_hsps.blastp hit 211 \#hsps 0 ok 459 - tile no_hsps.blastp hit 212 \#hsps 0 ok 460 - tile no_hsps.blastp hit 213 \#hsps 0 ok 461 - tile no_hsps.blastp hit 214 \#hsps 0 ok 462 - tile no_hsps.blastp hit 215 \#hsps 0 ok 463 - tile no_hsps.blastp hit 216 \#hsps 0 ok 464 - tile no_hsps.blastp hit 217 \#hsps 0 ok 465 - tile no_hsps.blastp hit 218 \#hsps 0 ok 466 - tile no_hsps.blastp hit 219 \#hsps 0 ok 467 - tile no_hsps.blastp hit 220 \#hsps 0 ok 468 - tile no_hsps.blastp hit 221 \#hsps 0 ok 469 - tile no_hsps.blastp hit 222 \#hsps 0 ok 470 - tile no_hsps.blastp hit 223 \#hsps 0 ok 471 - tile no_hsps.blastp hit 224 \#hsps 0 ok 472 - tile no_hsps.blastp hit 225 \#hsps 0 ok 473 - tile no_hsps.blastp hit 226 \#hsps 0 ok 474 - tile no_hsps.blastp hit 227 \#hsps 0 ok 475 - tile no_hsps.blastp hit 228 \#hsps 0 ok 476 - tile no_hsps.blastp hit 229 \#hsps 0 ok 477 - tile no_hsps.blastp hit 230 \#hsps 0 ok 478 - tile no_hsps.blastp hit 231 \#hsps 0 ok 479 - tile no_hsps.blastp hit 232 \#hsps 0 ok 480 - tile no_hsps.blastp hit 233 \#hsps 0 ok 481 - tile no_hsps.blastp hit 234 \#hsps 0 ok 482 - tile no_hsps.blastp hit 235 \#hsps 0 ok 483 - tile no_hsps.blastp hit 236 \#hsps 0 ok 484 - tile no_hsps.blastp hit 237 \#hsps 0 ok 485 - tile no_hsps.blastp hit 238 \#hsps 0 ok 486 - tile no_hsps.blastp hit 239 \#hsps 0 ok 487 - tile no_hsps.blastp hit 240 \#hsps 0 ok 488 - tile no_hsps.blastp hit 241 \#hsps 0 ok 489 - tile no_hsps.blastp hit 242 \#hsps 0 ok 490 - tile no_hsps.blastp hit 243 \#hsps 0 ok 491 - tile no_hsps.blastp hit 244 \#hsps 0 ok 492 - tile no_hsps.blastp hit 245 \#hsps 0 ok 493 - tile no_hsps.blastp hit 246 \#hsps 0 ok 494 - tile no_hsps.blastp hit 247 \#hsps 0 ok 495 - tile no_hsps.blastp hit 248 \#hsps 0 ok 496 - tile no_hsps.blastp hit 249 \#hsps 0 ok 497 - tile no_hsps.blastp hit 250 \#hsps 0 ok 498 - tile no_hsps.blastp hit 251 \#hsps 0 ok 499 - tile no_hsps.blastp hit 252 \#hsps 0 ok 500 - tile no_hsps.blastp hit 253 \#hsps 0 ok 501 - tile no_hsps.blastp hit 254 \#hsps 0 ok 502 - tile no_hsps.blastp hit 255 \#hsps 0 ok 503 - tile no_hsps.blastp hit 256 \#hsps 0 ok 504 - tile no_hsps.blastp hit 257 \#hsps 0 ok 505 - tile no_hsps.blastp hit 258 \#hsps 0 ok 506 - tile no_hsps.blastp hit 259 \#hsps 0 ok 507 - tile no_hsps.blastp hit 260 \#hsps 0 ok 508 - tile no_hsps.blastp hit 261 \#hsps 0 ok 509 - tile no_hsps.blastp hit 262 \#hsps 0 ok 510 - tile no_hsps.blastp hit 263 \#hsps 0 ok 511 - tile no_hsps.blastp hit 264 \#hsps 0 ok 512 - tile no_hsps.blastp hit 265 \#hsps 0 ok 513 - tile no_hsps.blastp hit 266 \#hsps 0 ok 514 - tile no_hsps.blastp hit 267 \#hsps 0 ok 515 - tile no_hsps.blastp hit 268 \#hsps 0 ok 516 - tile no_hsps.blastp hit 269 \#hsps 0 ok 517 - tile no_hsps.blastp hit 270 \#hsps 0 ok 518 - tile no_hsps.blastp hit 271 \#hsps 0 ok 519 - tile no_hsps.blastp hit 272 \#hsps 0 ok 520 - tile no_hsps.blastp hit 273 \#hsps 0 ok 521 - tile no_hsps.blastp hit 274 \#hsps 0 ok 522 - tile no_hsps.blastp hit 275 \#hsps 0 ok 523 - tile no_hsps.blastp hit 276 \#hsps 0 ok 524 - tile no_hsps.blastp hit 277 \#hsps 0 ok 525 - tile no_hsps.blastp hit 278 \#hsps 0 ok 526 - tile no_hsps.blastp hit 279 \#hsps 0 ok 527 - tile no_hsps.blastp hit 280 \#hsps 0 ok 528 - tile no_hsps.blastp hit 281 \#hsps 0 ok 529 - tile no_hsps.blastp hit 282 \#hsps 0 ok 530 - tile no_hsps.blastp hit 283 \#hsps 0 ok 531 - tile no_hsps.blastp hit 284 \#hsps 0 ok 532 - tile no_hsps.blastp hit 285 \#hsps 0 ok 533 - tile no_hsps.blastp hit 286 \#hsps 0 ok 534 - tile no_hsps.blastp hit 287 \#hsps 0 ok 535 - tile no_hsps.blastp hit 288 \#hsps 0 ok 536 - tile no_hsps.blastp hit 289 \#hsps 0 ok 537 - tile no_hsps.blastp hit 290 \#hsps 0 ok 538 - tile no_hsps.blastp hit 291 \#hsps 0 ok 539 - tile no_hsps.blastp hit 292 \#hsps 0 ok 540 - tile no_hsps.blastp hit 293 \#hsps 0 ok 541 - tile no_hsps.blastp hit 294 \#hsps 0 ok 542 - tile no_hsps.blastp hit 295 \#hsps 0 ok 543 - tile no_hsps.blastp hit 296 \#hsps 0 ok 544 - tile no_hsps.blastp hit 297 \#hsps 0 ok 545 - tile no_hsps.blastp hit 298 \#hsps 0 ok 546 - tile no_hsps.blastp hit 299 \#hsps 0 ok 547 - tile no_hsps.blastp hit 300 \#hsps 0 ok 548 - tile no_hsps.blastp hit 301 \#hsps 0 ok 549 - tile no_hsps.blastp hit 302 \#hsps 0 ok 550 - tile no_hsps.blastp hit 303 \#hsps 0 ok 551 - tile no_hsps.blastp hit 304 \#hsps 0 ok 552 - tile no_hsps.blastp hit 305 \#hsps 0 ok 553 - tile no_hsps.blastp hit 306 \#hsps 0 ok 554 - tile no_hsps.blastp hit 307 \#hsps 0 ok 555 - tile no_hsps.blastp hit 308 \#hsps 0 ok 556 - tile no_hsps.blastp hit 309 \#hsps 0 ok 557 - tile no_hsps.blastp hit 310 \#hsps 0 ok 558 - tile no_hsps.blastp hit 311 \#hsps 0 ok 559 - tile no_hsps.blastp hit 312 \#hsps 0 ok 560 - tile no_hsps.blastp hit 313 \#hsps 0 ok 561 - tile no_hsps.blastp hit 314 \#hsps 0 ok 562 - tile no_hsps.blastp hit 315 \#hsps 0 ok 563 - tile no_hsps.blastp hit 316 \#hsps 0 ok 564 - tile no_hsps.blastp hit 317 \#hsps 0 ok 565 - tile no_hsps.blastp hit 318 \#hsps 0 ok 566 - tile no_hsps.blastp hit 319 \#hsps 0 ok 567 - tile no_hsps.blastp hit 320 \#hsps 0 ok 568 - tile no_hsps.blastp hit 321 \#hsps 0 ok 569 - tile no_hsps.blastp hit 322 \#hsps 0 ok 570 - tile no_hsps.blastp hit 323 \#hsps 0 ok 571 - tile no_hsps.blastp hit 324 \#hsps 0 ok 572 - tile no_hsps.blastp hit 325 \#hsps 0 ok 573 - tile no_hsps.blastp hit 326 \#hsps 0 ok 574 - tile no_hsps.blastp hit 327 \#hsps 0 ok 575 - tile no_hsps.blastp hit 328 \#hsps 0 ok 576 - tile no_hsps.blastp hit 329 \#hsps 0 ok 577 - tile no_hsps.blastp hit 330 \#hsps 0 ok 578 - tile no_hsps.blastp hit 331 \#hsps 0 ok 579 - tile no_hsps.blastp hit 332 \#hsps 0 ok 580 - tile no_hsps.blastp hit 333 \#hsps 0 ok 581 - tile no_hsps.blastp hit 334 \#hsps 0 ok 582 - tile no_hsps.blastp hit 335 \#hsps 0 ok 583 - tile no_hsps.blastp hit 336 \#hsps 0 ok 584 - tile no_hsps.blastp hit 337 \#hsps 0 ok 585 - tile no_hsps.blastp hit 338 \#hsps 0 ok 586 - tile no_hsps.blastp hit 339 \#hsps 0 ok 587 - tile no_hsps.blastp hit 340 \#hsps 0 ok 588 - tile no_hsps.blastp hit 341 \#hsps 0 ok 589 - tile no_hsps.blastp hit 342 \#hsps 0 ok 590 - tile no_hsps.blastp hit 343 \#hsps 0 ok 591 - tile no_hsps.blastp hit 344 \#hsps 0 ok 592 - tile no_hsps.blastp hit 345 \#hsps 0 ok 593 - tile no_hsps.blastp hit 346 \#hsps 0 ok 594 - tile no_hsps.blastp hit 347 \#hsps 0 ok 595 - tile no_hsps.blastp hit 348 \#hsps 0 ok 596 - tile no_hsps.blastp hit 349 \#hsps 0 ok 597 - tile no_hsps.blastp hit 350 \#hsps 0 ok 598 - tile no_hsps.blastp hit 351 \#hsps 0 ok 599 - tile no_hsps.blastp hit 352 \#hsps 0 ok 600 - tile no_hsps.blastp hit 353 \#hsps 0 ok 601 - tile no_hsps.blastp hit 354 \#hsps 0 ok 602 - tile no_hsps.blastp hit 355 \#hsps 0 ok 603 - tile no_hsps.blastp hit 356 \#hsps 0 ok 604 - tile no_hsps.blastp hit 357 \#hsps 0 ok 605 - tile no_hsps.blastp hit 358 \#hsps 0 ok 606 - tile no_hsps.blastp hit 359 \#hsps 0 ok 607 - tile no_hsps.blastp hit 360 \#hsps 0 ok 608 - tile no_hsps.blastp hit 361 \#hsps 0 ok 609 - tile no_hsps.blastp hit 362 \#hsps 0 ok 610 - tile no_hsps.blastp hit 363 \#hsps 0 ok 611 - tile no_hsps.blastp hit 364 \#hsps 0 ok 612 - tile no_hsps.blastp hit 365 \#hsps 0 ok 613 - tile no_hsps.blastp hit 366 \#hsps 0 ok 614 - tile no_hsps.blastp hit 367 \#hsps 0 ok 615 - tile no_hsps.blastp hit 368 \#hsps 0 ok 616 - tile no_hsps.blastp hit 369 \#hsps 0 ok 617 - tile no_hsps.blastp hit 370 \#hsps 0 ok 618 - tile no_hsps.blastp hit 371 \#hsps 0 ok 619 - tile no_hsps.blastp hit 372 \#hsps 0 ok 620 - tile no_hsps.blastp hit 373 \#hsps 0 ok 621 - tile no_hsps.blastp hit 374 \#hsps 0 ok 622 - tile no_hsps.blastp hit 375 \#hsps 0 ok 623 - tile no_hsps.blastp hit 376 \#hsps 0 ok 624 - tile no_hsps.blastp hit 377 \#hsps 0 ok 625 - tile no_hsps.blastp hit 378 \#hsps 0 ok 626 - tile no_hsps.blastp hit 379 \#hsps 0 ok 627 - tile no_hsps.blastp hit 380 \#hsps 0 ok 628 - tile no_hsps.blastp hit 381 \#hsps 0 ok 629 - tile no_hsps.blastp hit 382 \#hsps 0 ok 630 - tile no_hsps.blastp hit 383 \#hsps 0 ok 631 - tile no_hsps.blastp hit 384 \#hsps 0 ok 632 - tile no_hsps.blastp hit 385 \#hsps 0 ok 633 - tile no_hsps.blastp hit 386 \#hsps 0 ok 634 - tile no_hsps.blastp hit 387 \#hsps 0 ok 635 - tile no_hsps.blastp hit 388 \#hsps 0 ok 636 - tile no_hsps.blastp hit 389 \#hsps 0 ok 637 - tile no_hsps.blastp hit 390 \#hsps 0 ok 638 - tile no_hsps.blastp hit 391 \#hsps 0 ok 639 - tile no_hsps.blastp hit 392 \#hsps 0 ok 640 - tile no_hsps.blastp hit 393 \#hsps 0 ok 641 - tile no_hsps.blastp hit 394 \#hsps 0 ok 642 - tile no_hsps.blastp hit 395 \#hsps 0 ok 643 - tile no_hsps.blastp hit 396 \#hsps 0 ok 644 - tile no_hsps.blastp hit 397 \#hsps 0 ok 645 - tile no_hsps.blastp hit 398 \#hsps 0 ok 646 - tile no_hsps.blastp hit 399 \#hsps 0 ok 647 - tile no_hsps.blastp hit 400 \#hsps 0 ok 648 - tile no_hsps.blastp hit 401 \#hsps 0 ok 649 - tile no_hsps.blastp hit 402 \#hsps 0 ok 650 - tile no_hsps.blastp hit 403 \#hsps 0 ok 651 - tile no_hsps.blastp hit 404 \#hsps 0 ok 652 - tile no_hsps.blastp hit 405 \#hsps 0 ok 653 - tile no_hsps.blastp hit 406 \#hsps 0 ok 654 - tile no_hsps.blastp hit 407 \#hsps 0 ok 655 - tile no_hsps.blastp hit 408 \#hsps 0 ok 656 - tile no_hsps.blastp hit 409 \#hsps 0 ok 657 - tile no_hsps.blastp hit 410 \#hsps 0 ok 658 - tile no_hsps.blastp hit 411 \#hsps 0 ok 659 - tile no_hsps.blastp hit 412 \#hsps 0 ok 660 - tile no_hsps.blastp hit 413 \#hsps 0 ok 661 - tile no_hsps.blastp hit 414 \#hsps 0 ok 662 - tile no_hsps.blastp hit 415 \#hsps 0 ok 663 - catalase-webblast.BLASTP ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1 ok 665 - q id: est (1.00000) = fast (1.00000) ok 666 - q cn: est (1.00000) = fast (1.00000) ok 667 - h id: est (1.00000) = fast (1.00000) ok 668 - h cn: est (1.00000) = fast (1.00000) ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1 ok 670 - q id: est (0.80973) = fast (0.80973) ok 671 - q cn: est (0.89006) = fast (0.89006) ok 672 - h id: est (0.82543) = fast (0.82543) ok 673 - h cn: est (0.90733) = fast (0.90733) ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1 ok 675 - q id: est (0.71670) = fast (0.71670) ok 676 - q cn: est (0.84144) = fast (0.84144) ok 677 - h id: est (0.72747) = fast (0.72747) ok 678 - h cn: est (0.85408) = fast (0.85408) ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1 ok 680 - q id: est (0.58910) = fast (0.58910) ok 681 - q cn: est (0.70860) = fast (0.70860) ok 682 - h id: est (0.65654) = fast (0.65654) ok 683 - h cn: est (0.78972) = fast (0.78972) ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1 ok 685 - q id: est (0.49245) = fast (0.49245) ok 686 - q cn: est (0.65257) = fast (0.65257) ok 687 - h id: est (0.49544) = fast (0.49544) ok 688 - h cn: est (0.65653) = fast (0.65653) ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1 ok 690 - q id: est (0.44366) = fast (0.44366) ok 691 - q cn: est (0.58920) = fast (0.58920) ok 692 - h id: est (0.44787) = fast (0.44787) ok 693 - h cn: est (0.59479) = fast (0.59479) ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1 ok 695 - q id: est (0.42564) = fast (0.42564) ok 696 - q cn: est (0.61282) = fast (0.61282) ok 697 - h id: est (0.43229) = fast (0.43229) ok 698 - h cn: est (0.62240) = fast (0.62240) ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1 ok 700 - q id: est (0.48358) = fast (0.48358) ok 701 - q cn: est (0.63881) = fast (0.63881) ok 702 - h id: est (0.48943) = fast (0.48943) ok 703 - h cn: est (0.64653) = fast (0.64653) ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1 ok 705 - q id: est (0.42308) = fast (0.42308) ok 706 - q cn: est (0.61282) = fast (0.61282) ok 707 - h id: est (0.42969) = fast (0.42969) ok 708 - h cn: est (0.62240) = fast (0.62240) ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1 ok 710 - q id: est (0.39675) = fast (0.39675) ok 711 - q cn: est (0.58933) = fast (0.58933) ok 712 - h id: est (0.39767) = fast (0.39767) ok 713 - h cn: est (0.59070) = fast (0.59070) ok 714 - dcr1_sp.WUBLASTP ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1 ok 716 - q id: est (1.00000) = fast (1.00000) ok 717 - q cn: est (1.00000) = fast (1.00000) ok 718 - h id: est (1.00000) = fast (1.00000) ok 719 - h cn: est (1.00000) = fast (1.00000) ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4 ok 721 - q id: exact (0.36876) ~ est (0.36973) ok 722 - q id: exact (0.36876) <= max (0.37070) ok 723 - q cn: exact (0.55022) ~ est (0.55041) ok 724 - q cn: exact (0.55022) <= max (0.55105) ok 725 - h id: exact (0.35111) ~ est (0.35111) ok 726 - h id: exact (0.35111) <= max (0.35111) ok 727 - h cn: exact (0.52305) ~ est (0.52305) ok 728 - h cn: exact (0.52305) <= max (0.52305) ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1 ok 730 - q id: est (0.38685) = fast (0.38685) ok 731 - q cn: est (0.55397) = fast (0.55397) ok 732 - h id: est (0.37613) = fast (0.37613) ok 733 - h cn: est (0.53863) = fast (0.53863) ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1 ok 735 - q id: est (0.38247) = fast (0.38247) ok 736 - q cn: est (0.55068) = fast (0.55068) ok 737 - h id: est (0.37306) = fast (0.37306) ok 738 - h cn: est (0.53715) = fast (0.53715) ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5 ok 740 - q id: exact (0.35010) ~ est (0.35010) ok 741 - q id: exact (0.35010) <= max (0.35010) ok 742 - q cn: exact (0.53183) ~ est (0.53183) ok 743 - q cn: exact (0.53183) <= max (0.53183) ok 744 - h id: exact (0.35082) ~ est (0.35082) ok 745 - h id: exact (0.35082) <= max (0.35082) ok 746 - h cn: exact (0.53292) ~ est (0.53292) ok 747 - h cn: exact (0.53292) <= max (0.53292) ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8 ok 749 - q id: exact (0.30547) ~ est (0.30659) ok 750 - q id: exact (0.30547) <= max (0.30623) ok 751 - q cn: exact (0.50076) ~ est (0.50205) ok 752 - q cn: exact (0.50076) <= max (0.50076) ok 753 - h id: exact (0.31390) ~ est (0.31179) ok 754 - h id: exact (0.31390) <= max (0.31795) ok 755 - h cn: exact (0.50531) ~ est (0.50557) ok 756 - h cn: exact (0.50531) <= max (0.51091) ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7 ok 758 - q id: exact (0.30136) ~ est (0.30184) ok 759 - q id: exact (0.30136) <= max (0.30498) ok 760 - q cn: exact (0.48688) ~ est (0.48742) ok 761 - q cn: exact (0.48688) <= max (0.49140) ok 762 - h id: exact (0.30944) ~ est (0.31034) ok 763 - h id: exact (0.30944) <= max (0.30988) ok 764 - h cn: exact (0.50178) ~ est (0.50277) ok 765 - h cn: exact (0.50178) <= max (0.50223) ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10 ok 767 - q id: exact (0.28918) ~ est (0.28961) ok 768 - q id: exact (0.28918) <= max (0.28955) ok 769 - q cn: exact (0.46418) ~ est (0.46247) ok 770 - q cn: exact (0.46418) <= max (0.46866) ok 771 - h id: exact (0.30166) ~ est (0.30299) ok 772 - h id: exact (0.30166) <= max (0.30800) ok 773 - h cn: exact (0.48179) ~ est (0.48439) ok 774 - h cn: exact (0.48179) <= max (0.48535) ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8 ok 776 - q id: exact (0.30289) ~ est (0.30238) ok 777 - q id: exact (0.30289) <= max (0.30651) ok 778 - q cn: exact (0.49955) ~ est (0.49787) ok 779 - q cn: exact (0.49955) <= max (0.50362) ok 780 - h id: exact (0.31395) ~ est (0.31347) ok 781 - h id: exact (0.31395) <= max (0.31721) ok 782 - h cn: exact (0.51535) ~ est (0.51578) ok 783 - h cn: exact (0.51535) <= max (0.51814) ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5 ok 785 - q id: exact (0.29334) ~ est (0.29534) ok 786 - q id: exact (0.29334) <= max (0.29810) ok 787 - q cn: exact (0.46617) ~ est (0.46719) ok 788 - q cn: exact (0.46617) <= max (0.47040) ok 789 - h id: exact (0.31176) ~ est (0.31176) ok 790 - h id: exact (0.31176) <= max (0.31176) ok 791 - h cn: exact (0.49299) ~ est (0.49299) ok 792 - h cn: exact (0.49299) <= max (0.49299) ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7 ok 794 - q id: exact (0.30456) ~ est (0.30514) ok 795 - q id: exact (0.30456) <= max (0.30650) ok 796 - q cn: exact (0.48739) ~ est (0.48879) ok 797 - q cn: exact (0.48739) <= max (0.49370) ok 798 - h id: exact (0.32062) ~ est (0.31987) ok 799 - h id: exact (0.32062) <= max (0.32932) ok 800 - h cn: exact (0.51071) ~ est (0.51306) ok 801 - h cn: exact (0.51071) <= max (0.52410) ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8 ok 803 - q id: exact (0.29615) ~ est (0.29879) ok 804 - q id: exact (0.29615) <= max (0.30009) ok 805 - q cn: exact (0.47419) ~ est (0.47394) ok 806 - q cn: exact (0.47419) <= max (0.48119) ok 807 - h id: exact (0.31611) ~ est (0.31482) ok 808 - h id: exact (0.31611) <= max (0.32227) ok 809 - h cn: exact (0.49779) ~ est (0.49788) ok 810 - h cn: exact (0.49779) <= max (0.50616) ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8 ok 812 - q id: exact (0.30390) ~ est (0.30440) ok 813 - q id: exact (0.30390) <= max (0.30701) ok 814 - q cn: exact (0.45874) ~ est (0.45993) ok 815 - q cn: exact (0.45874) <= max (0.45963) ok 816 - h id: exact (0.32282) ~ est (0.32324) ok 817 - h id: exact (0.32282) <= max (0.32560) ok 818 - h cn: exact (0.48052) ~ est (0.48136) ok 819 - h cn: exact (0.48052) <= max (0.48330) ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6 ok 821 - q id: exact (0.29769) ~ est (0.29851) ok 822 - q id: exact (0.29769) <= max (0.29769) ok 823 - q cn: exact (0.48480) ~ est (0.48628) ok 824 - q cn: exact (0.48480) <= max (0.48637) ok 825 - h id: exact (0.30704) ~ est (0.30810) ok 826 - h id: exact (0.30704) <= max (0.30917) ok 827 - h cn: exact (0.50107) ~ est (0.50292) ok 828 - h cn: exact (0.50107) <= max (0.50320) ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6 ok 830 - q id: exact (0.27854) ~ est (0.27854) ok 831 - q id: exact (0.27854) <= max (0.27854) ok 832 - q cn: exact (0.48174) ~ est (0.48174) ok 833 - q cn: exact (0.48174) <= max (0.48174) ok 834 - h id: exact (0.28514) ~ est (0.28623) ok 835 - h id: exact (0.28514) <= max (0.28594) ok 836 - h cn: exact (0.49197) ~ est (0.49154) ok 837 - h cn: exact (0.49197) <= max (0.49237) ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8 ok 839 - q id: exact (0.30362) ~ est (0.30824) ok 840 - q id: exact (0.30362) <= max (0.30852) ok 841 - q cn: exact (0.47111) ~ est (0.47587) ok 842 - q cn: exact (0.47111) <= max (0.47405) ok 843 - h id: exact (0.32347) ~ est (0.32392) ok 844 - h id: exact (0.32347) <= max (0.32643) ok 845 - h cn: exact (0.49310) ~ est (0.49360) ok 846 - h cn: exact (0.49310) <= max (0.49606) ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4 ok 848 - q id: exact (0.29174) ~ est (0.29174) ok 849 - q id: exact (0.29174) <= max (0.29174) ok 850 - q cn: exact (0.46230) ~ est (0.46230) ok 851 - q cn: exact (0.46230) <= max (0.46230) ok 852 - h id: exact (0.30204) ~ est (0.30204) ok 853 - h id: exact (0.30204) <= max (0.30204) ok 854 - h cn: exact (0.47862) ~ est (0.47862) ok 855 - h cn: exact (0.47862) <= max (0.47862) ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6 ok 857 - q id: exact (0.29064) ~ est (0.29089) ok 858 - q id: exact (0.29064) <= max (0.29115) ok 859 - q cn: exact (0.48765) ~ est (0.48670) ok 860 - q cn: exact (0.48765) <= max (0.48868) ok 861 - h id: exact (0.29848) ~ est (0.29887) ok 862 - h id: exact (0.29848) <= max (0.29902) ok 863 - h cn: exact (0.50108) ~ est (0.50116) ok 864 - h cn: exact (0.50108) <= max (0.50163) ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5 ok 866 - q id: exact (0.29510) ~ est (0.29505) ok 867 - q id: exact (0.29510) <= max (0.29510) ok 868 - q cn: exact (0.48982) ~ est (0.49039) ok 869 - q cn: exact (0.48982) <= max (0.49029) ok 870 - h id: exact (0.30019) ~ est (0.30019) ok 871 - h id: exact (0.30019) <= max (0.30019) ok 872 - h cn: exact (0.49906) ~ est (0.49906) ok 873 - h cn: exact (0.49906) <= max (0.49906) ok 874 - 503384.MEGABLAST.2 ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5 ok 876 - q id: exact (0.91435) ~ est (0.91435) ok 877 - q id: exact (0.91435) <= max (0.91435) ok 878 - q cn: exact (0.91435) ~ est (0.91435) ok 879 - q cn: exact (0.91435) <= max (0.91435) ok 880 - h id: exact (0.91157) ~ est (0.91157) ok 881 - h id: exact (0.91157) <= max (0.91157) ok 882 - h cn: exact (0.91157) ~ est (0.91157) ok 883 - h cn: exact (0.91157) <= max (0.91157) ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9 ok 885 - q id: exact (0.92895) ~ est (0.92895) ok 886 - q id: exact (0.92895) <= max (0.92895) ok 887 - q cn: exact (0.92895) ~ est (0.92895) ok 888 - q cn: exact (0.92895) <= max (0.92895) ok 889 - h id: exact (0.92854) ~ est (0.92854) ok 890 - h id: exact (0.92854) <= max (0.92854) ok 891 - h cn: exact (0.92854) ~ est (0.92854) ok 892 - h cn: exact (0.92854) <= max (0.92854) ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3 ok 894 - q id: exact (0.93516) ~ est (0.93516) ok 895 - q id: exact (0.93516) <= max (0.93516) ok 896 - q cn: exact (0.93516) ~ est (0.93516) ok 897 - q cn: exact (0.93516) <= max (0.93516) ok 898 - h id: exact (0.93651) ~ est (0.93651) ok 899 - h id: exact (0.93651) <= max (0.93651) ok 900 - h cn: exact (0.93651) ~ est (0.93651) ok 901 - h cn: exact (0.93651) <= max (0.93651) ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3 ok 903 - q id: exact (0.93064) ~ est (0.93064) ok 904 - q id: exact (0.93064) <= max (0.93064) ok 905 - q cn: exact (0.93064) ~ est (0.93064) ok 906 - q cn: exact (0.93064) <= max (0.93064) ok 907 - h id: exact (0.92885) ~ est (0.92885) ok 908 - h id: exact (0.92885) <= max (0.92885) ok 909 - h cn: exact (0.92885) ~ est (0.92885) ok 910 - h cn: exact (0.92885) <= max (0.92885) ok 911 - bl2seq.blastx.out ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6 ok 913 - q id: est (0.71429) = fast (0.71429) ok 914 - q cn: est (1.00000) = fast (1.00000) ok 915 - q id: est (0.35714) = fast (0.35714) ok 916 - q cn: est (0.57143) = fast (0.57143) ok 917 - q id: exact (0.70536) ~ est (0.70495) ok 918 - q id: exact (0.70536) <= max (0.94286) ok 919 - q cn: exact (0.78810) ~ est (0.78803) ok 920 - q cn: exact (0.78810) <= max (0.96429) ok 921 - h id: exact (0.61923) ~ est (0.61955) ok 922 - h id: exact (0.61923) <= max (0.64231) ok 923 - h cn: exact (0.73077) ~ est (0.73077) ok 924 - h cn: exact (0.73077) <= max (0.75000) ok 925 - dnaEbsub_ecoli.wublastx ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1 ok 927 - q id: est (0.36386) = fast (0.36386) ok 928 - q cn: est (0.53735) = fast (0.53735) ok 929 - h id: est (0.36562) = fast (0.36562) ok 930 - h cn: est (0.53995) = fast (0.53995) ok 931 - tblastn.out ok 932 - tile tblastn.out hit 1 \#hsps 2 ok 933 - q id: exact (0.31250) ~ est (0.33325) ok 934 - q id: exact (0.31250) <= max (0.33333) ok 935 - q cn: exact (0.44792) ~ est (0.47055) ok 936 - q cn: exact (0.44792) <= max (0.45833) ok 937 - h id: exact (0.33333) ~ est (0.33333) ok 938 - h id: exact (0.33333) <= max (0.33333) ok 939 - h cn: exact (0.47059) ~ est (0.47059) ok 940 - h cn: exact (0.47059) <= max (0.47059) ok 941 - tile tblastn.out hit 2 \#hsps 2 ok 942 - q id: exact (0.68750) ~ est (0.68750) ok 943 - q id: exact (0.68750) <= max (0.68750) ok 944 - q cn: exact (0.81250) ~ est (0.81250) ok 945 - q cn: exact (0.81250) <= max (0.81250) ok 946 - h id: est (0.66667) = fast (0.66667) ok 947 - h cn: est (0.77778) = fast (0.77778) ok 948 - h id: est (0.71429) = fast (0.71429) ok 949 - h cn: est (0.85714) = fast (0.85714) ok 950 - dnaEbsub_ecoli.wutblastn ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1 ok 952 - q id: est (0.36386) = fast (0.36386) ok 953 - q cn: est (0.53735) = fast (0.53735) ok 954 - h id: est (0.36562) = fast (0.36562) ok 955 - h cn: est (0.53995) = fast (0.53995) ok 956 - HUMBETGLOA.tblastx ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1 ok 958 - q id: est (0.42308) = fast (0.42308) ok 959 - q cn: est (0.61538) = fast (0.61538) ok 960 - h id: est (0.42308) = fast (0.42308) ok 961 - h cn: est (0.61538) = fast (0.61538) ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1 ok 963 - q id: est (0.47059) = fast (0.47059) ok 964 - q cn: est (0.76471) = fast (0.76471) ok 965 - h id: est (0.47059) = fast (0.47059) ok 966 - h cn: est (0.76471) = fast (0.76471) ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1 ok 968 - q id: est (0.36000) = fast (0.36000) ok 969 - q cn: est (0.56000) = fast (0.56000) ok 970 - h id: est (0.36000) = fast (0.36000) ok 971 - h cn: est (0.56000) = fast (0.56000) ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1 ok 973 - q id: est (0.29268) = fast (0.29268) ok 974 - q cn: est (0.58537) = fast (0.58537) ok 975 - h id: est (0.29268) = fast (0.29268) ok 976 - h cn: est (0.58537) = fast (0.58537) ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1 ok 978 - q id: est (0.38889) = fast (0.38889) ok 979 - q cn: est (0.55556) = fast (0.55556) ok 980 - h id: est (0.38889) = fast (0.38889) ok 981 - h cn: est (0.55556) = fast (0.55556) ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1 ok 983 - q id: est (0.43590) = fast (0.43590) ok 984 - q cn: est (0.51282) = fast (0.51282) ok 985 - h id: est (0.43590) = fast (0.43590) ok 986 - h cn: est (0.51282) = fast (0.51282) ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1 ok 988 - q id: est (0.35714) = fast (0.35714) ok 989 - q cn: est (0.42857) = fast (0.42857) ok 990 - h id: est (0.35714) = fast (0.35714) ok 991 - h cn: est (0.42857) = fast (0.42857) ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1 ok 993 - q id: est (0.33333) = fast (0.33333) ok 994 - q cn: est (0.66667) = fast (0.66667) ok 995 - h id: est (0.33333) = fast (0.33333) ok 996 - h cn: est (0.66667) = fast (0.66667) ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2 ok 998 - q id: exact (0.40541) ~ est (0.40541) ok 999 - q id: exact (0.40541) <= max (0.40541) ok 1000 - q cn: exact (0.56757) ~ est (0.56757) ok 1001 - q cn: exact (0.56757) <= max (0.56757) ok 1002 - h id: est (0.36364) = fast (0.36364) ok 1003 - h cn: est (0.63636) = fast (0.63636) ok 1004 - h id: est (0.42308) = fast (0.42308) ok 1005 - h cn: est (0.53846) = fast (0.53846) ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1 ok 1007 - q id: est (0.29167) = fast (0.29167) ok 1008 - q cn: est (0.39583) = fast (0.39583) ok 1009 - h id: est (0.29167) = fast (0.29167) ok 1010 - h cn: est (0.39583) = fast (0.39583) ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1 ok 1012 - q id: est (0.60000) = fast (0.60000) ok 1013 - q cn: est (0.65000) = fast (0.65000) ok 1014 - h id: est (0.60000) = fast (0.60000) ok 1015 - h cn: est (0.65000) = fast (0.65000) ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1 ok 1017 - q id: est (0.50000) = fast (0.50000) ok 1018 - q cn: est (0.68182) = fast (0.68182) ok 1019 - h id: est (0.50000) = fast (0.50000) ok 1020 - h cn: est (0.68182) = fast (0.68182) ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1 ok 1022 - q id: est (0.29630) = fast (0.29630) ok 1023 - q cn: est (0.48148) = fast (0.48148) ok 1024 - h id: est (0.29630) = fast (0.29630) ok 1025 - h cn: est (0.48148) = fast (0.48148) ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1 ok 1027 - q id: est (0.47826) = fast (0.47826) ok 1028 - q cn: est (0.52174) = fast (0.52174) ok 1029 - h id: est (0.47826) = fast (0.47826) ok 1030 - h cn: est (0.52174) = fast (0.52174) ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1 ok 1032 - q id: est (0.47368) = fast (0.47368) ok 1033 - q cn: est (0.63158) = fast (0.63158) ok 1034 - h id: est (0.47368) = fast (0.47368) ok 1035 - h cn: est (0.63158) = fast (0.63158) ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1 ok 1037 - q id: est (0.44444) = fast (0.44444) ok 1038 - q cn: est (0.55556) = fast (0.55556) ok 1039 - h id: est (0.44444) = fast (0.44444) ok 1040 - h cn: est (0.55556) = fast (0.55556) ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1 ok 1042 - q id: est (0.47059) = fast (0.47059) ok 1043 - q cn: est (0.70588) = fast (0.70588) ok 1044 - h id: est (0.47059) = fast (0.47059) ok 1045 - h cn: est (0.70588) = fast (0.70588) ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1 ok 1047 - q id: est (0.38889) = fast (0.38889) ok 1048 - q cn: est (0.66667) = fast (0.66667) ok 1049 - h id: est (0.38889) = fast (0.38889) ok 1050 - h cn: est (0.66667) = fast (0.66667) ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1 ok 1052 - q id: est (0.27660) = fast (0.27660) ok 1053 - q cn: est (0.48936) = fast (0.48936) ok 1054 - h id: est (0.27660) = fast (0.27660) ok 1055 - h cn: est (0.48936) = fast (0.48936) ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1 ok 1057 - q id: est (0.40000) = fast (0.40000) ok 1058 - q cn: est (0.60000) = fast (0.60000) ok 1059 - h id: est (0.40000) = fast (0.40000) ok 1060 - h cn: est (0.60000) = fast (0.60000) ok 1061 - dnaEbsub_ecoli.wutblastx ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12 ok 1063 - q id: est (0.37500) = fast (0.37500) ok 1064 - q cn: est (0.62500) = fast (0.62500) ok 1065 - q id: exact (0.40224) ~ est (0.40912) ok 1066 - q id: exact (0.40224) <= max (0.42628) ok 1067 - q cn: exact (0.58494) ~ est (0.58968) ok 1068 - q cn: exact (0.58494) <= max (0.62179) ok 1069 - q id: est (0.25352) = fast (0.25352) ok 1070 - q cn: est (0.47887) = fast (0.47887) ok 1071 - q id: exact (0.44118) ~ est (0.44118) ok 1072 - q id: exact (0.44118) <= max (0.44118) ok 1073 - q cn: exact (0.54412) ~ est (0.54412) ok 1074 - q cn: exact (0.54412) <= max (0.54412) ok 1075 - h id: exact (0.39848) ~ est (0.40304) ok 1076 - h id: exact (0.39848) <= max (0.40355) ok 1077 - h cn: exact (0.58376) ~ est (0.58889) ok 1078 - h cn: exact (0.58376) <= max (0.58883) ok 1079 - h id: est (0.25352) = fast (0.25352) ok 1080 - h cn: est (0.47887) = fast (0.47887) ok 1081 - h id: exact (0.44118) ~ est (0.44118) ok 1082 - h id: exact (0.44118) <= max (0.44118) ok 1083 - h cn: exact (0.54412) ~ est (0.54412) ok 1084 - h cn: exact (0.54412) <= max (0.54412) ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2 ok 1086 - q id: exact (0.41818) ~ est (0.41818) ok 1087 - q id: exact (0.41818) <= max (0.41818) ok 1088 - q cn: exact (0.52727) ~ est (0.52727) ok 1089 - q cn: exact (0.52727) <= max (0.52727) ok 1090 - h id: est (0.37500) = fast (0.37500) ok 1091 - h cn: est (0.47500) = fast (0.47500) ok 1092 - h id: est (0.53333) = fast (0.53333) ok 1093 - h cn: est (0.66667) = fast (0.66667) ok 1094 - bug2942: query m0: range correct ok 1095 - bug2942: query m1: range correct ok 1096 - bug2942: query m2: range correct ok 1097 - bug2942: subject all : range correct ok 1098 - get_tiled_alns ok 1099 - got all alns ok 1100 ok 1101 - aln and qfeat lengths correspond ok 1102 - q length correct ok 1103 ok 1104 - features on q and s correspond ok 1105 - aln and hfeat lengths correspond ok 1106 - s length correct ok 1107 ok 1108 - aln and qfeat lengths correspond ok 1109 - q length correct ok 1110 ok 1111 - features on q and s correspond ok 1112 - aln and hfeat lengths correspond ok 1113 - s length correct ok 1114 ok 1115 - aln and qfeat lengths correspond ok 1116 - q length correct ok 1117 ok 1118 - features on q and s correspond ok 1119 - aln and hfeat lengths correspond ok 1120 - s length correct ok 1121 ok 1122 - aln and qfeat lengths correspond ok 1123 - q length correct ok 1124 ok 1125 - features on q and s correspond ok 1126 - aln and hfeat lengths correspond ok 1127 - s length correct ok 1128 ok 1129 - aln and qfeat lengths correspond ok 1130 - q length correct ok 1131 ok 1132 - features on q and s correspond ok 1133 - aln and hfeat lengths correspond ok 1134 - s length correct ok 1135 ok 1136 - aln and qfeat lengths correspond ok 1137 - q length correct ok 1138 ok 1139 - features on q and s correspond ok 1140 - aln and hfeat lengths correspond ok 1141 - s length correct ok t/SearchIO/waba.t ................... 1..64 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::SearchIO::waba' isa 'Bio::SearchIO' ok 3 - query_name ok 4 - query database ok 5 - database name ok 6 - name ok 7 - hsps ok 8 - total length ok 9 - start ok 10 - end ok 11 - strand ok 12 - start ok 13 - end ok 14 - strand ok 15 - query string ok 16 - hit_string ok 17 - hmmstate string ok 18 ok 19 ok 20 ok 21 - total length ok 22 - start ok 23 - end ok 24 - strand ok 25 - start ok 26 - end ok 27 - strand ok 28 - query string ok 29 - hit_string ok 30 - hmmstate string ok 31 ok 32 ok 33 ok 34 - total length ok 35 - start ok 36 - end ok 37 - strand ok 38 - start ok 39 - end ok 40 - strand ok 41 - query string ok 42 - hit_string ok 43 - hmmstate string ok 44 ok 45 ok 46 ok 47 - query_name ok 48 - query database ok 49 - database name ok 50 - name ok 51 - hsps ok 52 - total length ok 53 - start ok 54 - end ok 55 - strand ok 56 - start ok 57 - end ok 58 - strand ok 59 - query string ok 60 - hit_string ok 61 - hmmstate string ok 62 ok 63 ok 64 ok t/SearchIO/wise.t ................... 1..20 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok t/SearchIO/Writer/GbrowseGFF.t ...... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/Writer/HitTableWriter.t .. 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HitTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/HSPTableWriter.t .. 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HSPTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/HTMLWriter.t ...... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/TextWriter.t ...... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::TextResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/Seq/DBLink.t ...................... 1..131 ok 1 - use Bio::SeqIO; ok 2 - "swissprot:K1C9_HUMAN" ok 3 - no double colon ok 4 - no trailing colon ok 5 - no double space ok 6 - dblink value is splittable ok 7 - "GenBank:Z29074.1" ok 8 - no double colon ok 9 - no trailing colon ok 10 - no double space ok 11 - dblink value is splittable ok 12 - "GenPept:CAA82315.1" ok 13 - no double colon ok 14 - no trailing colon ok 15 - no double space ok 16 - dblink value is splittable ok 17 - "GenBank:S69510.1" ok 18 - no double colon ok 19 - no trailing colon ok 20 - no double space ok 21 - dblink value is splittable ok 22 - "GenPept:AAC60619.1" ok 23 - no double colon ok 24 - no trailing colon ok 25 - no double space ok 26 - dblink value is splittable ok 27 - "GenBank:X75015.1" ok 28 - no double colon ok 29 - no trailing colon ok 30 - no double space ok 31 - dblink value is splittable ok 32 - "GenPept:CAA52924.1" ok 33 - no double colon ok 34 - no trailing colon ok 35 - no double space ok 36 - dblink value is splittable ok 37 - "GenBank:AB001594.1" ok 38 - no double colon ok 39 - no trailing colon ok 40 - no double space ok 41 - dblink value is splittable ok 42 - "GenPept:BAA19418.1" ok 43 - no double colon ok 44 - no trailing colon ok 45 - no double space ok 46 - dblink value is splittable ok 47 - "GenBank:I37984" ok 48 - no double colon ok 49 - no trailing colon ok 50 - no double space ok 51 - dblink value is splittable ok 52 - "HSSP:P08670" ok 53 - no double colon ok 54 - no trailing colon ok 55 - no double space ok 56 - dblink value is splittable ok 57 - "IntAct:P35527" ok 58 - no double colon ok 59 - no trailing colon ok 60 - no double space ok 61 - dblink value is splittable ok 62 - "Ensembl:ENSG00000171403" ok 63 - no double colon ok 64 - no trailing colon ok 65 - no double space ok 66 - dblink value is splittable ok 67 - "KEGG:hsa:3857" ok 68 - no double colon ok 69 - no trailing colon ok 70 - no double space ok 71 - dblink value is splittable ok 72 - "HGNC:6447" ok 73 - no double colon ok 74 - no trailing colon ok 75 - no double space ok 76 - dblink value is splittable ok 77 - "MIM:144200" ok 78 - no double colon ok 79 - no trailing colon ok 80 - no double space ok 81 - dblink value is splittable ok 82 - "MIM:607606" ok 83 - no double colon ok 84 - no trailing colon ok 85 - no double space ok 86 - dblink value is splittable ok 87 - "ArrayExpress:P35527" ok 88 - no double colon ok 89 - no trailing colon ok 90 - no double space ok 91 - dblink value is splittable ok 92 - "GO:0005200" ok 93 - no double colon ok 94 - no trailing colon ok 95 - no double space ok 96 - dblink value is splittable ok 97 - "GO:0008544" ok 98 - no double colon ok 99 - no trailing colon ok 100 - no double space ok 101 - dblink value is splittable ok 102 - "InterPro:IPR011000" ok 103 - no double colon ok 104 - no trailing colon ok 105 - no double space ok 106 - dblink value is splittable ok 107 - "InterPro:IPR001664" ok 108 - no double colon ok 109 - no trailing colon ok 110 - no double space ok 111 - dblink value is splittable ok 112 - "InterPro:IPR002957" ok 113 - no double colon ok 114 - no trailing colon ok 115 - no double space ok 116 - dblink value is splittable ok 117 - "Pfam:PF00038" ok 118 - no double colon ok 119 - no trailing colon ok 120 - no double space ok 121 - dblink value is splittable ok 122 - "PRINTS:PR01248" ok 123 - no double colon ok 124 - no trailing colon ok 125 - no double space ok 126 - dblink value is splittable ok 127 - "PROSITE:PS00226" ok 128 - no double colon ok 129 - no trailing colon ok 130 - no double space ok 131 - dblink value is splittable ok t/Seq/EncodedSeq.t .................. 1..37 ok 1 - use Bio::Seq::EncodedSeq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 12 ok 13 ok 14 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok t/Seq/LargeLocatableSeq.t ........... 1..8 ok 1 - use Bio::Seq::LargeLocatableSeq; ok 2 ok 3 - An object of class 'Bio::Seq::LargeLocatableSeq' isa 'Bio::Seq::LargeSeqI' ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Seq/LargePSeq.t ................... 1..30 ok 1 - use Bio::Seq::LargePrimarySeq; ok 2 - use Bio::Seq::LargeSeq; ok 3 - use Bio::Location::Simple; ok 4 - use Bio::Location::Fuzzy; ok 5 - use Bio::Location::Split; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 10 - Subseq is GGGGT ok 11 ok 12 ok 13 ok 14 - trunc seq was GGGGTGAA ok 15 ok 16 ok 17 ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 19 ok 20 - output via Bio::SeqIO::fasta ok 21 - Subseq is GGGGT ok 22 - trunc seq was GGGGTGAA ok 23 ok 24 ok 25 ok 26 - Sequence is ATGGGGTGGGGT ok 27 - Subseq is GGGGT ok 28 - trunc seq was GGGGT ok 29 ok 30 ok t/Seq/LocatableSeq.t ................ 1..119 ok 1 - use Bio::LocatableSeq; ok 2 - use Bio::AlignIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 13 ok 14 ok 15 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 16 ok 17 ok 18 ok 19 not ok 20 # TODO Need to fix columns before start of seq w/ start > 1 # Failed (TODO) test at t/Seq/LocatableSeq.t line 46. # got: 'Bio::Location::Simple=HASH(0x556c4601fe38)' # expected: undef ok 21 ok 22 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 23 ok 24 ok 25 ok 26 ok 27 - threw Regexp ((?^:.+)) ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 51 ok 52 ok 53 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - * is counted in length ok 107 - * is counted in length, but end is wrong ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 306. # got: '\-\.=~' # expected: '-\?' not ok 119 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 308. # got: '19' # expected: anything else ok t/Seq/MetaSeq.t ..................... 1..132 ok 1 - use Bio::Seq::Meta; ok 2 - use Bio::Seq::Meta::Array; ok 3 - use Bio::SeqIO; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Seq::Quality; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - aa-bb bb ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok t/Seq/PrimaryQual.t ................. 1..70 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 - A reference of type 'ARRAY' isa 'ARRAY' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - threw Regexp ((?^:.+)) ok 27 - threw Regexp ((?^:.+)) ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 - threw Regexp ((?^:EX)) ok 34 ok 35 ok 36 - threw Regexp ((?^:EX)) ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok t/Seq/PrimarySeq.t .................. 1..312 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::Location::Split; ok 5 - Bare object ok 6 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::IdentifiableI' ok 26 - An object of class 'Bio::PrimarySeq' isa 'Bio::DescribableI' ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 - threw Regexp ((?^:.+)) ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 59 ok 60 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 61 ok 62 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 63 ok 64 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - Translation: LVAST ok 77 - Translation: MVAST ok 78 - Translation: MVAST ok 79 - Translation: MVAST* ok 80 - Translation: M* ok 81 - Translation: M ok 82 ok 83 - Translation: MWP ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 - frame 0 start, frame 1 stop < frame 0 stop ok 93 - frame 1 start, frame 2 stop < frame 1 stop ok 94 ok 95 ok 96 ok 97 - Alphabet ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 - Bug 2438 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 - Bug \#2864 ok 141 - Terminator + inside sequence ok 142 ok 143 - Length method ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 - threw Regexp ((?^:.+)) ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - threw Regexp ((?^:.+)) ok 176 - Validation ok 177 ok 178 ok 179 - threw Regexp ((?^:.+)) ok 180 ok 181 ok 182 - _find_orfs 1 ok 183 - orfs are sorted by descending length ok 184 - got correct -orf => "longest" seq ok 185 - _find_orfs 1 ok 186 - orfs are sorted by descending length ok 187 - got correct -orf => "longest" seq ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok t/Seq/PrimedSeq.t ................... 1..65 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimedSeq; ok 3 - Priming the target with sequence objects ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 13 ok 14 ok 15 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - Priming the target with primer objects ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - Priming the target with located primer objects ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok t/Seq/Quality.t ..................... 1..85 ok 1 - use Bio::Seq::Quality; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bug 2845 ok 73 ok 74 - Bug 2845 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok t/Seq/Seq.t ......................... 1..76 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::RichSeq; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Species; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 - An object of class 'Bio::Seq' isa 'Bio::AnnotatableI' ok 8 ok 9 ok 10 ok 11 - truncated sequence length ok 12 - truncated sequence string ok 13 ok 14 ok 15 - alphabet ok 16 - id ok 17 - accession number ok 18 - subseq ok 19 - An object of class 'Bio::Seq' isa 'Bio::IdentifiableI' ok 20 - An object of class 'Bio::Seq' isa 'Bio::DescribableI' ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - translated sequence ok 35 - translated sequence with explicit unambiguous codons ok 36 - translated sequence with unknown unambiguous codons ok 37 - translated sequence with unknown unambiguous codons, completed ok 38 - translated sequence with unambiguous codons ok 39 - translated sequence with unambiguous codons ok 40 - translated sequence with unknown unambiguous codons, completed ok 41 - translated sequence with unambiguous codons ok 42 - translated sequence with unknown unambiguous codons, completed ok 43 - translated sequence with stop ok 44 - translated sequence ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 - Don't use clone for trunc of Bio::Seq::RichSeq ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 - Bug \#2864 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok t/Seq/SimulatedRead.t ............... 1..194 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::Seq::SimulatedRead; ok 6 ok 7 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::SimulatedRead' ok 8 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::LocatableSeq' ok 9 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::Quality' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 - redundant errors ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 - errors() ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 - track() ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 - qual_levels() ok 138 ok 139 - reference() ok 140 ok 141 - mid() ok 142 ok 143 ok 144 ok 145 - ACGT ok 146 ok 147 ok 148 ok 149 ok 150 - TTTAAA ok 151 ok 152 ok 153 ok 154 ok 155 - Bio::Seq::Quality ok 156 - Bio::Seq ok 157 - Bio::PrimarySeq ok 158 - Bio::LocatableSeq ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok t/SeqFeature/Amplicon.t ............. 1..21 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::Primer; ok 3 - use Bio::SeqFeature::Amplicon; ok 4 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 5 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::SubSeq' ok 6 ok 7 ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 16 ok 17 ok 18 ok 19 ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 21 ok t/SeqFeature/Clone.t ................ 1..17 ok 1 - clone() ok 2 - start() clone set ok 3 - start() clone get ok 4 - start() original unchanged ok 5 - clone() with arguments ok 6 - start() orig get ok 7 - end() orig get ok 8 - start() clone get ok 9 - end() clone get ok 10 - start() clone set ok 11 - start() clone get ok 12 - start() original unchanged ok 13 - location() Bio::Location::Split ok 14 - clone() ok 15 - start() clone set ok 16 - start() clone get ok 17 - start() original unchanged ok t/SeqFeature/Collection.t ........... 1..24 ok 1 - use Bio::SeqFeature::Collection; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Tools::GFF; ok 4 - use Bio::SeqIO; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/SeqFeature/Computation.t .......... 1..12 ok 1 - use Bio::SeqFeature::Computation; ok 2 ok 3 - computation id ok 4 - score value ok 5 ok 6 ok 7 ok 8 - sft[0] is exon ok 9 ok 10 - computation id ok 11 ok 12 - score value ok t/SeqFeature/FeaturePair.t .......... 1..19 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::FeaturePair; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - feature1 of pair stored ok 9 - feature2 of pair stored ok 10 - feature start ok 11 - feature end ok 12 - primary tag ok 13 - source tag ok 14 - hstart ok 15 - hend ok 16 - hprimary tag ok 17 - hsource tag ok 18 ok 19 - inverted end ok t/SeqFeature/Gene.t ................. 1..28 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Gene::Transcript; ok 3 - use Bio::SeqFeature::Gene::UTR; ok 4 - use Bio::SeqFeature::Gene::Exon; ok 5 - use Bio::SeqFeature::Gene::Poly_A_site; ok 6 - use Bio::SeqFeature::Gene::GeneStructure; ok 7 - use Bio::Location::Fuzzy; ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - mRNA spliced length ok 28 - has 2 UTRs ok t/SeqFeature/Generic.t .............. 1..364 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - Start of feature location ok 10 - End of feature location ok 11 - Primary tag ok 12 - Source tag ok 13 - Display name ok 14 - Undef phase by default ok 15 - Phase accessor returns ok 16 - Phase is persistent ok 17 ok 18 ok 19 - Set phase from constructor ok 20 ok 21 ok 22 - Start of first seqfeature ok 23 - End of first seqfeature ok 24 - Strand of first seqfeature ok 25 ok 26 - Sequence of first seqfeature ok 27 ok 28 ok 29 ok 30 - Start of second seqfeature ok 31 - End of second seqfeature ok 32 - Strand of second seqfeature ok 33 ok 34 - Sequence of second seqfeature ok 35 ok 36 ok 37 ok 38 - sfeat start for EXPAND-ED feature (bug \#947) ok 39 - sfeat end for EXPAND-ED feature (bug \#947) ok 40 ok 41 ok 42 - Can create feature starting and ending at 0 ok 43 ok 44 - Can create feature starting and ending at 0 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 55 ok 56 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 57 ok 58 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 59 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 60 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 61 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 62 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 63 ok 64 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 65 ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 67 ok 68 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 69 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 70 ok 71 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 72 ok 73 ok 74 - spliced_seq translation matches expected ok 75 ok 76 - spliced_seq translation matches expected ok 77 ok 78 - spliced_seq translation matches expected ok 79 ok 80 - spliced_seq translation matches expected ok 81 ok 82 - spliced_seq translation matches expected ok 83 ok 84 - spliced_seq translation matches expected ok 85 ok 86 - spliced_seq translation matches expected ok 87 ok 88 - spliced_seq translation matches expected ok 89 ok 90 - spliced_seq translation matches expected ok 91 ok 92 - spliced_seq translation matches expected ok 93 ok 94 - spliced_seq translation matches expected ok 95 ok 96 - spliced_seq translation matches expected ok 97 ok 98 - spliced_seq translation matches expected ok 99 ok 100 - spliced_seq translation matches expected ok 101 ok 102 - spliced_seq translation matches expected ok 103 ok 104 - spliced_seq translation matches expected ok 105 ok 106 - spliced_seq translation matches expected ok 107 ok 108 - spliced_seq translation matches expected ok 109 ok 110 - spliced_seq translation matches expected ok 111 ok 112 - spliced_seq translation matches expected ok 113 ok 114 - spliced_seq translation matches expected ok 115 ok 116 - spliced_seq translation matches expected ok 117 ok 118 - spliced_seq translation matches expected ok 119 ok 120 - spliced_seq translation matches expected ok 121 ok 122 - spliced_seq translation matches expected ok 123 ok 124 - spliced_seq translation matches expected ok 125 ok 126 - spliced_seq translation matches expected ok 127 ok 128 - spliced_seq translation matches expected ok 129 ok 130 - spliced_seq translation matches expected ok 131 ok 132 - spliced_seq translation matches expected ok 133 ok 134 - spliced_seq translation matches expected ok 135 ok 136 - spliced_seq translation matches expected ok 137 ok 138 - spliced_seq translation matches expected ok 139 ok 140 - spliced_seq translation matches expected ok 141 ok 142 - spliced_seq translation matches expected ok 143 ok 144 - spliced_seq translation matches expected ok 145 ok 146 - spliced_seq translation matches expected ok 147 ok 148 - spliced_seq translation matches expected ok 149 ok 150 - spliced_seq translation matches expected ok 151 ok 152 - spliced_seq translation matches expected ok 153 ok 154 - spliced_seq translation matches expected ok 155 ok 156 - spliced_seq translation matches expected ok 157 ok 158 - spliced_seq translation matches expected ok 159 ok 160 - spliced_seq translation matches expected ok 161 ok 162 - spliced_seq translation matches expected ok 163 ok 164 - spliced_seq translation matches expected ok 165 ok 166 - spliced_seq translation matches expected ok 167 ok 168 - spliced_seq translation matches expected ok 169 ok 170 - spliced_seq translation matches expected ok 171 ok 172 - spliced_seq translation matches expected ok 173 ok 174 - spliced_seq translation matches expected ok 175 ok 176 - spliced_seq translation matches expected ok 177 ok 178 - spliced_seq translation matches expected ok 179 ok 180 - spliced_seq translation matches expected ok 181 ok 182 - spliced_seq translation matches expected ok 183 ok 184 - spliced_seq translation matches expected ok 185 ok 186 - spliced_seq translation matches expected ok 187 ok 188 - spliced_seq translation matches expected ok 189 ok 190 - spliced_seq translation matches expected ok 191 ok 192 - spliced_seq translation matches expected ok 193 ok 194 - spliced_seq translation matches expected ok 195 ok 196 - spliced_seq translation matches expected ok 197 ok 198 - spliced_seq translation matches expected ok 199 ok 200 - spliced_seq translation matches expected ok 201 ok 202 - spliced_seq translation matches expected ok 203 ok 204 - spliced_seq translation matches expected ok 205 ok 206 - spliced_seq translation matches expected ok 207 ok 208 - spliced_seq translation matches expected ok 209 ok 210 - spliced_seq translation matches expected ok 211 ok 212 - spliced_seq translation matches expected ok 213 ok 214 - spliced_seq translation matches expected ok 215 ok 216 - spliced_seq translation matches expected ok 217 ok 218 - spliced_seq translation matches expected ok 219 ok 220 - spliced_seq translation matches expected ok 221 ok 222 - spliced_seq translation matches expected ok 223 ok 224 - spliced_seq translation matches expected ok 225 ok 226 - spliced_seq translation matches expected ok 227 ok 228 - spliced_seq translation matches expected ok 229 ok 230 - spliced_seq translation matches expected ok 231 ok 232 - spliced_seq translation matches expected ok 233 ok 234 - spliced_seq translation matches expected ok 235 ok 236 - spliced_seq translation matches expected ok 237 ok 238 - spliced_seq translation matches expected ok 239 ok 240 - spliced_seq translation matches expected ok 241 ok 242 - spliced_seq translation matches expected ok 243 ok 244 - spliced_seq translation matches expected ok 245 ok 246 - spliced_seq translation matches expected ok 247 ok 248 - spliced_seq translation matches expected ok 249 ok 250 - spliced_seq translation matches expected ok 251 ok 252 - spliced_seq translation matches expected ok 253 ok 254 - spliced_seq translation matches expected ok 255 ok 256 - spliced_seq translation matches expected ok 257 ok 258 - spliced_seq translation matches expected ok 259 ok 260 - spliced_seq translation matches expected ok 261 ok 262 - spliced_seq translation matches expected ok 263 ok 264 - spliced_seq translation matches expected ok 265 ok 266 - spliced_seq translation matches expected ok 267 ok 268 - spliced_seq translation matches expected ok 269 ok 270 - spliced_seq translation matches expected ok 271 ok 272 - spliced_seq translation matches expected ok 273 ok 274 - spliced_seq translation matches expected ok 275 ok 276 - spliced_seq translation matches expected ok 277 ok 278 - spliced_seq translation matches expected ok 279 ok 280 - spliced_seq translation matches expected ok 281 ok 282 - spliced_seq translation matches expected ok 283 ok 284 - spliced_seq translation matches expected ok 285 ok 286 - spliced_seq translation matches expected ok 287 ok 288 - spliced_seq translation matches expected ok 289 ok 290 - spliced_seq translation matches expected ok 291 ok 292 - spliced_seq translation matches expected ok 293 ok 294 - spliced_seq translation matches expected ok 295 ok 296 - spliced_seq translation matches expected ok 297 ok 298 - spliced_seq translation matches expected ok 299 ok 300 - spliced_seq translation matches expected ok 301 ok 302 - spliced_seq translation matches expected ok 303 ok 304 - spliced_seq translation matches expected ok 305 ok 306 - spliced_seq translation matches expected ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 - phase check ok 313 ok 314 ok 315 - phase check ok 316 ok 317 ok 318 - phase check ok 319 ok 320 ok 321 - phase check ok 322 ok 323 ok 324 - phase check ok 325 ok 326 ok 327 ok 328 - Tags found ok 329 - get_tagset_values tag values found ok 330 - get_tagset_values tag values for multiple tags found ok 331 - get_tag_values tag values found ok 332 - get_tag_values lives with tag ok 333 - get_tagset_values no tag values found ok 334 - get_tagset_values lives with no tag ok 335 - get_tag_values throws with no tag ok 336 - Phi-X174 genome is circular ok 337 ok 338 - Only 3 split locations ok 339 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 340 ok 341 - Feature string ok 342 - First ten nucleotides ok 343 - Strand ok 344 - Start ok 345 - End ok 346 - Expected length ok 347 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 348 ok 349 - Feature string ok 350 - First ten nucleotides ok 351 - Strand ok 352 - Start ok 353 - End ok 354 - Expected length ok 355 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 356 ok 357 - Feature string ok 358 - First ten nucleotides ok 359 - Strand ok 360 - Start ok 361 - End ok 362 - Expected length ok 363 - Reverse strand is spliced correctly ok 364 - Reverse strand is spliced correctly ok t/SeqFeature/Location.t ............. 1..109 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Location::Split; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::SeqFeature::SimilarityPair; ok 6 - use Bio::SeqFeature::FeaturePair; ok 7 - use Bio::SeqFeature::Lite; ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 9 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI' ok 10 - Bio::Location::Simple tests ok 11 ok 12 ok 13 ok 14 ok 15 - 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI' ok 16 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::RangeI' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - Bio::SeqFeature::FeaturePair tests ok 25 ok 26 ok 27 ok 28 - Bio::SeqFeature::Generic tests ok 29 ok 30 - Bio::Location::Fuzzy tests ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - Bio::Location::Split tests ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Bugfix 1074 ok 62 ok 63 ok 64 ok 65 - Positive length ok 66 ok 67 - seq_id() on Bio::Location::Split ok 68 ok 69 ok 70 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 71 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI' ok 72 - Bio::Location::Simple EXACT ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Bio::Location::Simple IN-BETWEEN ok 79 ok 80 ok 81 ok 82 ok 83 - Testing error handling ok 84 ok 85 ok 86 ok 87 - use Bio::Location::WidestCoordPolicy; ok 88 - use Bio::Location::NarrowestCoordPolicy; ok 89 - use Bio::Location::AvWithinCoordPolicy; ok 90 - Default coodinate policy ok 91 ok 92 ok 93 ok 94 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy' ok 95 - Narrowest coodinate policy ok 96 ok 97 ok 98 ok 99 - An object of class 'Bio::Location::NarrowestCoordPolicy' isa 'Bio::Location::NarrowestCoordPolicy' ok 100 - Average coodinate policy ok 101 ok 102 ok 103 ok 104 - An object of class 'Bio::Location::AvWithinCoordPolicy' isa 'Bio::Location::AvWithinCoordPolicy' ok 105 - Widest coodinate policy ok 106 ok 107 ok 108 ok 109 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy' ok t/SeqFeature/LocationFactory.t ...... 1..325 ok 1 - use Bio::Factory::FTLocationFactory; ok 2 - An object of class 'Bio::Factory::FTLocationFactory' isa 'Bio::Factory::LocationFactoryI' ok 3 - Bio::Location::Fuzzy ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - Location String: <1..888 ok 13 ok 14 - Bio::Location::Simple ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - Location String: J00194:100..202 ok 24 ok 25 - Bio::Location::Simple ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - Location String: 340..565 ok 35 ok 36 - Bio::Location::Fuzzy ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Location String: 1..? ok 46 ok 47 - Bio::Location::Fuzzy ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - Location String: ?..? ok 57 ok 58 - Bio::Location::Simple ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - Location String: 467 ok 68 ok 69 - Bio::Location::Split ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Location String: complement(join(2691..4571,4918..5163)) ok 79 ok 80 - Bio::Location::Fuzzy ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - Location String: 145^177 ok 90 ok 91 - Bio::Location::Fuzzy ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 - Location String: 22..?64 ok 101 ok 102 - Bio::Location::Fuzzy ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 - Location String: 1..>888 ok 112 ok 113 - Bio::Location::Fuzzy ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 - Location String: <345..500 ok 123 ok 124 - Bio::Location::Fuzzy ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 - Location String: ?1..12 ok 134 ok 135 - Bio::Location::Fuzzy ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 - Location String: ?2465..2774 ok 145 ok 146 - Bio::Location::Fuzzy ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - Location String: (122.133)..(204.221) ok 156 ok 157 - Bio::Location::Fuzzy ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 - Location String: complement(34..(122.126)) ok 167 ok 168 - Bio::Location::Split ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 - Location String: complement(join(94468..94578,94578..>94889)) ok 178 ok 179 - Bio::Location::Fuzzy ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 - Location String: ?..>393 ok 189 ok 190 - Bio::Location::Split ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599) ok 200 ok 201 - Bio::Location::Fuzzy ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 - Location String: (102.110) ok 211 ok 212 - Bio::Location::Split ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 - Location String: join(12..78,134..202) ok 222 ok 223 - Bio::Location::Fuzzy ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 - Location String: (122.133)..(204.221) ok 233 ok 234 - Bio::Location::Simple ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 - Location String: 123^124 ok 244 ok 245 - Bio::Location::Fuzzy ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 - Location String: ?..536 ok 255 ok 256 - Bio::Location::Simple ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 - Location String: J00194:100..202 ok 266 ok 267 - Bio::Location::Fuzzy ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 - Location String: <1..? ok 277 ok 278 - Bio::Location::Fuzzy ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 - Location String: (23.45)..600 ok 288 ok 289 - Bio::Location::Fuzzy ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 - Location String: ?22..?64 ok 299 ok 300 - Bio::Location::Split ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 - Location String: join(1..100,J00194.1:100..202) ok 310 ok 311 - complement(join(2691..4571,4918..5163)) ok 312 - join(complement(4918..5163),complement(2691..4571)) ok 313 - equivalent remote location strings ok 314 - complement(join(TEST0001.1:2691..4571,4918..5163)) ok 315 - join(complement(4918..5163),complement(TEST0001.1:2691..4571)) ok 316 - equivalent remote location strings ok 317 - complement(join(TEST0001.1:2691..4571,TEST0008.1:4918..5163)) ok 318 - join(complement(TEST0008.1:4918..5163),complement(TEST0001.1:2691..4571)) ok 319 - equivalent remote location strings ok 320 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294))) ok 321 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081))) ok 322 - join(20464..20694,21548..22763,complement(join(231520..231669,232596..232990,314652..314672))) ok 323 - join(20464..20694,21548..22763,join(complement(314652..314672),complement(232596..232990),complement(231520..231669))) ok 324 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000) ok 325 - order(S67862.1:72..75,join(S67863.1:1..788,1..19)) ok t/SeqFeature/Primer.t ............... 1..47 ok 1 - use Bio::SeqFeature::Primer; ok 2 - use Bio::PrimarySeq; ok 3 - Implied primer sequence ok 4 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 5 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::SubSeq' ok 6 ok 7 ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 9 ok 10 - PrimarySeq primer ok 11 ok 12 ok 13 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 42 ok 43 ok 44 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 45 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 46 ok 47 ok t/SeqFeature/Range.t ................ 1..49 ok 1 - use Bio::Range; ok 2 - 'BioRange object' isa 'Bio::Range' ok 3 ok 4 - 'BioRange object' isa 'Bio::Range' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - 'BioRange object' isa 'Bio::Range' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - 'BioRange object' isa 'Bio::Range' ok 26 - 'BioRange object' isa 'Bio::Range' ok 27 - 'BioRange object' isa 'Bio::Range' ok 28 - 1 & -1 ok 29 - 1 & 1 true ok 30 - 1 & 0 true ok 31 - 1 & -1 false ok 32 - 1 & 1 true ok 33 - 1 & 0 false ok 34 - 1 & -1 false ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - 'Bio::Range object' isa 'Bio::Range' ok 46 ok 47 ok 48 ok 49 ok t/SeqFeature/RangeI.t ............... 1..45 ok 1 - use Bio::SeqFeature::Generic; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 - subtract() of split features ok 40 - 0 start ok 41 - 0 end ok 42 - 1 start ok 43 - 1 end ok 44 - 2 start ok 45 - 2 end ok t/SeqFeature/SeqAnalysisParser.t .... 1..14 ok 1 - use Bio::Factory::SeqAnalysisParserFactory; ok 2 - use Bio::SeqIO; ok 3 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO' ok 4 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 5 - An object of class 'Bio::Tools::Genscan' isa 'Bio::SeqAnalysisParserI' ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 10 - An object of class 'Bio::Tools::MZEF' isa 'Bio::SeqAnalysisParserI' ok 11 ok 12 ok 13 - An object of class 'Bio::Tools::EPCR' isa 'Bio::SeqAnalysisParserI' ok 14 ok t/SeqFeature/SubSeq.t ............... 1..37 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::SubSeq; ok 3 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::SubSeq' ok 4 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::Generic' ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 31 ok 32 ok 33 ok 34 ok 35 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 36 ok 37 ok t/SeqFeature/Unflattener.t .......... 1..21 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Tools::Unflattener; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/SeqIO/ace.t ....................... 1..7 ok 1 - use Bio::SeqIO; ok 2 - number of sequence objects ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters ok 4 - alphabets detected ok 5 - alphabets detected ok 6 - writing sequence ok 7 - test output ok t/SeqIO/asciitree.t ................. 1..2 ok 1 - use Bio::SeqIO; not ok 2 # TODO Output doesn't exists on linux # Failed (TODO) test at t/SeqIO/asciitree.t line 38. ok t/SeqIO/bsml.t ...................... 1..16 ok 1 - use XML::DOM; ok 2 - use Bio::SeqIO::bsml; ok 3 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 4 - got correct number of refs ok 5 - display_id ok 6 - molecule ok 7 - is_circular ok 8 - dates ok 9 - accession_number ok 10 - seq_version ok 11 - got correct number of SeqFeatures ok 12 - feature start ok 13 - feature end ok 14 - get_tag_values db_xref ok 15 - get_Annotations reference ok 16 - get_Annotations dblink ok t/SeqIO/bsml_sax.t .................. 1..15 ok 1 - use Bio::SeqIO; ok 2 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SeqIO/embl.t ...................... 1..100 ok 1 - use Bio::SeqIO::embl; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - success reading Embl with ^ location and badly split double quotes ok 25 ok 26 - success writing Embl format with ^ < and > locations ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - genus duplication test ok 55 ok 56 ok 57 ok 58 ok 59 - CDS - accession on PA line ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - CDS - OX tagname ok 68 - CDS - OX database ok 69 - CDS - OX primary_id ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 - Check if product was parsed correctly ok 86 - Parse long qualifier ok 87 ok 88 - TaxID set correctly ok 89 - The read sequence has a species object ok 90 - NCBI TaxID has roundtripped ok 91 - Name has roundtripped ok 92 - TaxID set correctly ok 93 - The read sequence has a species object ok 94 - The taxid of the source feature overrides that of the OX line ok 95 - Name has roundtripped ok 96 - The ID field was written correctly ok 97 - EMBL format with space after equal sign parses ok 98 - CDS read ok 99 - /product found ok 100 - Qualifier /product value matches ok t/SeqIO/fasta.t ..................... 1..22 ok 1 - use Bio::SeqIO::fasta; ok 2 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO' ok 3 - Bio::SeqIO::fasta->can('next_seq') ok 4 - Bio::SeqIO::fasta->can('write_seq') ok 5 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 6 - sequence ok 7 - length ok 8 - primary_id ok 9 - description ok 10 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 11 - sequence ok 12 - length ok 13 - primary_id ok 14 - description ok 15 - use Algorithm::Diff; ok 16 - use IO::ScalarArray; ok 17 - use IO::String; ok 18 - fasta format can round-trip ok 19 - dies with roa1.genbank ok 20 - dies with test.gcg ok 21 - dies with test.ace ok 22 - dies with test.raw ok t/SeqIO/fastq.t ..................... 1..149 ok 1 - use Bio::SeqIO::fastq; ok 2 - use Bio::Seq::Quality; ok 3 - RT98876 parses ok 4 - correct num. seqs in RT98876 ok 5 - sample sequence obtained ok 6 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 7 - seq() matches RT98876 ok 8 - desc() matches RT98876 ok 9 - display_id() matches RT98876 ok 10 - qual() matches RT98876 ok 11 ok 12 - bug2335 parses ok 13 - correct num. seqs in bug2335 ok 14 - sample sequence obtained ok 15 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 16 - seq() matches bug2335 ok 17 - desc() matches bug2335 ok 18 - display_id() matches bug2335 ok 19 - qual() matches bug2335 ok 20 ok 21 - evil_wrapping parses ok 22 - correct num. seqs in evil_wrapping ok 23 - sample sequence obtained ok 24 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 25 - seq() matches evil_wrapping ok 26 - desc() matches evil_wrapping ok 27 - display_id() matches evil_wrapping ok 28 - qual() matches evil_wrapping ok 29 ok 30 - example parses ok 31 - correct num. seqs in example ok 32 - sample sequence obtained ok 33 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 34 - seq() matches example ok 35 - desc() matches example ok 36 - display_id() matches example ok 37 - qual() matches example ok 38 ok 39 - illumina_faked parses ok 40 - correct num. seqs in illumina_faked ok 41 - sample sequence obtained ok 42 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 43 - seq() matches illumina_faked ok 44 - desc() matches illumina_faked ok 45 - display_id() matches illumina_faked ok 46 - qual() matches illumina_faked ok 47 ok 48 - sanger_93 parses ok 49 - correct num. seqs in sanger_93 ok 50 - sample sequence obtained ok 51 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 52 - seq() matches sanger_93 ok 53 - desc() matches sanger_93 ok 54 - display_id() matches sanger_93 ok 55 - qual() matches sanger_93 ok 56 ok 57 - sanger_faked parses ok 58 - correct num. seqs in sanger_faked ok 59 - sample sequence obtained ok 60 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 61 - seq() matches sanger_faked ok 62 - desc() matches sanger_faked ok 63 - display_id() matches sanger_faked ok 64 - qual() matches sanger_faked ok 65 ok 66 - solexa_example parses ok 67 - correct num. seqs in solexa_example ok 68 - sample sequence obtained ok 69 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 70 - seq() matches solexa_example ok 71 - desc() matches solexa_example ok 72 - display_id() matches solexa_example ok 73 - qual() matches solexa_example ok 74 ok 75 - solexa_faked parses ok 76 - correct num. seqs in solexa_faked ok 77 - sample sequence obtained ok 78 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 79 - seq() matches solexa_faked ok 80 - desc() matches solexa_faked ok 81 - display_id() matches solexa_faked ok 82 - qual() matches solexa_faked ok 83 ok 84 - test1_sanger parses ok 85 - correct num. seqs in test1_sanger ok 86 - sample sequence obtained ok 87 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 88 - seq() matches test1_sanger ok 89 - desc() matches test1_sanger ok 90 - display_id() matches test1_sanger ok 91 - qual() matches test1_sanger ok 92 ok 93 - test2_solexa parses ok 94 - correct num. seqs in test2_solexa ok 95 - sample sequence obtained ok 96 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 97 - seq() matches test2_solexa ok 98 - desc() matches test2_solexa ok 99 - display_id() matches test2_solexa ok 100 - qual() matches test2_solexa ok 101 ok 102 - test3_illumina parses ok 103 - correct num. seqs in test3_illumina ok 104 - sample sequence obtained ok 105 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 106 - seq() matches test3_illumina ok 107 - desc() matches test3_illumina ok 108 - display_id() matches test3_illumina ok 109 - qual() matches test3_illumina ok 110 ok 111 - tricky parses ok 112 - correct num. seqs in tricky ok 113 - sample sequence obtained ok 114 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 115 - seq() matches tricky ok 116 - desc() matches tricky ok 117 - display_id() matches tricky ok 118 - qual() matches tricky ok 119 ok 120 - Conversion from illumina to sanger ok 121 - Conversion from illumina to illumina ok 122 - Conversion from illumina to solexa ok 123 - Conversion from sanger to sanger ok 124 - Conversion from sanger to illumina ok 125 - Conversion from sanger to solexa ok 126 - Conversion from solexa to sanger ok 127 - Conversion from solexa to illumina ok 128 - Conversion from solexa to solexa ok 129 - Exception caught for error_diff_ids ok 130 - Exception caught for error_long_qual ok 131 - Exception caught for error_no_qual ok 132 - Exception caught for error_qual_del ok 133 - Exception caught for error_qual_escape ok 134 - Exception caught for error_qual_null ok 135 - Exception caught for error_qual_space ok 136 - Exception caught for error_qual_tab ok 137 - Exception caught for error_qual_unit_sep ok 138 - Exception caught for error_qual_vtab ok 139 - Exception caught for error_short_qual ok 140 - Exception caught for error_spaces ok 141 - Exception caught for error_tabs ok 142 - Exception caught for error_trunc_at_plus ok 143 - Exception caught for error_trunc_at_qual ok 144 - Exception caught for error_trunc_at_seq ok 145 - Exception caught for error_trunc_in_plus ok 146 - Exception caught for error_trunc_in_qual ok 147 - Exception caught for error_trunc_in_seq ok 148 - Exception caught for error_trunc_in_title ok 149 - edge case; single 0 in quality fails ok t/SeqIO/game.t ...................... 1..24 ok 1 - use Bio::SeqIO::game; ok 2 - An object of class 'Bio::SeqIO::game' isa 'Bio::SeqIO' ok 3 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/SeqIO/gbxml.t ..................... 1..14 ok 1 - use Bio::SeqIO::gbxml; ok 2 - An object of class 'Bio::SeqIO::gbxml' isa 'Bio::SeqIO' ok 3 - molecule ok 4 - alphabet ok 5 - primary_id ok 6 - display_id ok 7 - version ok 8 - is_circular ok 9 - description ok 10 - sequence ok 11 - classification ok 12 - feat - clone_lib ok 13 - feat - db_xref ok 14 - feat - lab_host ok t/SeqIO/gcg.t ....................... 1..17 ok 1 - use Bio::SeqIO::gcg; ok 2 - An object of class 'Bio::SeqIO::gcg' isa 'Bio::SeqIO' ok 3 - Bio::SeqIO::gcg->can('next_seq') ok 4 - Bio::SeqIO::gcg->can('write_seq') ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 6 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 7 - sequence ok 8 - length not ok 9 - primary_id # TODO possible bug: RichSeq not setting primary_id? # Failed (TODO) test 'primary_id' # at t/SeqIO/gcg.t line 53. # got: 'Bio::PrimarySeq=HASH(0x563b6eaf1f90)' # expected: 'roa1_drome' ok 10 - description ok 11 ok 12 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI' ok 13 ok 14 - use Algorithm::Diff; ok 15 - use IO::ScalarArray; ok 16 - use IO::String; ok 17 - gcg format can round-trip ok t/SeqIO/genbank.t ................... 1..306 ok 1 - use Bio::SeqIO::genbank; ok 2 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 3 - AI129902 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - NT_021877 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - BAB68554 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 - NC_006346 ok 30 ok 31 ok 32 - U71225 ok 33 ok 34 - AB077698 ok 35 ok 36 - DQ018368 ok 37 - D10483 ok 38 ok 39 ok 40 ok 41 - bug 1487 ok 42 ok 43 - bug 1647 ok 44 ok 45 ok 46 - bug 1673 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - AF165282 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - species parsing incorrect for genbank ok 62 - genus duplicated in genbank parsing ok 63 ok 64 ok 65 - species parsing incorrect for genbank ok 66 - genus duplicated in genbank parsing ok 67 ok 68 ok 69 - species parsing incorrect for genbank ok 70 - genus duplicated in genbank parsing ok 71 ok 72 - streaming ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Total number of sequences in test file ok 79 ok 80 - Fuzzy in ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 - Fuzzy out ok 93 - BK000016 ok 94 ok 95 - BK000016 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 - BK000016 ok 111 - roundtrip ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 - revcomp split location ok 130 - Bug 1925 ok 131 ok 132 ok 133 - wgs ok 134 ok 135 - wgs_scafld ok 136 ok 137 - wgs_scafld ok 138 ok 139 ok 140 - BC000007 ok 141 - BK000016-tpa.gbk ok 142 - ay116458.gb ok 143 - ay149291.gb ok 144 - NC_006346.gb ok 145 - ay007676.gb ok 146 - dq519393.gb ok 147 ok 148 - swissprot:K1C9_HUMAN ok 149 ok 150 - swissprot ok 151 ok 152 - GenBank:Z29074.1 ok 153 ok 154 - GenBank ok 155 ok 156 - GenPept:CAA82315.1 ok 157 ok 158 - GenPept ok 159 ok 160 - GenBank:S69510.1 ok 161 ok 162 - GenBank ok 163 ok 164 - GenPept:AAC60619.1 ok 165 ok 166 - GenPept ok 167 ok 168 - GenBank:X75015.1 ok 169 ok 170 - GenBank ok 171 ok 172 - GenPept:CAA52924.1 ok 173 ok 174 - GenPept ok 175 ok 176 - GenBank:AB001594.1 ok 177 ok 178 - GenBank ok 179 ok 180 - GenPept:BAA19418.1 ok 181 ok 182 - GenPept ok 183 ok 184 - GenBank:I37984 ok 185 ok 186 - GenBank ok 187 ok 188 - HSSP:P08670 ok 189 ok 190 - HSSP ok 191 ok 192 - IntAct:P35527 ok 193 ok 194 - IntAct ok 195 ok 196 - Ensembl:ENSG00000171403 ok 197 ok 198 - Ensembl ok 199 ok 200 - KEGG:hsa:3857 ok 201 ok 202 - KEGG ok 203 ok 204 - HGNC:6447 ok 205 ok 206 - HGNC ok 207 ok 208 - MIM:144200 ok 209 ok 210 - MIM ok 211 ok 212 - MIM:607606 ok 213 ok 214 - MIM ok 215 ok 216 - ArrayExpress:P35527 ok 217 ok 218 - ArrayExpress ok 219 ok 220 - GO:0005200 ok 221 ok 222 - GO ok 223 ok 224 - GO:0008544 ok 225 ok 226 - GO ok 227 ok 228 - InterPro:IPR011000 ok 229 ok 230 - InterPro ok 231 ok 232 - InterPro:IPR001664 ok 233 ok 234 - InterPro ok 235 ok 236 - InterPro:IPR002957 ok 237 ok 238 - InterPro ok 239 ok 240 - Pfam:PF00038 ok 241 ok 242 - Pfam ok 243 ok 244 - PRINTS:PR01248 ok 245 ok 246 - PRINTS ok 247 ok 248 - PROSITE:PS00226 ok 249 ok 250 - PROSITE ok 251 ok 252 - Bug 2195 ok 253 - Bug 2195 ok 254 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 255 ok 256 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 257 ok 258 - P39765 ok 259 - P39765 ok 260 - P39765 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 - operator overloading in AnnotationI is deprecated ok 271 ok 272 ok 273 ok 274 ok 275 - bug3375 database is BioProject ok 276 - bug3375 primary_id is PRJNA15288 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 - Label is the same ok 283 ok 284 ok 285 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 286 ok 287 ok 288 ok 289 ok 290 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 291 ok 292 ok 293 - Got 11 features ok 294 - Got 1 feature ok 295 - Correct primary tag for feature ok 296 - Got 10 features ok 297 - Got correct Structured Comment ok 298 - Got correct Structured Comment ok 299 - Got correct Structured Comment ok 300 - Got correct Structured Comment ok 301 - Got correct Structured Comment ok 302 - Got correct Structured Comment ok 303 - Got correct Structured Comment ok 304 - Got correct Structured Comment ok 305 - unquoted labels wrap at comma ok 306 - Label is the same ok t/SeqIO/Handler.t ................... 1..561 ok 1 - use Bio::SeqIO; ok 2 - AI129902 ok 3 ok 4 ok 5 ok 6 - NT_021877 ok 7 ok 8 ok 9 ok 10 ok 11 - BAB68554 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - operator overloading in AnnotationI is deprecated ok 22 - NC_006346 ok 23 ok 24 ok 25 - U71225 ok 26 ok 27 - AB077698 ok 28 ok 29 - DQ018368 ok 30 - D10483 ok 31 ok 32 ok 33 ok 34 - bug 1487 ok 35 ok 36 - bug 1647 ok 37 ok 38 ok 39 - bug 1673 ok 40 ok 41 ok 42 ok 43 - AF165282 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - species parsing incorrect for genbank ok 53 - genus duplicated in genbank parsing ok 54 ok 55 ok 56 - species parsing incorrect for genbank ok 57 - genus duplicated in genbank parsing ok 58 ok 59 ok 60 - species parsing incorrect for genbank ok 61 - genus duplicated in genbank parsing ok 62 ok 63 - streaming ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 - Total number of sequences in test file ok 70 ok 71 - Fuzzy in ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 - Fuzzy out ok 84 - BK000016 ok 85 ok 86 - BK000016 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 - BK000016 ok 102 - roundtrip ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 - revcomp split location ok 121 - Bug 1925 ok 122 ok 123 ok 124 - wgs ok 125 ok 126 - wgs_scafld ok 127 ok 128 - wgs_scafld ok 129 ok 130 ok 131 - BC000007 ok 132 - BK000016-tpa.gbk ok 133 - ay116458.gb ok 134 - ay149291.gb ok 135 - NC_006346.gb ok 136 - ay007676.gb ok 137 - dq519393.gb ok 138 ok 139 - swissprot:K1C9_HUMAN ok 140 ok 141 - swissprot ok 142 ok 143 - GenBank:Z29074.1 ok 144 ok 145 - GenBank ok 146 ok 147 - GenPept:CAA82315.1 ok 148 ok 149 - GenPept ok 150 ok 151 - GenBank:S69510.1 ok 152 ok 153 - GenBank ok 154 ok 155 - GenPept:AAC60619.1 ok 156 ok 157 - GenPept ok 158 ok 159 - GenBank:X75015.1 ok 160 ok 161 - GenBank ok 162 ok 163 - GenPept:CAA52924.1 ok 164 ok 165 - GenPept ok 166 ok 167 - GenBank:AB001594.1 ok 168 ok 169 - GenBank ok 170 ok 171 - GenPept:BAA19418.1 ok 172 ok 173 - GenPept ok 174 ok 175 - GenBank:I37984 ok 176 ok 177 - GenBank ok 178 ok 179 - HSSP:P08670 ok 180 ok 181 - HSSP ok 182 ok 183 - IntAct:P35527 ok 184 ok 185 - IntAct ok 186 ok 187 - Ensembl:ENSG00000171403 ok 188 ok 189 - Ensembl ok 190 ok 191 - KEGG:hsa:3857 ok 192 ok 193 - KEGG ok 194 ok 195 - HGNC:6447 ok 196 ok 197 - HGNC ok 198 ok 199 - MIM:144200 ok 200 ok 201 - MIM ok 202 ok 203 - MIM:607606 ok 204 ok 205 - MIM ok 206 ok 207 - ArrayExpress:P35527 ok 208 ok 209 - ArrayExpress ok 210 ok 211 - GO:0005200 ok 212 ok 213 - GO ok 214 ok 215 - GO:0008544 ok 216 ok 217 - GO ok 218 ok 219 - InterPro:IPR011000 ok 220 ok 221 - InterPro ok 222 ok 223 - InterPro:IPR001664 ok 224 ok 225 - InterPro ok 226 ok 227 - InterPro:IPR002957 ok 228 ok 229 - InterPro ok 230 ok 231 - Pfam:PF00038 ok 232 ok 233 - Pfam ok 234 ok 235 - PRINTS:PR01248 ok 236 ok 237 - PRINTS ok 238 ok 239 - PROSITE:PS00226 ok 240 ok 241 - PROSITE ok 242 ok 243 - Bug 2195 ok 244 - Bug 2195 ok 245 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 246 ok 247 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 - success reading Embl with ^ location and badly split double quotes ok 274 ok 275 ok 276 - success writing Embl format with ^ < and > locations ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 - genus duplication test ok 310 ok 311 ok 312 - An object of class 'Bio::SeqIO::swissdriver' isa 'Bio::SeqIO' ok 313 - An object of class 'Bio::Species' isa 'Bio::Species' ok 314 ok 315 ok 316 - operator overloading in AnnotationI is deprecated ok 317 ok 318 - dates ok 319 - dates ok 320 - dates ok 321 ok 322 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 323 ok 324 ok 325 ok 326 - operator overloading in AnnotationI is deprecated ok 327 ok 328 ok 329 ok 330 ok 331 - id is ROA1_HUMAN ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 - operator overloading in AnnotationI is deprecated ok 340 ok 341 ok 342 ok 343 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 - operator overloading in AnnotationI is deprecated ok 354 ok 355 ok 356 ok 357 - GC1QBP ok 358 - HABP1 ok 359 - SF2P32 ok 360 - C1QBP ok 361 ok 362 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 - F54H12.1 ok 370 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 383 ok 384 ok 385 ok 386 ok 387 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 - An object of class 'Bio::Species' isa 'Bio::Species' ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 - An object of class 'Bio::Species' isa 'Bio::Species' ok 518 ok 519 ok 520 - operator overloading in AnnotationI is deprecated ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 - P39765 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 - operator overloading in AnnotationI is deprecated ok t/SeqIO/kegg.t ...................... 1..16 ok 1 - use Bio::SeqIO::kegg; ok 2 - An object of class 'Bio::SeqIO::kegg' isa 'Bio::SeqIO' ok 3 ok 4 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/largefasta.t ................ 1..16 ok 1 - use Bio::SeqIO::largefasta; ok 2 - An object of class 'Bio::SeqIO::largefasta' isa 'Bio::SeqIO' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/locuslink.t ................. 1..26 ok 1 - use Bio::SeqIO::locuslink; ok 2 - use Bio::SeqFeature::Generic; ok 3 - use Bio::SeqFeature::AnnotationAdaptor; ok 4 ok 5 - An object of class 'Bio::SeqIO::locuslink' isa 'Bio::SeqIO' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/SeqIO/mbsout.t .................... 1..74 ok 1 - use Bio::SeqIO::mbsout; ok 2 - Bio::SeqIO::mbsout is at least api version 1.1.3 ok 3 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 4 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 5 - Get NREPS ok 6 - Get POSITIONS ok 7 - Get NEXT_RUN_NUM ok 8 - Get TRAJ_FILENAME ok 9 - Get CURRENT_RUN_SEGSITES ok 10 - Get RUNS ok 11 - Get NFILES ok 12 - Get POP_MUT_PARAM_PER_SITE ok 13 - Get MBS_INFO_LINE ok 14 - Get TOT_RUN_HAPS ok 15 - Get SEGSITES ok 16 - Get LAST_READ_HAP_NUM ok 17 - Get POP_RECOMB_PARAM_PER_SITE ok 18 - Get SELPOS ok 19 - Get NSITES ok 20 - Get next_hap at beginning of run ok 21 - Get next_hap after beginning of run ok 22 - Get next_pop after beginning of pop ok 23 - Get next_hap ok 24 - Get next_hap ok 25 - Get next_run after beginning of run ok 26 - Get next_run at beginning of run ok 27 - Get next_run at beginning of run ok 28 - have all lines been read? ok 29 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 30 - Get POSITIONS ok 31 - Get NREPS ok 32 - Get TRAJ_FILENAME ok 33 - Get NEXT_RUN_NUM ok 34 - Get CURRENT_RUN_SEGSITES ok 35 - Get TOT_RUN_HAPS ok 36 - Get SEGSITES ok 37 - Get POP_RECOMB_PARAM_PER_SITE ok 38 - Get LAST_READ_HAP_NUM ok 39 - Get SELPOS ok 40 - Get NSITES ok 41 - Get RUNS ok 42 - Get NFILES ok 43 - Get POP_MUT_PARAM_PER_SITE ok 44 - Get MBS_INFO_LINE ok 45 - Get next_hap at beginning of run ok 46 - Get next_hap after beginning of run ok 47 - Testing mbsout::outgroup ok 48 - Get next_run after beginning of run ok 49 - Get next_run after beginning of run ok 50 - Get next_run at beginning of run ok 51 - Get next_hap at beginning of run 2 ok 52 - Get next_run after hap ok 53 - next run should be 5. ok 54 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 55 - Get POSITIONS ok 56 - Get NREPS ok 57 - Get NEXT_RUN_NUM ok 58 - Get TRAJ_FILENAME ok 59 - Get CURRENT_RUN_SEGSITES ok 60 - Get RUNS ok 61 - Get NFILES ok 62 - Get MBS_INFO_LINE ok 63 - Get POP_MUT_PARAM_PER_SITE ok 64 - Get POP_RECOMB_PARAM_PER_SITE ok 65 - Get LAST_READ_HAP_NUM ok 66 - Get TOT_RUN_HAPS ok 67 - Get SEGSITES ok 68 - Get SELPOS ok 69 - Get NSITES ok 70 - Get next_run at end/beginning of run ok 71 - have all lines been read? ok 72 - Get next_run at eof ok 73 - Get next_hap at eof ok 74 - Get next_seq at eof ok t/SeqIO/metafasta.t ................. 1..6 ok 1 - use Bio::SeqIO::metafasta; ok 2 - An object of class 'Bio::SeqIO::metafasta' isa 'Bio::SeqIO' ok 3 ok 4 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta' ok 5 ok 6 ok t/SeqIO/msout.t ..................... 1..165 ok 1 - use Bio::SeqIO::msout; ok 2 - Bio::SeqIO::msout is at least api version 1.1.5 ok 3 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 4 - Get NEXT_RUN_NUM ok 5 - Get LAST_READ_HAP_NUM ok 6 - Get POSITIONS ok 7 - Get CURRENT_RUN_SEGSITES ok 8 - Get POPS ok 9 - Get SEEDS ok 10 - Get TOT_RUN_HAPS ok 11 - Get SEGSITES ok 12 - Get MS_INFO_LINE ok 13 - Get N_SITES ok 14 - Get RUNS ok 15 - Get next_hap at beginning of run ok 16 - Get next_hap after beginning of run ok 17 - Testing msout::outgroup ok 18 - Get next_pop after beginning of pop ok 19 - Get next_pop at beginning of pop ok 20 - Get next_run after beginning of run ok 21 - Get next_pop at beginning of run ok 22 - Get next_hap after pop ok 23 - Get next_run after pop and hap ok 24 - Get next_run at beginning of run ok 25 - have all lines been read? ok 26 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 27 - Get NEXT_RUN_NUM ok 28 - Get LAST_READ_HAP_NUM ok 29 - Get POSITIONS ok 30 - Get CURRENT_RUN_SEGSITES ok 31 - Get POPS ok 32 - Get SEEDS ok 33 - Get SEGSITES ok 34 - Get TOT_RUN_HAPS ok 35 - Get RUNS ok 36 - Get MS_INFO_LINE ok 37 - Get N_SITES ok 38 - Get next_hap at beginning of run ok 39 - Get next_hap after beginning of run ok 40 - Testing msout::outgroup ok 41 - Get next_pop after beginning of pop ok 42 - Get next_pop at beginning of pop/run ok 43 - Get next_run at beginning of run ok 44 - Get next_hap at beginning of run 2 ok 45 - Get next_run after hap ok 46 - next run should be 5. ok 47 - Get last hap through next_hap ok 48 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 49 - Get NEXT_RUN_NUM ok 50 - Get POPS ok 51 - Get SEGSITES ok 52 - Get TOT_RUN_HAPS ok 53 - Get RUNS ok 54 - Get MS_INFO_LINE ok 55 - Get CURRENT_RUN_SEGSITES ok 56 - Get POSITIONS ok 57 - Get LAST_READ_HAP_NUM ok 58 - Get SEEDS ok 59 - Get next_pop at end of run ok 60 - have all lines been read? ok 61 - Get next_pop at eof ok 62 - Get next_run at eof ok 63 - Get next_hap at eof ok 64 - Get next_seq at eof ok 65 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 66 - Get NEXT_RUN_NUM ok 67 - Get POSITIONS ok 68 - Get CURRENT_RUN_SEGSITES ok 69 - Get LAST_READ_HAP_NUM ok 70 - Get POPS ok 71 - Get SEEDS ok 72 - Get RUNS ok 73 - Get MS_INFO_LINE ok 74 - Get N_SITES ok 75 - Get SEGSITES ok 76 - Get TOT_RUN_HAPS ok 77 - Get next_hap at beginning of run ok 78 - Get next_hap after beginning of run ok 79 - Testing msout::outgroup ok 80 - Get next_pop after beginning of pop ok 81 - Get next_pop at beginning of pop ok 82 - Get next_run after beginning of run ok 83 - Get next_pop at beginning of run ok 84 - Get next_hap after pop ok 85 - Get next_run after pop and hap ok 86 - Get next_run at beginning of run ok 87 - have all lines been read? ok 88 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 89 - Caught error in bad msout file 1 ok 90 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 91 - Caught error in bad msout file 2 ok 92 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 93 - Get CURRENT_RUN_SEGSITES ok 94 - Get POSITIONS ok 95 - Get LAST_READ_HAP_NUM ok 96 - Get NEXT_RUN_NUM ok 97 - Get RUNS ok 98 - Get N_SITES ok 99 - Get MS_INFO_LINE ok 100 - Get SEGSITES ok 101 - Get TOT_RUN_HAPS ok 102 - Get SEEDS ok 103 - Get POPS ok 104 - Get next_hap at beginning of run ok 105 - Get next_hap after beginning of run ok 106 - Testing msout::outgroup ok 107 - Get next_pop after beginning of pop ok 108 - Get next_pop at beginning of pop ok 109 - Get next_run after beginning of run ok 110 - Get next_pop at beginning of run ok 111 - Get next_hap after pop ok 112 - Get next_run after pop and hap ok 113 - Get next_run at beginning of run ok 114 - have all lines been read? ok 115 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 116 - Get POPS ok 117 - Get N_SITES ok 118 - Get MS_INFO_LINE ok 119 - Get RUNS ok 120 - Get TOT_RUN_HAPS ok 121 - Get SEGSITES ok 122 - Get SEEDS ok 123 - Get NEXT_RUN_NUM ok 124 - Get POSITIONS ok 125 - Get CURRENT_RUN_SEGSITES ok 126 - Get LAST_READ_HAP_NUM ok 127 - Get next_hap at beginning of run ok 128 - Get next_hap after beginning of run ok 129 - Testing msout::outgroup ok 130 - Get next_pop after beginning of pop ok 131 - Get next_pop at beginning of pop/run ok 132 - Get next_run at beginning of run ok 133 - Get next_hap at beginning of run 2 ok 134 - Get next_run after hap ok 135 - next run should be 5. ok 136 - Get last hap through next_hap ok 137 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 138 - Get SEEDS ok 139 - Get N_SITES ok 140 - Get MS_INFO_LINE ok 141 - Get RUNS ok 142 - Get TOT_RUN_HAPS ok 143 - Get SEGSITES ok 144 - Get POPS ok 145 - Get CURRENT_RUN_SEGSITES ok 146 - Get LAST_READ_HAP_NUM ok 147 - Get POSITIONS ok 148 - Get NEXT_RUN_NUM ok 149 - Get next_hap at beginning of run ok 150 - Get next_hap after beginning of run ok 151 - Testing msout::outgroup ok 152 - Get next_pop after beginning of pop ok 153 - Get next_pop at beginning of pop ok 154 - Get next_run after beginning of run ok 155 - Get next_pop at beginning of run ok 156 - Get next_hap after pop ok 157 - Get next_run after pop and hap ok 158 - Get next_run at beginning of run ok 159 - have all lines been read? ok 160 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 161 - Caught error in bad msout file 1 ok 162 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 163 - Caught error in bad msout file 2 ok 164 - threw Regexp ((?^:first argument needs to be a positive integer. argument supplied: -1)) ok 165 - too few n_sites failed OK ok t/SeqIO/MultiFile.t ................. 1..5 ok 1 - use Bio::SeqIO::MultiFile; ok 2 ok 3 ok 4 ok 5 ok t/SeqIO/Multiple_fasta.t ............ 1..9 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - all sequences in the file ok t/SeqIO/phd.t ....................... 1..21 ok 1 - use Bio::SeqIO::phd; ok 2 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd' ok 3 - Did you get the 'QUALITY_LEVELS' comment? ok 4 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 5 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd' ok 6 ok 7 - $seq->subseq() ok 8 - $seq->subqual_tex() ok 9 - $seq->subqual_tex() ok 10 - $phd->chromat_file() ok 11 - $phd->chromat_file() ok 12 ok 13 - $seq->subseq() ok 14 - $seq->subqual_tex() ok 15 - $seq->subqual_tex() ok 16 ok 17 - $seq->subseq() ok 18 - $seq->subqual_tex() ok 19 - $seq->subqual_tex() ok 20 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd' ok 21 ok t/SeqIO/pir.t ....................... 1..12 ok 1 - use Bio::SeqIO::pir; ok 2 - new instance is defined ok 3 - An object of class 'Bio::SeqIO::pir' isa 'Bio::SeqIO' ok 4 - checked length ok 5 - checked length ok 6 - checked length ok 7 - checked length ok 8 - checked length ok 9 - checked length ok 10 - Correct start ok 11 - Correct start ok 12 - Correct start ok t/SeqIO/qual.t ...................... 1..18 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimaryQual; ok 3 ok 4 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 5 ok 6 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 7 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 8 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 9 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 10 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 11 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 12 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/SeqIO/raw.t ....................... 1..25 ok 1 - use Bio::SeqIO::raw; ok 2 - An object of class 'Bio::SeqIO::raw' isa 'Bio::SeqIO' ok 3 ok 4 - Bio::SeqIO::raw->can('next_seq') ok 5 - Bio::SeqIO::raw->can('write_seq') ok 6 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 7 - sequence ok 8 - length ok 9 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 10 - sequence ok 11 - length ok 12 - use Algorithm::Diff; ok 13 - raw format can round-trip ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok t/SeqIO/scf.t ....................... 1..80 ok 1 - use Bio::SeqIO::scf; ok 2 - use Bio::Seq::SequenceTrace; ok 3 ok 4 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 14 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 15 - alphabet ok 16 - display_id ok 17 - primary_id is the stringified memory position ok 18 - set primary_id ok 19 - accession_number ok 20 - desc ok 21 - desc ok 22 - id ok 23 - id ok 24 - seq ok 25 - subseq ok 26 - baseat ok 27 - qualat ok 28 - trace_value_at not ok 29 - accuracies # TODO documentation and code for accuracies() do not match # Failed (TODO) test 'accuracies' # at t/SeqIO/scf.t line 77. # got: 'ARRAY(0x55db34dad190)' # expected: '482' ok 30 ok 31 - sub_peak_index ok 32 - peak_index_at ok 33 ok 34 ok 35 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 36 - accuracy_at ok 37 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 42 ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 44 ok 45 ok 46 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 55 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 56 ok 57 ok 58 ok 59 ok 60 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 61 ok 62 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 63 - qual scores match ok 64 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 65 ok 66 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' not ok 67 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 284. # got: 'ML4942R' # expected: undef ok 68 - qual scores match ok 69 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 70 ok 71 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' not ok 72 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 284. # got: 'IIABP1D4373' # expected: undef ok 73 - qual scores match ok 74 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 75 ok 76 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' not ok 77 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 284. # got: 'IIABP1D4373' # expected: undef ok 78 - qual scores match ok 79 - Bio::Sequence::Quality matches ok 80 - Bio::Sequence::Quality matches ok t/SeqIO/SeqBuilder.t ................ 1..137 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::Seq::SeqBuilder' isa 'Bio::Factory::ObjectBuilderI' ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok t/SeqIO/SeqIO.t ..................... 1..58 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 - ID for format gcg ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - ID for format fasta ok 11 ok 12 ok 13 ok 14 - accession.version ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - ID for format pir ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - ID for format tab ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - ID for format ace ok 38 ok 39 ok 40 ok 41 ok 42 - use Algorithm::Diff; ok 43 - use IO::ScalarArray; ok 44 - use IO::String; ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 not ok 55 - Must pass a file or file handle # TODO file/fh-based tests should be in Bio::Root::IO, see issue #3204 # Failed (TODO) test 'Must pass a file or file handle' # at t/SeqIO/SeqIO.t line 158. # expecting: Regexp ((?^:No file, fh, or string argument provided)) # found: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: Could not guess format from file, filehandle or string # STACK: Error::throw # STACK: Bio::Root::Root::throw /build/bioperl-QLxev6/bioperl-1.7.8/blib/lib/Bio/Root/Root.pm:449 # STACK: Bio::SeqIO::new /build/bioperl-QLxev6/bioperl-1.7.8/blib/lib/Bio/SeqIO.pm:420 # STACK: Test::Exception::throws_ok t/SeqIO/SeqIO.t:157 # STACK: t/SeqIO/SeqIO.t:158 # ----------------------------------------------------------- # ) ok 56 - Must pass a file or file handle ok 57 - Must pass a file or file handle ok 58 - Must pass a real file ok t/SeqIO/seqxml.t .................... 1..61 ok 1 - use Bio::SeqIO; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::SeqIO::seqxml; ok 4 - stream ok ok 5 - seqXML version ok 6 - source ok 7 - source version ok 8 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 9 - display id ok 10 - primary id ok 11 - description ok 12 - sequence ok 13 - length ok 14 - entry source ok 15 - 'species' isa 'Bio::Species' ok 16 - species name ok 17 - NCBI tax id ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::Annotation::DBLink' ok 19 - dblink source ok 20 - dblink ID ok 21 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 22 - boolean property ok 23 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 24 - property with value ok 25 - writer ok ok 26 - outfile is created ok 27 - seqXML version ok 28 - source ok 29 - source version ok 30 - schemaLocation ok 31 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 32 - display id ok 33 - primary id ok 34 - description ok 35 - sequence ok 36 - length ok 37 - entry source ok 38 - 'species' isa 'Bio::Species' ok 39 - species name ok 40 - NCBI tax id ok 41 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::Annotation::DBLink' ok 42 - dblink source ok 43 - dblink ID ok 44 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 45 - property with value ok 46 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 47 - boolean property ok 48 - outfile is created ok 49 - seqXML version ok 50 - source ok 51 - source version ok 52 - display id ok 53 - primary id ok 54 - description ok 55 - sequence ok 56 - length ok 57 - display id ok 58 - primary id ok 59 - description ok 60 - sequence ok 61 - length ok t/SeqIO/Splicedseq.t ................ 1..27 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - get_SeqFeatures() ok 14 - protein sequence ok 15 - nucleotide sequence - correct CDS range ok 16 - nucleotide length ok 17 - appropriate warning if db not provided for remote sequence ok 18 - correct number of Ns added if remote sequence not provided ok 19 - cut by origin sequence using $feat->seq ok 20 - cut by origin sequence using $feat->spliced_seq ok 21 - cut by origin start using $feat->start ok 22 - cut by origin end using $feat->end ok 23 - cut by origin start using $feat->location->start ok 24 - cut by origin end using $feat->location->end ok 25 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 26 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok 27 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed ok t/SeqIO/swiss.t ..................... 1..247 ok 1 - use Bio::SeqIO::swiss; ok 2 - An object of class 'Bio::SeqIO::swiss' isa 'Bio::SeqIO' ok 3 - An object of class 'Bio::Species' isa 'Bio::Species' ok 4 ok 5 ok 6 - operator overloading in AnnotationI is deprecated ok 7 - dates ok 8 - dates ok 9 - dates ok 10 ok 11 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 12 ok 13 ok 14 ok 15 - operator overloading in AnnotationI is deprecated ok 16 ok 17 ok 18 ok 19 ok 20 - id is ROA1_HUMAN ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 ok 30 ok 31 ok 32 ok 33 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 ok 47 - GC1QBP ok 48 - HABP1 ok 49 - SF2P32 ok 50 - C1QBP ok 51 ok 52 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - F54H12.1 ok 60 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 73 ok 74 ok 75 ok 76 ok 77 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - An object of class 'Bio::Species' isa 'Bio::Species' ok 176 ok 177 ok 178 - operator overloading in AnnotationI is deprecated ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 - An object of class 'Bio::Species' isa 'Bio::Species' ok 208 ok 209 ok 210 - operator overloading in AnnotationI is deprecated ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 - Converting to fasta seqids match ok 242 - Converting to fasta sequences match ok 243 - Can parse generated swiss ok 244 - Roundtrip, seqids match ok 245 - Roundtrip, sequences match ok 246 ok 247 ok t/SeqIO/tab.t ....................... 1..8 ok 1 - use Bio::SeqIO::tab; ok 2 - An object of class 'Bio::SeqIO::tab' isa 'Bio::SeqIO' ok 3 - seq is defined ok 4 - check seq length ok 5 - check matching ok 6 - seq is defined ok 7 - check seq length ok 8 - check matching ok t/SeqIO/table.t ..................... 1..351 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::SeqIO::table; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok t/SeqIO/tigr.t ...................... 1..8 ok 1 - use Bio::SeqIO::tigr; not ok 2 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 3 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 4 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 5 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 6 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 7 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 8 # TODO & SKIP No tests for tigr format -- no sample file to test against ok t/SeqIO/tigrxml.t ................... 1..49 ok 1 - use Bio::SeqIO::tigrxml; ok 2 - An object of class 'Bio::SeqIO::tigrxml' isa 'Bio::SeqIO' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok t/SeqIO/tinyseq.t ................... 1..16 ok 1 - use Bio::SeqIO::tinyseq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqTools/Backtranslate.t .......... 1..8 ok 1 - use Bio::Tools::SeqPattern::Backtranslate; ok 2 - Bio::Tools::SeqPattern::Backtranslate->can('_reverse_translate_motif') ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - threw Regexp ((?^:syntax token)) ok t/SeqTools/CodonTable.t ............. 1..84 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::CodonUsage::IO; ok 3 ok 4 - An object of class 'Bio::Tools::CodonTable' isa 'Bio::Tools::CodonTable' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - is_start_codon, ATG ok 35 - is_start_codon, GGH ok 36 - is_start_codon, HTG ok 37 - is_start_codon, CCC ok 38 - is_ter_codon, U should map to T, UAG ok 39 - is_ter_codon,TaG ok 40 - is_ter_codon,TaR ok 41 - is_ter_codon,tRa ok 42 - is_ter_codon,ttA ok 43 - is_ter_codon, ambiguous codons should fail, NNN ok 44 - is_ter_codon, ambiguous codons should fail, TAN ok 45 - is_ter_codon, incomplete codons should fail, CC ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok t/SeqTools/ECnumber.t ............... 1..27 ok 1 - use Bio::Tools::ECnumber; ok 2 - An object of class 'Bio::Tools::ECnumber' isa 'Bio::Tools::ECnumber' ok 3 - An object of class 'Bio::Tools::ECnumber' isa 'Bio::Tools::ECnumber' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/SeqTools/GuessSeqFormat.t ......... 1..105 ok 1 - use Bio::Tools::GuessSeqFormat; ok 2 - use Bio::SeqIO; ok 3 - use Bio::AlignIO; ok 4 ok 5 - An object of class 'Bio::Tools::GuessSeqFormat' isa 'Bio::Tools::GuessSeqFormat' ok 6 - File input ok 7 ok 8 - String input ok 9 ok 10 - Filehandle input ok 11 ok 12 - Unknown file format ok 13 - threw Regexp ((?^:Could not guess format)) ok 14 - ace format ok 15 ok 16 ok 17 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 18 - embl format ok 19 ok 20 ok 21 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 22 - fasta format ok 23 ok 24 ok 25 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 26 - fastq format ok 27 ok 28 ok 29 - An object of class 'Bio::Seq::Quality' isa 'Bio::PrimarySeqI' ok 30 - game format ok 31 ok 32 ok 33 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 34 - gcg format ok 35 ok 36 ok 37 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 38 - genbank format ok 39 ok 40 ok 41 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 42 - pir format ok 43 ok 44 ok 45 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 46 - raw format ok 47 ok 48 ok 49 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 50 - swiss format ok 51 ok 52 ok 53 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 54 - tab format ok 55 ok 56 ok 57 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 58 - clustalw format ok 59 ok 60 ok 61 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 62 - fasta format ok 63 ok 64 ok 65 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 66 - fastq format ok 67 - mase format ok 68 ok 69 ok 70 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 71 - mega format ok 72 ok 73 ok 74 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 75 - msf format ok 76 ok 77 ok 78 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 79 - nexus format ok 80 ok 81 ok 82 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 83 - pfam format ok 84 ok 85 ok 86 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 87 - phylip format ok 88 ok 89 ok 90 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 91 - prodom format ok 92 ok 93 ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 95 - selex format ok 96 ok 97 ok 98 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 99 - stockholm format ok 100 ok 101 ok 102 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 103 - gcgblast format ok 104 - blast format ok 105 - vcf format ok t/SeqTools/OddCodes.t ............... 1..11 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::OddCodes; ok 3 - An object of class 'Bio::Tools::OddCodes' isa 'Bio::Tools::OddCodes' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/SeqTools/SeqPattern.t ............. 1..28 ok 1 - use Bio::Tools::SeqPattern; ok 2 ok 3 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 8 ok 9 ok 10 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 11 ok 12 - threw Regexp ((?^:revcom for .+ sequence types)) ok 13 - threw Regexp ((?^:backtranslate for .+ sequence types)) ok 14 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 15 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 16 ok 17 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 18 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 19 ok 20 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 21 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 22 ok 23 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 24 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 25 ok 26 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 27 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 28 ok t/SeqTools/SeqStats.t ............... 1..47 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqStats; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools:SeqStats object ok 5 - count_monomers() ok 6 - count_codons() ok 7 - get_mol_wt() ok 8 ok 9 - An object of class 'Bio::Tools::SeqStats' isa 'Bio::Tools::SeqStats' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/SeqTools/SeqUtils.t ............... 1..133 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqUtils; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Annotation::SimpleValue; ok 5 - use Bio::Annotation::Collection; ok 6 - use Bio::Annotation::Comment; ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed ok 25 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed ok 26 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed ok 27 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - cat - has expected tags ok 37 - cat - has expected tag values ok 38 - cat - note tag transfered (no throw) ok 39 - cat - note tag values transfered (correct count) ok 40 - get correct start of feature before 'cat' ok 41 - get correct start of feature after 'cat' ok 42 - different alphabets ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - trunc_with_features - has expected tags ok 49 - trunc_with_features - has expected tag values ok 50 ok 51 - primary_tag matches original feature... ok 52 - but tagged sf is now revcom ok 53 - primary_tag matches original feature... ok 54 - but tagged sf is now revcom ok 55 - primary_tag matches original feature... ok 56 - but tagged sf is now revcom ok 57 - revcom_with_features - has expected tags ok 58 - revcom_with_features - has expected tag values ok 59 - still not circular ok 60 - still circular ok 61 - No error thrown when deleting a segment of the sequence ok 62 - annotation of whole sequence has been moved to new molecule ok 63 - the product has an additional 'misc_feature' and the note specifies the lengths of the deletion' ok 64 - The composite feature is still present ok 65 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 66 - 'a composite feature that spanned the deletion site has been split up, Location' isa 'Bio::Location::Split' ok 67 - one of the sub-eatures of the composite feature has been deleted completely ok 68 - sub-feature 1 of the composite feature is still present ok 69 - the original end of sf1 is 12 ok 70 - after deletion, the end of sf1 is 1nt before the deletion site ok 71 - the original end location of sf1 EXACT ok 72 - annotation of subeature 1 has been moved to new molecule ok 73 - feature1 is till present ok 74 - 'feature1 location has now been split by the deletion and location object' isa 'Bio::Location::Split' ok 75 - feature1 has two locations after the deletion ok 76 - feature1 start is unaffected by the deletion ok 77 - feature1 end of first split is 1nt before deletion site ok 78 - feature1 start of second split is 1nt after deletion site ok 79 - feature1 end of second split has been adjusted correctly ok 80 - split feature now has a note ok 81 - got the expected note about length and position of deletion ok 82 - feature3 is till present ok 83 - a feature downstream of the deletion site is shifted entirely by 10nt to the left ok 84 - feature4 is till present ok 85 - a feature upstream of the deletion site is not repositioned by the deletion ok 86 - feature2 is till present ok 87 - start pos of a feature that started in the deletion site has been altered accordingly ok 88 - feature 2 now has a note ok 89 - note added to feature2 about deletion at 3' end ok 90 - a feature that was completely positioned inside the deletion site is not present on the new molecule ok 91 - feature6 is till present ok 92 - start pos of a feature that started in the deletion site has been altered accordingly ok 93 - end pos of a feature that started in the deletion site has been altered accordingly ok 94 - No error thrown when inserting a fragment into recipient sequence ok 95 - annotation of whole sequence has been moved to new molecule ok 96 - The composite feature is still present ok 97 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 98 - 'a composite feature that spanned the insertion site has been split up, Location' isa 'Bio::Location::Split' ok 99 - all of the parts of the composite feature are still present ok 100 - sub-feature 1 of the composite feature is still present ok 101 - the original end of sf1 is 12 ok 102 - after insertion, the end of sf1 has been shifted by the length of the insertion ok 103 - 'sub-feature 1 (spans insertion site) is now split up and' isa 'Bio::Location::Split' ok 104 - the start and end position types of sub-feature1 have not changed ok 105 - annotation of subeature 1 has been moved to new molecule ok 106 - split feature now has a note ok 107 - got the expected note about length and position of insertion ok 108 - feature3 is till present ok 109 - a feature downstream of the insertion site is shifted entirely to the left by the length of the insertion ok 110 - feature4 is till present ok 111 - a feature upstream of the insertion site is not repositioned ok 112 - a feature on the inserted fragment is present on the product molecule ok 113 - position of the feature on the insert has been adjusted to product coordinates ok 114 - strand of the feature on insert has not changed ok 115 - desctription of the product contains description of the fragment ok 116 - desctription of the product contains description of the recipient ok 117 - the product has an additional 'misc_feature' with note='inserted fragment' ok 118 - No error thrown using 'ligate' of fragment into recipient ok 119 - product has the expected length ok 120 - the sequence of the fragment is inserted into the product ok 121 - we have a feature annotating the ligated fragment ok 122 - coordinates of the feature annotating the ligated feature are correct ok 123 - the fragment feature1 is now a feature of the product ok 124 - start and end of a feature on the fragment are correct after insertion with "flip" option ok 125 - Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error ok 126 - Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new' ok 127 - An object of class 'Bio::Seq::Foo' isa 'Bio::Seq::Foo' ok 128 - the product has an additional 'misc_feature' and the note specifies the lengths of the deletion' ok 129 - The composite feature is still present ok 130 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 131 - 'a composite feature that spanned the deletion site has been split up, Location' isa 'Bio::Location::Split' ok 132 - 'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new ok 133 - 'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new ok t/SeqTools/SeqWords.t ............... 1..22 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqWords; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools::SeqWords object ok 5 - count_words ok 6 ok 7 - An object of class 'Bio::Tools::SeqWords' isa 'Bio::Tools::SeqWords' ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - An object of class 'Bio::Tools::SeqWords' isa 'Bio::Tools::SeqWords' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Species.t ......................... 1..27 ok 1 - use Bio::Species; ok 2 - use Bio::DB::Taxonomy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 18 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 19 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 20 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 21 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Tools/Alignment/Consed.t .......... 1..15 ok 1 - use Bio::Tools::Alignment::Consed; ok 2 - new CSM::Consed object was created ok 3 - An object of class 'Bio::Tools::Alignment::Consed' isa 'Bio::Tools::Alignment::Consed' ok 4 - singlets can be successfully set ok 5 - singlets can be retrieved ok 6 - doublets can be set ok 7 - doublets can be retreived ok 8 - doublets can be retrieved ok 9 - pairs can be retrieved ok 10 - multiplets can be retrieved ok 11 - singletons can be retrieved ok 12 - how many sequences there are in the acefile _and_ in the singlets file ok 13 - statistics from the Bio::Tools::Alignment::Consed object to compare the total number of sequences accounted for there to the number of sequences found via grep ok 14 ok 15 ok t/Tools/AmpliconSearch.t ............ 1..185 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::Primer; ok 3 - use Bio::Tools::AmpliconSearch; ok 4 - Basic ok 5 - An object of class 'Bio::Tools::AmpliconSearch' isa 'Bio::Tools::AmpliconSearch' ok 6 - Forward primer only ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 11 ok 12 ok 13 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - Reverse primer only ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 - Two primers, no match ok 39 ok 40 ok 41 ok 42 ok 43 - Two degenerate primers from a file ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - RNA template ok 55 ok 56 ok 57 ok 58 ok 59 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - Forward primer from file ok 66 ok 67 ok 68 ok 69 ok 70 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 71 ok 72 ok 73 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - Multiple amplicons ok 80 ok 81 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 - Amplicon on reverse strand ok 94 ok 95 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 - Overlapping amplicons (1) ok 108 ok 109 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 - Overlapping amplicons (2) ok 116 ok 117 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 - Overlapping amplicons (3) ok 124 ok 125 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 - Amplicons on both strands ok 132 ok 133 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 - Overlapping amplicons on both strands ok 146 ok 147 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 - Annotated template ok 154 ok 155 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 156 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 157 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 158 ok 159 ok 160 - Update primers ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - Update template ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok t/Tools/EMBOSS/Palindrome.t ......... 1..13 ok 1 - use Bio::Tools::EMBOSS::Palindrome; ok 2 - use Bio::Tools::GFF; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/Tools/ePCR.t ...................... 1..27 ok 1 - use Bio::Tools::EPCR; ok 2 - use Bio::SeqIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - got 3 forward strand ePCR hits ok 27 - got 3 reverse strand ePCR hits ok t/Tools/Est2Genome.t ................ 1..61 ok 1 - use Bio::Tools::Est2Genome; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok t/Tools/FootPrinter.t ............... 1..27 ok 1 - use Bio::Tools::FootPrinter; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Tools/Geneid.t .................... 1..26 ok 1 - use Bio::Tools::Geneid; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/Tools/Genewise.t .................. 1..33 ok 1 - use Bio::Tools::Genewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok t/Tools/Genomewise.t ................ 1..21 ok 1 - use Bio::Tools::Genomewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Tools/Genpred.t ................... 1..185 ok 1 - use Bio::Tools::Fgenesh; ok 2 - use Bio::Tools::Genscan; ok 3 - use Bio::Tools::Genemark; ok 4 - use Bio::Tools::Glimmer; ok 5 - use Bio::Tools::MZEF; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 ok 10 - strand match (-1 and -1) ok 11 - score match (1.05 and 1.05) ok 12 ok 13 - predicted and extracted protein seqs match ok 14 - strand match (1 and 1) ok 15 - score match (4.46 and 4.46) ok 16 ok 17 - predicted and extracted protein seqs match ok 18 - initial exons 0 ok 19 - score match 1.74 ok 20 ok 21 - predicted and extracted protein seqs match ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - Genemark tests ok 43 ok 44 ok 45 ok 46 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok t/Tools/GFF.t ....................... 1..34 ok 1 - use Bio::Tools::GFF; ok 2 - use Bio::SeqFeature::Generic; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok t/Tools/IUPAC.t ..................... 1..46 ok 1 - use Bio::Tools::IUPAC; ok 2 - use Bio::Seq; ok 3 - use Bio::PrimarySeq; ok 4 ok 5 ok 6 - Regexp ok 7 ok 8 - Regexp ok 9 - Count ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - Regexp matches ambiguous sequences ok 28 ok 29 - Nucleic IUPAC ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - Proteic IUPAC ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok t/Tools/Lucy.t ...................... 1..22 ok 1 - use Bio::Tools::Lucy; ok 2 - An object of class 'Bio::Tools::Lucy' isa 'Bio::Tools::Lucy' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Tools/Match.t ..................... 1..38 ok 1 - use Bio::Tools::Match; ok 2 ok 3 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature core score correct ok 8 - feature matrix score correct ok 9 - feature matrix id correct ok 10 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 11 - correct source ok 12 - feature start correct ok 13 - feature end correct ok 14 - feature core score correct ok 15 - feature matrix score correct ok 16 - feature matrix id correct ok 17 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 18 - correct source ok 19 - feature start correct ok 20 - feature end correct ok 21 - feature core score correct ok 22 - feature matrix score correct ok 23 - feature matrix id correct ok 24 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 25 - correct source ok 26 - feature start correct ok 27 - feature end correct ok 28 - feature core score correct ok 29 - feature matrix score correct ok 30 - feature matrix id correct ok 31 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 32 - correct source ok 33 - feature start correct ok 34 - feature end correct ok 35 - feature core score correct ok 36 - feature matrix score correct ok 37 - feature matrix id correct ok 38 - correct number of results managed to get tested ok t/Tools/Phylo/Gerp.t ................ 1..33 ok 1 - use Bio::Tools::Phylo::Gerp; ok 2 ok 3 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature score correct ok 8 - feature pvalue correct ok 9 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 10 - correct source ok 11 - feature start correct ok 12 - feature end correct ok 13 - feature score correct ok 14 - feature pvalue correct ok 15 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 16 - correct source ok 17 - feature start correct ok 18 - feature end correct ok 19 - feature score correct ok 20 - feature pvalue correct ok 21 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 22 - correct source ok 23 - feature start correct ok 24 - feature end correct ok 25 - feature score correct ok 26 - feature pvalue correct ok 27 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 28 - correct source ok 29 - feature start correct ok 30 - feature end correct ok 31 - feature score correct ok 32 - feature pvalue correct ok 33 - correct number of results parsed out ok t/Tools/Phylo/Molphy.t .............. 1..18 ok 1 - use Bio::Tools::Phylo::Molphy; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/Tools/Phylo/Phylip/ProtDist.t ..... 1..47 ok 1 - use Bio::Tools::Phylo::Phylip::ProtDist; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/Tools/pICalculator.t .............. 1..38 ok 1 - use Bio::Seq; ok 2 - use Bio::Tools::pICalculator; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/Tools/Primer3.t ................... 1..14 ok 1 - use Bio::Tools::Primer3; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::Seq::PrimedSeq' isa 'Bio::Seq::PrimedSeq' ok 11 ok 12 ok 13 ok 14 - bug 2862 ok t/Tools/Promoterwise.t .............. 1..7 ok 1 - use Bio::Tools::Promoterwise; ok 2 - An object of class 'Bio::Tools::Promoterwise' isa 'Bio::Tools::Promoterwise' ok 3 ok 4 ok 5 ok 6 ok 7 ok t/Tools/PrositeScan.t ............... 1..3 ok 1 - use Bio::Tools::PrositeScan; ok 2 - use Bio::SeqFeature::FeaturePair; # Subtest: Predictions ok 1 - Comparing parsed prediction input 1..1 ok 3 - Predictions ok t/Tools/Pseudowise.t ................ 1..21 ok 1 - use Bio::Tools::Pseudowise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Tools/QRNA.t ...................... 1..30 ok 1 - use Bio::Tools::QRNA; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok t/Tools/RandDistFunctions.t ......... 1..5 ok 1 - use Bio::Tools::RandomDistFunctions; ok 2 ok 3 ok 4 ok 5 ok t/Tools/RepeatMasker.t .............. 1..28 ok 1 - use Bio::Tools::RepeatMasker; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Tools/Seg.t ....................... 1..15 ok 1 - use Bio::Tools::Seg; ok 2 - parser defined ok 3 ok 4 - seq id for seq 0 identified ok 5 - start for seq 0 identified ok 6 - end for seq 0 identified ok 7 - score for seq 0 identified ok 8 - seq id for seq 1 identified ok 9 - start for seq 1 identified ok 10 - end for seq 1 identified ok 11 - score for seq 1 identified ok 12 - seq id for seq 2 identified ok 13 - start for seq 2 identified ok 14 - end for seq 2 identified ok 15 - score for seq 2 identified ok t/Tools/Sigcleave.t ................. 1..18 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::Sigcleave; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - unable to get raw sigcleave results ok 16 ok 17 - unable to get raw sigcleave results ok 18 ok t/Tools/Signalp.t ................... 1..11 ok 1 - use Bio::Tools::Signalp; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/Tools/Signalp/ExtendedSignalp.t ... 1..185 ok 1 - use Bio::Tools::Signalp::ExtendedSignalp; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok t/Tools/Sim4.t ...................... 1..27 ok 1 - use Bio::Tools::Sim4::Results; ok 2 - new Sim4 results instance ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - new Sim4 results instance ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Tools/Spidey/Spidey.t ............. 1..26 ok 1 - use Bio::Tools::Spidey::Results; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/Tools/TandemRepeatsFinder.t ....... 1..66 ok 1 - use Bio::Tools::TandemRepeatsFinder; ok 2 - Parser created successfully ok 3 - empty results file correctly returns no results ok 4 - Second parser created successfully ok 5 - seq_id for first result correctly parsed ok 6 - start for first result correctly parsed ok 7 - end for first result correctly parsed ok 8 - source tag for first result correctly parsed ok 9 - primary tag for first result correctly parsed ok 10 - score for first result correctly parsed ok 11 - sequence description correctly parsed. ok 12 - correctly parsed all run parameters ok 13 - correctly parsed period_size for first result ok 14 - correctly parsed copy_number for first result ok 15 - correctly parsed consensus_size for first result ok 16 - correctly parsed percent_matches for first result ok 17 - correctly parsed percent_indels for first result ok 18 - correctly parsed percent_a for first result ok 19 - correctly parsed percent_c for first result ok 20 - correctly parsed percent_g for first result ok 21 - correctly parsed percent_t for first result ok 22 - correctly parsed entropy for first result ok 23 - correctly parsed repeat_sequence for first result ok 24 - correctly parsed consensus_sequence for first result ok 25 - seq_id for second result correctly parsed ok 26 - start for second result correctly parsed ok 27 - end for second result correctly parsed ok 28 - source tag for first result correctly parsed ok 29 - primary tag for first result correctly parsed ok 30 - score for first result correctly parsed ok 31 - sequence description correctly parsed. ok 32 - correctly reatained all run parameters for second feature ok 33 - correctly parsed period_size for second result ok 34 - correctly parsed copy_number for second result ok 35 - correctly parsed consensus_size for second result ok 36 - correctly parsed percent_matches for second result ok 37 - correctly parsed percent_indels for second result ok 38 - correctly parsed percent_a for second result ok 39 - correctly parsed percent_c for second result ok 40 - correctly parsed percent_g for second result ok 41 - correctly parsed percent_t for second result ok 42 - correctly parsed entropy for second result ok 43 - correctly parsed repeat_sequence for second result ok 44 - correctly parsed consensus_sequence for second result ok 45 - seq_id for first result correctly parsed ok 46 - start for first result correctly parsed ok 47 - end for first result correctly parsed ok 48 - source tag for first result correctly parsed ok 49 - primary tag for first result correctly parsed ok 50 - score for first result correctly parsed ok 51 - sequence description correctly parsed. ok 52 - correctly reatained all run parameters for third feature ok 53 - correctly parsed period_size for third result ok 54 - correctly parsed copy_number for third result ok 55 - correctly parsed consensus_size for third result ok 56 - correctly parsed percent_matches for third result ok 57 - correctly parsed percent_indels for third result ok 58 - correctly parsed percent_a for third result ok 59 - correctly parsed percent_c for third result ok 60 - correctly parsed percent_g for third result ok 61 - correctly parsed percent_t for third result ok 62 - correctly parsed entropy for third result ok 63 - correctly parsed repeat_sequence for third result ok 64 - correctly parsed consensus_sequence for third result ok 65 - correctly return undef when no features are left ok 66 - Correctly parsed seq_id even if description does not exist ok t/Tools/TargetP.t ................... 1..124 ok 1 - use Bio::Tools::TargetP; ok 2 ok 3 ok 4 ok 5 - good SeqID ok 6 - good Seqlength ok 7 - correct Mitochondrion cutoff ok 8 - correct signalpPeptide cutoff ok 9 - correct other cutoff ok 10 - correct location ok 11 - correct Reliability class score ok 12 - No peptide signal length reported ok 13 - good SeqID ok 14 - good Seqlength ok 15 - correct Mitochondrion cutoff ok 16 - correct signalpPeptide cutoff ok 17 - correct other cutoff ok 18 - correct location ok 19 - correct Reliability class score ok 20 - correct peptide signal length ok 21 - good SeqID ok 22 - good Seqlength ok 23 - correct Mitochondrion cutoff ok 24 - correct signalpPeptide cutoff ok 25 - correct other cutoff ok 26 - correct location ok 27 - correct Reliability class score ok 28 - correct peptide signal length ok 29 - good SeqID ok 30 - good Seqlength ok 31 - correct Mitochondrion cutoff ok 32 - correct signalpPeptide cutoff ok 33 - correct other cutoff ok 34 - correct location ok 35 - correct Reliability class score ok 36 - No peptide signal length reported ok 37 - good SeqID ok 38 - good Seqlength ok 39 - correct Mitochondrion cutoff ok 40 - correct signalpPeptide cutoff ok 41 - correct other cutoff ok 42 - correct location ok 43 - correct Reliability class score ok 44 - No peptide signal length reported ok 45 - good SeqID ok 46 - good Seqlength ok 47 - correct Mitochondrion cutoff ok 48 - correct signalpPeptide cutoff ok 49 - correct other cutoff ok 50 - correct location ok 51 - correct Reliability class score ok 52 - No peptide signal length reported ok 53 - good SeqID ok 54 - good Seqlength ok 55 - correct Mitochondrion cutoff ok 56 - correct signalpPeptide cutoff ok 57 - correct other cutoff ok 58 - correct location ok 59 - correct Reliability class score ok 60 - No peptide signal length reported ok 61 - good SeqID ok 62 - good Seqlength ok 63 - correct Mitochondrion cutoff ok 64 - correct signalpPeptide cutoff ok 65 - correct other cutoff ok 66 - correct location ok 67 - correct Reliability class score ok 68 - correct peptide signal length ok 69 - good SeqID ok 70 - good Seqlength ok 71 - correct Mitochondrion cutoff ok 72 - correct signalpPeptide cutoff ok 73 - correct other cutoff ok 74 - correct location ok 75 - correct Reliability class score ok 76 - No peptide signal length reported ok 77 - good SeqID ok 78 - good Seqlength ok 79 - correct Mitochondrion cutoff ok 80 - correct signalpPeptide cutoff ok 81 - correct other cutoff ok 82 - correct location ok 83 - correct Reliability class score ok 84 - No peptide signal length reported ok 85 - good SeqID ok 86 - good Seqlength ok 87 - correct Mitochondrion cutoff ok 88 - correct signalpPeptide cutoff ok 89 - correct other cutoff ok 90 - correct location ok 91 - correct Reliability class score ok 92 - No peptide signal length reported ok 93 - good SeqID ok 94 - good Seqlength ok 95 - correct Mitochondrion cutoff ok 96 - correct signalpPeptide cutoff ok 97 - correct other cutoff ok 98 - correct location ok 99 - correct Reliability class score ok 100 - No peptide signal length reported ok 101 - good SeqID ok 102 - good Seqlength ok 103 - correct Mitochondrion cutoff ok 104 - correct signalpPeptide cutoff ok 105 - correct other cutoff ok 106 - correct location ok 107 - correct Reliability class score ok 108 - correct peptide signal length ok 109 - good SeqID ok 110 - good Seqlength ok 111 - correct Mitochondrion cutoff ok 112 - correct signalpPeptide cutoff ok 113 - correct other cutoff ok 114 - correct location ok 115 - correct Reliability class score ok 116 - No peptide signal length reported ok 117 - good SeqID ok 118 - good Seqlength ok 119 - correct Mitochondrion cutoff ok 120 - correct signalpPeptide cutoff ok 121 - correct other cutoff ok 122 - correct location ok 123 - correct Reliability class score ok 124 - No peptide signal length reported ok t/Tools/Tmhmm.t ..................... 1..12 ok 1 - use Bio::Tools::Tmhmm; ok 2 - new() ok 3 - got 3 feat ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Tools/tRNAscanSE.t ................ 1..14 ok 1 - use Bio::Tools::tRNAscanSE; ok 2 - An object of class 'Bio::Tools::tRNAscanSE' isa 'Bio::Tools::tRNAscanSE' ok 3 ok 4 - seq_id ok 5 - codon ok 6 - start ok 7 - end ok 8 - strand ok 9 - exons ok 10 - end ok 11 - start ok 12 - start ok 13 - end ok 14 - seq_id ok t/Tree/Compatible.t ................. 1..5 ok 1 - use Bio::Tree::Compatible; ok 2 - use Bio::TreeIO; ok 3 ok 4 ok 5 ok t/Tree/Node.t ....................... 1..33 ok 1 - use Bio::Tree::Node; ok 2 - use Bio::TreeIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - retrieve the first value ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - with fake node ok 30 - after reroot on fake node ok 31 - reroot on B ok 32 - remove fake node, reroot on former B anc ok 33 - roundtrip ok t/Tree/RandomTreeFactory.t .......... 1..5 ok 1 - use Bio::Tree::RandomFactory; ok 2 - use Bio::TreeIO; ok 3 - use Bio::Tree::Statistics; ok 4 ok 5 ok t/Tree/Tree.t ....................... 1..66 ok 1 - use Bio::TreeIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 - retrieve the first value ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - Number of nodes that have ADH2 as name ok 15 - Test Monophyly ok 16 - Height ok 17 - Depth ok 18 - non-monophyletic group ok 19 - not a binary tree ok 20 - 12 nodes ok 21 - after force_binary() it is ok 22 - and there are more nodes (17) ok 23 - B,C are Monophyletic ok 24 - A,B are Monophyletic ok 25 - B,F are not Monophyletic ok 26 - A,B are Monophyletic ok 27 - A,B,C are not Monophyletic w D as outgroup ok 28 - A,F,E are monophyletic with I as outgroup ok 29 - subtree_length() without attributes is an alias to total_branch_lenght() ok 30 - Length of the tree is larger that lenght of a subtree ok 31 - Can re-root with A as outgroup ok 32 - Count the number of nodes ok 33 - same length ok 34 - Root node is A ok 35 - Root node is A's ancestor ok 36 - Can reroot with C's ancsestor ok 37 - Node count correct ok 38 - Total original branch length is what it is supposed to be ok 39 - Updated total branch length after the reroot ok 40 - Make sure root is really what we asked for ok 41 - Testing for failed re-rerooting ok 42 - Test that rooting succeeded ok 43 - Test that re-rooted tree has proper number of nodes after re-rooting ok 44 - Branch length before rerooting ok 45 - Branch length after rerooting ok 46 - Root is really the ancestor we asked for ok 47 - BFS traversal order ok 48 - DFS travfersal order ok 49 - DFS traversal after removing H ok 50 - DFS traversal after removing G ok 51 - DFS traversal after removing E ok 52 - DFS after removing all but 0,1,2,A,B,C,D ok 53 - Testing bootstrap copy ok 54 - Testing bootstrap copy ok 55 - Testing bootstrap copy ok 56 - Testing bootstrap copy ok 57 - Testing bootstrap copy ok 58 - Testing bootstrap copy ok 59 - Testing bootstrap copy ok 60 - Testing bootstrap copy ok 61 - Testing auto-boostrap copy during parse ok 62 - Testing auto-boostrap copy during parse ok 63 - Testing auto-boostrap copy during parse ok 64 - Testing auto-boostrap copy during parse ok 65 ok 66 ok t/Tree/TreeIO.t ..................... 1..76 ok 1 - use Bio::TreeIO; ok 2 ok 3 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 14 ok 15 ok 16 ok 17 ok 18 - Saw SINFRUP0000006110 as expected ok 19 ok 20 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 21 - Total Nodes ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 41 - Leaf nodes ok 42 - All nodes ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - bug 2356 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 - An object of class 'Bio::Tree::Node' isa 'Bio::Tree::NodeI' ok 74 ok 75 - An object of class 'Bio::Tree::Node' isa 'Bio::Tree::NodeI' not ok 76 # TODO The nodes are garbage-collected away b/c Tree isn't retained in memory # Failed (TODO) test at t/Tree/TreeIO.t line 332. # got: '0' # expected: '198' ok t/Tree/TreeIO/lintree.t ............. 1..24 ok 1 - use Bio::TreeIO; ok 2 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 18 - Leaf nodes ok 19 - All nodes ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Tree/TreeIO/newick.t .............. 1..51 ok 1 - use Bio::TreeIO; ok 2 ok 3 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 14 ok 15 ok 16 ok 17 ok 18 - Saw SINFRUP0000006110 as expected ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - Round trip: simple newick ok 28 - Round trip: Root node branch length ok 29 - Round trip: Root node branch length ok 30 - Round trip: from Wikipedia ok 31 - Branch length on root ok 32 - Tiny branch length on root ok 33 - Zero branch lenghts ok 34 - wkp blank tree ok 35 - wkp only leaves labeled ok 36 - wkp all nodes labeled ok 37 - wkp branch lengths, no labels ok 38 - wkp branch lengths, including root ok 39 - wkp distances and leaf names ok 40 - wkp distances and all names ok 41 - wkp rooted on leaf node ok 42 - phylip simple tree ok 43 - phylip no labels ok 44 - phylip w/ branch lengths ok 45 - phylip w/ internal label ok 46 - phylip raccoon tree ok 47 - phylip mammal tree ok 48 - phylip mammal tree w/ underbars ok 49 - phylip single node ok 50 - phylip_quartet ok 51 - phylip greek ok t/Tree/TreeIO/nexus.t ............... 1..24 ok 1 - use Bio::TreeIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - bug 2356 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Tree/TreeIO/nhx.t ................. 1..19 ok 1 - use Bio::TreeIO; ok 2 ok 3 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 4 - Total Nodes ok 5 ok 6 ok 7 ok 8 - Roundtrip: simple newick ok 9 - Roundtrip: bug 1471 test ok 10 - Roundtrip: different combinations of label, NHX, and branch length ok 11 - Roundtrip: doot node branch length ok 12 - Roundtrip: Example from Wikipedia ok 13 - Roundtrip: ADH NHX tree ok 14 - Roundtrip: notung nhx example http://www.cs.cmu.edu/~aiton/split/Manual-2.6.master014.html ok 15 - Roundtrip: notung nhx bootstrap http://www.cs.cmu.edu/~aiton/split/Manual-2.6.master014.html ok 16 - Roundtrip: r-sig-phylo mailing list http://www.mail-archive.com/r-sig-phylo@r-project.org/msg00516.html ok 17 - Roundtrip: treebest example nhx ok 18 - Roundtrip: Wellcome Trust ToL (from http://iphylo.blogspot.com/2009/02/thoughts-on-wellcome-interactive-tree.html) ok 19 - Roundtrip: Biorecipes NHX file (http://www.biorecipes.com/Orthologues/StatusPage/pics/TreeEukaryota.nt) ok t/Tree/TreeIO/phyloxml.t ............ 1..98 ok 1 - use Bio::TreeIO; ok 2 - use Bio::TreeIO::phyloxml; ok 3 ok 4 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 24 ok 25 ok 26 ok 27 ok 28 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 29 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 30 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 31 ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 33 ok 34 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 35 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 36 ok 37 ok 38 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 39 ok 40 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 41 - An object of class 'Bio::Annotation::Relation' isa 'Bio::Annotation::Relation' ok 42 ok 43 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 44 - An object of class 'Bio::Annotation::Relation' isa 'Bio::Annotation::Relation' ok 45 ok 46 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 47 ok 48 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 49 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 50 ok 51 ok 52 ok 53 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 54 ok 55 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 56 - An object of class 'Bio::Annotation::Relation' isa 'Bio::Annotation::Relation' ok 57 ok 58 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode' ok 59 ok 60 ok 61 ok 62 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 63 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode' ok 64 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 66 ok 67 ok 68 ok 69 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 70 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode' ok 71 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 72 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 73 ok 74 ok 75 ok 76 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 77 ok 78 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 91 ok 92 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode' ok 93 ok 94 ok 95 ok 96 ok 97 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 98 ok t/Tree/TreeIO/tabtree.t ............. 1..24 ok 1 - use Bio::TreeIO; ok 2 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 18 - Leaf nodes ok 19 - All nodes ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Tree/TreeStatistics.t ............. 1..44 ok 1 - use Bio::TreeIO; ok 2 - use Bio::Tree::Statistics; ok 3 - cherries ok 4 - cherries # Subtest: transfer-bootstrap-expectation (experimental) 1..15 ok 1 - Testing TBE for node ok 2 - Testing TBE for node N7 ok 3 - Testing TBE for node N3 ok 4 - Testing TBE for node N1 ok 5 - Testing TBE for node N2 ok 6 - Testing TBE for node N6 ok 7 - Testing TBE for node N4 ok 8 - Testing TBE for node N5 ok 9 - Testing TBE for node N14 ok 10 - Testing TBE for node N10 ok 11 - Testing TBE for node N8 ok 12 - Testing TBE for node N9 ok 13 - Testing TBE for node N13 ok 14 - Testing TBE for node N11 ok 15 - Testing TBE for node N12 ok 5 - transfer-bootstrap-expectation (experimental) # Subtest: assess_bootstrap 1..15 ok 1 - Testing bootstrap for node ok 2 - Testing bootstrap for node N7 ok 3 - Testing bootstrap for node N3 ok 4 - Testing bootstrap for node N1 ok 5 - Testing bootstrap for node N2 ok 6 - Testing bootstrap for node N6 ok 7 - Testing bootstrap for node N4 ok 8 - Testing bootstrap for node N5 ok 9 - Testing bootstrap for node N14 ok 10 - Testing bootstrap for node N10 ok 11 - Testing bootstrap for node N8 ok 12 - Testing bootstrap for node N9 ok 13 - Testing bootstrap for node N13 ok 14 - Testing bootstrap for node N11 ok 15 - Testing bootstrap for node N12 ok 6 - assess_bootstrap ok 7 - read traits ok 8 - Add traits in second column and ignore missing ok 9 - Add traits in third column ok 10 - parsimony score ok 11 - subtree parsimony score ok 12 - ps value ok 13 - fitch_down ok 14 - ps value after fitch_down ok 15 - persistence of a leaf ok 16 - persistence of an internal node value ok 17 - persistence of an internal node value ok 18 - persistence of an internal node value ok 19 - leaf node: number of clusters = 0 ok 20 - number of clusters ok 21 - number of clusters ok 22 - number of clusters ok 23 - number of leaves in phylotype ok 24 - number of leaves in phylotype ok 25 - number of leaves in phylotype ok 26 - number of leaves in phylotype ok 27 - phylotype length ok 28 - phylotype length ok 29 - phylotype length ok 30 - phylotype length ok 31 - phylotype length ok 32 - sum of leaf distances ok 33 - sum of leaf distances ok 34 - sum of leaf distances ok 35 - sum of leaf distances ok 36 - sum of leaf distances ok 37 - genetic diversity ok 38 - separation ok 39 - association index ok 40 - subtree association index ok 41 - monophyletic clade size ok 42 - monophyletic clade size ok 43 - monophyletic clade size ok 44 - monophyletic clade size ok All tests successful. Test Summary Report ------------------- t/Root/IO.t (Wstat: 0 Tests: 154 Failed: 0) TODO passed: 109, 112, 115, 118 Files=211, Tests=14841, 78 wallclock secs ( 1.17 usr 0.26 sys + 58.30 cusr 10.28 csys = 70.01 CPU) Result: PASS make[1]: Leaving directory '/build/bioperl-QLxev6/bioperl-1.7.8' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j2 install DESTDIR=/build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp AM_UPDATE_INFO_DIR=no PREFIX=/usr make[1]: Entering directory '/build/bioperl-QLxev6/bioperl-1.7.8' Manifying 40 pod documents Manifying 35 pod documents Manifying 33 pod documents Manifying 32 pod documents Manifying 34 pod documents Manifying 32 pod documents Manifying 32 pod documents Manifying 30 pod documents Manifying 27 pod documents Manifying 35 pod documents Manifying 29 pod documents Manifying 35 pod documents Manifying 36 pod documents Manifying 33 pod documents Manifying 33 pod documents Manifying 15 pod documents Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/BioPerl.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/PrimarySeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AnalysisI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqAnalysisParserI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Range.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/IdentifiableI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Species.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/FeatureHolderI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqUtils.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/RangeI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DescribableI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/PullParserI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/HandlerBaseI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AnnotatableI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AnnotationI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AnalysisResultI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SimpleAlign.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/PrimarySeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DasI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DBLinkContainerI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeatureI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/UpdateableSeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SimpleAnalysisI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Taxon.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/ParameterBaseI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AnnotationCollectionI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/LocatableSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AnalysisParserI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/WebAgent.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/LocationI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/IdCollectionI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/EventHandlerI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/SearchResultEventBuilder.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/sim4.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/axt.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/FastHitEventBuilder.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/erpin.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/megablast.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/IteratedSearchResultEventBuilder.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/blasttable.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/rnamotif.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/waba.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/gmap_f9.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/wise.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/exonerate.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/cross_match.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/psl.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/blast.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/blast_pull.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/infernal.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/SearchWriterI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/HitTableWriter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/GbrowseGFF.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/HSPTableWriter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/ResultTableWriter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/TextResultWriter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Failover.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Qual.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/QueryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/FileCache.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/DBFetch.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/SeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Registry.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/RandomAccessI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/WebDBSeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/InMemoryCache.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/GenericWebAgent.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/UpdateableSeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/ReferenceI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/LocationI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/IndexedBase.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/GFF/Util/Rearrange.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/GFF/Util/Binning.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/silva.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/greengenes.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/list.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/flatfile.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat/BinarySearch.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/swiss.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/genbank.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/embl.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/DB/Query/WebQuery.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/DatabaseI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/GenericDatabase.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/BlastStatistics.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/GenericStatistics.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/StatisticsI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/BlastUtils.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Processor.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/SearchUtils.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/PsiBlastHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/FastaHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/BlastPullHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/WABAHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/PullHSPI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/HSPI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/BlastHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/PSLHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/HSPFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/GenericHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/HSP/ModelHSP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/PullHitI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/GenericHit.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/ModelHit.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/BlastHit.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/BlastPullHit.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/PsiBlastHit.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/Fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/HitI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Hit/HitFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Tiling/MapTileUtils.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Tiling/TilingI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Tiling/MapTiling.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/CrossMatchResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/BlastResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/ResultI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/WABAResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/BlastPullResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/PullResultI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/ResultFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/GenericResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Result/INFERNALResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Iteration/IterationI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Search/Iteration/GenericIteration.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/Tree.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/TreeI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/TreeFunctionsI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/NodeI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/Node.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/Compatible.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/AnnotatableNode.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/Statistics.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/NodeNHX.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/RandomFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tree/DistanceFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/phd.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/MultiFile.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/locuslink.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/FTHelper.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/seqxml.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/tab.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/mbsout.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/kegg.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/game.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/swiss.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/msout.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/largefasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/scf.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/pir.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/tinyseq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/tigr.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/fastq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/bsml_sax.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/tigrxml.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/embldriver.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/gcg.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/genbank.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/gbdriver.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/asciitree.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/raw.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/embl.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/bsml.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/table.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/metafasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/qual.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/gbxml.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/swissdriver.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/ace.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/game/gameHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/game/gameWriter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/game/seqHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/game/gameSubs.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/game/featHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/tinyseq/tinyseqHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqIO/Handler/GenericRichSeqHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Event/EventHandlerI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Event/EventGeneratorI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/Scoring.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/MatrixI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/Mlagan.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PhylipDist.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/Generic.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/IO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/ProtPsm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/PsmHeader.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/ProtMatrix.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/SiteMatrix.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/Psm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/PsmHeaderI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/InstanceSite.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/SiteMatrixI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/PsmI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/InstanceSiteI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/transfac.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/psiblast.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/masta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/mast.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/meme.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/IO/mlagan.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/IO/phylip.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Matrix/IO/scoring.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Align/Utilities.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Align/PairwiseStatistics.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Align/ProteinStatistics.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Align/StatisticsI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Align/DNAStatistics.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Align/AlignI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/AbstractSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/Qual.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/Abstract.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/Blast.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/GenBank.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/Fastq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/EMBL.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/SwissPfam.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/BlastTable.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/Fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Index/Swissprot.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/Fuzzy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/NarrowestCoordPolicy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/Atomic.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/FuzzyLocationI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/Simple.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/Split.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/SplitLocationI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/CoordinatePolicyI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/AvWithinCoordPolicy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Location/WidestCoordPolicy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/TraceI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/RichSeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/BaseSeqProcessor.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/LargeSeqI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/SeqBuilder.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/LargeLocatableSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/RichSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/PrimedSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/QualI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/MetaI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/EncodedSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/Meta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/SimulatedRead.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/Quality.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/SeqFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/PrimaryQual.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/LargeSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/SequenceTrace.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/LargePrimarySeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/SeqFastaSpeedFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Seq/Meta/Array.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/pfam.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/msf.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/mase.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/nexus.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/prodom.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/psi.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/phylip.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/mega.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/arp.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/proda.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/largemultifasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/maf.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/fasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/xmfa.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/clustalw.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/emboss.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/po.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/meme.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/metafasta.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/selex.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/bl2seq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/AlignIO/Handler/GenericAlignHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/CodonUsage/Table.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/CodonUsage/IO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Das/FeatureTypeI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Das/SegmentI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/TypedSeqFeatureI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/SubSeq.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/PositionProxy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/AnnotationAdaptor.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Collection.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Similarity.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Computation.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Lite.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Primer.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/FeaturePair.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/CollectionI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/SimilarityPair.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Generic.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Amplicon.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/FeatureNamer.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/IDHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/TypeMapper.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/Unflattener.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Promoter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Exon.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Transcript.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Poly_A_site.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/GeneStructure.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/TranscriptI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/UTR.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/NC_Feature.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/ExonI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/GeneStructureI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Intron.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/cluster.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/phyloxml.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/nhx.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/NewickParser.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/tabtree.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/nexus.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/TreeEventBuilder.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/lintree.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/pag.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/TreeIO/newick.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/OntologyTerm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/Tree.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/Collection.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/Reference.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/Target.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/DBLink.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/TypeManager.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/Relation.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/StructuredValue.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/SimpleValue.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/TagTree.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/Comment.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Annotation/AnnotationFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/AnalysisI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/ObjectFactoryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/SequenceStreamI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/SeqAnalysisParserFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/ObjectBuilderI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/FTLocationFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/LocationFactoryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/TreeFactoryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/ObjectFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/ApplicationFactoryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/DriverFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/SequenceFactoryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/SequenceProcessorI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Factory/SeqAnalysisParserFactoryI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/simplehierarchy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/InterProParser.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/obo.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/goflat.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/dagflat.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/soflat.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/Handlers/InterProHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/OntologyIO/Handlers/BaseSAXHandler.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Fgenesh.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/tRNAscanSE.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/GFF.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Primer3.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/CodonTable.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Glimmer.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Genewise.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/isPcr.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Tmhmm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/TandemRepeatsFinder.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Match.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Coil.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/EPCR.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/GuessSeqFormat.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/RandomDistFunctions.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Eponine.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/pICalculator.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/MZEF.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Blat.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Geneid.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Prints.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/ECnumber.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/ipcress.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Lucy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Sigcleave.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Seg.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Profile.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/QRNA.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/SeqWords.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/SeqStats.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/AmpliconSearch.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/ESTScan.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/FootPrinter.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/IUPAC.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/SeqPattern.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Pseudowise.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Genomewise.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Genscan.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Est2Genome.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/AnalysisResult.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Grail.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/RepeatMasker.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/PrositeScan.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/TargetP.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Signalp.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Promoterwise.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Genemark.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/OddCodes.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/GenericParameters.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/AnalysisFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/WrapperBase.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/ParametersI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/Analysis.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/WrapperBase/CommandExts.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Run/Phylo/PhyloBase.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Primer/Pair.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Primer/AssessorI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Primer/Feature.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Primer/Assessor/Base.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Sim4/Exon.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Sim4/Results.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Signalp/ExtendedSignalp.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Alignment/Trim.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Alignment/Consed.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Spidey/Exon.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Spidey/Results.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Analysis/SimpleAnalysisBase.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/EMBOSS/Palindrome.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Gerp.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Molphy.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Molphy/Result.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Phylip/ProtDist.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Prediction/Exon.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/Prediction/Gene.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Tools/SeqPattern/Backtranslate.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/RelationshipFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/OntologyI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/Path.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/RelationshipType.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/GOterm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/TermFactory.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/OntologyEngineI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/OBOEngine.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/OBOterm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/Ontology.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/OntologyStore.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/RelationshipI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/PathI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/InterProTerm.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/Relationship.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/DocumentRegistry.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/TermI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/SimpleOntologyEngine.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/Term.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/Exception.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/Root.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/Utilities.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/Test.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/RootI.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/TestObject.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/IO.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/Storable.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/Version.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/perl5/Bio/Root/HTTPget.pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_process_sgd.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_search2gff.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_seqcut.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_extract_feature_seq.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_seqconvert.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_fetch.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_search2table.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_split_seq.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_mrtrans.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_nrdb.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_seq_length.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_tree2pag.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_unflatten_seq.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_biogetseq.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_taxid4species.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_mask_by_search.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_search2tribe.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_bioflat_index.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_oligo_count.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_process_gadfly.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_search2alnblocks.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_index.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_find-blast-matches.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_sreformat.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_filter_search.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_translate_seq.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_dbsplit.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_seqret.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_seqpart.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_local_taxonomydb_query.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_fastam9_to_table.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_seqretsplit.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_aacomp.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_genbank2gff3.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_taxonomy2tree.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_nexus2nh.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_revtrans-motif.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_mutate.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_make_mrna_protein.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man1/bp_gccalc.1p Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::OBOEngine.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::QueryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Align::AlignI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::WABAResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::pag.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::FTHelper.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Fgenesh.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Glimmer.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::HTTPget.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::silva.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Geneid.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::FastaHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::GenericDatabase.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::pfam.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::embl.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::MultiFile.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::LargeSeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::TermI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::nexus.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::BlastTable.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::Root.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::SubSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::IO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::Collection.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::DatabaseI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::TextResultWriter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::seqxml.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::AmpliconSearch.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::FeaturePair.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::Reference.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::TranscriptI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::GFF::Util::Rearrange.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::InterProParser.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Promoterwise.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Computation.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::RepeatMasker.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AnnotationI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::RichSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::Relation.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::tabtree.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::newick.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::RandomDistFunctions.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Similarity.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::Pair.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::swiss.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::GbrowseGFF.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::Feature.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Est2Genome.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::ExonI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DescribableI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::INFERNALResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/BioPerl.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Genscan.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::cluster.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Promoter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::psiblast.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::gameHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::po.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::fastq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::TreeFunctionsI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::SeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::FTLocationFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Tiling::TilingI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Phylip::ProtDist.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::HitTableWriter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::IDHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Gerp.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Analysis::SimpleAnalysisBase.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AnalysisParserI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Pseudowise.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::SeqStats.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::axt.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::TagTree.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::flatfile.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Spidey::Exon.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::SearchWriterI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Tiling::MapTileUtils.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactoryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::FuzzyLocationI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::ApplicationFactoryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::DBFetch.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::InterProTerm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::PullResultI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::goflat.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Generic.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::ParametersI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::RootI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::SequenceFactoryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::PsmHeaderI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::Assessor::Base.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Blat.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::LocationI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::SiteMatrixI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::TargetP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::FileCache.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Signalp::ExtendedSignalp.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::ModelHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::locuslink.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::Tree.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::msout.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Species.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::FastHitEventBuilder.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqAnalysisParserI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::RelationshipType.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::swiss.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::CodonUsage::Table.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::GenericHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::PositionProxy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::StructuredValue.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::Comment.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::LocationFactoryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::DistanceFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Qual.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::exonerate.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::proda.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::HSPI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Taxon.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::LocatableSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::megablast.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Amplicon.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::Handlers::BaseSAXHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::TreeFactoryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::tRNAscanSE.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::MatrixI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::PullHSPI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::HandlerBaseI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::WABAHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::WrapperBase::CommandExts.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::PrimaryQual.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::AbstractSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::PullParserI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::GenericStatistics.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::IO::phylip.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::Node.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::OntologyI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Processor.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::Meta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::Atomic.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::TestObject.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Sim4::Results.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::qual.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::PullHitI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::msf.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::pICalculator.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::Utilities.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::tigrxml.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::emboss.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::NC_Feature.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructure.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Primer3.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::swissdriver.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::InstanceSiteI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::DBLink.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::PsiBlastHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::pir.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::selex.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BinarySearch.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::PSLHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Prints.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::EMBL.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::LargeLocatableSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::Quality.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::Compatible.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Genomewise.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::scf.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::EncodedSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::SwissPfam.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Poly_A_site.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Sim4::Exon.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Lucy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::EMBOSS::Palindrome.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::MZEF.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SimpleAlign.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::BlastPullHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Query::WebQuery.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::LocationI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::prodom.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::AssessorI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::QualI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::gbxml.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Transcript.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::ReferenceI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::BlastHSP.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::seqHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::Test.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::kegg.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::obo.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Prediction::Gene.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::tigr.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Molphy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::arp.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::SimulatedRead.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::NewickParser.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::SequenceProcessorI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Das::SegmentI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::StatisticsI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::GenBank.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::WidestCoordPolicy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Spidey::Results.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::SearchResultEventBuilder.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Align::StatisticsI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::IO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::embl.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::NodeI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::ESTScan.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::Statistics.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Alignment::Trim.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::tinyseq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DBLinkContainerI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::clustalw.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::BlastHit.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::ParameterBaseI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::PrimarySeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::gameSubs.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Tmhmm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::SeqFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::UpdateableSeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::meme.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::HitFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::RandomAccessI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::OntologyEngineI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::dagflat.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::Mlagan.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::SimpleGOEngine::GraphAdaptor.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::psi.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::psl.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::Analysis.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::PrimarySeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::blasttable.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::tinyseq::tinyseqHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Range.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::Target.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Collection.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::rnamotif.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::ObjectBuilderI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Coil.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::ResultI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::HSP::HSPFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Registry.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::waba.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Iteration::GenericIteration.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::Phylo::PhyloBase.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::OntologyStore.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::infernal.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Profile.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::ResultFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::bl2seq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::sim4.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::GOterm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::Split.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::metafasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Genemark.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::isPcr.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::table.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::AvWithinCoordPolicy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::LargeSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::masta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::TypedSeqFeatureI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::SearchUtils.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::PrositeScan.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Prediction::Exon.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::AnnotationAdaptor.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::tab.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::largefasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::DriverFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::SimilarityPair.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::RelationshipI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::CodonUsage::IO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Genewise.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::GuessSeqFormat.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::ipcress.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::gmap_f9.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::CrossMatchResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::PsiBlastHit.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::SeqWords.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Event::EventGeneratorI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::SiteMatrix.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::lintree.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::CoordinatePolicyI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::gcg.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::EPCR.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::Path.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::ECnumber.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::TypeMapper.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Align::Utilities.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::BlastResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Alignment::Consed.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::bsml_sax.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::game.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::asciitree.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::Psm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::RichSeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::cross_match.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::Exception.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::BlastStatistics.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AnnotatableI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::ProtMatrix.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::OBOterm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::AnalysisI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::BlastUtils.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::SequenceStreamI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::genbank.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::AnalysisFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::SeqFastaSpeedFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::UTR.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::metafasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::Ontology.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::gbdriver.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PhylipDist.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::FootPrinter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::HTMLResultWriter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::phyloxml.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AnalysisResultI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Align::DNAStatistics.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Sigcleave.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::Relationship.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::list.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Primer.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::PathI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::Meta::Array.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqUtils.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::FeatureNamer.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::RandomFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::AnnotationFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Seg.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Align::ProteinStatistics.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::DocumentRegistry.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::TraceI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::WebAgent.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::MetaI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::BlastPullHit.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::CollectionI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::largemultifasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::IndexedBase.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::nexus.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::GenericParameters.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::gameWriter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::Fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Match.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::IO::mlagan.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::erpin.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::ResultTableWriter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::PsmI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::NodeNHX.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Lite.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::meme.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Das::FeatureTypeI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SimpleAnalysisI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::Fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::ObjectFactoryI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::Blast.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Intron.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::SimpleValue.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::Fuzzy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::phd.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::Version.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::Handler::GenericAlignHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::IUPAC.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::IO::scoring.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::Unflattener.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeatureI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::UpdateableSeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::RelationshipFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::wise.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::TermFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::OddCodes.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::Term.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Iteration::IterationI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::mase.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::ProtPsm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::TandemRepeatsFinder.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::Handler::GenericRichSeqHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::blast.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::BaseSeqProcessor.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Exon.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Root::Storable.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::Qual.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Signalp.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::raw.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::featHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::fasta.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AnnotationCollectionI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::FeatureHolderI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::Tree.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::simplehierarchy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::TreeEventBuilder.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::BlastPullResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::Scoring.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DasI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::IdCollectionI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::mast.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::AnalysisResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::Fastq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::Generic.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::bsml.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Failover.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::phylip.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::InMemoryCache.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Molphy::Result.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::AnnotatableNode.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Result::GenericResult.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::NarrowestCoordPolicy.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::ModelHit.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::genbank.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AnalysisI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructureI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::GenericHit.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Hit::HitI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::InstanceSite.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::IteratedSearchResultEventBuilder.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::SplitLocationI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::SeqBuilder.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::CodonTable.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::HSPTableWriter.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::TypeManager.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Location::Simple.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Search::Tiling::MapTiling.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::mega.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::PrimedSeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::Abstract.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Run::WrapperBase.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tree::TreeI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::RangeI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::greengenes.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::EventHandlerI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Annotation::OntologyTerm.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::embldriver.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::GFF::Util::Binning.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Index::Swissprot.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::xmfa.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Event::EventHandlerI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::LargePrimarySeq.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::SeqPattern::Backtranslate.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::ace.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::PsmHeader.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::GFF.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::IdentifiableI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Seq::SequenceTrace.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::WebDBSeqI.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::soflat.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::QRNA.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::AlignIO::maf.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Factory::ObjectFactory.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::transfac.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::OntologyIO::Handlers::InterProHandler.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::DB::GenericWebAgent.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO::mbsout.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Grail.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::SeqPattern.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Align::PairwiseStatistics.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Tools::Eponine.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::Ontology::SimpleOntologyEngine.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SeqIO.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::SearchIO::blast_pull.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/share/man/man3/Bio::TreeIO::nhx.3pm Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_seqpart Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_search2gff Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_genbank2gff3 Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_tree2pag Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_seqretsplit Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_search2alnblocks Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_extract_feature_seq Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_mutate Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_nexus2nh Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_seqconvert Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_bioflat_index Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_aacomp Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_mask_by_search Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_taxid4species Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_biogetseq Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_taxonomy2tree Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_split_seq Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_local_taxonomydb_query Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_search2table Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_search2tribe Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_find-blast-matches Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_filter_search Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_index Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_dbsplit Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_gccalc Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_revtrans-motif Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_fastam9_to_table Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_oligo_count Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_process_sgd Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_fetch Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_seqcut Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_unflatten_seq Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_sreformat Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_seq_length Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_nrdb Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_mrtrans Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_make_mrna_protein Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_process_gadfly Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_seqret Installing /build/bioperl-QLxev6/bioperl-1.7.8/debian/tmp/usr/bin/bp_translate_seq make[1]: Leaving directory '/build/bioperl-QLxev6/bioperl-1.7.8' dh_install dh_installdocs dh_installchangelogs debian/rules override_dh_installexamples make[1]: Entering directory '/build/bioperl-QLxev6/bioperl-1.7.8' dh_installexamples examples/* for pl in `grep -Rl '#![[:space:]]*/usr/bin/env[[:space:]]\+perl' debian/*/usr/*` ; do \ sed -i '1s?^#![[:space:]]*/usr/bin/env[[:space:]]\+perl?#!/usr/bin/perl?' ${pl} ; \ done for pl in `grep -Rl '#![[:space:]]*/usr/local/bin/perl' debian/*/usr/*` ; do \ sed -i '1s?^#![[:space:]]*/usr/local/bin/[[:space:]]*perl?#!/usr/bin/perl?' ${pl} ; \ done make[1]: Leaving directory '/build/bioperl-QLxev6/bioperl-1.7.8' dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'bioperl' in '../bioperl_1.7.8-4_all.deb'. dpkg-deb: building package 'libbio-perl-perl' in '../libbio-perl-perl_1.7.8-4_all.deb'. dpkg-genbuildinfo -O../bioperl_1.7.8-4_amd64.buildinfo dpkg-genchanges -O../bioperl_1.7.8-4_amd64.changes dpkg-genchanges: info: not including original source code in upload dpkg-source -Zxz --after-build . dpkg-buildpackage: info: binary and diff upload (original source NOT included) -------------------------------------------------------------------------------- Build finished at 2026-07-11T16:12:41Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Changes Sat, 11 Jul 2026 16:12:42 +0000 | +------------------------------------------------------------------------------+ bioperl_1.7.8-4_amd64.changes: ------------------------------ Format: 1.8 Date: Sun, 21 Jun 2026 22:49:02 +0200 Source: bioperl Binary: bioperl libbio-perl-perl Architecture: source all Version: 1.7.8-4 Distribution: perl-5.44-throwaway Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Étienne Mollier Description: bioperl - Perl tools for computational molecular biology libbio-perl-perl - BioPerl core perl modules Closes: 1136915 Changes: bioperl (1.7.8-4) unstable; urgency=medium . [ Michael R. Crusoe ] * d/control: include libbio-alignio-stockholm-perl which was split off. . [ Andreas Tille ] * d/watch: version=5 * cme fix dpkg-control . [ Étienne Mollier ] * fix-missing-Test-modules.patch: new: fix multiple test failures. (Closes: #1136915) * d/control: add myself to uploaders. Checksums-Sha1: 359bba6e7e576f1cdd2099b3859b0047f0f0c28f 2367 bioperl_1.7.8-4.dsc b0fb79e3145cb9774b77731f626488b56e2675c2 13508 bioperl_1.7.8-4.debian.tar.xz 42448ec19f841a0340138e3b1305ad59173f719d 232456 bioperl_1.7.8-4_all.deb d2c171bbb49a88f647f4dfc17f0f4f694ed4d99d 14474 bioperl_1.7.8-4_amd64.buildinfo aff0351478556950baa6cef8fe05081ce4c64e8d 2509072 libbio-perl-perl_1.7.8-4_all.deb Checksums-Sha256: 7584adb526f1becc6997d1fb9bd03b95dc777b23001a4a827bac894340f028a2 2367 bioperl_1.7.8-4.dsc c15fd2200ae005ea28c7846982b1dbd8821678d632beee605b88747142742aea 13508 bioperl_1.7.8-4.debian.tar.xz 946e2676df9d057768b32c30eab0ef55be939c38505e7895d9091fa4929583d8 232456 bioperl_1.7.8-4_all.deb 0de25dd7a0a5fd1a9eb94a7356037cb422dd941e3f72c35d3a97f1217fc9801f 14474 bioperl_1.7.8-4_amd64.buildinfo 58144d02320a3bf7146bb267b43db515df1f4455a70cbe31050f0553eb666657 2509072 libbio-perl-perl_1.7.8-4_all.deb Files: 5cf3253a5d440a7b90fa0c1bf92d052e 2367 science optional bioperl_1.7.8-4.dsc ce53c03f1911d8fe722adb5b98d21d91 13508 science optional bioperl_1.7.8-4.debian.tar.xz 0d02c738f8d7ba65a3dc791efd57f6c3 232456 science optional bioperl_1.7.8-4_all.deb a9c932d39c0bc20852e525bb808eed5e 14474 science optional bioperl_1.7.8-4_amd64.buildinfo 447908a94fc141a3380463b2dfb6277c 2509072 perl optional libbio-perl-perl_1.7.8-4_all.deb +------------------------------------------------------------------------------+ | Buildinfo Sat, 11 Jul 2026 16:12:42 +0000 | +------------------------------------------------------------------------------+ Format: 1.0 Source: bioperl Binary: bioperl libbio-perl-perl Architecture: all source Version: 1.7.8-4 Checksums-Md5: 5cf3253a5d440a7b90fa0c1bf92d052e 2367 bioperl_1.7.8-4.dsc 0d02c738f8d7ba65a3dc791efd57f6c3 232456 bioperl_1.7.8-4_all.deb 447908a94fc141a3380463b2dfb6277c 2509072 libbio-perl-perl_1.7.8-4_all.deb Checksums-Sha1: 359bba6e7e576f1cdd2099b3859b0047f0f0c28f 2367 bioperl_1.7.8-4.dsc 42448ec19f841a0340138e3b1305ad59173f719d 232456 bioperl_1.7.8-4_all.deb aff0351478556950baa6cef8fe05081ce4c64e8d 2509072 libbio-perl-perl_1.7.8-4_all.deb Checksums-Sha256: 7584adb526f1becc6997d1fb9bd03b95dc777b23001a4a827bac894340f028a2 2367 bioperl_1.7.8-4.dsc 946e2676df9d057768b32c30eab0ef55be939c38505e7895d9091fa4929583d8 232456 bioperl_1.7.8-4_all.deb 58144d02320a3bf7146bb267b43db515df1f4455a70cbe31050f0553eb666657 2509072 libbio-perl-perl_1.7.8-4_all.deb Build-Origin: Debian Build-Architecture: amd64 Build-Date: Sat, 11 Jul 2026 16:12:41 +0000 Build-Path: /build/bioperl-QLxev6/bioperl-1.7.8 Build-Tainted-By: usr-local-has-programs Installed-Build-Depends: autoconf (= 2.73-2), automake (= 1:1.18.1-4), autopoint (= 1.0-3), autotools-dev (= 20240727.1+nmu1), base-files (= 14.2), base-passwd (= 3.6.8), bash (= 5.3-3), binutils (= 2.46.50.20260617-1), binutils-common (= 2.46.50.20260617-1), binutils-x86-64-linux-gnu (= 2.46.50.20260617-1), bsdextrautils (= 2.42.2-1), build-essential (= 12.12), bzip2 (= 1.0.8-6+b2), ca-certificates (= 20260601), coreutils (= 9.10-1), cpp (= 4:15.2.0-5+b1), cpp-15 (= 15.3.0-1), cpp-15-x86-64-linux-gnu (= 15.3.0-1), cpp-x86-64-linux-gnu (= 4:15.2.0-5+b1), dash (= 0.5.12-12), debconf (= 1.5.92), debhelper (= 14.3), debianutils (= 5.23.2), dh-autoreconf (= 22), dh-strip-nondeterminism (= 1.15.1-1), diffutils (= 1:3.12-1), dpkg (= 1.23.7), dpkg-dev (= 1.23.7), dwz (= 0.16-4), file (= 1:5.47-4), findutils (= 4.10.0-4), fontconfig (= 2.17.1-5), fontconfig-config (= 2.17.1-5), fonts-dejavu-core (= 2.37-9), fonts-dejavu-mono (= 2.37-9), g++ (= 4:15.2.0-5+b1), g++-15 (= 15.3.0-1), g++-15-x86-64-linux-gnu (= 15.3.0-1), g++-x86-64-linux-gnu (= 4:15.2.0-5+b1), gcc (= 4:15.2.0-5+b1), gcc-15 (= 15.3.0-1), gcc-15-base (= 15.3.0-1), gcc-15-x86-64-linux-gnu (= 15.3.0-1), gcc-16-base (= 16.1.0-2), gcc-x86-64-linux-gnu (= 4:15.2.0-5+b1), gettext (= 1.0-3), gettext-base (= 1.0-3), graphviz (= 14.1.2-1+b3), graphviz-tools (= 14.1.2-1+b3), grep (= 3.12-1), groff-base (= 1.24.1-1), gzip (= 1.13-1), hostname (= 3.25), init-system-helpers (= 1.69), intltool-debian (= 0.35.0+20060710.6), libabsl20260107 (= 20260107.0-5), libace-perl (= 1.92-14+b1), libacl1 (= 2.4.0-1), libalgorithm-diff-perl (= 1.201-1), libalgorithm-munkres-perl (= 0.08-5), libann0 (= 1.1.2+doc-9+b1), libaom3 (= 3.13.1-2+b1), libarchive-zip-perl (= 1.68-1), libarray-compare-perl (= 3.0.8-1), libasan8 (= 16.1.0-2), libatomic1 (= 16.1.0-2), libattr1 (= 1:2.6.0-1), libaudit-common (= 1:4.1.2-1), libaudit1 (= 1:4.1.2-1+b1), libavif16 (= 1.4.2-1), libb-hooks-op-check-perl (= 0.22-3+b5), libb2-1 (= 0.98.1-1.1+b3), libbinutils (= 2.46.50.20260617-1), libbio-alignio-stockholm-perl (= 1.7.3-2), libbio-asn1-entrezgene-perl (= 1.730-3), libbio-cluster-perl (= 1.7.3-6), libbio-perl-perl (= 1.7.8-4), libbio-samtools-perl (= 1.43-5+b2), libbio-variation-perl (= 1.7.5-3), libblkid1 (= 2.42.2-1), libbrotli1 (= 1.2.0-3), libbsd0 (= 0.12.2-3), libbz2-1.0 (= 1.0.8-6+b2), libc-bin (= 2.42-17), libc-dev-bin (= 2.42-17), libc-gconv-modules-extra (= 2.42-17), libc6 (= 2.42-17), libc6-dev (= 2.42-17), libcache-cache-perl (= 1.08-3), libcairo2 (= 1.18.4-3+b1), libcap-ng0 (= 0.9.3-1+b1), libcapture-tiny-perl (= 0.50-1), libcc1-0 (= 16.1.0-2), libcdt6 (= 14.1.2-1+b3), libcgi-pm-perl (= 4.72-1), libcgraph8 (= 14.1.2-1+b3), libclass-data-inheritable-perl (= 0.10-1), libclass-inspector-perl (= 1.36-3), libclass-method-modifiers-perl (= 2.15-1), libclass-unload-perl (= 0.12-1), libclass-xsaccessor-perl (= 1.19-4+b6), libclone-perl (= 0.50-1+b1), libcom-err2 (= 1.47.4-1), libconvert-binary-c-perl (= 0.86-1+b1), libconvert-binhex-perl (= 1.125-3), libcrypt-rc4-perl (= 2.02-5), libcrypt1 (= 1:4.5.1-1+b1), libctf-nobfd0 (= 2.46.50.20260617-1), libctf0 (= 2.46.50.20260617-1), libdata-stag-perl (= 0.14-4), libdatrie1 (= 0.2.14-2), libdav1d7 (= 1.5.3-1+b2), libdb5.3t64 (= 5.3.28+dfsg2-11+b1), libdbd-mysql-perl (= 4.055-1+b1), libdbd-pg-perl (= 3.20.2-1+b1), libdbd-sqlite3-perl (= 1.78-1+b2), libdbi-perl (= 1.650-1+b1), libdbus-1-3 (= 1.16.2-5+b1), libde265-0 (= 1.1.1-1), libdebconfclient0 (= 0.283), libdebhelper-perl (= 14.3), libdeflate0 (= 1.25-1), libdevel-callchecker-perl (= 0.009-3+b1), libdevel-cycle-perl (= 1.12-2), libdevel-stacktrace-perl (= 2.0500-1), libdigest-perl-md5-perl (= 1.91-1), libdouble-conversion3 (= 3.4.0-1+b1), libdpkg-perl (= 1.23.7), libdrm-amdgpu1 (= 2.4.134-3), libdrm-common (= 2.4.134-3), libdrm-intel1 (= 2.4.134-3), libdrm2 (= 2.4.134-3), libdynaloader-functions-perl (= 0.004-2), libedit2 (= 3.1-20260512-1), libegl-mesa0 (= 26.1.4-1), libegl1 (= 1.7.0-3+b1), libelf1t64 (= 0.195-1), libencode-locale-perl (= 1.05-3), liberror-perl (= 0.17030-1), libevdev2 (= 1.13.6+dfsg-3), libexception-class-perl (= 1.45-1), libexpat1 (= 2.8.2-1), libexporter-tiny-perl (= 1.006003-1), libfcgi-perl (= 0.82+ds-3+b3), libfcgi0t64 (= 2.4.5-0.1+b2), libffi8 (= 3.5.2-4), libfile-listing-perl (= 6.16-1), libfile-slurper-perl (= 0.014-1), libfile-stripnondeterminism-perl (= 1.15.1-1), libfontconfig1 (= 2.17.1-5), libfreetype6 (= 2.14.3+dfsg-1), libfribidi0 (= 1.0.16-5+b1), libgav1-2 (= 0.20.0-2+b1), libgbm1 (= 26.1.4-1), libgcc-15-dev (= 15.3.0-1), libgcc-s1 (= 16.1.0-2), libgd3 (= 2.3.3-13+b2), libgdbm-compat4t64 (= 1.26-1+b2), libgdbm6t64 (= 1.26-1+b2), libgl1-mesa-dri (= 26.1.4-1), libglib2.0-0t64 (= 2.88.2-1), libglvnd0 (= 1.7.0-3+b1), libglx-mesa0 (= 26.1.4-1), libglx0 (= 1.7.0-3+b1), libgmp10 (= 2:6.3.0+dfsg-5+b2), libgomp1 (= 16.1.0-2), libgprofng0 (= 2.46.50.20260617-1), libgraph-perl (= 1:0.9735-1), libgraphite2-3 (= 1.3.15-2), libgraphviz-perl (= 2.26-1), libgssapi-krb5-2 (= 1.22.1-3), libgts-0.7-5t64 (= 0.7.6+darcs121130-5.2+b2), libgudev-1.0-0 (= 238-7+b2), libgvc7 (= 14.1.2-1+b3), libgvplugin-gd8 (= 14.1.2-1+b3), libgvplugin-neato-layout8 (= 14.1.2-1+b3), libgvplugin-pango8 (= 14.1.2-1+b3), libgvpr2 (= 14.1.2-1+b3), libharfbuzz0b (= 12.3.2-2+b2), libheap-perl (= 0.80-5), libheif-plugin-dav1d (= 1.23.1-1), libheif-plugin-libde265 (= 1.23.1-1), libheif1 (= 1.23.1-1), libhtml-parser-perl (= 3.83-2+b1), libhtml-tableextract-perl (= 2.15-2), libhtml-tagset-perl (= 3.24-1), libhtml-tree-perl (= 5.07-3), libhttp-cookies-perl (= 6.11-1), libhttp-daemon-perl (= 6.17-1), libhttp-date-perl (= 6.08-1), libhttp-message-perl (= 7.02-1), libhttp-negotiate-perl (= 6.01-2), libhwasan0 (= 16.1.0-2), libice6 (= 2:1.1.1-1+b2), libicu78 (= 78.3-2), libimagequant0 (= 4.4.1-1+b2), libimport-into-perl (= 1.002005-2), libinput-bin (= 1.31.3-1), libinput10 (= 1.31.3-1), libio-html-perl (= 1.004-3), libio-pty-perl (= 1:1.31-1+b1), libio-sessiondata-perl (= 1.03-3), libio-socket-ssl-perl (= 2.099-1), libio-string-perl (= 1.08-4), libio-stringy-perl (= 2.113-2), libipc-run-perl (= 20260402.0-1), libipc-sharelite-perl (= 0.17-5+b4), libisl23 (= 0.27-2), libitm1 (= 16.1.0-2), libjansson4 (= 2.15.1-1), libjbig0 (= 2.1-6.1+b3), libjcode-pm-perl (= 2.07-1), libjpeg62-turbo (= 1:3.1.3-4), libk5crypto3 (= 1.22.1-3), libkeyutils1 (= 1.6.3-6+b2), libkrb5-3 (= 1.22.1-3), libkrb5support0 (= 1.22.1-3), libldap2 (= 2.6.13+dfsg-1+b1), liblerc4 (= 4.1.1+ds-1), liblist-moreutils-perl (= 0.430-2), liblist-moreutils-xs-perl (= 0.430-4+b3), libllvm21 (= 1:21.1.8-7+b4), liblsan0 (= 16.1.0-2), libltdl7 (= 2.5.4-11), liblwp-mediatypes-perl (= 6.04-2), liblwp-protocol-https-perl (= 6.15-1), liblzma5 (= 5.8.3-1), libmagic-mgc (= 1:5.47-4), libmagic1t64 (= 1:5.47-4), libmailtools-perl (= 2.22-1), libmariadb3 (= 1:11.8.8-1), libmath-derivative-perl (= 1.01-3), libmath-spline-perl (= 0.02-4), libmd0 (= 1.2.0-2), libmd4c0 (= 0.5.3-1), libmime-tools-perl (= 5.517-1), libmodule-build-perl (= 0.423400-3), libmodule-runtime-perl (= 0.018-1), libmoo-perl (= 2.005005-1), libmount1 (= 2.42.2-1), libmpc3 (= 1.3.1-3), libmpfr6 (= 4.2.2-3), libmtdev1t64 (= 1.1.7-1+b2), libncursesw6 (= 6.6+20260608-2), libnet-http-perl (= 6.24-1), libnet-smtp-ssl-perl (= 1.04-2), libnet-ssleay-perl (= 1.96-1+b1), libole-storage-lite-perl (= 0.24-1), libopengl0 (= 1.7.0-3+b1), libpadwalker-perl (= 2.5-1+b7), libpam-modules (= 1.7.0-8), libpam-modules-bin (= 1.7.0-8), libpam-runtime (= 1.7.0-8), libpam0g (= 1.7.0-8), libpango-1.0-0 (= 1.58.0-1), libpangocairo-1.0-0 (= 1.58.0-1), libpangoft2-1.0-0 (= 1.58.0-1), libparams-classify-perl (= 0.015-2+b6), libparse-recdescent-perl (= 1.967015+dfsg-4), libpath-class-perl (= 0.37-4), libpathplan4 (= 14.1.2-1+b3), libpciaccess0 (= 0.19-2), libpcre2-16-0 (= 10.46-1+b2), libpcre2-8-0 (= 10.46-1+b2), libperl5.44 (= 5.44.0~rc2-1), libperlio-eol-perl (= 0.19-1+b4), libpipeline1 (= 1.5.8-3), libpixman-1-0 (= 0.46.4-1+b2), libpng16-16t64 (= 1.6.58-1), libpostscript-perl (= 0.06-3.1), libpq5 (= 18.4-1+b2), libproc2-1 (= 2:4.0.6-2), libqt6core6t64 (= 6.10.2+dfsg-15), libqt6dbus6 (= 6.10.2+dfsg-15), libqt6gui6 (= 6.10.2+dfsg-15), libqt6widgets6 (= 6.10.2+dfsg-15), libquadmath0 (= 16.1.0-2), librav1e0.8 (= 0.8.1-10), librole-tiny-perl (= 2.002005-1), libsasl2-2 (= 2.1.28+dfsg1-11), libsasl2-modules-db (= 2.1.28+dfsg1-11), libseccomp2 (= 2.6.1-1), libselinux1 (= 3.11-2), libsensors-config (= 1:3.6.2-2), libsensors5 (= 1:3.6.2-2+b2), libset-object-perl (= 1.43-1+b1), libset-scalar-perl (= 1.29-3), libsframe3 (= 2.46.50.20260617-1), libsharpyuv0 (= 1.5.0-0.1+b2), libsm6 (= 2:1.2.6-1+b2), libsmartcols1 (= 2.42.2-1), libsoap-lite-perl (= 1.27-3), libsort-naturally-perl (= 1.03-4), libspreadsheet-parseexcel-perl (= 0.6600-1), libspreadsheet-writeexcel-perl (= 2.40-4), libsqlite3-0 (= 3.53.3-1), libssl3t64 (= 3.6.3-1), libstatistics-descriptive-perl (= 3.0801-1), libstdc++-15-dev (= 15.3.0-1), libstdc++6 (= 16.1.0-2), libsub-quote-perl (= 2.006009-1), libsub-uplevel-perl (= 0.2800-3), libsvg-graph-perl (= 0.02-4), libsvg-perl (= 2.89-1), libsvtav1enc4 (= 4.1.0+dfsg-1), libsystemd0 (= 261.1-2), libtask-weaken-perl (= 1.06-2), libtest-deep-perl (= 1.205-1), libtest-differences-perl (= 0.72-1), libtest-exception-perl (= 0.43-3), libtest-memory-cycle-perl (= 1.06-2), libtest-most-perl (= 0.42-1), libtest-pod-perl (= 1.52-3), libtest-requiresinternet-perl (= 0.05-4), libtest-warn-perl (= 0.37-2), libtest-weaken-perl (= 3.022000-2), libtext-charwidth-perl (= 0.04-12+b1), libtext-diff-perl (= 1.45-2), libtext-wrapi18n-perl (= 0.06-11), libthai-data (= 0.1.30-2), libthai0 (= 0.1.30-2), libtiff6 (= 4.7.2-1), libtimedate-perl (= 2.3500-1), libtinfo6 (= 6.6+20260608-2), libtool (= 2.5.4-11), libtree-dagnode-perl (= 1.37-1), libtry-tiny-perl (= 0.32-1), libts0t64 (= 1.22-1.1+b2), libtsan2 (= 16.1.0-2), libtype-tiny-perl (= 2.010001-1), libubsan1 (= 16.1.0-2), libuchardet0 (= 0.0.8-2+b2), libudev1 (= 261.1-2), libunicode-map-perl (= 0.112-13+b6), libunistring5 (= 1.4.2-1), liburi-perl (= 5.35-1), libuuid1 (= 2.42.2-1), libvulkan1 (= 1.4.341.0-1), libwacom-common (= 2.18.0-1), libwacom9 (= 2.18.0-1), libwayland-client0 (= 1.25.0-2), libwebp7 (= 1.5.0-0.1+b2), libwww-perl (= 6.83-1), libwww-robotrules-perl (= 6.03-1), libx11-6 (= 2:1.8.13-1), libx11-data (= 2:1.8.13-1), libx11-xcb1 (= 2:1.8.13-1), libxau6 (= 1:1.0.11-1+b2), libxcb-cursor0 (= 0.1.6-1), libxcb-dri3-0 (= 1.17.0-2+b2), libxcb-glx0 (= 1.17.0-2+b2), libxcb-icccm4 (= 0.4.2-1+b2), libxcb-image0 (= 0.4.0-2+b3), libxcb-keysyms1 (= 0.4.1-1+b2), libxcb-present0 (= 1.17.0-2+b2), libxcb-randr0 (= 1.17.0-2+b2), libxcb-render-util0 (= 0.3.10-1+b2), libxcb-render0 (= 1.17.0-2+b2), libxcb-shape0 (= 1.17.0-2+b2), libxcb-shm0 (= 1.17.0-2+b2), libxcb-sync1 (= 1.17.0-2+b2), libxcb-util1 (= 0.4.1-1+b2), libxcb-xfixes0 (= 1.17.0-2+b2), libxcb-xinput0 (= 1.17.0-2+b2), libxcb-xkb1 (= 1.17.0-2+b2), libxcb1 (= 1.17.0-2+b2), libxdmcp6 (= 1:1.1.5-2+b1), libxdot4 (= 14.1.2-1+b3), libxext6 (= 2:1.3.4-1+b4), libxkbcommon-x11-0 (= 1.13.1-1), libxkbcommon0 (= 1.13.1-1), libxml-dom-perl (= 1.46-2), libxml-dom-xpath-perl (= 0.14-4), libxml-filter-buffertext-perl (= 1.01-7), libxml-libxml-perl (= 2.0207+dfsg+really+2.0134-8+b1), libxml-namespacesupport-perl (= 1.12-2), libxml-parser-perl (= 2.47-2+b1), libxml-perl (= 0.08-4), libxml-regexp-perl (= 0.04-2), libxml-sax-base-perl (= 1.09-3), libxml-sax-expatxs-perl (= 1.33-3+b5), libxml-sax-perl (= 1.02+dfsg-5), libxml-sax-writer-perl (= 0.57-3), libxml-simple-perl (= 2.25-2), libxml-twig-perl (= 1:3.54-1), libxml-writer-perl (= 0.900-2), libxml-xpath-perl (= 1.49-1), libxml-xpathengine-perl (= 0.14-2), libxml2-16 (= 2.15.3+dfsg-1), libxpm4 (= 1:3.5.19-1), libxrender1 (= 1:0.9.12-1+b2), libxshmfence1 (= 1.3.3-1+b2), libxxf86vm1 (= 1:1.1.4-2+b1), libyaml-perl (= 1.31-1), libyuv0 (= 0.0.1949.20260706-1), libz3-4 (= 4.13.3-1.1), libzstd1 (= 1.5.7+dfsg-3+b2), linux-libc-dev (= 7.1.3-1), m4 (= 1.4.21-1), make (= 4.4.1-3), man-db (= 2.13.1-1), mariadb-common (= 1:11.8.8-1), mawk (= 1.3.4.20260302-1), mesa-libgallium (= 26.1.4-1), mysql-common (= 5.8+1.1.1), ncurses-base (= 6.6+20260608-2), ncurses-bin (= 6.6+20260608-2), netbase (= 6.5), openssl (= 3.6.3-1), openssl-provider-legacy (= 3.6.3-1), patch (= 2.8-2), pci.ids (= 0.0~2026.07.06-1), perl (= 5.44.0~rc2-1), perl-base (= 5.44.0~rc2-1), perl-modules-5.44 (= 5.44.0~rc2-1), perl-openssl-defaults (= 7+b2), po-debconf (= 1.0.22), procps (= 2:4.0.6-2), rename (= 2.02-2), rpcsvc-proto (= 1.4.4-1), sed (= 4.9-3), sensible-utils (= 0.0.26), shared-mime-info (= 2.4-5+b3), sysvinit-utils (= 3.18-1), tar (= 1.35+dfsg-4), ucf (= 3.0056), util-linux (= 2.42.2-1), x11-common (= 1:7.7+26), xkb-data (= 2.47-1), xz-utils (= 5.8.3-1), zlib1g (= 1:1.3.dfsg+really1.3.2-3) Environment: DEB_BUILD_OPTIONS="parallel=2" LANG="C.UTF-8" LANGUAGE="en_GB:en" LC_COLLATE="C.UTF-8" LC_CTYPE="C.UTF-8" LD_LIBRARY_PATH="/usr/lib/libeatmydata" LD_PRELOAD="libeatmydata.so" SOURCE_DATE_EPOCH="1782074942" +------------------------------------------------------------------------------+ | Package contents Sat, 11 Jul 2026 16:12:42 +0000 | +------------------------------------------------------------------------------+ bioperl_1.7.8-4_all.deb ----------------------- new Debian package, version 2.0. size 232456 bytes: control archive=4476 bytes. 1166 bytes, 23 lines control 9628 bytes, 132 lines md5sums Package: bioperl Version: 1.7.8-4 Architecture: all Maintainer: Debian Med Packaging Team Installed-Size: 676 Depends: libbio-perl-perl (= 1.7.8-4), perl:any, libtest-most-perl Recommends: bioperl-run, perl-doc, libhttp-message-perl, libwww-perl, libcache-cache-perl, libbio-perl-run-perl, libdbi-perl, libapache-dbi-perl, liburi-perl, libxml-simple-perl, libyaml-perl, libace-perl, liblist-moreutils-perl, libxml-twig-perl, libset-scalar-perl Suggests: groff-base Section: science Priority: optional Homepage: http://www.bioperl.org/ Description: Perl tools for computational molecular biology The Bioperl project is a coordinated effort to collect computational methods routinely used in bioinformatics into a set of standard CPAN-style, well-documented, and freely available Perl modules. It is well-accepted throughout the community and used in many high-profile projects, e.g., Ensembl. . The recommended packages are needed to run some of the included binaries, for a detailed explanation including the specific Perl modules please see README.Debian. . The suggested package enhances the manual pages. drwxr-xr-x root/root 0 2026-06-21 20:49 ./ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/bin/ -rwxr-xr-x root/root 2764 2026-06-21 20:49 ./usr/bin/bp_aacomp -rwxr-xr-x root/root 3599 2026-06-21 20:49 ./usr/bin/bp_bioflat_index -rwxr-xr-x root/root 1508 2026-06-21 20:49 ./usr/bin/bp_biogetseq -rwxr-xr-x root/root 2706 2026-06-21 20:49 ./usr/bin/bp_dbsplit -rwxr-xr-x root/root 2769 2026-06-21 20:49 ./usr/bin/bp_extract_feature_seq -rwxr-xr-x root/root 3905 2026-06-21 20:49 ./usr/bin/bp_fastam9_to_table -rwxr-xr-x root/root 7288 2026-06-21 20:49 ./usr/bin/bp_fetch -rwxr-xr-x root/root 1712 2026-06-21 20:49 ./usr/bin/bp_filter_search -rwxr-xr-x root/root 15000 2026-06-21 20:49 ./usr/bin/bp_find-blast-matches -rwxr-xr-x root/root 3330 2026-06-21 20:49 ./usr/bin/bp_gccalc -rwxr-xr-x root/root 79645 2026-06-21 20:49 ./usr/bin/bp_genbank2gff3 -rwxr-xr-x root/root 4520 2026-06-21 20:49 ./usr/bin/bp_index -rwxr-xr-x root/root 1780 2026-06-21 20:49 ./usr/bin/bp_local_taxonomydb_query -rwxr-xr-x root/root 3142 2026-06-21 20:49 ./usr/bin/bp_make_mrna_protein -rwxr-xr-x root/root 4801 2026-06-21 20:49 ./usr/bin/bp_mask_by_search -rwxr-xr-x root/root 2944 2026-06-21 20:49 ./usr/bin/bp_mrtrans -rwxr-xr-x root/root 4195 2026-06-21 20:49 ./usr/bin/bp_mutate -rwxr-xr-x root/root 830 2026-06-21 20:49 ./usr/bin/bp_nexus2nh -rwxr-xr-x root/root 3436 2026-06-21 20:49 ./usr/bin/bp_nrdb -rwxr-xr-x root/root 6234 2026-06-21 20:49 ./usr/bin/bp_oligo_count -rwxr-xr-x root/root 7220 2026-06-21 20:49 ./usr/bin/bp_process_gadfly -rwxr-xr-x root/root 3655 2026-06-21 20:49 ./usr/bin/bp_process_sgd -rwxr-xr-x root/root 24319 2026-06-21 20:49 ./usr/bin/bp_revtrans-motif -rwxr-xr-x root/root 4093 2026-06-21 20:49 ./usr/bin/bp_search2alnblocks -rwxr-xr-x root/root 12422 2026-06-21 20:49 ./usr/bin/bp_search2gff -rwxr-xr-x root/root 2358 2026-06-21 20:49 ./usr/bin/bp_search2table -rwxr-xr-x root/root 2642 2026-06-21 20:49 ./usr/bin/bp_search2tribe -rwxr-xr-x root/root 1682 2026-06-21 20:49 ./usr/bin/bp_seq_length -rwxr-xr-x root/root 2192 2026-06-21 20:49 ./usr/bin/bp_seqconvert -rwxr-xr-x root/root 3736 2026-06-21 20:49 ./usr/bin/bp_seqcut -rwxr-xr-x root/root 4498 2026-06-21 20:49 ./usr/bin/bp_seqpart -rwxr-xr-x root/root 2242 2026-06-21 20:49 ./usr/bin/bp_seqret -rwxr-xr-x root/root 1452 2026-06-21 20:49 ./usr/bin/bp_seqretsplit -rwxr-xr-x root/root 4200 2026-06-21 20:49 ./usr/bin/bp_split_seq -rwxr-xr-x root/root 5815 2026-06-21 20:49 ./usr/bin/bp_sreformat -rwxr-xr-x root/root 3146 2026-06-21 20:49 ./usr/bin/bp_taxid4species -rwxr-xr-x root/root 2843 2026-06-21 20:49 ./usr/bin/bp_taxonomy2tree -rwxr-xr-x root/root 1527 2026-06-21 20:49 ./usr/bin/bp_translate_seq -rwxr-xr-x root/root 1391 2026-06-21 20:49 ./usr/bin/bp_tree2pag -rwxr-xr-x root/root 7407 2026-06-21 20:49 ./usr/bin/bp_unflatten_seq drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/ -rw-r--r-- root/root 2740 2021-02-03 05:04 ./usr/share/doc/bioperl/AUTHORS.gz -rw-r--r-- root/root 2625 2021-02-03 05:04 ./usr/share/doc/bioperl/README.md -rw-r--r-- root/root 877 2026-06-21 20:49 ./usr/share/doc/bioperl/changelog.Debian.gz -rw-r--r-- root/root 31723 2021-02-03 05:04 ./usr/share/doc/bioperl/changelog.gz -rw-r--r-- root/root 8717 2026-06-21 20:49 ./usr/share/doc/bioperl/copyright drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/ drwxr-xr-x root/root 0 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/Bio-DB-GFF/ -rw-r--r-- root/root 15280 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/Bio-DB-GFF/load_ucsc.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/align/ -rw-r--r-- root/root 6822 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/FastAlign.pl -rw-r--r-- root/root 4700 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/align_on_codons.pl -rw-r--r-- root/root 3489 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/aligntutorial.pl -rw-r--r-- root/root 13526 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/simplealign.pl -rw-r--r-- root/root 7810 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/classify_hits_kingdom drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/contributed/ -rw-r--r-- root/root 4650 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/contributed/nmrpdb_parse.pl -rw-r--r-- root/root 644 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/contributed/prosite2perl.pl -rw-r--r-- root/root 549 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/contributed/rebase2list.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/db/ -rw-r--r-- root/root 4838 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/est_tissue_query.pl -rw-r--r-- root/root 1675 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/get_seqs.pl -rw-r--r-- root/root 1290 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/rfetch.pl -rw-r--r-- root/root 314 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/use_registry.pl -rw-r--r-- root/root 2488 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/generate_random_seq.pl -rw-r--r-- root/root 4241 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/longorf.pl -rw-r--r-- root/root 5302 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/make_primers.pl drwxr-xr-x root/root 0 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/quality/ -rw-r--r-- root/root 1577 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/quality/svgtrace.pl -rw-r--r-- root/root 1163 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/rev_and_trans.pl -rw-r--r-- root/root 2294 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/revcom_dir.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/root/ -rw-r--r-- root/root 7779 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/README -rw-r--r-- root/root 4563 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions1.pl -rw-r--r-- root/root 4506 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions2.pl -rw-r--r-- root/root 1277 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions3.pl -rw-r--r-- root/root 3338 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions4.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/searchio/ -rw-r--r-- root/root 6846 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/blast_example.pl -rw-r--r-- root/root 3171 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/custom_writer.pl -rw-r--r-- root/root 4036 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/hitwriter.pl -rw-r--r-- root/root 3110 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/hspwriter.pl -rw-r--r-- root/root 1947 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/htmlwriter.pl -rw-r--r-- root/root 1628 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/psiblast_features.pl -rw-r--r-- root/root 2213 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/psiblast_iterations.pl -rw-r--r-- root/root 1939 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/rawwriter.pl -rw-r--r-- root/root 3802 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/resultwriter.pl -rw-r--r-- root/root 779 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/waba2gff.pl -rw-r--r-- root/root 4533 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/waba2gff3.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/tk/ -rw-r--r-- root/root 52860 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tk/gsequence.pl -rw-r--r-- root/root 3375 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tk/hitdisplay.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/tools/ -rw-r--r-- root/root 3437 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/extract_genes.pl -rw-r--r-- root/root 608 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/gb_to_gff.pl -rw-r--r-- root/root 5758 2026-06-21 20:49 ./usr/share/doc/bioperl/examples/tools/gff2ps.pl -rw-r--r-- root/root 1217 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/parse_codeml.pl -rw-r--r-- root/root 1377 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/reverse-translate.pl -rw-r--r-- root/root 2386 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/run_genscan.pl -rw-r--r-- root/root 2379 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/run_primer3.pl -rw-r--r-- root/root 3850 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/seq_pattern.pl -rw-r--r-- root/root 15008 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/standaloneblast.pl drwxr-xr-x root/root 0 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tree/ -rw-r--r-- root/root 526 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tree/paup2phylip.pl drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/man/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/man/man1/ -rw-r--r-- root/root 1554 2026-06-21 20:49 ./usr/share/man/man1/bp_aacomp.1p.gz -rw-r--r-- root/root 1488 2026-06-21 20:49 ./usr/share/man/man1/bp_bioflat_index.1p.gz -rw-r--r-- root/root 1150 2026-06-21 20:49 ./usr/share/man/man1/bp_biogetseq.1p.gz -rw-r--r-- root/root 1683 2026-06-21 20:49 ./usr/share/man/man1/bp_dbsplit.1p.gz -rw-r--r-- root/root 1621 2026-06-21 20:49 ./usr/share/man/man1/bp_extract_feature_seq.1p.gz -rw-r--r-- root/root 1450 2026-06-21 20:49 ./usr/share/man/man1/bp_fastam9_to_table.1p.gz -rw-r--r-- root/root 2518 2026-06-21 20:49 ./usr/share/man/man1/bp_fetch.1p.gz -rw-r--r-- root/root 1416 2026-06-21 20:49 ./usr/share/man/man1/bp_filter_search.1p.gz -rw-r--r-- root/root 2156 2026-06-21 20:49 ./usr/share/man/man1/bp_find-blast-matches.1p.gz -rw-r--r-- root/root 1583 2026-06-21 20:49 ./usr/share/man/man1/bp_gccalc.1p.gz -rw-r--r-- root/root 4340 2026-06-21 20:49 ./usr/share/man/man1/bp_genbank2gff3.1p.gz -rw-r--r-- root/root 2228 2026-06-21 20:49 ./usr/share/man/man1/bp_index.1p.gz -rw-r--r-- root/root 1264 2026-06-21 20:49 ./usr/share/man/man1/bp_local_taxonomydb_query.1p.gz -rw-r--r-- root/root 1339 2026-06-21 20:49 ./usr/share/man/man1/bp_make_mrna_protein.1p.gz -rw-r--r-- root/root 1909 2026-06-21 20:49 ./usr/share/man/man1/bp_mask_by_search.1p.gz -rw-r--r-- root/root 1297 2026-06-21 20:49 ./usr/share/man/man1/bp_mrtrans.1p.gz -rw-r--r-- root/root 1539 2026-06-21 20:49 ./usr/share/man/man1/bp_mutate.1p.gz -rw-r--r-- root/root 1055 2026-06-21 20:49 ./usr/share/man/man1/bp_nexus2nh.1p.gz -rw-r--r-- root/root 1316 2026-06-21 20:49 ./usr/share/man/man1/bp_nrdb.1p.gz -rw-r--r-- root/root 1722 2026-06-21 20:49 ./usr/share/man/man1/bp_oligo_count.1p.gz -rw-r--r-- root/root 2086 2026-06-21 20:49 ./usr/share/man/man1/bp_process_gadfly.1p.gz -rw-r--r-- root/root 1428 2026-06-21 20:49 ./usr/share/man/man1/bp_process_sgd.1p.gz -rw-r--r-- root/root 1923 2026-06-21 20:49 ./usr/share/man/man1/bp_revtrans-motif.1p.gz -rw-r--r-- root/root 1664 2026-06-21 20:49 ./usr/share/man/man1/bp_search2alnblocks.1p.gz -rw-r--r-- root/root 2321 2026-06-21 20:49 ./usr/share/man/man1/bp_search2gff.1p.gz -rw-r--r-- root/root 1378 2026-06-21 20:49 ./usr/share/man/man1/bp_search2table.1p.gz -rw-r--r-- root/root 1536 2026-06-21 20:49 ./usr/share/man/man1/bp_search2tribe.1p.gz -rw-r--r-- root/root 1489 2026-06-21 20:49 ./usr/share/man/man1/bp_seq_length.1p.gz -rw-r--r-- root/root 1459 2026-06-21 20:49 ./usr/share/man/man1/bp_seqconvert.1p.gz -rw-r--r-- root/root 1757 2026-06-21 20:49 ./usr/share/man/man1/bp_seqcut.1p.gz -rw-r--r-- root/root 1890 2026-06-21 20:49 ./usr/share/man/man1/bp_seqpart.1p.gz -rw-r--r-- root/root 1246 2026-06-21 20:49 ./usr/share/man/man1/bp_seqret.1p.gz -rw-r--r-- root/root 1524 2026-06-21 20:49 ./usr/share/man/man1/bp_seqretsplit.1p.gz -rw-r--r-- root/root 1612 2026-06-21 20:49 ./usr/share/man/man1/bp_split_seq.1p.gz -rw-r--r-- root/root 1494 2026-06-21 20:49 ./usr/share/man/man1/bp_sreformat.1p.gz -rw-r--r-- root/root 1445 2026-06-21 20:49 ./usr/share/man/man1/bp_taxid4species.1p.gz -rw-r--r-- root/root 1492 2026-06-21 20:49 ./usr/share/man/man1/bp_taxonomy2tree.1p.gz -rw-r--r-- root/root 1361 2026-06-21 20:49 ./usr/share/man/man1/bp_translate_seq.1p.gz -rw-r--r-- root/root 1138 2026-06-21 20:49 ./usr/share/man/man1/bp_tree2pag.1p.gz -rw-r--r-- root/root 2831 2026-06-21 20:49 ./usr/share/man/man1/bp_unflatten_seq.1p.gz libbio-perl-perl_1.7.8-4_all.deb -------------------------------- new Debian package, version 2.0. size 2509072 bytes: control archive=23508 bytes. 1440 bytes, 17 lines control 75475 bytes, 945 lines md5sums Package: libbio-perl-perl Source: bioperl Version: 1.7.8-4 Architecture: all Maintainer: Debian Med Packaging Team Installed-Size: 8300 Depends: libio-string-perl, libdata-stag-perl, perl:any Recommends: bioperl-run | libbio-perl-run-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-simple-perl, libxml-twig-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl Suggests: bioperl, libxml-sax-expatxs-perl, libbio-alignio-stockholm-perl Section: perl Priority: optional Homepage: http://www.bioperl.org/ Description: BioPerl core perl modules BioPerl is a toolkit of perl modules useful in building bioinformatics solutions in Perl. It is built in an object-oriented manner so that many modules depend on each other to achieve a task. The collection of modules in libbio-perl-perl consist of the core of the functionality of bioperl. drwxr-xr-x root/root 0 2026-06-21 20:49 ./ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/doc/libbio-perl-perl/ -rw-r--r-- root/root 882 2026-06-21 20:49 ./usr/share/doc/libbio-perl-perl/changelog.Debian.gz -rw-r--r-- root/root 31723 2021-02-03 05:04 ./usr/share/doc/libbio-perl-perl/changelog.gz -rw-r--r-- root/root 8717 2026-06-21 20:49 ./usr/share/doc/libbio-perl-perl/copyright drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/man/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/man/man3/ -rw-r--r-- root/root 5915 2026-06-21 20:49 ./usr/share/man/man3/Bio::Align::AlignI.3pm.gz -rw-r--r-- root/root 5571 2026-06-21 20:49 ./usr/share/man/man3/Bio::Align::DNAStatistics.3pm.gz -rw-r--r-- root/root 2135 2026-06-21 20:49 ./usr/share/man/man3/Bio::Align::PairwiseStatistics.3pm.gz -rw-r--r-- root/root 2329 2026-06-21 20:49 ./usr/share/man/man3/Bio::Align::ProteinStatistics.3pm.gz -rw-r--r-- root/root 1846 2026-06-21 20:49 ./usr/share/man/man3/Bio::Align::StatisticsI.3pm.gz -rw-r--r-- root/root 3401 2026-06-21 20:49 ./usr/share/man/man3/Bio::Align::Utilities.3pm.gz -rw-r--r-- root/root 5089 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO.3pm.gz -rw-r--r-- root/root 4275 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::Handler::GenericAlignHandler.3pm.gz -rw-r--r-- root/root 2387 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::arp.3pm.gz -rw-r--r-- root/root 2465 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::bl2seq.3pm.gz -rw-r--r-- root/root 2194 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::clustalw.3pm.gz -rw-r--r-- root/root 1926 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::emboss.3pm.gz -rw-r--r-- root/root 1920 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::fasta.3pm.gz -rw-r--r-- root/root 1906 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::largemultifasta.3pm.gz -rw-r--r-- root/root 1959 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::maf.3pm.gz -rw-r--r-- root/root 1647 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::mase.3pm.gz -rw-r--r-- root/root 2020 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::mega.3pm.gz -rw-r--r-- root/root 2063 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::meme.3pm.gz -rw-r--r-- root/root 2050 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::metafasta.3pm.gz -rw-r--r-- root/root 1768 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::msf.3pm.gz -rw-r--r-- root/root 2582 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::nexus.3pm.gz -rw-r--r-- root/root 1625 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::pfam.3pm.gz -rw-r--r-- root/root 3111 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::phylip.3pm.gz -rw-r--r-- root/root 1780 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::po.3pm.gz -rw-r--r-- root/root 2319 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::proda.3pm.gz -rw-r--r-- root/root 1651 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::prodom.3pm.gz -rw-r--r-- root/root 1828 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::psi.3pm.gz -rw-r--r-- root/root 1875 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::selex.3pm.gz -rw-r--r-- root/root 2025 2026-06-21 20:49 ./usr/share/man/man3/Bio::AlignIO::xmfa.3pm.gz -rw-r--r-- root/root 7256 2026-06-21 20:49 ./usr/share/man/man3/Bio::AnalysisI.3pm.gz -rw-r--r-- root/root 2828 2026-06-21 20:49 ./usr/share/man/man3/Bio::AnalysisParserI.3pm.gz -rw-r--r-- root/root 2878 2026-06-21 20:49 ./usr/share/man/man3/Bio::AnalysisResultI.3pm.gz -rw-r--r-- root/root 1985 2026-06-21 20:49 ./usr/share/man/man3/Bio::AnnotatableI.3pm.gz -rw-r--r-- root/root 2328 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::AnnotationFactory.3pm.gz -rw-r--r-- root/root 3925 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::Collection.3pm.gz -rw-r--r-- root/root 1995 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::Comment.3pm.gz -rw-r--r-- root/root 3285 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::DBLink.3pm.gz -rw-r--r-- root/root 3840 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::OntologyTerm.3pm.gz -rw-r--r-- root/root 3323 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::Reference.3pm.gz -rw-r--r-- root/root 2870 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::Relation.3pm.gz -rw-r--r-- root/root 2695 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::SimpleValue.3pm.gz -rw-r--r-- root/root 3174 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::StructuredValue.3pm.gz -rw-r--r-- root/root 4894 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::TagTree.3pm.gz -rw-r--r-- root/root 1971 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::Target.3pm.gz -rw-r--r-- root/root 2212 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::Tree.3pm.gz -rw-r--r-- root/root 1777 2026-06-21 20:49 ./usr/share/man/man3/Bio::Annotation::TypeManager.3pm.gz -rw-r--r-- root/root 3239 2026-06-21 20:49 ./usr/share/man/man3/Bio::AnnotationCollectionI.3pm.gz -rw-r--r-- root/root 2911 2026-06-21 20:49 ./usr/share/man/man3/Bio::AnnotationI.3pm.gz -rw-r--r-- root/root 1986 2026-06-21 20:49 ./usr/share/man/man3/Bio::CodonUsage::IO.3pm.gz -rw-r--r-- root/root 3527 2026-06-21 20:49 ./usr/share/man/man3/Bio::CodonUsage::Table.3pm.gz -rw-r--r-- root/root 2958 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::DBFetch.3pm.gz -rw-r--r-- root/root 1862 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Failover.3pm.gz -rw-r--r-- root/root 3298 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Fasta.3pm.gz -rw-r--r-- root/root 2501 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::FileCache.3pm.gz -rw-r--r-- root/root 2991 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat.3pm.gz -rw-r--r-- root/root 2118 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat::BDB.3pm.gz -rw-r--r-- root/root 1615 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat::BDB::embl.3pm.gz -rw-r--r-- root/root 1616 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat::BDB::fasta.3pm.gz -rw-r--r-- root/root 1615 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat::BDB::genbank.3pm.gz -rw-r--r-- root/root 1616 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat::BDB::swiss.3pm.gz -rw-r--r-- root/root 5065 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Flat::BinarySearch.3pm.gz -rw-r--r-- root/root 1596 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::GFF::Util::Binning.3pm.gz -rw-r--r-- root/root 1596 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::GFF::Util::Rearrange.3pm.gz -rw-r--r-- root/root 3151 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::GenericWebAgent.3pm.gz -rw-r--r-- root/root 1799 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::InMemoryCache.3pm.gz -rw-r--r-- root/root 6324 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::IndexedBase.3pm.gz -rw-r--r-- root/root 2228 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::LocationI.3pm.gz -rw-r--r-- root/root 3571 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Qual.3pm.gz -rw-r--r-- root/root 3320 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Query::WebQuery.3pm.gz -rw-r--r-- root/root 2415 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::QueryI.3pm.gz -rw-r--r-- root/root 2022 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::RandomAccessI.3pm.gz -rw-r--r-- root/root 2212 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::ReferenceI.3pm.gz -rw-r--r-- root/root 2265 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Registry.3pm.gz -rw-r--r-- root/root 2399 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::SeqI.3pm.gz -rw-r--r-- root/root 3059 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Taxonomy.3pm.gz -rw-r--r-- root/root 2819 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Taxonomy::flatfile.3pm.gz -rw-r--r-- root/root 2119 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Taxonomy::greengenes.3pm.gz -rw-r--r-- root/root 3008 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Taxonomy::list.3pm.gz -rw-r--r-- root/root 2122 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::Taxonomy::silva.3pm.gz -rw-r--r-- root/root 2617 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::UpdateableSeqI.3pm.gz -rw-r--r-- root/root 4492 2026-06-21 20:49 ./usr/share/man/man3/Bio::DB::WebDBSeqI.3pm.gz -rw-r--r-- root/root 1905 2026-06-21 20:49 ./usr/share/man/man3/Bio::DBLinkContainerI.3pm.gz -rw-r--r-- root/root 3618 2026-06-21 20:49 ./usr/share/man/man3/Bio::Das::FeatureTypeI.3pm.gz -rw-r--r-- root/root 4382 2026-06-21 20:49 ./usr/share/man/man3/Bio::Das::SegmentI.3pm.gz -rw-r--r-- root/root 5204 2026-06-21 20:49 ./usr/share/man/man3/Bio::DasI.3pm.gz -rw-r--r-- root/root 2072 2026-06-21 20:49 ./usr/share/man/man3/Bio::DescribableI.3pm.gz -rw-r--r-- root/root 1744 2026-06-21 20:49 ./usr/share/man/man3/Bio::Event::EventGeneratorI.3pm.gz -rw-r--r-- root/root 3741 2026-06-21 20:49 ./usr/share/man/man3/Bio::Event::EventHandlerI.3pm.gz -rw-r--r-- root/root 2345 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::AnalysisI.3pm.gz -rw-r--r-- root/root 1738 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::ApplicationFactoryI.3pm.gz -rw-r--r-- root/root 2254 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::DriverFactory.3pm.gz -rw-r--r-- root/root 2068 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::FTLocationFactory.3pm.gz -rw-r--r-- root/root 1905 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::LocationFactoryI.3pm.gz -rw-r--r-- root/root 2611 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::ObjectBuilderI.3pm.gz -rw-r--r-- root/root 2752 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::ObjectFactory.3pm.gz -rw-r--r-- root/root 1864 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::ObjectFactoryI.3pm.gz -rw-r--r-- root/root 2842 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactory.3pm.gz -rw-r--r-- root/root 2337 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactoryI.3pm.gz -rw-r--r-- root/root 2047 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::SequenceFactoryI.3pm.gz -rw-r--r-- root/root 3138 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::SequenceProcessorI.3pm.gz -rw-r--r-- root/root 2203 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::SequenceStreamI.3pm.gz -rw-r--r-- root/root 1937 2026-06-21 20:49 ./usr/share/man/man3/Bio::Factory::TreeFactoryI.3pm.gz -rw-r--r-- root/root 2943 2026-06-21 20:49 ./usr/share/man/man3/Bio::FeatureHolderI.3pm.gz -rw-r--r-- root/root 3653 2026-06-21 20:49 ./usr/share/man/man3/Bio::HandlerBaseI.3pm.gz -rw-r--r-- root/root 1926 2026-06-21 20:49 ./usr/share/man/man3/Bio::IdCollectionI.3pm.gz -rw-r--r-- root/root 2621 2026-06-21 20:49 ./usr/share/man/man3/Bio::IdentifiableI.3pm.gz -rw-r--r-- root/root 4885 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::Abstract.3pm.gz -rw-r--r-- root/root 2641 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::AbstractSeq.3pm.gz -rw-r--r-- root/root 4924 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::Blast.3pm.gz -rw-r--r-- root/root 4722 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::BlastTable.3pm.gz -rw-r--r-- root/root 2271 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::EMBL.3pm.gz -rw-r--r-- root/root 2897 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::Fasta.3pm.gz -rw-r--r-- root/root 2629 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::Fastq.3pm.gz -rw-r--r-- root/root 2640 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::GenBank.3pm.gz -rw-r--r-- root/root 2922 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::Qual.3pm.gz -rw-r--r-- root/root 2179 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::SwissPfam.3pm.gz -rw-r--r-- root/root 2696 2026-06-21 20:49 ./usr/share/man/man3/Bio::Index::Swissprot.3pm.gz -rw-r--r-- root/root 4480 2026-06-21 20:49 ./usr/share/man/man3/Bio::LocatableSeq.3pm.gz -rw-r--r-- root/root 3886 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::Atomic.3pm.gz -rw-r--r-- root/root 2016 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::AvWithinCoordPolicy.3pm.gz -rw-r--r-- root/root 2195 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::CoordinatePolicyI.3pm.gz -rw-r--r-- root/root 3692 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::Fuzzy.3pm.gz -rw-r--r-- root/root 2872 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::FuzzyLocationI.3pm.gz -rw-r--r-- root/root 1938 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::NarrowestCoordPolicy.3pm.gz -rw-r--r-- root/root 3151 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::Simple.3pm.gz -rw-r--r-- root/root 4435 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::Split.3pm.gz -rw-r--r-- root/root 3085 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::SplitLocationI.3pm.gz -rw-r--r-- root/root 1943 2026-06-21 20:49 ./usr/share/man/man3/Bio::Location::WidestCoordPolicy.3pm.gz -rw-r--r-- root/root 4070 2026-06-21 20:49 ./usr/share/man/man3/Bio::LocationI.3pm.gz -rw-r--r-- root/root 3565 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::Generic.3pm.gz -rw-r--r-- root/root 2403 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::IO.3pm.gz -rw-r--r-- root/root 1876 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::IO::mlagan.3pm.gz -rw-r--r-- root/root 1862 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::IO::phylip.3pm.gz -rw-r--r-- root/root 1858 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::IO::scoring.3pm.gz -rw-r--r-- root/root 2276 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::MatrixI.3pm.gz -rw-r--r-- root/root 2265 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::Mlagan.3pm.gz -rw-r--r-- root/root 3149 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::IO.3pm.gz -rw-r--r-- root/root 2282 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::IO::mast.3pm.gz -rw-r--r-- root/root 2326 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::IO::masta.3pm.gz -rw-r--r-- root/root 2456 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::IO::meme.3pm.gz -rw-r--r-- root/root 1787 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::IO::psiblast.3pm.gz -rw-r--r-- root/root 1951 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::IO::transfac.3pm.gz -rw-r--r-- root/root 2947 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::InstanceSite.3pm.gz -rw-r--r-- root/root 2484 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::InstanceSiteI.3pm.gz -rw-r--r-- root/root 6097 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::ProtMatrix.3pm.gz -rw-r--r-- root/root 3389 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::ProtPsm.3pm.gz -rw-r--r-- root/root 3219 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::Psm.3pm.gz -rw-r--r-- root/root 2347 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::PsmHeader.3pm.gz -rw-r--r-- root/root 2782 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::PsmHeaderI.3pm.gz -rw-r--r-- root/root 3269 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::PsmI.3pm.gz -rw-r--r-- root/root 6255 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::SiteMatrix.3pm.gz -rw-r--r-- root/root 4588 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PSM::SiteMatrixI.3pm.gz -rw-r--r-- root/root 2932 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::PhylipDist.3pm.gz -rw-r--r-- root/root 1997 2026-06-21 20:49 ./usr/share/man/man3/Bio::Matrix::Scoring.3pm.gz -rw-r--r-- root/root 2070 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::DocumentRegistry.3pm.gz -rw-r--r-- root/root 2664 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::GOterm.3pm.gz -rw-r--r-- root/root 2967 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::InterProTerm.3pm.gz -rw-r--r-- root/root 3984 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::OBOEngine.3pm.gz -rw-r--r-- root/root 2107 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::OBOterm.3pm.gz -rw-r--r-- root/root 4723 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::Ontology.3pm.gz -rw-r--r-- root/root 4521 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::OntologyEngineI.3pm.gz -rw-r--r-- root/root 3766 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::OntologyI.3pm.gz -rw-r--r-- root/root 3208 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::OntologyStore.3pm.gz -rw-r--r-- root/root 2213 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::Path.3pm.gz -rw-r--r-- root/root 2294 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::PathI.3pm.gz -rw-r--r-- root/root 2953 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::Relationship.3pm.gz -rw-r--r-- root/root 1864 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::RelationshipFactory.3pm.gz -rw-r--r-- root/root 2488 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::RelationshipI.3pm.gz -rw-r--r-- root/root 2881 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::RelationshipType.3pm.gz -rw-r--r-- root/root 2492 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::SimpleGOEngine::GraphAdaptor.3pm.gz -rw-r--r-- root/root 4013 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::SimpleOntologyEngine.3pm.gz -rw-r--r-- root/root 4905 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::Term.3pm.gz -rw-r--r-- root/root 2075 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::TermFactory.3pm.gz -rw-r--r-- root/root 3196 2026-06-21 20:49 ./usr/share/man/man3/Bio::Ontology::TermI.3pm.gz -rw-r--r-- root/root 3197 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO.3pm.gz -rw-r--r-- root/root 2405 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::Handlers::BaseSAXHandler.3pm.gz -rw-r--r-- root/root 2673 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::Handlers::InterProHandler.3pm.gz -rw-r--r-- root/root 2963 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler.3pm.gz -rw-r--r-- root/root 2462 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::InterProParser.3pm.gz -rw-r--r-- root/root 3261 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::dagflat.3pm.gz -rw-r--r-- root/root 2459 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::goflat.3pm.gz -rw-r--r-- root/root 2923 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::obo.3pm.gz -rw-r--r-- root/root 3206 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::simplehierarchy.3pm.gz -rw-r--r-- root/root 2397 2026-06-21 20:49 ./usr/share/man/man3/Bio::OntologyIO::soflat.3pm.gz -rw-r--r-- root/root 3355 2026-06-21 20:49 ./usr/share/man/man3/Bio::ParameterBaseI.3pm.gz -rw-r--r-- root/root 6795 2026-06-21 20:49 ./usr/share/man/man3/Bio::PrimarySeq.3pm.gz -rw-r--r-- root/root 6671 2026-06-21 20:49 ./usr/share/man/man3/Bio::PrimarySeqI.3pm.gz -rw-r--r-- root/root 5023 2026-06-21 20:49 ./usr/share/man/man3/Bio::PullParserI.3pm.gz -rw-r--r-- root/root 3056 2026-06-21 20:49 ./usr/share/man/man3/Bio::Range.3pm.gz -rw-r--r-- root/root 3723 2026-06-21 20:49 ./usr/share/man/man3/Bio::RangeI.3pm.gz -rw-r--r-- root/root 4084 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::Exception.3pm.gz -rw-r--r-- root/root 2443 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::HTTPget.3pm.gz -rw-r--r-- root/root 5722 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::IO.3pm.gz -rw-r--r-- root/root 4162 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::Root.3pm.gz -rw-r--r-- root/root 6143 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::RootI.3pm.gz -rw-r--r-- root/root 2905 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::Storable.3pm.gz -rw-r--r-- root/root 3434 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::Test.3pm.gz -rw-r--r-- root/root 1030 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::TestObject.3pm.gz -rw-r--r-- root/root 7344 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::Utilities.3pm.gz -rw-r--r-- root/root 1313 2026-06-21 20:49 ./usr/share/man/man3/Bio::Root::Version.3pm.gz -rw-r--r-- root/root 1866 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::BlastStatistics.3pm.gz -rw-r--r-- root/root 3959 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::BlastUtils.3pm.gz -rw-r--r-- root/root 1990 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::DatabaseI.3pm.gz -rw-r--r-- root/root 1920 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::GenericDatabase.3pm.gz -rw-r--r-- root/root 1915 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::GenericStatistics.3pm.gz -rw-r--r-- root/root 9369 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::BlastHSP.3pm.gz -rw-r--r-- root/root 2692 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::BlastPullHSP.3pm.gz -rw-r--r-- root/root 1942 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::FastaHSP.3pm.gz -rw-r--r-- root/root 7055 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::GenericHSP.3pm.gz -rw-r--r-- root/root 1918 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::HSPFactory.3pm.gz -rw-r--r-- root/root 5128 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::HSPI.3pm.gz -rw-r--r-- root/root 4689 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::ModelHSP.3pm.gz -rw-r--r-- root/root 1919 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::PSLHSP.3pm.gz -rw-r--r-- root/root 9375 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::PsiBlastHSP.3pm.gz -rw-r--r-- root/root 5376 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::PullHSPI.3pm.gz -rw-r--r-- root/root 1997 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::HSP::WABAHSP.3pm.gz -rw-r--r-- root/root 2484 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::BlastHit.3pm.gz -rw-r--r-- root/root 2646 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::BlastPullHit.3pm.gz -rw-r--r-- root/root 1975 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::Fasta.3pm.gz -rw-r--r-- root/root 8875 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::GenericHit.3pm.gz -rw-r--r-- root/root 1913 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::HitFactory.3pm.gz -rw-r--r-- root/root 6963 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::HitI.3pm.gz -rw-r--r-- root/root 5596 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::ModelHit.3pm.gz -rw-r--r-- root/root 12549 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::PsiBlastHit.3pm.gz -rw-r--r-- root/root 7834 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Hit::PullHitI.3pm.gz -rw-r--r-- root/root 3315 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Iteration::GenericIteration.3pm.gz -rw-r--r-- root/root 5397 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Iteration::IterationI.3pm.gz -rw-r--r-- root/root 1783 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Processor.3pm.gz -rw-r--r-- root/root 2779 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::BlastPullResult.3pm.gz -rw-r--r-- root/root 3619 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::BlastResult.3pm.gz -rw-r--r-- root/root 3333 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::CrossMatchResult.3pm.gz -rw-r--r-- root/root 4850 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::GenericResult.3pm.gz -rw-r--r-- root/root 1990 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::INFERNALResult.3pm.gz -rw-r--r-- root/root 4195 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::PullResultI.3pm.gz -rw-r--r-- root/root 1918 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::ResultFactory.3pm.gz -rw-r--r-- root/root 4139 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::ResultI.3pm.gz -rw-r--r-- root/root 2015 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Result::WABAResult.3pm.gz -rw-r--r-- root/root 4411 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::SearchUtils.3pm.gz -rw-r--r-- root/root 1857 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::StatisticsI.3pm.gz -rw-r--r-- root/root 3196 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Tiling::MapTileUtils.3pm.gz -rw-r--r-- root/root 7648 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Tiling::MapTiling.3pm.gz -rw-r--r-- root/root 3828 2026-06-21 20:49 ./usr/share/man/man3/Bio::Search::Tiling::TilingI.3pm.gz -rw-r--r-- root/root 5120 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO.3pm.gz -rw-r--r-- root/root 2406 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::EventHandlerI.3pm.gz -rw-r--r-- root/root 2548 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::FastHitEventBuilder.3pm.gz -rw-r--r-- root/root 2332 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::IteratedSearchResultEventBuilder.3pm.gz -rw-r--r-- root/root 3149 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::SearchResultEventBuilder.3pm.gz -rw-r--r-- root/root 1795 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::SearchWriterI.3pm.gz -rw-r--r-- root/root 2549 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::Writer::GbrowseGFF.3pm.gz -rw-r--r-- root/root 3533 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::Writer::HSPTableWriter.3pm.gz -rw-r--r-- root/root 4829 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::Writer::HTMLResultWriter.3pm.gz -rw-r--r-- root/root 3788 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::Writer::HitTableWriter.3pm.gz -rw-r--r-- root/root 3136 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::Writer::ResultTableWriter.3pm.gz -rw-r--r-- root/root 4307 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::Writer::TextResultWriter.3pm.gz -rw-r--r-- root/root 2551 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::axt.3pm.gz -rw-r--r-- root/root 5075 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::blast.3pm.gz -rw-r--r-- root/root 2510 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::blast_pull.3pm.gz -rw-r--r-- root/root 2970 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::blasttable.3pm.gz -rw-r--r-- root/root 2383 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::cross_match.3pm.gz -rw-r--r-- root/root 2827 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::erpin.3pm.gz -rw-r--r-- root/root 3305 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::exonerate.3pm.gz -rw-r--r-- root/root 3302 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::fasta.3pm.gz -rw-r--r-- root/root 2582 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::gmap_f9.3pm.gz -rw-r--r-- root/root 3838 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::infernal.3pm.gz -rw-r--r-- root/root 2903 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::megablast.3pm.gz -rw-r--r-- root/root 2596 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::psl.3pm.gz -rw-r--r-- root/root 3526 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::rnamotif.3pm.gz -rw-r--r-- root/root 2875 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::sim4.3pm.gz -rw-r--r-- root/root 2419 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::waba.3pm.gz -rw-r--r-- root/root 2400 2026-06-21 20:49 ./usr/share/man/man3/Bio::SearchIO::wise.3pm.gz -rw-r--r-- root/root 11487 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq.3pm.gz -rw-r--r-- root/root 2876 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::BaseSeqProcessor.3pm.gz -rw-r--r-- root/root 4770 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::EncodedSeq.3pm.gz -rw-r--r-- root/root 2384 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::LargeLocatableSeq.3pm.gz -rw-r--r-- root/root 2244 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::LargePrimarySeq.3pm.gz -rw-r--r-- root/root 2137 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::LargeSeq.3pm.gz -rw-r--r-- root/root 2086 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::LargeSeqI.3pm.gz -rw-r--r-- root/root 5131 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::Meta.3pm.gz -rw-r--r-- root/root 4362 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::Meta::Array.3pm.gz -rw-r--r-- root/root 4452 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::MetaI.3pm.gz -rw-r--r-- root/root 4005 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::PrimaryQual.3pm.gz -rw-r--r-- root/root 3652 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::PrimedSeq.3pm.gz -rw-r--r-- root/root 4876 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::QualI.3pm.gz -rw-r--r-- root/root 4089 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::Quality.3pm.gz -rw-r--r-- root/root 3197 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::RichSeq.3pm.gz -rw-r--r-- root/root 2426 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::RichSeqI.3pm.gz -rw-r--r-- root/root 5026 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::SeqBuilder.3pm.gz -rw-r--r-- root/root 2095 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::SeqFactory.3pm.gz -rw-r--r-- root/root 1997 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::SeqFastaSpeedFactory.3pm.gz -rw-r--r-- root/root 5923 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::SequenceTrace.3pm.gz -rw-r--r-- root/root 3603 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::SimulatedRead.3pm.gz -rw-r--r-- root/root 3022 2026-06-21 20:49 ./usr/share/man/man3/Bio::Seq::TraceI.3pm.gz -rw-r--r-- root/root 2231 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqAnalysisParserI.3pm.gz -rw-r--r-- root/root 2162 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Amplicon.3pm.gz -rw-r--r-- root/root 4060 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::AnnotationAdaptor.3pm.gz -rw-r--r-- root/root 3657 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Collection.3pm.gz -rw-r--r-- root/root 2340 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::CollectionI.3pm.gz -rw-r--r-- root/root 3504 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Computation.3pm.gz -rw-r--r-- root/root 3074 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::FeaturePair.3pm.gz -rw-r--r-- root/root 2695 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::Exon.3pm.gz -rw-r--r-- root/root 2000 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::ExonI.3pm.gz -rw-r--r-- root/root 3090 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructure.3pm.gz -rw-r--r-- root/root 2194 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructureI.3pm.gz -rw-r--r-- root/root 2044 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::Intron.3pm.gz -rw-r--r-- root/root 1751 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::NC_Feature.3pm.gz -rw-r--r-- root/root 1586 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::Poly_A_site.3pm.gz -rw-r--r-- root/root 1576 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::Promoter.3pm.gz -rw-r--r-- root/root 4336 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::Transcript.3pm.gz -rw-r--r-- root/root 2389 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::TranscriptI.3pm.gz -rw-r--r-- root/root 1959 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Gene::UTR.3pm.gz -rw-r--r-- root/root 6041 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Generic.3pm.gz -rw-r--r-- root/root 4164 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Lite.3pm.gz -rw-r--r-- root/root 2981 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::PositionProxy.3pm.gz -rw-r--r-- root/root 3282 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Primer.3pm.gz -rw-r--r-- root/root 2047 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Similarity.3pm.gz -rw-r--r-- root/root 2412 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::SimilarityPair.3pm.gz -rw-r--r-- root/root 2418 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::SubSeq.3pm.gz -rw-r--r-- root/root 2766 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Tools::FeatureNamer.3pm.gz -rw-r--r-- root/root 2290 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Tools::IDHandler.3pm.gz -rw-r--r-- root/root 2959 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Tools::TypeMapper.3pm.gz -rw-r--r-- root/root 11197 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::Tools::Unflattener.3pm.gz -rw-r--r-- root/root 2134 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeature::TypedSeqFeatureI.3pm.gz -rw-r--r-- root/root 5223 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqFeatureI.3pm.gz -rw-r--r-- root/root 3001 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqI.3pm.gz -rw-r--r-- root/root 6649 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO.3pm.gz -rw-r--r-- root/root 2244 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::FTHelper.3pm.gz -rw-r--r-- root/root 3928 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::Handler::GenericRichSeqHandler.3pm.gz -rw-r--r-- root/root 1903 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::MultiFile.3pm.gz -rw-r--r-- root/root 1995 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::ace.3pm.gz -rw-r--r-- root/root 2052 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::asciitree.3pm.gz -rw-r--r-- root/root 6126 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::bsml.3pm.gz -rw-r--r-- root/root 1971 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::bsml_sax.3pm.gz -rw-r--r-- root/root 3411 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::embl.3pm.gz -rw-r--r-- root/root 2451 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::embldriver.3pm.gz -rw-r--r-- root/root 2349 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::fasta.3pm.gz -rw-r--r-- root/root 3967 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::fastq.3pm.gz -rw-r--r-- root/root 2149 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::game.3pm.gz -rw-r--r-- root/root 2679 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::game::featHandler.3pm.gz -rw-r--r-- root/root 1875 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::game::gameHandler.3pm.gz -rw-r--r-- root/root 2561 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::game::gameSubs.3pm.gz -rw-r--r-- root/root 4156 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::game::gameWriter.3pm.gz -rw-r--r-- root/root 2323 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::game::seqHandler.3pm.gz -rw-r--r-- root/root 3347 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::gbdriver.3pm.gz -rw-r--r-- root/root 1794 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::gbxml.3pm.gz -rw-r--r-- root/root 2134 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::gcg.3pm.gz -rw-r--r-- root/root 4291 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::genbank.3pm.gz -rw-r--r-- root/root 2357 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::kegg.3pm.gz -rw-r--r-- root/root 2137 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::largefasta.3pm.gz -rw-r--r-- root/root 2005 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::locuslink.3pm.gz -rw-r--r-- root/root 4392 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::mbsout.3pm.gz -rw-r--r-- root/root 2267 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::metafasta.3pm.gz -rw-r--r-- root/root 5128 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::msout.3pm.gz -rw-r--r-- root/root 2618 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::phd.3pm.gz -rw-r--r-- root/root 1911 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::pir.3pm.gz -rw-r--r-- root/root 2460 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::qual.3pm.gz -rw-r--r-- root/root 2045 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::raw.3pm.gz -rw-r--r-- root/root 4125 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::scf.3pm.gz -rw-r--r-- root/root 3928 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::seqxml.3pm.gz -rw-r--r-- root/root 4481 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::swiss.3pm.gz -rw-r--r-- root/root 2248 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::swissdriver.3pm.gz -rw-r--r-- root/root 2261 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::tab.3pm.gz -rw-r--r-- root/root 4898 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::table.3pm.gz -rw-r--r-- root/root 1708 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::tigr.3pm.gz -rw-r--r-- root/root 1695 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::tigrxml.3pm.gz -rw-r--r-- root/root 2771 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::tinyseq.3pm.gz -rw-r--r-- root/root 2175 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqIO::tinyseq::tinyseqHandler.3pm.gz -rw-r--r-- root/root 7417 2026-06-21 20:49 ./usr/share/man/man3/Bio::SeqUtils.3pm.gz -rw-r--r-- root/root 11479 2026-06-21 20:49 ./usr/share/man/man3/Bio::SimpleAlign.3pm.gz -rw-r--r-- root/root 3635 2026-06-21 20:49 ./usr/share/man/man3/Bio::SimpleAnalysisI.3pm.gz -rw-r--r-- root/root 3782 2026-06-21 20:49 ./usr/share/man/man3/Bio::Species.3pm.gz -rw-r--r-- root/root 5518 2026-06-21 20:49 ./usr/share/man/man3/Bio::Taxon.3pm.gz -rw-r--r-- root/root 7876 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Alignment::Consed.3pm.gz -rw-r--r-- root/root 4016 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Alignment::Trim.3pm.gz -rw-r--r-- root/root 3280 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::AmpliconSearch.3pm.gz -rw-r--r-- root/root 2326 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Analysis::SimpleAnalysisBase.3pm.gz -rw-r--r-- root/root 3428 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::AnalysisResult.3pm.gz -rw-r--r-- root/root 1868 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Blat.3pm.gz -rw-r--r-- root/root 5137 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::CodonTable.3pm.gz -rw-r--r-- root/root 2132 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Coil.3pm.gz -rw-r--r-- root/root 2936 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::ECnumber.3pm.gz -rw-r--r-- root/root 2208 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::EMBOSS::Palindrome.3pm.gz -rw-r--r-- root/root 2485 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::EPCR.3pm.gz -rw-r--r-- root/root 2553 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::ESTScan.3pm.gz -rw-r--r-- root/root 2562 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Eponine.3pm.gz -rw-r--r-- root/root 2631 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Est2Genome.3pm.gz -rw-r--r-- root/root 2787 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Fgenesh.3pm.gz -rw-r--r-- root/root 2086 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::FootPrinter.3pm.gz -rw-r--r-- root/root 4150 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::GFF.3pm.gz -rw-r--r-- root/root 2434 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Geneid.3pm.gz -rw-r--r-- root/root 2932 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Genemark.3pm.gz -rw-r--r-- root/root 2231 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Genewise.3pm.gz -rw-r--r-- root/root 2279 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Genomewise.3pm.gz -rw-r--r-- root/root 2756 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Genscan.3pm.gz -rw-r--r-- root/root 3088 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Glimmer.3pm.gz -rw-r--r-- root/root 2285 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Grail.3pm.gz -rw-r--r-- root/root 4370 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::GuessSeqFormat.3pm.gz -rw-r--r-- root/root 3551 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::IUPAC.3pm.gz -rw-r--r-- root/root 5279 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Lucy.3pm.gz -rw-r--r-- root/root 2698 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::MZEF.3pm.gz -rw-r--r-- root/root 2035 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Match.3pm.gz -rw-r--r-- root/root 3165 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::OddCodes.3pm.gz -rw-r--r-- root/root 2213 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Phylo::Gerp.3pm.gz -rw-r--r-- root/root 2284 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Phylo::Molphy.3pm.gz -rw-r--r-- root/root 2896 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Phylo::Molphy::Result.3pm.gz -rw-r--r-- root/root 1884 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Phylo::Phylip::ProtDist.3pm.gz -rw-r--r-- root/root 2396 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Prediction::Exon.3pm.gz -rw-r--r-- root/root 2262 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Prediction::Gene.3pm.gz -rw-r--r-- root/root 3146 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Primer3.3pm.gz -rw-r--r-- root/root 1626 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Primer::Assessor::Base.3pm.gz -rw-r--r-- root/root 1688 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Primer::AssessorI.3pm.gz -rw-r--r-- root/root 1812 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Primer::Feature.3pm.gz -rw-r--r-- root/root 1754 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Primer::Pair.3pm.gz -rw-r--r-- root/root 2010 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Prints.3pm.gz -rw-r--r-- root/root 1863 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Profile.3pm.gz -rw-r--r-- root/root 2190 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Promoterwise.3pm.gz -rw-r--r-- root/root 1684 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::PrositeScan.3pm.gz -rw-r--r-- root/root 2293 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Pseudowise.3pm.gz -rw-r--r-- root/root 3036 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::QRNA.3pm.gz -rw-r--r-- root/root 2262 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::RandomDistFunctions.3pm.gz -rw-r--r-- root/root 1849 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::RepeatMasker.3pm.gz -rw-r--r-- root/root 5841 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::Analysis.3pm.gz -rw-r--r-- root/root 3794 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::AnalysisFactory.3pm.gz -rw-r--r-- root/root 1972 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::GenericParameters.3pm.gz -rw-r--r-- root/root 1866 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::ParametersI.3pm.gz -rw-r--r-- root/root 2392 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::Phylo::PhyloBase.3pm.gz -rw-r--r-- root/root 3651 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::WrapperBase.3pm.gz -rw-r--r-- root/root 7757 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Run::WrapperBase::CommandExts.3pm.gz -rw-r--r-- root/root 2143 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Seg.3pm.gz -rw-r--r-- root/root 5425 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::SeqPattern.3pm.gz -rw-r--r-- root/root 1103 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::SeqPattern::Backtranslate.3pm.gz -rw-r--r-- root/root 4427 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::SeqStats.3pm.gz -rw-r--r-- root/root 3128 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::SeqWords.3pm.gz -rw-r--r-- root/root 3996 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Sigcleave.3pm.gz -rw-r--r-- root/root 2391 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Signalp.3pm.gz -rw-r--r-- root/root 2911 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Signalp::ExtendedSignalp.3pm.gz -rw-r--r-- root/root 2348 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Sim4::Exon.3pm.gz -rw-r--r-- root/root 3808 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Sim4::Results.3pm.gz -rw-r--r-- root/root 2448 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Spidey::Exon.3pm.gz -rw-r--r-- root/root 3279 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Spidey::Results.3pm.gz -rw-r--r-- root/root 2548 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::TandemRepeatsFinder.3pm.gz -rw-r--r-- root/root 3359 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::TargetP.3pm.gz -rw-r--r-- root/root 2090 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::Tmhmm.3pm.gz -rw-r--r-- root/root 2619 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::ipcress.3pm.gz -rw-r--r-- root/root 2631 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::isPcr.3pm.gz -rw-r--r-- root/root 2931 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::pICalculator.3pm.gz -rw-r--r-- root/root 2482 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tools::tRNAscanSE.3pm.gz -rw-r--r-- root/root 2619 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::AnnotatableNode.3pm.gz -rw-r--r-- root/root 4043 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::Compatible.3pm.gz -rw-r--r-- root/root 2856 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::DistanceFactory.3pm.gz -rw-r--r-- root/root 4367 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::Node.3pm.gz -rw-r--r-- root/root 3980 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::NodeI.3pm.gz -rw-r--r-- root/root 2108 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::NodeNHX.3pm.gz -rw-r--r-- root/root 2985 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::RandomFactory.3pm.gz -rw-r--r-- root/root 4595 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::Statistics.3pm.gz -rw-r--r-- root/root 4124 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::Tree.3pm.gz -rw-r--r-- root/root 5179 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::TreeFunctionsI.3pm.gz -rw-r--r-- root/root 2939 2026-06-21 20:49 ./usr/share/man/man3/Bio::Tree::TreeI.3pm.gz -rw-r--r-- root/root 2365 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO.3pm.gz -rw-r--r-- root/root 1880 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::NewickParser.3pm.gz -rw-r--r-- root/root 2050 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::TreeEventBuilder.3pm.gz -rw-r--r-- root/root 1997 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::cluster.3pm.gz -rw-r--r-- root/root 2534 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::lintree.3pm.gz -rw-r--r-- root/root 2535 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::newick.3pm.gz -rw-r--r-- root/root 2249 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::nexus.3pm.gz -rw-r--r-- root/root 1726 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::nhx.3pm.gz -rw-r--r-- root/root 2233 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::pag.3pm.gz -rw-r--r-- root/root 3700 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::phyloxml.3pm.gz -rw-r--r-- root/root 1881 2026-06-21 20:49 ./usr/share/man/man3/Bio::TreeIO::tabtree.3pm.gz -rw-r--r-- root/root 2204 2026-06-21 20:49 ./usr/share/man/man3/Bio::UpdateableSeqI.3pm.gz -rw-r--r-- root/root 2558 2026-06-21 20:49 ./usr/share/man/man3/Bio::WebAgent.3pm.gz -rw-r--r-- root/root 3966 2026-06-21 20:49 ./usr/share/man/man3/BioPerl.3pm.gz drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Align/ -rw-r--r-- root/root 19407 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/AlignI.pm -rw-r--r-- root/root 51172 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/DNAStatistics.pm -rw-r--r-- root/root 7414 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/PairwiseStatistics.pm -rw-r--r-- root/root 8585 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/ProteinStatistics.pm -rw-r--r-- root/root 2660 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/StatisticsI.pm -rw-r--r-- root/root 18903 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/Utilities.pm -rw-r--r-- root/root 15593 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/AlignIO/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/AlignIO/Handler/ -rw-r--r-- root/root 24260 2026-06-21 20:49 ./usr/share/perl5/Bio/AlignIO/Handler/GenericAlignHandler.pm -rw-r--r-- root/root 9087 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/arp.pm -rw-r--r-- root/root 5754 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/bl2seq.pm -rw-r--r-- root/root 10487 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/clustalw.pm -rw-r--r-- root/root 6790 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/emboss.pm -rw-r--r-- root/root 6775 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/fasta.pm -rw-r--r-- root/root 5536 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/largemultifasta.pm -rw-r--r-- root/root 4332 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/maf.pm -rw-r--r-- root/root 3327 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/mase.pm -rw-r--r-- root/root 6485 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/mega.pm -rw-r--r-- root/root 7011 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/meme.pm -rw-r--r-- root/root 5714 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/metafasta.pm -rw-r--r-- root/root 6268 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/msf.pm -rw-r--r-- root/root 14232 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/nexus.pm -rw-r--r-- root/root 3712 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/pfam.pm -rw-r--r-- root/root 19375 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/phylip.pm -rw-r--r-- root/root 8993 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/po.pm -rw-r--r-- root/root 8259 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/proda.pm -rw-r--r-- root/root 3116 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/prodom.pm -rw-r--r-- root/root 4061 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/psi.pm -rw-r--r-- root/root 4524 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/selex.pm -rw-r--r-- root/root 6601 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/xmfa.pm -rw-r--r-- root/root 22893 2021-02-03 05:04 ./usr/share/perl5/Bio/AnalysisI.pm -rw-r--r-- root/root 5104 2021-02-03 05:04 ./usr/share/perl5/Bio/AnalysisParserI.pm -rw-r--r-- root/root 6541 2021-02-03 05:04 ./usr/share/perl5/Bio/AnalysisResultI.pm -rw-r--r-- root/root 2888 2021-02-03 05:04 ./usr/share/perl5/Bio/AnnotatableI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Annotation/ -rw-r--r-- root/root 7391 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/AnnotationFactory.pm -rw-r--r-- root/root 18814 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Collection.pm -rw-r--r-- root/root 4663 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Comment.pm -rw-r--r-- root/root 10653 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/DBLink.pm -rw-r--r-- root/root 14672 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/OntologyTerm.pm -rw-r--r-- root/root 12817 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Reference.pm -rw-r--r-- root/root 7707 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Relation.pm -rw-r--r-- root/root 6433 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/SimpleValue.pm -rw-r--r-- root/root 10041 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/StructuredValue.pm -rw-r--r-- root/root 19050 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/TagTree.pm -rw-r--r-- root/root 4539 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Target.pm -rw-r--r-- root/root 5669 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Tree.pm -rw-r--r-- root/root 3411 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/TypeManager.pm -rw-r--r-- root/root 6571 2021-02-03 05:04 ./usr/share/perl5/Bio/AnnotationCollectionI.pm -rw-r--r-- root/root 5564 2021-02-03 05:04 ./usr/share/perl5/Bio/AnnotationI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/CodonUsage/ -rw-r--r-- root/root 5966 2021-02-03 05:04 ./usr/share/perl5/Bio/CodonUsage/IO.pm -rw-r--r-- root/root 17806 2021-02-03 05:04 ./usr/share/perl5/Bio/CodonUsage/Table.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/ -rw-r--r-- root/root 9901 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/DBFetch.pm -rw-r--r-- root/root 4126 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Failover.pm -rw-r--r-- root/root 14656 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Fasta.pm -rw-r--r-- root/root 7259 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/FileCache.pm -rw-r--r-- root/root 17276 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/Flat/ -rw-r--r-- root/root 13522 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/Flat/BDB/ -rw-r--r-- root/root 2376 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/embl.pm -rw-r--r-- root/root 2466 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/fasta.pm -rw-r--r-- root/root 2506 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/genbank.pm -rw-r--r-- root/root 2435 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/swiss.pm -rw-r--r-- root/root 45132 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BinarySearch.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/GFF/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/GFF/Util/ -rw-r--r-- root/root 2468 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/GFF/Util/Binning.pm -rw-r--r-- root/root 2648 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/GFF/Util/Rearrange.pm -rw-r--r-- root/root 10490 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/GenericWebAgent.pm -rw-r--r-- root/root 6422 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/InMemoryCache.pm -rw-r--r-- root/root 32565 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/IndexedBase.pm -rw-r--r-- root/root 3936 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/LocationI.pm -rw-r--r-- root/root 16529 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Qual.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/Query/ -rw-r--r-- root/root 10765 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Query/WebQuery.pm -rw-r--r-- root/root 3967 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/QueryI.pm -rw-r--r-- root/root 3096 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/RandomAccessI.pm -rw-r--r-- root/root 3938 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/ReferenceI.pm -rw-r--r-- root/root 8117 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Registry.pm -rw-r--r-- root/root 4751 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/SeqI.pm -rw-r--r-- root/root 10689 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/DB/Taxonomy/ -rw-r--r-- root/root 17959 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/flatfile.pm -rw-r--r-- root/root 4799 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/greengenes.pm -rw-r--r-- root/root 15933 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/list.pm -rw-r--r-- root/root 4722 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/silva.pm -rw-r--r-- root/root 5863 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/UpdateableSeqI.pm -rw-r--r-- root/root 25601 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/WebDBSeqI.pm -rw-r--r-- root/root 2868 2021-02-03 05:04 ./usr/share/perl5/Bio/DBLinkContainerI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Das/ -rw-r--r-- root/root 10626 2021-02-03 05:04 ./usr/share/perl5/Bio/Das/FeatureTypeI.pm -rw-r--r-- root/root 12543 2021-02-03 05:04 ./usr/share/perl5/Bio/Das/SegmentI.pm -rw-r--r-- root/root 13815 2021-02-03 05:04 ./usr/share/perl5/Bio/DasI.pm -rw-r--r-- root/root 3041 2021-02-03 05:04 ./usr/share/perl5/Bio/DescribableI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Event/ -rw-r--r-- root/root 2313 2021-02-03 05:04 ./usr/share/perl5/Bio/Event/EventGeneratorI.pm -rw-r--r-- root/root 9115 2021-02-03 05:04 ./usr/share/perl5/Bio/Event/EventHandlerI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Factory/ -rw-r--r-- root/root 4109 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/AnalysisI.pm -rw-r--r-- root/root 2170 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ApplicationFactoryI.pm -rw-r--r-- root/root 4738 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/DriverFactory.pm -rw-r--r-- root/root 13105 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/FTLocationFactory.pm -rw-r--r-- root/root 3388 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/LocationFactoryI.pm -rw-r--r-- root/root 5746 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ObjectBuilderI.pm -rw-r--r-- root/root 7315 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ObjectFactory.pm -rw-r--r-- root/root 2732 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ObjectFactoryI.pm -rw-r--r-- root/root 7038 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SeqAnalysisParserFactory.pm -rw-r--r-- root/root 3955 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SeqAnalysisParserFactoryI.pm -rw-r--r-- root/root 2892 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SequenceFactoryI.pm -rw-r--r-- root/root 6478 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SequenceProcessorI.pm -rw-r--r-- root/root 3564 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SequenceStreamI.pm -rw-r--r-- root/root 2832 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/TreeFactoryI.pm -rw-r--r-- root/root 7307 2021-02-03 05:04 ./usr/share/perl5/Bio/FeatureHolderI.pm -rw-r--r-- root/root 7539 2021-02-03 05:04 ./usr/share/perl5/Bio/HandlerBaseI.pm -rw-r--r-- root/root 2696 2021-02-03 05:04 ./usr/share/perl5/Bio/IdCollectionI.pm -rw-r--r-- root/root 5199 2021-02-03 05:04 ./usr/share/perl5/Bio/IdentifiableI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Index/ -rw-r--r-- root/root 22075 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Abstract.pm -rw-r--r-- root/root 7731 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/AbstractSeq.pm -rw-r--r-- root/root 14617 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Blast.pm -rw-r--r-- root/root 13216 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/BlastTable.pm -rw-r--r-- root/root 5478 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/EMBL.pm -rw-r--r-- root/root 6961 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Fasta.pm -rw-r--r-- root/root 6151 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Fastq.pm -rw-r--r-- root/root 6449 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/GenBank.pm -rw-r--r-- root/root 6527 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Qual.pm -rw-r--r-- root/root 5563 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/SwissPfam.pm -rw-r--r-- root/root 6189 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Swissprot.pm -rw-r--r-- root/root 20259 2021-02-03 05:04 ./usr/share/perl5/Bio/LocatableSeq.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Location/ -rw-r--r-- root/root 14359 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Atomic.pm -rw-r--r-- root/root 3830 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/AvWithinCoordPolicy.pm -rw-r--r-- root/root 3689 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/CoordinatePolicyI.pm -rw-r--r-- root/root 19496 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Fuzzy.pm -rw-r--r-- root/root 6012 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/FuzzyLocationI.pm -rw-r--r-- root/root 3804 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/NarrowestCoordPolicy.pm -rw-r--r-- root/root 11378 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Simple.pm -rw-r--r-- root/root 27817 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Split.pm -rw-r--r-- root/root 6775 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/SplitLocationI.pm -rw-r--r-- root/root 3798 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/WidestCoordPolicy.pm -rw-r--r-- root/root 12356 2021-02-03 05:04 ./usr/share/perl5/Bio/LocationI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Matrix/ -rw-r--r-- root/root 20881 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/Generic.pm -rw-r--r-- root/root 6379 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Matrix/IO/ -rw-r--r-- root/root 4100 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO/mlagan.pm -rw-r--r-- root/root 4636 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO/phylip.pm -rw-r--r-- root/root 4549 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO/scoring.pm -rw-r--r-- root/root 5598 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/MatrixI.pm -rw-r--r-- root/root 4871 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/Mlagan.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Matrix/PSM/ -rw-r--r-- root/root 8196 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Matrix/PSM/IO/ -rw-r--r-- root/root 8922 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/mast.pm -rw-r--r-- root/root 8477 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/masta.pm -rw-r--r-- root/root 9662 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/meme.pm -rw-r--r-- root/root 3786 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/psiblast.pm -rw-r--r-- root/root 6999 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/transfac.pm -rw-r--r-- root/root 8070 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/InstanceSite.pm -rw-r--r-- root/root 4219 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/InstanceSiteI.pm -rw-r--r-- root/root 26641 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/ProtMatrix.pm -rw-r--r-- root/root 8095 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/ProtPsm.pm -rw-r--r-- root/root 7477 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/Psm.pm -rw-r--r-- root/root 6992 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/PsmHeader.pm -rw-r--r-- root/root 6525 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/PsmHeaderI.pm -rw-r--r-- root/root 6544 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/PsmI.pm -rw-r--r-- root/root 32831 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/SiteMatrix.pm -rw-r--r-- root/root 12750 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/SiteMatrixI.pm -rw-r--r-- root/root 11115 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PhylipDist.pm -rw-r--r-- root/root 5985 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/Scoring.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Ontology/ -rw-r--r-- root/root 4948 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/DocumentRegistry.pm -rw-r--r-- root/root 9457 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/GOterm.pm -rw-r--r-- root/root 15211 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/InterProTerm.pm -rw-r--r-- root/root 28873 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OBOEngine.pm -rw-r--r-- root/root 3149 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OBOterm.pm -rw-r--r-- root/root 23503 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Ontology.pm -rw-r--r-- root/root 14445 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OntologyEngineI.pm -rw-r--r-- root/root 11171 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OntologyI.pm -rw-r--r-- root/root 10269 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OntologyStore.pm -rw-r--r-- root/root 5236 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Path.pm -rw-r--r-- root/root 4744 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/PathI.pm -rw-r--r-- root/root 11066 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Relationship.pm -rw-r--r-- root/root 3691 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/RelationshipFactory.pm -rw-r--r-- root/root 5464 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/RelationshipI.pm -rw-r--r-- root/root 11668 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/RelationshipType.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Ontology/SimpleGOEngine/ -rw-r--r-- root/root 7334 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm -rw-r--r-- root/root 28013 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/SimpleOntologyEngine.pm -rw-r--r-- root/root 26114 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Term.pm -rw-r--r-- root/root 4204 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/TermFactory.pm -rw-r--r-- root/root 9552 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/TermI.pm -rw-r--r-- root/root 9768 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/OntologyIO/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/OntologyIO/Handlers/ -rw-r--r-- root/root 5825 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/Handlers/BaseSAXHandler.pm -rw-r--r-- root/root 22306 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/Handlers/InterProHandler.pm -rw-r--r-- root/root 19570 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm -rw-r--r-- root/root 7250 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/InterProParser.pm -rw-r--r-- root/root 26105 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/dagflat.pm -rw-r--r-- root/root 5463 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/goflat.pm -rw-r--r-- root/root 24424 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/obo.pm -rw-r--r-- root/root 20093 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/simplehierarchy.pm -rw-r--r-- root/root 5064 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/soflat.pm -rw-r--r-- root/root 7128 2021-02-03 05:04 ./usr/share/perl5/Bio/ParameterBaseI.pm -rw-r--r-- root/root 31180 2021-02-03 05:04 ./usr/share/perl5/Bio/PrimarySeq.pm -rw-r--r-- root/root 32342 2021-02-03 05:04 ./usr/share/perl5/Bio/PrimarySeqI.pm -rw-r--r-- root/root 20061 2021-02-03 05:04 ./usr/share/perl5/Bio/PullParserI.pm -rw-r--r-- root/root 8875 2021-02-03 05:04 ./usr/share/perl5/Bio/Range.pm -rw-r--r-- root/root 19904 2021-02-03 05:04 ./usr/share/perl5/Bio/RangeI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Root/ -rw-r--r-- root/root 13362 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Exception.pm -rw-r--r-- root/root 11962 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/HTTPget.pm -rw-r--r-- root/root 36837 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/IO.pm -rw-r--r-- root/root 17000 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Root.pm -rw-r--r-- root/root 26600 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/RootI.pm -rw-r--r-- root/root 15326 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Storable.pm -rw-r--r-- root/root 19040 2026-06-21 20:49 ./usr/share/perl5/Bio/Root/Test.pm -rw-r--r-- root/root 1797 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/TestObject.pm -rw-r--r-- root/root 45487 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Utilities.pm -rw-r--r-- root/root 1383 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Version.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Search/ -rw-r--r-- root/root 3156 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/BlastStatistics.pm -rw-r--r-- root/root 19861 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/BlastUtils.pm -rw-r--r-- root/root 3450 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/DatabaseI.pm -rw-r--r-- root/root 4128 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/GenericDatabase.pm -rw-r--r-- root/root 3229 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/GenericStatistics.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Search/HSP/ -rw-r--r-- root/root 55654 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/BlastHSP.pm -rw-r--r-- root/root 16051 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/BlastPullHSP.pm -rw-r--r-- root/root 5936 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/FastaHSP.pm -rw-r--r-- root/root 57564 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/GenericHSP.pm -rw-r--r-- root/root 3687 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/HSPFactory.pm -rw-r--r-- root/root 22409 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/HSPI.pm -rw-r--r-- root/root 18032 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/ModelHSP.pm -rw-r--r-- root/root 3732 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/PSLHSP.pm -rw-r--r-- root/root 57922 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/PsiBlastHSP.pm -rw-r--r-- root/root 26165 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/PullHSPI.pm -rw-r--r-- root/root 4311 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/WABAHSP.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Search/Hit/ -rw-r--r-- root/root 5162 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/BlastHit.pm -rw-r--r-- root/root 9197 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/BlastPullHit.pm -rw-r--r-- root/root 3256 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/Fasta.pm -rw-r--r-- root/root 60429 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/GenericHit.pm -rw-r--r-- root/root 3718 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/HitFactory.pm -rw-r--r-- root/root 22189 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/HitI.pm -rw-r--r-- root/root 20246 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/ModelHit.pm -rw-r--r-- root/root 69661 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/PsiBlastHit.pm -rw-r--r-- root/root 35845 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/PullHitI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Search/Iteration/ -rw-r--r-- root/root 21576 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Iteration/GenericIteration.pm -rw-r--r-- root/root 22097 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Iteration/IterationI.pm -rw-r--r-- root/root 3050 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Processor.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Search/Result/ -rw-r--r-- root/root 11837 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/BlastPullResult.pm -rw-r--r-- root/root 15261 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/BlastResult.pm -rw-r--r-- root/root 13144 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/CrossMatchResult.pm -rw-r--r-- root/root 22920 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/GenericResult.pm -rw-r--r-- root/root 3180 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/INFERNALResult.pm -rw-r--r-- root/root 14808 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/PullResultI.pm -rw-r--r-- root/root 3809 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/ResultFactory.pm -rw-r--r-- root/root 12882 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/ResultI.pm -rw-r--r-- root/root 3387 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/WABAResult.pm -rw-r--r-- root/root 31259 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/SearchUtils.pm -rw-r--r-- root/root 2853 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/StatisticsI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Search/Tiling/ -rw-r--r-- root/root 21011 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Tiling/MapTileUtils.pm -rw-r--r-- root/root 47411 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Tiling/MapTiling.pm -rw-r--r-- root/root 10557 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Tiling/TilingI.pm -rw-r--r-- root/root 22379 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SearchIO/ -rw-r--r-- root/root 5621 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/EventHandlerI.pm -rw-r--r-- root/root 8117 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/FastHitEventBuilder.pm -rw-r--r-- root/root 11926 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/IteratedSearchResultEventBuilder.pm -rw-r--r-- root/root 21823 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/SearchResultEventBuilder.pm -rw-r--r-- root/root 3472 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/SearchWriterI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SearchIO/Writer/ -rw-r--r-- root/root 16185 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/GbrowseGFF.pm -rw-r--r-- root/root 12391 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/HSPTableWriter.pm -rw-r--r-- root/root 30893 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm -rw-r--r-- root/root 12896 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/HitTableWriter.pm -rw-r--r-- root/root 13638 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/ResultTableWriter.pm -rw-r--r-- root/root 24361 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/TextResultWriter.pm -rw-r--r-- root/root 13007 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/axt.pm -rw-r--r-- root/root 95057 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/blast.pm -rw-r--r-- root/root 8869 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/blast_pull.pm -rw-r--r-- root/root 18097 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/blasttable.pm -rw-r--r-- root/root 10058 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/cross_match.pm -rw-r--r-- root/root 19686 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/erpin.pm -rw-r--r-- root/root 22677 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/exonerate.pm -rw-r--r-- root/root 53335 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/fasta.pm -rw-r--r-- root/root 12287 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/gmap_f9.pm -rw-r--r-- root/root 54467 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/infernal.pm -rw-r--r-- root/root 13388 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/megablast.pm -rw-r--r-- root/root 18788 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/psl.pm -rw-r--r-- root/root 24645 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/rnamotif.pm -rw-r--r-- root/root 21857 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/sim4.pm -rw-r--r-- root/root 13234 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/waba.pm -rw-r--r-- root/root 12660 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/wise.pm -rw-r--r-- root/root 41092 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Seq/ -rw-r--r-- root/root 8299 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/BaseSeqProcessor.pm -rw-r--r-- root/root 21760 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/EncodedSeq.pm -rw-r--r-- root/root 8455 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargeLocatableSeq.pm -rw-r--r-- root/root 7847 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargePrimarySeq.pm -rw-r--r-- root/root 3773 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargeSeq.pm -rw-r--r-- root/root 2905 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargeSeqI.pm -rw-r--r-- root/root 19982 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/Meta.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Seq/Meta/ -rw-r--r-- root/root 19353 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/Meta/Array.pm -rw-r--r-- root/root 12085 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/MetaI.pm -rw-r--r-- root/root 14100 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/PrimaryQual.pm -rw-r--r-- root/root 14731 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/PrimedSeq.pm -rw-r--r-- root/root 16512 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/QualI.pm -rw-r--r-- root/root 19246 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/Quality.pm -rw-r--r-- root/root 10577 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/RichSeq.pm -rw-r--r-- root/root 5595 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/RichSeqI.pm -rw-r--r-- root/root 17697 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SeqBuilder.pm -rw-r--r-- root/root 4061 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SeqFactory.pm -rw-r--r-- root/root 4010 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SeqFastaSpeedFactory.pm -rw-r--r-- root/root 33849 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SequenceTrace.pm -rw-r--r-- root/root 22638 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SimulatedRead.pm -rw-r--r-- root/root 7406 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/TraceI.pm -rw-r--r-- root/root 3559 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqAnalysisParserI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqFeature/ -rw-r--r-- root/root 4953 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Amplicon.pm -rw-r--r-- root/root 15697 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/AnnotationAdaptor.pm -rw-r--r-- root/root 15553 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Collection.pm -rw-r--r-- root/root 3860 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/CollectionI.pm -rw-r--r-- root/root 15040 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Computation.pm -rw-r--r-- root/root 13320 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/FeaturePair.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqFeature/Gene/ -rw-r--r-- root/root 6374 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Exon.pm -rw-r--r-- root/root 2905 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/ExonI.pm -rw-r--r-- root/root 10660 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/GeneStructure.pm -rw-r--r-- root/root 4848 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/GeneStructureI.pm -rw-r--r-- root/root 9169 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Intron.pm -rw-r--r-- root/root 2700 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/NC_Feature.pm -rw-r--r-- root/root 1988 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Poly_A_site.pm -rw-r--r-- root/root 1962 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Promoter.pm -rw-r--r-- root/root 22539 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Transcript.pm -rw-r--r-- root/root 5840 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/TranscriptI.pm -rw-r--r-- root/root 3289 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/UTR.pm -rw-r--r-- root/root 31395 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Generic.pm -rw-r--r-- root/root 24659 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Lite.pm -rw-r--r-- root/root 9485 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/PositionProxy.pm -rw-r--r-- root/root 12239 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Primer.pm -rw-r--r-- root/root 4670 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Similarity.pm -rw-r--r-- root/root 7295 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/SimilarityPair.pm -rw-r--r-- root/root 6309 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/SubSeq.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqFeature/Tools/ -rw-r--r-- root/root 6256 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/FeatureNamer.pm -rw-r--r-- root/root 7149 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/IDHandler.pm -rw-r--r-- root/root 14449 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/TypeMapper.pm -rw-r--r-- root/root 91336 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/Unflattener.pm -rw-r--r-- root/root 3328 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/TypedSeqFeatureI.pm -rw-r--r-- root/root 25329 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeatureI.pm -rw-r--r-- root/root 6576 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqI.pm -rw-r--r-- root/root 25083 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqIO/ -rw-r--r-- root/root 7634 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/FTHelper.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqIO/Handler/ -rw-r--r-- root/root 39054 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqIO/Handler/GenericRichSeqHandler.pm -rw-r--r-- root/root 4999 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/MultiFile.pm -rw-r--r-- root/root 5456 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/ace.pm -rw-r--r-- root/root 5630 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/asciitree.pm -rw-r--r-- root/root 48677 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/bsml.pm -rw-r--r-- root/root 8127 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/bsml_sax.pm -rw-r--r-- root/root 51630 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/embl.pm -rw-r--r-- root/root 10894 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/embldriver.pm -rw-r--r-- root/root 12299 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/fasta.pm -rw-r--r-- root/root 18244 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/fastq.pm -rw-r--r-- root/root 4499 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqIO/game/ -rw-r--r-- root/root 22538 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/featHandler.pm -rw-r--r-- root/root 5046 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/gameHandler.pm -rw-r--r-- root/root 11586 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/gameSubs.pm -rw-r--r-- root/root 34989 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/gameWriter.pm -rw-r--r-- root/root 14369 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/seqHandler.pm -rw-r--r-- root/root 16216 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/gbdriver.pm -rw-r--r-- root/root 13213 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/gbxml.pm -rw-r--r-- root/root 7980 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/gcg.pm -rw-r--r-- root/root 72095 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/genbank.pm -rw-r--r-- root/root 8408 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/kegg.pm -rw-r--r-- root/root 4965 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/largefasta.pm -rw-r--r-- root/root 15490 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/locuslink.pm -rw-r--r-- root/root 21613 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/mbsout.pm -rw-r--r-- root/root 6467 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/metafasta.pm -rw-r--r-- root/root 25692 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/msout.pm -rw-r--r-- root/root 12934 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/phd.pm -rw-r--r-- root/root 4716 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/pir.pm -rw-r--r-- root/root 8434 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/qual.pm -rw-r--r-- root/root 5692 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/raw.pm -rw-r--r-- root/root 46817 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/scf.pm -rw-r--r-- root/root 29091 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/seqxml.pm -rw-r--r-- root/root 52322 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/swiss.pm -rw-r--r-- root/root 9003 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/swissdriver.pm -rw-r--r-- root/root 4477 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tab.pm -rw-r--r-- root/root 26593 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/table.pm -rw-r--r-- root/root 33209 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tigr.pm -rw-r--r-- root/root 17288 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tigrxml.pm -rw-r--r-- root/root 11316 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tinyseq.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/SeqIO/tinyseq/ -rw-r--r-- root/root 6341 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tinyseq/tinyseqHandler.pm -rw-r--r-- root/root 58335 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqUtils.pm -rw-r--r-- root/root 92964 2021-02-03 05:04 ./usr/share/perl5/Bio/SimpleAlign.pm -rw-r--r-- root/root 7761 2021-02-03 05:04 ./usr/share/perl5/Bio/SimpleAnalysisI.pm -rw-r--r-- root/root 19633 2021-02-03 05:04 ./usr/share/perl5/Bio/Species.pm -rw-r--r-- root/root 24652 2021-02-03 05:04 ./usr/share/perl5/Bio/Taxon.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Alignment/ -rw-r--r-- root/root 64748 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Alignment/Consed.pm -rw-r--r-- root/root 22317 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Alignment/Trim.pm -rw-r--r-- root/root 16166 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/AmpliconSearch.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Analysis/ -rw-r--r-- root/root 7001 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Analysis/SimpleAnalysisBase.pm -rw-r--r-- root/root 9630 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/AnalysisResult.pm -rw-r--r-- root/root 6984 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Blat.pm -rw-r--r-- root/root 29040 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/CodonTable.pm -rw-r--r-- root/root 6413 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Coil.pm -rw-r--r-- root/root 14361 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/ECnumber.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/EMBOSS/ -rw-r--r-- root/root 5562 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/EMBOSS/Palindrome.pm -rw-r--r-- root/root 6433 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/EPCR.pm -rw-r--r-- root/root 11199 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/ESTScan.pm -rw-r--r-- root/root 7812 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Eponine.pm -rw-r--r-- root/root 12071 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Est2Genome.pm -rw-r--r-- root/root 15590 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Fgenesh.pm -rw-r--r-- root/root 6647 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/FootPrinter.pm -rw-r--r-- root/root 38214 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/GFF.pm -rw-r--r-- root/root 9408 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Geneid.pm -rw-r--r-- root/root 15046 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genemark.pm -rw-r--r-- root/root 8992 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genewise.pm -rw-r--r-- root/root 5391 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genomewise.pm -rw-r--r-- root/root 13589 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genscan.pm -rw-r--r-- root/root 19019 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Glimmer.pm -rw-r--r-- root/root 6381 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Grail.pm -rw-r--r-- root/root 22639 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/GuessSeqFormat.pm -rw-r--r-- root/root 14299 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/IUPAC.pm -rw-r--r-- root/root 21683 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Lucy.pm -rw-r--r-- root/root 9802 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/MZEF.pm -rw-r--r-- root/root 5597 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Match.pm -rw-r--r-- root/root 11728 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/OddCodes.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Phylo/ -rw-r--r-- root/root 4596 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Gerp.pm -rw-r--r-- root/root 8471 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Molphy.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Phylo/Molphy/ -rw-r--r-- root/root 8852 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Molphy/Result.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Phylo/Phylip/ -rw-r--r-- root/root 3933 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Phylip/ProtDist.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Prediction/ -rw-r--r-- root/root 5613 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Prediction/Exon.pm -rw-r--r-- root/root 4774 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Prediction/Gene.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Primer/ drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Primer/Assessor/ -rw-r--r-- root/root 2332 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/Assessor/Base.pm -rw-r--r-- root/root 2113 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/AssessorI.pm -rw-r--r-- root/root 3348 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/Feature.pm -rw-r--r-- root/root 3340 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/Pair.pm -rw-r--r-- root/root 12663 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer3.pm -rw-r--r-- root/root 6096 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Prints.pm -rw-r--r-- root/root 4608 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Profile.pm -rw-r--r-- root/root 7281 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Promoterwise.pm -rw-r--r-- root/root 4869 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/PrositeScan.pm -rw-r--r-- root/root 6516 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Pseudowise.pm -rw-r--r-- root/root 12051 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/QRNA.pm -rw-r--r-- root/root 5862 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/RandomDistFunctions.pm -rw-r--r-- root/root 4223 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/RepeatMasker.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Run/ -rw-r--r-- root/root 24413 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/Analysis.pm -rw-r--r-- root/root 10889 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/AnalysisFactory.pm -rw-r--r-- root/root 3362 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/GenericParameters.pm -rw-r--r-- root/root 2860 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/ParametersI.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Run/Phylo/ -rw-r--r-- root/root 8609 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/Phylo/PhyloBase.pm -rw-r--r-- root/root 14176 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/WrapperBase.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Run/WrapperBase/ -rw-r--r-- root/root 41120 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/WrapperBase/CommandExts.pm -rw-r--r-- root/root 3541 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Seg.pm -rw-r--r-- root/root 26154 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqPattern.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/SeqPattern/ -rw-r--r-- root/root 22486 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqPattern/Backtranslate.pm -rw-r--r-- root/root 28296 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqStats.pm -rw-r--r-- root/root 9515 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqWords.pm -rw-r--r-- root/root 18404 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Sigcleave.pm -rw-r--r-- root/root 7755 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Signalp.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Signalp/ -rw-r--r-- root/root 17373 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Signalp/ExtendedSignalp.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Sim4/ -rw-r--r-- root/root 5470 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Sim4/Exon.pm -rw-r--r-- root/root 15247 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Sim4/Results.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tools/Spidey/ -rw-r--r-- root/root 6340 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Spidey/Exon.pm -rw-r--r-- root/root 14640 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Spidey/Results.pm -rw-r--r-- root/root 9265 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/TandemRepeatsFinder.pm -rw-r--r-- root/root 12225 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/TargetP.pm -rw-r--r-- root/root 3507 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Tmhmm.pm -rw-r--r-- root/root 7597 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/ipcress.pm -rw-r--r-- root/root 6811 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/isPcr.pm -rw-r--r-- root/root 10462 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/pICalculator.pm -rw-r--r-- root/root 8405 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/tRNAscanSE.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/Tree/ -rw-r--r-- root/root 8378 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/AnnotatableNode.pm -rw-r--r-- root/root 12844 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Compatible.pm -rw-r--r-- root/root 16956 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/DistanceFactory.pm -rw-r--r-- root/root 21958 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Node.pm -rw-r--r-- root/root 11871 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/NodeI.pm -rw-r--r-- root/root 4680 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/NodeNHX.pm -rw-r--r-- root/root 14194 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/RandomFactory.pm -rw-r--r-- root/root 29044 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Statistics.pm -rw-r--r-- root/root 15063 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Tree.pm -rw-r--r-- root/root 35263 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/TreeFunctionsI.pm -rw-r--r-- root/root 7137 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/TreeI.pm -rw-r--r-- root/root 8440 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO.pm drwxr-xr-x root/root 0 2026-06-21 20:49 ./usr/share/perl5/Bio/TreeIO/ -rw-r--r-- root/root 7886 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/NewickParser.pm -rw-r--r-- root/root 8332 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/TreeEventBuilder.pm -rw-r--r-- root/root 5406 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/cluster.pm -rw-r--r-- root/root 6572 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/lintree.pm -rw-r--r-- root/root 9121 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/newick.pm -rw-r--r-- root/root 10727 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/nexus.pm -rw-r--r-- root/root 2758 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/nhx.pm -rw-r--r-- root/root 7065 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/pag.pm -rw-r--r-- root/root 42868 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/phyloxml.pm -rw-r--r-- root/root 3674 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/tabtree.pm -rw-r--r-- root/root 3517 2021-02-03 05:04 ./usr/share/perl5/Bio/UpdateableSeqI.pm -rw-r--r-- root/root 5190 2021-02-03 05:04 ./usr/share/perl5/Bio/WebAgent.pm -rw-r--r-- root/root 7252 2021-02-03 05:04 ./usr/share/perl5/BioPerl.pm +------------------------------------------------------------------------------+ | Post Build Sat, 11 Jul 2026 16:12:42 +0000 | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup Sat, 11 Jul 2026 16:12:42 +0000 | +------------------------------------------------------------------------------+ Purging /build/bioperl-QLxev6 Not cleaning session: cloned chroot in use +------------------------------------------------------------------------------+ | Summary Sat, 11 Jul 2026 16:12:43 +0000 | +------------------------------------------------------------------------------+ Build Architecture: amd64 Build Type: full Build-Space: 76544 Build-Time: 103 Distribution: perl-5.44-throwaway Host Architecture: amd64 Install-Time: 26 Job: /srv/debomatic/incoming/bioperl_1.7.8-4.dsc Machine Architecture: amd64 Package: bioperl Package-Time: 137 Source-Version: 1.7.8-4 Space: 76544 Status: successful Version: 1.7.8-4 -------------------------------------------------------------------------------- Finished at 2026-07-11T16:12:41Z Build needed 00:02:17, 76544k disk space