sbuild (Debian sbuild) 0.85.9 (29 May 2024) on carme.larted.org.uk +==============================================================================+ | trinityrnaseq 2.15.1+dfsg-5 (amd64) Wed, 05 Jun 2024 11:50:17 +0000 | +==============================================================================+ Package: trinityrnaseq Version: 2.15.1+dfsg-5 Source Version: 2.15.1+dfsg-5 Distribution: perl-5.40-throwaway Machine Architecture: amd64 Host Architecture: amd64 Build Architecture: amd64 Build Type: full I: NOTICE: Log filtering will replace 'var/run/schroot/mount/perl-5.40-amd64-debomatic-c4432663-5099-4aa0-bc0e-6acbd76e645f' with '<>' +------------------------------------------------------------------------------+ | Chroot Setup Commands | +------------------------------------------------------------------------------+ /usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup trinityrnaseq_2.15.1+dfsg-5 perl-5.40-throwaway amd64 ---------------------------------------------------------------------------------------------------------------------------- I: Finished running '/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup trinityrnaseq_2.15.1+dfsg-5 perl-5.40-throwaway amd64'. Finished processing commands. -------------------------------------------------------------------------------- I: NOTICE: Log filtering will replace 'build/trinityrnaseq-Xko77x/resolver-oCozW9' with '<>' +------------------------------------------------------------------------------+ | Update chroot | +------------------------------------------------------------------------------+ Get:1 file:/srv/reprepro perl-5.40 InRelease [3039 B] Get:2 http://localhost:3142/debian unstable InRelease [198 kB] Get:1 file:/srv/reprepro perl-5.40 InRelease [3039 B] Get:3 http://localhost:3142/debian sid InRelease [198 kB] Get:4 http://localhost:3142/debian unstable/main amd64 Packages.diff/Index [63.6 kB] Get:5 http://localhost:3142/debian unstable/main amd64 Packages T-2024-06-05-0804.11-F-2024-06-03-0205.12.pdiff [122 kB] Get:6 file:/srv/reprepro perl-5.40/main amd64 Packages [598 kB] Get:5 http://localhost:3142/debian unstable/main amd64 Packages T-2024-06-05-0804.11-F-2024-06-03-0205.12.pdiff [122 kB] Get:7 http://localhost:3142/debian sid/main Sources.diff/Index [63.6 kB] Get:8 http://localhost:3142/debian sid/main Sources T-2024-06-05-0804.11-F-2024-06-03-0205.12.pdiff [83.8 kB] Get:8 http://localhost:3142/debian sid/main Sources T-2024-06-05-0804.11-F-2024-06-03-0205.12.pdiff [83.8 kB] Fetched 730 kB in 3s (242 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages will be upgraded: bsdutils libblkid1 libmount1 libsmartcols1 libssl3t64 libuuid1 login passwd util-linux 9 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 5660 kB of archives. After this operation, 53.2 kB disk space will be freed. Get:1 http://localhost:3142/debian unstable/main amd64 bsdutils amd64 1:2.40.1-8 [104 kB] Get:2 http://localhost:3142/debian unstable/main amd64 login amd64 1:4.13+dfsg1-5 [590 kB] Get:3 http://localhost:3142/debian unstable/main amd64 libsmartcols1 amd64 2.40.1-8 [137 kB] Get:4 http://localhost:3142/debian unstable/main amd64 libuuid1 amd64 2.40.1-8 [34.7 kB] Get:5 http://localhost:3142/debian unstable/main amd64 libblkid1 amd64 2.40.1-8 [166 kB] Get:6 http://localhost:3142/debian unstable/main amd64 libmount1 amd64 2.40.1-8 [197 kB] Get:7 http://localhost:3142/debian unstable/main amd64 util-linux amd64 2.40.1-8 [1210 kB] Get:8 http://localhost:3142/debian unstable/main amd64 passwd amd64 1:4.13+dfsg1-5 [974 kB] Get:9 http://localhost:3142/debian unstable/main amd64 libssl3t64 amd64 3.2.2-1 [2246 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 5660 kB in 0s (129 MB/s) (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21779 files and directories currently installed.) Preparing to unpack .../bsdutils_1%3a2.40.1-8_amd64.deb ... Unpacking bsdutils (1:2.40.1-8) over (1:2.40.1-7) ... Setting up bsdutils (1:2.40.1-8) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21779 files and directories currently installed.) Preparing to unpack .../login_1%3a4.13+dfsg1-5_amd64.deb ... Unpacking login (1:4.13+dfsg1-5) over (1:4.13+dfsg1-4) ... Setting up login (1:4.13+dfsg1-5) ... Installing new version of config file /etc/pam.d/login ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../libsmartcols1_2.40.1-8_amd64.deb ... Unpacking libsmartcols1:amd64 (2.40.1-8) over (2.40.1-7) ... Setting up libsmartcols1:amd64 (2.40.1-8) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../libuuid1_2.40.1-8_amd64.deb ... Unpacking libuuid1:amd64 (2.40.1-8) over (2.40.1-7) ... Setting up libuuid1:amd64 (2.40.1-8) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../libblkid1_2.40.1-8_amd64.deb ... Unpacking libblkid1:amd64 (2.40.1-8) over (2.40.1-7) ... Setting up libblkid1:amd64 (2.40.1-8) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../libmount1_2.40.1-8_amd64.deb ... Unpacking libmount1:amd64 (2.40.1-8) over (2.40.1-7) ... Setting up libmount1:amd64 (2.40.1-8) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../util-linux_2.40.1-8_amd64.deb ... Unpacking util-linux (2.40.1-8) over (2.40.1-7) ... Setting up util-linux (2.40.1-8) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../passwd_1%3a4.13+dfsg1-5_amd64.deb ... Unpacking passwd (1:4.13+dfsg1-5) over (1:4.13+dfsg1-4) ... Setting up passwd (1:4.13+dfsg1-5) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../libssl3t64_3.2.2-1_amd64.deb ... Unpacking libssl3t64:amd64 (3.2.2-1) over (3.2.1-3) ... Setting up libssl3t64:amd64 (3.2.2-1) ... Processing triggers for libc-bin (2.38-12) ... +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- /srv/debomatic/incoming/trinityrnaseq_2.15.1+dfsg-5.dsc exists in /srv/debomatic/incoming; copying to chroot I: NOTICE: Log filtering will replace 'build/trinityrnaseq-Xko77x/trinityrnaseq-2.15.1+dfsg' with '<>' I: NOTICE: Log filtering will replace 'build/trinityrnaseq-Xko77x' with '<>' +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libjung-free-java (>= 2.1.1), javahelper, libgetopt-java, default-jdk, libjs-jquery, jaligner, libhts-dev, zlib1g-dev, cmake, build-essential, fakeroot Filtered Build-Depends: debhelper-compat (= 13), libjung-free-java (>= 2.1.1), javahelper, libgetopt-java, default-jdk, libjs-jquery, jaligner, libhts-dev, zlib1g-dev, cmake, build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<>/apt_archive/sbuild-build-depends-main-dummy.deb'. Ign:1 copy:/<>/apt_archive ./ InRelease Get:2 copy:/<>/apt_archive ./ Release [609 B] Ign:3 copy:/<>/apt_archive ./ Release.gpg Get:4 copy:/<>/apt_archive ./ Sources [743 B] Get:5 copy:/<>/apt_archive ./ Packages [775 B] Fetched 2127 B in 0s (191 kB/s) Reading package lists... Reading package lists... Install main build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following additional packages will be installed: adwaita-icon-theme at-spi2-common autoconf automake autopoint autotools-dev binfmt-support bsdextrautils ca-certificates ca-certificates-java cmake cmake-data dctrl-tools debhelper default-jdk default-jdk-headless default-jre default-jre-headless devscripts dh-autoreconf dh-strip-nondeterminism dwz fakeroot fastjar file fontconfig fontconfig-config fonts-dejavu-core fonts-dejavu-mono gettext gettext-base groff-base gtk-update-icon-cache hicolor-icon-theme intltool-debian jaligner jarwrapper java-common javahelper libarchive-zip-perl libarchive13t64 libasound2-data libasound2t64 libatinject-jsr330-api-java libatk1.0-0t64 libavahi-client3 libavahi-common-data libavahi-common3 libb-hooks-op-check-perl libbrotli1 libbsd0 libcairo2 libclass-method-modifiers-perl libclass-xsaccessor-perl libclone-perl libcom-err2 libcups2t64 libcurl3t64-gnutls libcurl4-gnutls-dev libcurl4t64 libdatrie1 libdbus-1-3 libdebhelper-perl libdeflate-dev libdeflate0 libdevel-callchecker-perl libdrm-amdgpu1 libdrm-common libdrm-intel1 libdrm-radeon1 libdrm2 libdynaloader-functions-perl libedit2 libelf1t64 libencode-locale-perl liberror-prone-java libexpat1 libfakeroot libfile-dirlist-perl libfile-homedir-perl libfile-listing-perl libfile-stripnondeterminism-perl libfile-touch-perl libfile-which-perl libfontconfig1 libfreetype6 libfribidi0 libgdk-pixbuf-2.0-0 libgdk-pixbuf2.0-common libgetopt-java libgif7 libgl1 libgl1-mesa-dri libglapi-mesa libglib2.0-0t64 libglvnd0 libglx-mesa0 libglx0 libgraphite2-3 libgssapi-krb5-2 libgtk2.0-0t64 libgtk2.0-common libguava-java libharfbuzz0b libhtml-parser-perl libhtml-tagset-perl libhtml-tree-perl libhts-dev libhts3t64 libhtscodecs2 libhttp-cookies-perl libhttp-date-perl libhttp-message-perl libhttp-negotiate-perl libicu72 libimport-into-perl libio-html-perl libio-pty-perl libio-socket-ssl-perl libipc-run-perl libjbig0 libjpeg62-turbo libjs-jquery libjsoncpp25 libjsr305-java libjung-free-java libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 liblcms2-2 liblerc4 libllvm17t64 liblwp-mediatypes-perl liblwp-protocol-https-perl liblzma-dev libmagic-mgc libmagic1t64 libmodule-runtime-perl libmoo-perl libnet-http-perl libnet-ssleay-perl libnghttp2-14 libnspr4 libnss3 libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libparams-classify-perl libpciaccess0 libpcsclite1 libpipeline1 libpixman-1-0 libpng16-16t64 libproc2-0 libpsl5t64 libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib librhash0 librole-tiny-perl librtmp1 libsensors-config libsensors5 libsharpyuv0 libssh2-1t64 libsub-quote-perl libthai-data libthai0 libtiff6 libtimedate-perl libtool libtry-tiny-perl libuchardet0 liburi-perl libuv1t64 libvulkan1 libwebp7 libwww-perl libwww-robotrules-perl libx11-6 libx11-data libx11-xcb1 libxau6 libxcb-dri2-0 libxcb-dri3-0 libxcb-glx0 libxcb-present0 libxcb-randr0 libxcb-render0 libxcb-shm0 libxcb-sync1 libxcb-xfixes0 libxcb1 libxcomposite1 libxcursor1 libxdamage1 libxdmcp6 libxext6 libxfixes3 libxi6 libxinerama1 libxml2 libxrandr2 libxrender1 libxshmfence1 libxtst6 libxxf86vm1 libz3-4 m4 man-db media-types netbase openjdk-17-jdk openjdk-17-jdk-headless openjdk-17-jre openjdk-17-jre-headless openssl patchutils perl-openssl-defaults po-debconf procps python3 python3-minimal python3.11 python3.11-minimal sensible-utils shared-mime-info tzdata wdiff x11-common zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc cmake-doc cmake-format elpa-cmake-mode ninja-build debtags dh-make adequate at autopkgtest bls-standalone bsd-mailx | mailx check-all-the-things cvs-buildpackage diffoscope disorderfs dose-extra duck elpa-devscripts faketime gnuplot how-can-i-help libauthen-sasl-perl libdbd-pg-perl libfile-desktopentry-perl libterm-size-perl libyaml-syck-perl mmdebstrap mutt piuparts postgresql-client pristine-lfs quilt ratt reprotest ssh-client svn-buildpackage w3m gettext-doc libasprintf-dev libgettextpo-dev groff lrzip alsa-utils libasound2-plugins libatinject-jsr330-api-java-doc cups-common libcurl4-doc libgnutls28-dev libidn-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev pkgconf low-memory-monitor krb5-doc krb5-user gvfs libdata-dump-perl libjsr305-java-doc liblcms2-utils libcrypt-ssleay-perl liblzma-doc libscalar-number-perl pciutils pcscd lm-sensors libtool-doc gfortran | fortran95-compiler gcj-jdk libsub-name-perl libbusiness-isbn-perl libregexp-ipv6-perl libauthen-ntlm-perl m4-doc apparmor less www-browser openjdk-17-demo openjdk-17-source visualvm libnss-mdns fonts-dejavu-extra fonts-ipafont-gothic fonts-ipafont-mincho fonts-wqy-microhei | fonts-wqy-zenhei fonts-indic libmail-box-perl python3-doc python3-tk python3-venv python3.11-venv python3.11-doc wdiff-doc Recommended packages: librsvg2-common dput | dupload libdistro-info-perl libgit-wrapper-perl libjson-perl liblist-compare-perl libstring-shellquote-perl licensecheck lintian python3-apt python3-debian python3-magic python3-requests python3-unidiff python3-xdg strace unzip wget | curl debian-keyring equivs libgitlab-api-v4-perl libsoap-lite-perl pristine-tar curl | wget | lynx alsa-ucm-conf alsa-topology-conf dbus libarchive-cpio-perl libgdk-pixbuf2.0-bin libglib2.0-data xdg-user-dirs libgail-common libgtk2.0-bin libhtml-format-perl libio-compress-brotli-perl javascript-common krb5-locales libnamespace-clean-perl publicsuffix libxstring-perl libltdl-dev mesa-vulkan-drivers | vulkan-icd libdata-dump-perl libhtml-form-perl libhttp-daemon-perl libmailtools-perl libxt-dev libatk-wrapper-java-jni fonts-dejavu-extra libmail-sendmail-perl psmisc The following NEW packages will be installed: adwaita-icon-theme at-spi2-common autoconf automake autopoint autotools-dev binfmt-support bsdextrautils ca-certificates ca-certificates-java cmake cmake-data dctrl-tools debhelper default-jdk default-jdk-headless default-jre default-jre-headless devscripts dh-autoreconf dh-strip-nondeterminism dwz fakeroot fastjar file fontconfig fontconfig-config fonts-dejavu-core fonts-dejavu-mono gettext gettext-base groff-base gtk-update-icon-cache hicolor-icon-theme intltool-debian jaligner jarwrapper java-common javahelper libarchive-zip-perl libarchive13t64 libasound2-data libasound2t64 libatinject-jsr330-api-java libatk1.0-0t64 libavahi-client3 libavahi-common-data libavahi-common3 libb-hooks-op-check-perl libbrotli1 libbsd0 libcairo2 libclass-method-modifiers-perl libclass-xsaccessor-perl libclone-perl libcom-err2 libcups2t64 libcurl3t64-gnutls libcurl4-gnutls-dev libcurl4t64 libdatrie1 libdbus-1-3 libdebhelper-perl libdeflate-dev libdeflate0 libdevel-callchecker-perl libdrm-amdgpu1 libdrm-common libdrm-intel1 libdrm-radeon1 libdrm2 libdynaloader-functions-perl libedit2 libelf1t64 libencode-locale-perl liberror-prone-java libexpat1 libfakeroot libfile-dirlist-perl libfile-homedir-perl libfile-listing-perl libfile-stripnondeterminism-perl libfile-touch-perl libfile-which-perl libfontconfig1 libfreetype6 libfribidi0 libgdk-pixbuf-2.0-0 libgdk-pixbuf2.0-common libgetopt-java libgif7 libgl1 libgl1-mesa-dri libglapi-mesa libglib2.0-0t64 libglvnd0 libglx-mesa0 libglx0 libgraphite2-3 libgssapi-krb5-2 libgtk2.0-0t64 libgtk2.0-common libguava-java libharfbuzz0b libhtml-parser-perl libhtml-tagset-perl libhtml-tree-perl libhts-dev libhts3t64 libhtscodecs2 libhttp-cookies-perl libhttp-date-perl libhttp-message-perl libhttp-negotiate-perl libicu72 libimport-into-perl libio-html-perl libio-pty-perl libio-socket-ssl-perl libipc-run-perl libjbig0 libjpeg62-turbo libjs-jquery libjsoncpp25 libjsr305-java libjung-free-java libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 liblcms2-2 liblerc4 libllvm17t64 liblwp-mediatypes-perl liblwp-protocol-https-perl liblzma-dev libmagic-mgc libmagic1t64 libmodule-runtime-perl libmoo-perl libnet-http-perl libnet-ssleay-perl libnghttp2-14 libnspr4 libnss3 libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libparams-classify-perl libpciaccess0 libpcsclite1 libpipeline1 libpixman-1-0 libpng16-16t64 libproc2-0 libpsl5t64 libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib librhash0 librole-tiny-perl librtmp1 libsensors-config libsensors5 libsharpyuv0 libssh2-1t64 libsub-quote-perl libthai-data libthai0 libtiff6 libtimedate-perl libtool libtry-tiny-perl libuchardet0 liburi-perl libuv1t64 libvulkan1 libwebp7 libwww-perl libwww-robotrules-perl libx11-6 libx11-data libx11-xcb1 libxau6 libxcb-dri2-0 libxcb-dri3-0 libxcb-glx0 libxcb-present0 libxcb-randr0 libxcb-render0 libxcb-shm0 libxcb-sync1 libxcb-xfixes0 libxcb1 libxcomposite1 libxcursor1 libxdamage1 libxdmcp6 libxext6 libxfixes3 libxi6 libxinerama1 libxml2 libxrandr2 libxrender1 libxshmfence1 libxtst6 libxxf86vm1 libz3-4 m4 man-db media-types netbase openjdk-17-jdk openjdk-17-jdk-headless openjdk-17-jre openjdk-17-jre-headless openssl patchutils perl-openssl-defaults po-debconf procps python3 python3-minimal python3.11 python3.11-minimal sbuild-build-depends-main-dummy sensible-utils shared-mime-info tzdata wdiff x11-common zlib1g-dev 0 upgraded, 233 newly installed, 0 to remove and 0 not upgraded. Need to get 233 MB/234 MB of archives. After this operation, 737 MB of additional disk space will be used. Get:1 file:/srv/reprepro perl-5.40/main amd64 libio-pty-perl amd64 1:1.20-1+b2 [34.3 kB] Get:2 copy:/<>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [956 B] Get:3 file:/srv/reprepro perl-5.40/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b4 [36.3 kB] Get:4 file:/srv/reprepro perl-5.40/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b2 [10.6 kB] Get:5 file:/srv/reprepro perl-5.40/main amd64 libdevel-callchecker-perl amd64 0.009-1+b1 [16.1 kB] Get:6 file:/srv/reprepro perl-5.40/main amd64 libparams-classify-perl amd64 0.015-2+b4 [22.4 kB] Get:7 file:/srv/reprepro perl-5.40/main amd64 libhtml-parser-perl amd64 3.82-1+b1 [99.2 kB] Get:8 file:/srv/reprepro perl-5.40/main amd64 libclone-perl amd64 0.46-1+b3 [13.7 kB] Get:9 http://localhost:3142/debian unstable/main amd64 libpipeline1 amd64 1.5.7-2 [38.0 kB] Get:10 file:/srv/reprepro perl-5.40/main amd64 libnet-ssleay-perl amd64 1.94-1+b2 [339 kB] Get:11 http://localhost:3142/debian unstable/main amd64 binfmt-support amd64 2.2.2-7 [64.3 kB] Get:12 http://localhost:3142/debian unstable/main amd64 libpython3.11-minimal amd64 3.11.9-1 [817 kB] Get:13 http://localhost:3142/debian unstable/main amd64 libexpat1 amd64 2.6.2-1 [103 kB] Get:14 http://localhost:3142/debian unstable/main amd64 python3.11-minimal amd64 3.11.9-1 [1879 kB] Get:15 http://localhost:3142/debian unstable/main amd64 python3-minimal amd64 3.11.8-1 [26.3 kB] Get:16 http://localhost:3142/debian unstable/main amd64 media-types all 10.1.0 [26.9 kB] Get:17 http://localhost:3142/debian unstable/main amd64 netbase all 6.4 [12.8 kB] Get:18 http://localhost:3142/debian unstable/main amd64 tzdata all 2024a-4 [255 kB] Get:19 http://localhost:3142/debian unstable/main amd64 libpython3.11-stdlib amd64 3.11.9-1 [1792 kB] Get:20 http://localhost:3142/debian unstable/main amd64 python3.11 amd64 3.11.9-1 [602 kB] Get:21 http://localhost:3142/debian unstable/main amd64 libpython3-stdlib amd64 3.11.8-1 [9332 B] Get:22 http://localhost:3142/debian unstable/main amd64 python3 amd64 3.11.8-1 [27.4 kB] Get:23 http://localhost:3142/debian unstable/main amd64 libproc2-0 amd64 2:4.0.4-4 [64.6 kB] Get:24 http://localhost:3142/debian unstable/main amd64 procps amd64 2:4.0.4-4 [880 kB] Get:25 http://localhost:3142/debian unstable/main amd64 sensible-utils all 0.0.22 [22.4 kB] Get:26 http://localhost:3142/debian unstable/main amd64 openssl amd64 3.2.2-1 [1364 kB] Get:27 http://localhost:3142/debian unstable/main amd64 ca-certificates all 20240203 [158 kB] Get:28 http://localhost:3142/debian unstable/main amd64 libmagic-mgc amd64 1:5.45-3 [314 kB] Get:29 http://localhost:3142/debian unstable/main amd64 libmagic1t64 amd64 1:5.45-3 [105 kB] Get:30 http://localhost:3142/debian unstable/main amd64 file amd64 1:5.45-3 [42.9 kB] Get:31 http://localhost:3142/debian unstable/main amd64 gettext-base amd64 0.21-14+b1 [161 kB] Get:32 http://localhost:3142/debian unstable/main amd64 libuchardet0 amd64 0.0.8-1+b1 [68.8 kB] Get:33 http://localhost:3142/debian unstable/main amd64 groff-base amd64 1.23.0-4 [1180 kB] Get:34 http://localhost:3142/debian unstable/main amd64 bsdextrautils amd64 2.40.1-8 [96.0 kB] Get:35 http://localhost:3142/debian unstable/main amd64 man-db amd64 2.12.1-1 [1411 kB] Get:36 http://localhost:3142/debian unstable/main amd64 libgdk-pixbuf2.0-common all 2.42.12+dfsg-1 [311 kB] Get:37 http://localhost:3142/debian unstable/main amd64 libglib2.0-0t64 amd64 2.80.2-2 [1485 kB] Get:38 http://localhost:3142/debian unstable/main amd64 libicu72 amd64 72.1-4+b1 [9395 kB] Get:39 http://localhost:3142/debian unstable/main amd64 libxml2 amd64 2.12.7+dfsg-3 [670 kB] Get:40 http://localhost:3142/debian unstable/main amd64 shared-mime-info amd64 2.4-5 [758 kB] Get:41 http://localhost:3142/debian unstable/main amd64 libjpeg62-turbo amd64 1:2.1.5-3 [167 kB] Get:42 http://localhost:3142/debian unstable/main amd64 libpng16-16t64 amd64 1.6.43-5 [278 kB] Get:43 http://localhost:3142/debian unstable/main amd64 libdeflate0 amd64 1.20-1 [46.0 kB] Get:44 http://localhost:3142/debian unstable/main amd64 libjbig0 amd64 2.1-6.1+b1 [32.0 kB] Get:45 http://localhost:3142/debian unstable/main amd64 liblerc4 amd64 4.0.0+ds-4+b1 [171 kB] Get:46 http://localhost:3142/debian unstable/main amd64 libsharpyuv0 amd64 1.4.0-0.1 [113 kB] Get:47 http://localhost:3142/debian unstable/main amd64 libwebp7 amd64 1.4.0-0.1 [311 kB] Get:48 http://localhost:3142/debian unstable/main amd64 libtiff6 amd64 4.5.1+git230720-4 [322 kB] Get:49 http://localhost:3142/debian unstable/main amd64 libgdk-pixbuf-2.0-0 amd64 2.42.12+dfsg-1 [139 kB] Get:50 http://localhost:3142/debian unstable/main amd64 gtk-update-icon-cache amd64 3.24.42-1 [46.7 kB] Get:51 http://localhost:3142/debian unstable/main amd64 hicolor-icon-theme all 0.18-1 [12.0 kB] Get:52 http://localhost:3142/debian unstable/main amd64 adwaita-icon-theme all 46.0-1 [614 kB] Get:53 http://localhost:3142/debian unstable/main amd64 at-spi2-common all 2.52.0-1 [166 kB] Get:54 http://localhost:3142/debian unstable/main amd64 m4 amd64 1.4.19-4 [287 kB] Get:55 http://localhost:3142/debian unstable/main amd64 autoconf all 2.71-3 [332 kB] Get:56 http://localhost:3142/debian unstable/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get:57 http://localhost:3142/debian unstable/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get:58 http://localhost:3142/debian unstable/main amd64 autopoint all 0.21-14 [496 kB] Get:59 http://localhost:3142/debian unstable/main amd64 ca-certificates-java all 20240118 [11.6 kB] Get:60 http://localhost:3142/debian unstable/main amd64 libarchive13t64 amd64 3.7.2-2.1 [346 kB] Get:61 http://localhost:3142/debian unstable/main amd64 libbrotli1 amd64 1.1.0-2+b3 [305 kB] Get:62 http://localhost:3142/debian unstable/main amd64 libkrb5support0 amd64 1.20.1-6+b1 [33.3 kB] Get:63 http://localhost:3142/debian unstable/main amd64 libcom-err2 amd64 1.47.1-1 [22.9 kB] Get:64 http://localhost:3142/debian unstable/main amd64 libk5crypto3 amd64 1.20.1-6+b1 [79.8 kB] Get:65 http://localhost:3142/debian unstable/main amd64 libkeyutils1 amd64 1.6.3-3 [8952 B] Get:66 http://localhost:3142/debian unstable/main amd64 libkrb5-3 amd64 1.20.1-6+b1 [333 kB] Get:67 http://localhost:3142/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.20.1-6+b1 [135 kB] Get:68 http://localhost:3142/debian unstable/main amd64 libnghttp2-14 amd64 1.61.0-1+b1 [75.6 kB] Get:69 http://localhost:3142/debian unstable/main amd64 libpsl5t64 amd64 0.21.2-1.1 [56.8 kB] Get:70 http://localhost:3142/debian unstable/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b4 [58.5 kB] Get:71 http://localhost:3142/debian unstable/main amd64 libssh2-1t64 amd64 1.11.0-5 [215 kB] Get:72 http://localhost:3142/debian unstable/main amd64 libcurl4t64 amd64 8.8.0-1 [441 kB] Get:73 http://localhost:3142/debian unstable/main amd64 libjsoncpp25 amd64 1.9.5-6+b2 [81.9 kB] Get:74 http://localhost:3142/debian unstable/main amd64 librhash0 amd64 1.4.3-3+b1 [132 kB] Get:75 http://localhost:3142/debian unstable/main amd64 libuv1t64 amd64 1.48.0-4 [148 kB] Get:76 http://localhost:3142/debian unstable/main amd64 cmake-data all 3.29.4-1 [2167 kB] Get:77 http://localhost:3142/debian unstable/main amd64 cmake amd64 3.29.4-1 [10.7 MB] Get:78 http://localhost:3142/debian unstable/main amd64 dctrl-tools amd64 2.24-3+b1 [104 kB] Get:79 http://localhost:3142/debian unstable/main amd64 libdebhelper-perl all 13.15.3 [88.0 kB] Get:80 http://localhost:3142/debian unstable/main amd64 libtool all 2.4.7-7 [517 kB] Get:81 http://localhost:3142/debian unstable/main amd64 dh-autoreconf all 20 [17.1 kB] Get:82 http://localhost:3142/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get:83 http://localhost:3142/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get:84 http://localhost:3142/debian unstable/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get:85 http://localhost:3142/debian unstable/main amd64 libelf1t64 amd64 0.191-1+b1 [189 kB] Get:86 http://localhost:3142/debian unstable/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get:87 http://localhost:3142/debian unstable/main amd64 gettext amd64 0.21-14+b1 [1301 kB] Get:88 http://localhost:3142/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get:89 http://localhost:3142/debian unstable/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get:90 http://localhost:3142/debian unstable/main amd64 debhelper all 13.15.3 [901 kB] Get:91 http://localhost:3142/debian unstable/main amd64 java-common all 0.75 [6640 B] Get:92 http://localhost:3142/debian unstable/main amd64 liblcms2-2 amd64 2.14-2+b1 [154 kB] Get:93 http://localhost:3142/debian unstable/main amd64 libnspr4 amd64 2:4.35-1.1+b1 [109 kB] Get:94 http://localhost:3142/debian unstable/main amd64 libnss3 amd64 2:3.100-1 [1406 kB] Get:95 http://localhost:3142/debian unstable/main amd64 libpcsclite1 amd64 2.2.3-1 [54.9 kB] Get:96 http://localhost:3142/debian unstable/main amd64 openjdk-17-jre-headless amd64 17.0.11+9-1 [43.8 MB] Get:97 http://localhost:3142/debian unstable/main amd64 default-jre-headless amd64 2:1.17-75 [3068 B] Get:98 http://localhost:3142/debian unstable/main amd64 libgtk2.0-common all 2.24.33-4 [2661 kB] Get:99 http://localhost:3142/debian unstable/main amd64 libatk1.0-0t64 amd64 2.52.0-1 [50.8 kB] Get:100 http://localhost:3142/debian unstable/main amd64 libfreetype6 amd64 2.13.2+dfsg-1+b4 [439 kB] Get:101 http://localhost:3142/debian unstable/main amd64 fonts-dejavu-mono all 2.37-8 [489 kB] Get:102 http://localhost:3142/debian unstable/main amd64 fonts-dejavu-core all 2.37-8 [840 kB] Get:103 http://localhost:3142/debian unstable/main amd64 fontconfig-config amd64 2.15.0-1.1 [317 kB] Get:104 http://localhost:3142/debian unstable/main amd64 libfontconfig1 amd64 2.15.0-1.1 [388 kB] Get:105 http://localhost:3142/debian unstable/main amd64 libpixman-1-0 amd64 0.42.2-1+b1 [556 kB] Get:106 http://localhost:3142/debian unstable/main amd64 libxau6 amd64 1:1.0.9-1+b1 [18.1 kB] Get:107 http://localhost:3142/debian unstable/main amd64 libbsd0 amd64 0.12.2-1 [131 kB] Get:108 http://localhost:3142/debian unstable/main amd64 libxdmcp6 amd64 1:1.1.2-3+b1 [24.3 kB] Get:109 http://localhost:3142/debian unstable/main amd64 libxcb1 amd64 1.17.0-2 [144 kB] Get:110 http://localhost:3142/debian unstable/main amd64 libx11-data all 2:1.8.7-1 [328 kB] Get:111 http://localhost:3142/debian unstable/main amd64 libx11-6 amd64 2:1.8.7-1+b1 [799 kB] Get:112 http://localhost:3142/debian unstable/main amd64 libxcb-render0 amd64 1.17.0-2 [115 kB] Get:113 http://localhost:3142/debian unstable/main amd64 libxcb-shm0 amd64 1.17.0-2 [105 kB] Get:114 http://localhost:3142/debian unstable/main amd64 libxext6 amd64 2:1.3.4-1+b1 [52.9 kB] Get:115 http://localhost:3142/debian unstable/main amd64 libxrender1 amd64 1:0.9.10-1.1+b1 [27.9 kB] Get:116 http://localhost:3142/debian unstable/main amd64 libcairo2 amd64 1.18.0-3+b1 [531 kB] Get:117 http://localhost:3142/debian unstable/main amd64 libavahi-common-data amd64 0.8-13+b2 [112 kB] Get:118 http://localhost:3142/debian unstable/main amd64 libavahi-common3 amd64 0.8-13+b2 [43.3 kB] Get:119 http://localhost:3142/debian unstable/main amd64 libdbus-1-3 amd64 1.14.10-4+b1 [203 kB] Get:120 http://localhost:3142/debian unstable/main amd64 libavahi-client3 amd64 0.8-13+b2 [47.0 kB] Get:121 http://localhost:3142/debian unstable/main amd64 libcups2t64 amd64 2.4.7-1.2+b1 [247 kB] Get:122 http://localhost:3142/debian unstable/main amd64 fontconfig amd64 2.15.0-1.1 [463 kB] Get:123 http://localhost:3142/debian unstable/main amd64 libfribidi0 amd64 1.0.13-3+b1 [71.4 kB] Get:124 http://localhost:3142/debian unstable/main amd64 libgraphite2-3 amd64 1.3.14-2 [74.9 kB] Get:125 http://localhost:3142/debian unstable/main amd64 libharfbuzz0b amd64 8.3.0-2+b1 [2214 kB] Get:126 http://localhost:3142/debian unstable/main amd64 libthai-data all 0.1.29-2 [168 kB] Get:127 http://localhost:3142/debian unstable/main amd64 libdatrie1 amd64 0.2.13-3 [37.7 kB] Get:128 http://localhost:3142/debian unstable/main amd64 libthai0 amd64 0.1.29-2 [49.1 kB] Get:129 http://localhost:3142/debian unstable/main amd64 libpango-1.0-0 amd64 1.52.2+ds-1 [218 kB] Get:130 http://localhost:3142/debian unstable/main amd64 libpangoft2-1.0-0 amd64 1.52.2+ds-1 [48.1 kB] Get:131 http://localhost:3142/debian unstable/main amd64 libpangocairo-1.0-0 amd64 1.52.2+ds-1 [35.0 kB] Get:132 http://localhost:3142/debian unstable/main amd64 libxcomposite1 amd64 1:0.4.5-1+b1 [14.9 kB] Get:133 http://localhost:3142/debian unstable/main amd64 libxfixes3 amd64 1:6.0.0-2+b1 [20.3 kB] Get:134 http://localhost:3142/debian unstable/main amd64 libxcursor1 amd64 1:1.2.2-1 [37.1 kB] Get:135 http://localhost:3142/debian unstable/main amd64 libxdamage1 amd64 1:1.1.6-1+b1 [15.5 kB] Get:136 http://localhost:3142/debian unstable/main amd64 libxi6 amd64 2:1.8.1-1 [79.0 kB] Get:137 http://localhost:3142/debian unstable/main amd64 libxinerama1 amd64 2:1.1.4-3+b1 [16.0 kB] Get:138 http://localhost:3142/debian unstable/main amd64 libxrandr2 amd64 2:1.5.4-1 [36.1 kB] Get:139 http://localhost:3142/debian unstable/main amd64 libgtk2.0-0t64 amd64 2.24.33-4 [1816 kB] Get:140 http://localhost:3142/debian unstable/main amd64 libglvnd0 amd64 1.7.0-1+b1 [56.3 kB] Get:141 http://localhost:3142/debian unstable/main amd64 libdrm-common all 2.4.120-2 [7688 B] Get:142 http://localhost:3142/debian unstable/main amd64 libdrm2 amd64 2.4.120-2 [38.1 kB] Get:143 http://localhost:3142/debian unstable/main amd64 libglapi-mesa amd64 24.1.0-2 [36.6 kB] Get:144 http://localhost:3142/debian unstable/main amd64 libx11-xcb1 amd64 2:1.8.7-1+b1 [232 kB] Get:145 http://localhost:3142/debian unstable/main amd64 libxcb-dri2-0 amd64 1.17.0-2 [106 kB] Get:146 http://localhost:3142/debian unstable/main amd64 libxcb-dri3-0 amd64 1.17.0-2 [107 kB] Get:147 http://localhost:3142/debian unstable/main amd64 libxcb-glx0 amd64 1.17.0-2 [122 kB] Get:148 http://localhost:3142/debian unstable/main amd64 libxcb-present0 amd64 1.17.0-2 [105 kB] Get:149 http://localhost:3142/debian unstable/main amd64 libxcb-randr0 amd64 1.17.0-2 [116 kB] Get:150 http://localhost:3142/debian unstable/main amd64 libxcb-sync1 amd64 1.17.0-2 [108 kB] Get:151 http://localhost:3142/debian unstable/main amd64 libxcb-xfixes0 amd64 1.17.0-2 [109 kB] Get:152 http://localhost:3142/debian unstable/main amd64 libxshmfence1 amd64 1.3-1+b1 [8852 B] Get:153 http://localhost:3142/debian unstable/main amd64 libxxf86vm1 amd64 1:1.1.4-1+b2 [20.8 kB] Get:154 http://localhost:3142/debian unstable/main amd64 libvulkan1 amd64 1.3.283.0-1 [125 kB] Get:155 http://localhost:3142/debian unstable/main amd64 libdrm-amdgpu1 amd64 2.4.120-2 [21.4 kB] Get:156 http://localhost:3142/debian unstable/main amd64 libpciaccess0 amd64 0.17-3+b1 [51.9 kB] Get:157 http://localhost:3142/debian unstable/main amd64 libdrm-intel1 amd64 2.4.120-2 [62.7 kB] Get:158 http://localhost:3142/debian unstable/main amd64 libdrm-radeon1 amd64 2.4.120-2 [22.2 kB] Get:159 http://localhost:3142/debian unstable/main amd64 libedit2 amd64 3.1-20240517-1 [93.3 kB] Get:160 http://localhost:3142/debian unstable/main amd64 libz3-4 amd64 4.8.12-3.1+b2 [7346 kB] Get:161 http://localhost:3142/debian unstable/main amd64 libllvm17t64 amd64 1:17.0.6-12 [23.7 MB] Get:162 http://localhost:3142/debian unstable/main amd64 libsensors-config all 1:3.6.0-10 [14.6 kB] Get:163 http://localhost:3142/debian unstable/main amd64 libsensors5 amd64 1:3.6.0-10 [34.7 kB] Get:164 http://localhost:3142/debian unstable/main amd64 libgl1-mesa-dri amd64 24.1.0-2 [8638 kB] Get:165 http://localhost:3142/debian unstable/main amd64 libglx-mesa0 amd64 24.1.0-2 [151 kB] Get:166 http://localhost:3142/debian unstable/main amd64 libglx0 amd64 1.7.0-1+b1 [35.0 kB] Get:167 http://localhost:3142/debian unstable/main amd64 libgl1 amd64 1.7.0-1+b1 [89.8 kB] Get:168 http://localhost:3142/debian unstable/main amd64 libasound2-data all 1.2.11-1 [20.9 kB] Get:169 http://localhost:3142/debian unstable/main amd64 libasound2t64 amd64 1.2.11-1+b1 [369 kB] Get:170 http://localhost:3142/debian unstable/main amd64 libgif7 amd64 5.2.2-1 [43.9 kB] Get:171 http://localhost:3142/debian unstable/main amd64 x11-common all 1:7.7+23 [252 kB] Get:172 http://localhost:3142/debian unstable/main amd64 libxtst6 amd64 2:1.2.3-1.1+b1 [25.9 kB] Get:173 http://localhost:3142/debian unstable/main amd64 openjdk-17-jre amd64 17.0.11+9-1 [185 kB] Get:174 http://localhost:3142/debian unstable/main amd64 default-jre amd64 2:1.17-75 [1056 B] Get:175 http://localhost:3142/debian unstable/main amd64 openjdk-17-jdk-headless amd64 17.0.11+9-1 [71.4 MB] Get:176 http://localhost:3142/debian unstable/main amd64 default-jdk-headless amd64 2:1.17-75 [1108 B] Get:177 http://localhost:3142/debian unstable/main amd64 openjdk-17-jdk amd64 17.0.11+9-1 [10.4 kB] Get:178 http://localhost:3142/debian unstable/main amd64 default-jdk amd64 2:1.17-75 [1068 B] Get:179 http://localhost:3142/debian unstable/main amd64 libfile-dirlist-perl all 0.05-3 [7600 B] Get:180 http://localhost:3142/debian unstable/main amd64 libfile-which-perl all 1.27-2 [15.1 kB] Get:181 http://localhost:3142/debian unstable/main amd64 libfile-homedir-perl all 1.006-2 [42.4 kB] Get:182 http://localhost:3142/debian unstable/main amd64 libfile-touch-perl all 0.12-2 [8816 B] Get:183 http://localhost:3142/debian unstable/main amd64 libipc-run-perl all 20231003.0-2 [101 kB] Get:184 http://localhost:3142/debian unstable/main amd64 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] Get:185 http://localhost:3142/debian unstable/main amd64 libdynaloader-functions-perl all 0.003-3 [12.7 kB] Get:186 http://localhost:3142/debian unstable/main amd64 libmodule-runtime-perl all 0.016-2 [19.6 kB] Get:187 http://localhost:3142/debian unstable/main amd64 libimport-into-perl all 1.002005-2 [11.3 kB] Get:188 http://localhost:3142/debian unstable/main amd64 librole-tiny-perl all 2.002004-1 [21.4 kB] Get:189 http://localhost:3142/debian unstable/main amd64 libsub-quote-perl all 2.006008-1 [21.8 kB] Get:190 http://localhost:3142/debian unstable/main amd64 libmoo-perl all 2.005005-1 [58.0 kB] Get:191 http://localhost:3142/debian unstable/main amd64 libencode-locale-perl all 1.05-3 [12.9 kB] Get:192 http://localhost:3142/debian unstable/main amd64 libtimedate-perl all 2.3300-2 [39.3 kB] Get:193 http://localhost:3142/debian unstable/main amd64 libhttp-date-perl all 6.06-1 [10.7 kB] Get:194 http://localhost:3142/debian unstable/main amd64 libfile-listing-perl all 6.16-1 [12.4 kB] Get:195 http://localhost:3142/debian unstable/main amd64 libhtml-tagset-perl all 3.24-1 [14.7 kB] Get:196 http://localhost:3142/debian unstable/main amd64 liburi-perl all 5.28-1 [98.6 kB] Get:197 http://localhost:3142/debian unstable/main amd64 libhtml-tree-perl all 5.07-3 [211 kB] Get:198 http://localhost:3142/debian unstable/main amd64 libio-html-perl all 1.004-3 [16.2 kB] Get:199 http://localhost:3142/debian unstable/main amd64 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] Get:200 http://localhost:3142/debian unstable/main amd64 libhttp-message-perl all 6.46-1 [79.7 kB] Get:201 http://localhost:3142/debian unstable/main amd64 libhttp-cookies-perl all 6.11-1 [19.1 kB] Get:202 http://localhost:3142/debian unstable/main amd64 libhttp-negotiate-perl all 6.01-2 [13.1 kB] Get:203 http://localhost:3142/debian unstable/main amd64 perl-openssl-defaults amd64 7+b2 [6724 B] Get:204 http://localhost:3142/debian unstable/main amd64 libio-socket-ssl-perl all 2.085-1 [218 kB] Get:205 http://localhost:3142/debian unstable/main amd64 libnet-http-perl all 6.23-1 [23.9 kB] Get:206 http://localhost:3142/debian unstable/main amd64 liblwp-protocol-https-perl all 6.14-1 [10.8 kB] Get:207 http://localhost:3142/debian unstable/main amd64 libtry-tiny-perl all 0.31-2 [22.6 kB] Get:208 http://localhost:3142/debian unstable/main amd64 libwww-robotrules-perl all 6.02-1 [12.9 kB] Get:209 http://localhost:3142/debian unstable/main amd64 libwww-perl all 6.77-1 [183 kB] Get:210 http://localhost:3142/debian unstable/main amd64 patchutils amd64 0.4.2-1 [77.5 kB] Get:211 http://localhost:3142/debian unstable/main amd64 wdiff amd64 1.2.2-6 [119 kB] Get:212 http://localhost:3142/debian unstable/main amd64 devscripts all 2.23.7 [1068 kB] Get:213 http://localhost:3142/debian unstable/main amd64 libfakeroot amd64 1.34-1 [28.9 kB] Get:214 http://localhost:3142/debian unstable/main amd64 fakeroot amd64 1.34-1 [74.0 kB] Get:215 http://localhost:3142/debian unstable/main amd64 fastjar amd64 2:0.98-7 [80.1 kB] Get:216 http://localhost:3142/debian unstable/main amd64 jaligner all 1.0+dfsg-11 [133 kB] Get:217 http://localhost:3142/debian unstable/main amd64 jarwrapper all 0.80 [9692 B] Get:218 http://localhost:3142/debian unstable/main amd64 javahelper all 0.80 [80.4 kB] Get:219 http://localhost:3142/debian unstable/main amd64 libatinject-jsr330-api-java all 1.0+ds1-5 [5312 B] Get:220 http://localhost:3142/debian unstable/main amd64 libcurl3t64-gnutls amd64 8.8.0-1 [434 kB] Get:221 http://localhost:3142/debian unstable/main amd64 libcurl4-gnutls-dev amd64 8.8.0-1 [540 kB] Get:222 http://localhost:3142/debian unstable/main amd64 libdeflate-dev amd64 1.20-1 [54.5 kB] Get:223 http://localhost:3142/debian unstable/main amd64 libjsr305-java all 0.1~+svn49-11 [26.9 kB] Get:224 http://localhost:3142/debian unstable/main amd64 libguava-java all 32.0.1-1 [2708 kB] Get:225 http://localhost:3142/debian unstable/main amd64 liberror-prone-java all 2.18.0-1 [22.5 kB] Get:226 http://localhost:3142/debian unstable/main amd64 libgetopt-java all 1.0.14+dfsg-6 [25.7 kB] Get:227 http://localhost:3142/debian unstable/main amd64 libhtscodecs2 amd64 1.6.0-1+b1 [93.0 kB] Get:228 http://localhost:3142/debian unstable/main amd64 libhts3t64 amd64 1.20+ds-1 [452 kB] Get:229 http://localhost:3142/debian unstable/main amd64 liblzma-dev amd64 5.6.1+really5.4.5-1 [293 kB] Get:230 http://localhost:3142/debian unstable/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1 [919 kB] Get:231 http://localhost:3142/debian unstable/main amd64 libhts-dev amd64 1.20+ds-1 [1684 kB] Get:232 http://localhost:3142/debian unstable/main amd64 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB] Get:233 http://localhost:3142/debian unstable/main amd64 libjung-free-java all 2.1.1-2 [1477 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 233 MB in 2s (139 MB/s) Selecting previously unselected package libpipeline1:amd64. (Reading database ... 21765 files and directories currently installed.) Preparing to unpack .../libpipeline1_1.5.7-2_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.7-2) ... Selecting previously unselected package binfmt-support. Preparing to unpack .../binfmt-support_2.2.2-7_amd64.deb ... Unpacking binfmt-support (2.2.2-7) ... Selecting previously unselected package libpython3.11-minimal:amd64. Preparing to unpack .../libpython3.11-minimal_3.11.9-1_amd64.deb ... Unpacking libpython3.11-minimal:amd64 (3.11.9-1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.6.2-1_amd64.deb ... Unpacking libexpat1:amd64 (2.6.2-1) ... Selecting previously unselected package python3.11-minimal. Preparing to unpack .../python3.11-minimal_3.11.9-1_amd64.deb ... Unpacking python3.11-minimal (3.11.9-1) ... Setting up libpython3.11-minimal:amd64 (3.11.9-1) ... Setting up libexpat1:amd64 (2.6.2-1) ... Setting up python3.11-minimal (3.11.9-1) ... Selecting previously unselected package python3-minimal. (Reading database ... 22104 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.11.8-1_amd64.deb ... Unpacking python3-minimal (3.11.8-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2024a-4_all.deb ... Unpacking tzdata (2024a-4) ... Selecting previously unselected package libpython3.11-stdlib:amd64. Preparing to unpack .../4-libpython3.11-stdlib_3.11.9-1_amd64.deb ... Unpacking libpython3.11-stdlib:amd64 (3.11.9-1) ... Selecting previously unselected package python3.11. Preparing to unpack .../5-python3.11_3.11.9-1_amd64.deb ... Unpacking python3.11 (3.11.9-1) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../6-libpython3-stdlib_3.11.8-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.11.8-1) ... Setting up python3-minimal (3.11.8-1) ... Selecting previously unselected package python3. (Reading database ... 23064 files and directories currently installed.) Preparing to unpack .../000-python3_3.11.8-1_amd64.deb ... Unpacking python3 (3.11.8-1) ... Selecting previously unselected package libproc2-0:amd64. Preparing to unpack .../001-libproc2-0_2%3a4.0.4-4_amd64.deb ... Unpacking libproc2-0:amd64 (2:4.0.4-4) ... Selecting previously unselected package procps. Preparing to unpack .../002-procps_2%3a4.0.4-4_amd64.deb ... Unpacking procps (2:4.0.4-4) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../003-sensible-utils_0.0.22_all.deb ... Unpacking sensible-utils (0.0.22) ... Selecting previously unselected package openssl. Preparing to unpack .../004-openssl_3.2.2-1_amd64.deb ... Unpacking openssl (3.2.2-1) ... Selecting previously unselected package ca-certificates. Preparing to unpack .../005-ca-certificates_20240203_all.deb ... Unpacking ca-certificates (20240203) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../006-libmagic-mgc_1%3a5.45-3_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../007-libmagic1t64_1%3a5.45-3_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3) ... Selecting previously unselected package file. Preparing to unpack .../008-file_1%3a5.45-3_amd64.deb ... Unpacking file (1:5.45-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../009-gettext-base_0.21-14+b1_amd64.deb ... Unpacking gettext-base (0.21-14+b1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../010-libuchardet0_0.0.8-1+b1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b1) ... Selecting previously unselected package groff-base. Preparing to unpack .../011-groff-base_1.23.0-4_amd64.deb ... Unpacking groff-base (1.23.0-4) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../012-bsdextrautils_2.40.1-8_amd64.deb ... Unpacking bsdextrautils (2.40.1-8) ... Selecting previously unselected package man-db. Preparing to unpack .../013-man-db_2.12.1-1_amd64.deb ... Unpacking man-db (2.12.1-1) ... Selecting previously unselected package libgdk-pixbuf2.0-common. Preparing to unpack .../014-libgdk-pixbuf2.0-common_2.42.12+dfsg-1_all.deb ... Unpacking libgdk-pixbuf2.0-common (2.42.12+dfsg-1) ... Selecting previously unselected package libglib2.0-0t64:amd64. Preparing to unpack .../015-libglib2.0-0t64_2.80.2-2_amd64.deb ... Unpacking libglib2.0-0t64:amd64 (2.80.2-2) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../016-libicu72_72.1-4+b1_amd64.deb ... Unpacking libicu72:amd64 (72.1-4+b1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../017-libxml2_2.12.7+dfsg-3_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg-3) ... Selecting previously unselected package shared-mime-info. Preparing to unpack .../018-shared-mime-info_2.4-5_amd64.deb ... Unpacking shared-mime-info (2.4-5) ... Selecting previously unselected package libjpeg62-turbo:amd64. Preparing to unpack .../019-libjpeg62-turbo_1%3a2.1.5-3_amd64.deb ... Unpacking libjpeg62-turbo:amd64 (1:2.1.5-3) ... Selecting previously unselected package libpng16-16t64:amd64. Preparing to unpack .../020-libpng16-16t64_1.6.43-5_amd64.deb ... Unpacking libpng16-16t64:amd64 (1.6.43-5) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../021-libdeflate0_1.20-1_amd64.deb ... Unpacking libdeflate0:amd64 (1.20-1) ... Selecting previously unselected package libjbig0:amd64. Preparing to unpack .../022-libjbig0_2.1-6.1+b1_amd64.deb ... Unpacking libjbig0:amd64 (2.1-6.1+b1) ... Selecting previously unselected package liblerc4:amd64. Preparing to unpack .../023-liblerc4_4.0.0+ds-4+b1_amd64.deb ... Unpacking liblerc4:amd64 (4.0.0+ds-4+b1) ... Selecting previously unselected package libsharpyuv0:amd64. Preparing to unpack .../024-libsharpyuv0_1.4.0-0.1_amd64.deb ... Unpacking libsharpyuv0:amd64 (1.4.0-0.1) ... Selecting previously unselected package libwebp7:amd64. Preparing to unpack .../025-libwebp7_1.4.0-0.1_amd64.deb ... Unpacking libwebp7:amd64 (1.4.0-0.1) ... Selecting previously unselected package libtiff6:amd64. Preparing to unpack .../026-libtiff6_4.5.1+git230720-4_amd64.deb ... Unpacking libtiff6:amd64 (4.5.1+git230720-4) ... Selecting previously unselected package libgdk-pixbuf-2.0-0:amd64. Preparing to unpack .../027-libgdk-pixbuf-2.0-0_2.42.12+dfsg-1_amd64.deb ... Unpacking libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-1) ... Selecting previously unselected package gtk-update-icon-cache. Preparing to unpack .../028-gtk-update-icon-cache_3.24.42-1_amd64.deb ... Unpacking gtk-update-icon-cache (3.24.42-1) ... Selecting previously unselected package hicolor-icon-theme. Preparing to unpack .../029-hicolor-icon-theme_0.18-1_all.deb ... Unpacking hicolor-icon-theme (0.18-1) ... Selecting previously unselected package adwaita-icon-theme. Preparing to unpack .../030-adwaita-icon-theme_46.0-1_all.deb ... Unpacking adwaita-icon-theme (46.0-1) ... Selecting previously unselected package at-spi2-common. Preparing to unpack .../031-at-spi2-common_2.52.0-1_all.deb ... Unpacking at-spi2-common (2.52.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../032-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../033-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../034-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../035-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../036-autopoint_0.21-14_all.deb ... Unpacking autopoint (0.21-14) ... Selecting previously unselected package ca-certificates-java. Preparing to unpack .../037-ca-certificates-java_20240118_all.deb ... Unpacking ca-certificates-java (20240118) ... Selecting previously unselected package libarchive13t64:amd64. Preparing to unpack .../038-libarchive13t64_3.7.2-2.1_amd64.deb ... Unpacking libarchive13t64:amd64 (3.7.2-2.1) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../039-libbrotli1_1.1.0-2+b3_amd64.deb ... Unpacking libbrotli1:amd64 (1.1.0-2+b3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../040-libkrb5support0_1.20.1-6+b1_amd64.deb ... Unpacking libkrb5support0:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../041-libcom-err2_1.47.1-1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.1-1) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../042-libk5crypto3_1.20.1-6+b1_amd64.deb ... Unpacking libk5crypto3:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../043-libkeyutils1_1.6.3-3_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-3) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../044-libkrb5-3_1.20.1-6+b1_amd64.deb ... Unpacking libkrb5-3:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../045-libgssapi-krb5-2_1.20.1-6+b1_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../046-libnghttp2-14_1.61.0-1+b1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.61.0-1+b1) ... Selecting previously unselected package libpsl5t64:amd64. Preparing to unpack .../047-libpsl5t64_0.21.2-1.1_amd64.deb ... Unpacking libpsl5t64:amd64 (0.21.2-1.1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../048-librtmp1_2.4+20151223.gitfa8646d.1-2+b4_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b4) ... Selecting previously unselected package libssh2-1t64:amd64. Preparing to unpack .../049-libssh2-1t64_1.11.0-5_amd64.deb ... Unpacking libssh2-1t64:amd64 (1.11.0-5) ... Selecting previously unselected package libcurl4t64:amd64. Preparing to unpack .../050-libcurl4t64_8.8.0-1_amd64.deb ... Unpacking libcurl4t64:amd64 (8.8.0-1) ... Selecting previously unselected package libjsoncpp25:amd64. Preparing to unpack .../051-libjsoncpp25_1.9.5-6+b2_amd64.deb ... Unpacking libjsoncpp25:amd64 (1.9.5-6+b2) ... Selecting previously unselected package librhash0:amd64. Preparing to unpack .../052-librhash0_1.4.3-3+b1_amd64.deb ... Unpacking librhash0:amd64 (1.4.3-3+b1) ... Selecting previously unselected package libuv1t64:amd64. Preparing to unpack .../053-libuv1t64_1.48.0-4_amd64.deb ... Unpacking libuv1t64:amd64 (1.48.0-4) ... Selecting previously unselected package cmake-data. Preparing to unpack .../054-cmake-data_3.29.4-1_all.deb ... Unpacking cmake-data (3.29.4-1) ... Selecting previously unselected package cmake. Preparing to unpack .../055-cmake_3.29.4-1_amd64.deb ... Unpacking cmake (3.29.4-1) ... Selecting previously unselected package dctrl-tools. Preparing to unpack .../056-dctrl-tools_2.24-3+b1_amd64.deb ... Unpacking dctrl-tools (2.24-3+b1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../057-libdebhelper-perl_13.15.3_all.deb ... Unpacking libdebhelper-perl (13.15.3) ... Selecting previously unselected package libtool. Preparing to unpack .../058-libtool_2.4.7-7_all.deb ... Unpacking libtool (2.4.7-7) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../059-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../060-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../061-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../062-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../063-libelf1t64_0.191-1+b1_amd64.deb ... Unpacking libelf1t64:amd64 (0.191-1+b1) ... Selecting previously unselected package dwz. Preparing to unpack .../064-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../065-gettext_0.21-14+b1_amd64.deb ... Unpacking gettext (0.21-14+b1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../066-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../067-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../068-debhelper_13.15.3_all.deb ... Unpacking debhelper (13.15.3) ... Selecting previously unselected package java-common. Preparing to unpack .../069-java-common_0.75_all.deb ... Unpacking java-common (0.75) ... Selecting previously unselected package liblcms2-2:amd64. Preparing to unpack .../070-liblcms2-2_2.14-2+b1_amd64.deb ... Unpacking liblcms2-2:amd64 (2.14-2+b1) ... Selecting previously unselected package libnspr4:amd64. Preparing to unpack .../071-libnspr4_2%3a4.35-1.1+b1_amd64.deb ... Unpacking libnspr4:amd64 (2:4.35-1.1+b1) ... Selecting previously unselected package libnss3:amd64. Preparing to unpack .../072-libnss3_2%3a3.100-1_amd64.deb ... Unpacking libnss3:amd64 (2:3.100-1) ... Selecting previously unselected package libpcsclite1:amd64. Preparing to unpack .../073-libpcsclite1_2.2.3-1_amd64.deb ... Unpacking libpcsclite1:amd64 (2.2.3-1) ... Selecting previously unselected package openjdk-17-jre-headless:amd64. Preparing to unpack .../074-openjdk-17-jre-headless_17.0.11+9-1_amd64.deb ... Unpacking openjdk-17-jre-headless:amd64 (17.0.11+9-1) ... Selecting previously unselected package default-jre-headless. Preparing to unpack .../075-default-jre-headless_2%3a1.17-75_amd64.deb ... Unpacking default-jre-headless (2:1.17-75) ... Selecting previously unselected package libgtk2.0-common. Preparing to unpack .../076-libgtk2.0-common_2.24.33-4_all.deb ... Unpacking libgtk2.0-common (2.24.33-4) ... Selecting previously unselected package libatk1.0-0t64:amd64. Preparing to unpack .../077-libatk1.0-0t64_2.52.0-1_amd64.deb ... Unpacking libatk1.0-0t64:amd64 (2.52.0-1) ... Selecting previously unselected package libfreetype6:amd64. Preparing to unpack .../078-libfreetype6_2.13.2+dfsg-1+b4_amd64.deb ... Unpacking libfreetype6:amd64 (2.13.2+dfsg-1+b4) ... Selecting previously unselected package fonts-dejavu-mono. Preparing to unpack .../079-fonts-dejavu-mono_2.37-8_all.deb ... Unpacking fonts-dejavu-mono (2.37-8) ... Selecting previously unselected package fonts-dejavu-core. Preparing to unpack .../080-fonts-dejavu-core_2.37-8_all.deb ... Unpacking fonts-dejavu-core (2.37-8) ... Selecting previously unselected package fontconfig-config. Preparing to unpack .../081-fontconfig-config_2.15.0-1.1_amd64.deb ... Unpacking fontconfig-config (2.15.0-1.1) ... Selecting previously unselected package libfontconfig1:amd64. Preparing to unpack .../082-libfontconfig1_2.15.0-1.1_amd64.deb ... Unpacking libfontconfig1:amd64 (2.15.0-1.1) ... Selecting previously unselected package libpixman-1-0:amd64. Preparing to unpack .../083-libpixman-1-0_0.42.2-1+b1_amd64.deb ... Unpacking libpixman-1-0:amd64 (0.42.2-1+b1) ... Selecting previously unselected package libxau6:amd64. Preparing to unpack .../084-libxau6_1%3a1.0.9-1+b1_amd64.deb ... Unpacking libxau6:amd64 (1:1.0.9-1+b1) ... Selecting previously unselected package libbsd0:amd64. Preparing to unpack .../085-libbsd0_0.12.2-1_amd64.deb ... Unpacking libbsd0:amd64 (0.12.2-1) ... Selecting previously unselected package libxdmcp6:amd64. Preparing to unpack .../086-libxdmcp6_1%3a1.1.2-3+b1_amd64.deb ... Unpacking libxdmcp6:amd64 (1:1.1.2-3+b1) ... Selecting previously unselected package libxcb1:amd64. Preparing to unpack .../087-libxcb1_1.17.0-2_amd64.deb ... Unpacking libxcb1:amd64 (1.17.0-2) ... Selecting previously unselected package libx11-data. Preparing to unpack .../088-libx11-data_2%3a1.8.7-1_all.deb ... Unpacking libx11-data (2:1.8.7-1) ... Selecting previously unselected package libx11-6:amd64. Preparing to unpack .../089-libx11-6_2%3a1.8.7-1+b1_amd64.deb ... Unpacking libx11-6:amd64 (2:1.8.7-1+b1) ... Selecting previously unselected package libxcb-render0:amd64. Preparing to unpack .../090-libxcb-render0_1.17.0-2_amd64.deb ... Unpacking libxcb-render0:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-shm0:amd64. Preparing to unpack .../091-libxcb-shm0_1.17.0-2_amd64.deb ... Unpacking libxcb-shm0:amd64 (1.17.0-2) ... Selecting previously unselected package libxext6:amd64. Preparing to unpack .../092-libxext6_2%3a1.3.4-1+b1_amd64.deb ... Unpacking libxext6:amd64 (2:1.3.4-1+b1) ... Selecting previously unselected package libxrender1:amd64. Preparing to unpack .../093-libxrender1_1%3a0.9.10-1.1+b1_amd64.deb ... Unpacking libxrender1:amd64 (1:0.9.10-1.1+b1) ... Selecting previously unselected package libcairo2:amd64. Preparing to unpack .../094-libcairo2_1.18.0-3+b1_amd64.deb ... Unpacking libcairo2:amd64 (1.18.0-3+b1) ... Selecting previously unselected package libavahi-common-data:amd64. Preparing to unpack .../095-libavahi-common-data_0.8-13+b2_amd64.deb ... Unpacking libavahi-common-data:amd64 (0.8-13+b2) ... Selecting previously unselected package libavahi-common3:amd64. Preparing to unpack .../096-libavahi-common3_0.8-13+b2_amd64.deb ... Unpacking libavahi-common3:amd64 (0.8-13+b2) ... Selecting previously unselected package libdbus-1-3:amd64. Preparing to unpack .../097-libdbus-1-3_1.14.10-4+b1_amd64.deb ... Unpacking libdbus-1-3:amd64 (1.14.10-4+b1) ... Selecting previously unselected package libavahi-client3:amd64. Preparing to unpack .../098-libavahi-client3_0.8-13+b2_amd64.deb ... Unpacking libavahi-client3:amd64 (0.8-13+b2) ... Selecting previously unselected package libcups2t64:amd64. Preparing to unpack .../099-libcups2t64_2.4.7-1.2+b1_amd64.deb ... Unpacking libcups2t64:amd64 (2.4.7-1.2+b1) ... Selecting previously unselected package fontconfig. Preparing to unpack .../100-fontconfig_2.15.0-1.1_amd64.deb ... Unpacking fontconfig (2.15.0-1.1) ... Selecting previously unselected package libfribidi0:amd64. Preparing to unpack .../101-libfribidi0_1.0.13-3+b1_amd64.deb ... Unpacking libfribidi0:amd64 (1.0.13-3+b1) ... Selecting previously unselected package libgraphite2-3:amd64. Preparing to unpack .../102-libgraphite2-3_1.3.14-2_amd64.deb ... Unpacking libgraphite2-3:amd64 (1.3.14-2) ... Selecting previously unselected package libharfbuzz0b:amd64. Preparing to unpack .../103-libharfbuzz0b_8.3.0-2+b1_amd64.deb ... Unpacking libharfbuzz0b:amd64 (8.3.0-2+b1) ... Selecting previously unselected package libthai-data. Preparing to unpack .../104-libthai-data_0.1.29-2_all.deb ... Unpacking libthai-data (0.1.29-2) ... Selecting previously unselected package libdatrie1:amd64. Preparing to unpack .../105-libdatrie1_0.2.13-3_amd64.deb ... Unpacking libdatrie1:amd64 (0.2.13-3) ... Selecting previously unselected package libthai0:amd64. Preparing to unpack .../106-libthai0_0.1.29-2_amd64.deb ... Unpacking libthai0:amd64 (0.1.29-2) ... Selecting previously unselected package libpango-1.0-0:amd64. Preparing to unpack .../107-libpango-1.0-0_1.52.2+ds-1_amd64.deb ... Unpacking libpango-1.0-0:amd64 (1.52.2+ds-1) ... Selecting previously unselected package libpangoft2-1.0-0:amd64. Preparing to unpack .../108-libpangoft2-1.0-0_1.52.2+ds-1_amd64.deb ... Unpacking libpangoft2-1.0-0:amd64 (1.52.2+ds-1) ... Selecting previously unselected package libpangocairo-1.0-0:amd64. Preparing to unpack .../109-libpangocairo-1.0-0_1.52.2+ds-1_amd64.deb ... Unpacking libpangocairo-1.0-0:amd64 (1.52.2+ds-1) ... Selecting previously unselected package libxcomposite1:amd64. Preparing to unpack .../110-libxcomposite1_1%3a0.4.5-1+b1_amd64.deb ... Unpacking libxcomposite1:amd64 (1:0.4.5-1+b1) ... Selecting previously unselected package libxfixes3:amd64. Preparing to unpack .../111-libxfixes3_1%3a6.0.0-2+b1_amd64.deb ... Unpacking libxfixes3:amd64 (1:6.0.0-2+b1) ... Selecting previously unselected package libxcursor1:amd64. Preparing to unpack .../112-libxcursor1_1%3a1.2.2-1_amd64.deb ... Unpacking libxcursor1:amd64 (1:1.2.2-1) ... Selecting previously unselected package libxdamage1:amd64. Preparing to unpack .../113-libxdamage1_1%3a1.1.6-1+b1_amd64.deb ... Unpacking libxdamage1:amd64 (1:1.1.6-1+b1) ... Selecting previously unselected package libxi6:amd64. Preparing to unpack .../114-libxi6_2%3a1.8.1-1_amd64.deb ... Unpacking libxi6:amd64 (2:1.8.1-1) ... Selecting previously unselected package libxinerama1:amd64. Preparing to unpack .../115-libxinerama1_2%3a1.1.4-3+b1_amd64.deb ... Unpacking libxinerama1:amd64 (2:1.1.4-3+b1) ... Selecting previously unselected package libxrandr2:amd64. Preparing to unpack .../116-libxrandr2_2%3a1.5.4-1_amd64.deb ... Unpacking libxrandr2:amd64 (2:1.5.4-1) ... Selecting previously unselected package libgtk2.0-0t64:amd64. Preparing to unpack .../117-libgtk2.0-0t64_2.24.33-4_amd64.deb ... Unpacking libgtk2.0-0t64:amd64 (2.24.33-4) ... Selecting previously unselected package libglvnd0:amd64. Preparing to unpack .../118-libglvnd0_1.7.0-1+b1_amd64.deb ... Unpacking libglvnd0:amd64 (1.7.0-1+b1) ... Selecting previously unselected package libdrm-common. Preparing to unpack .../119-libdrm-common_2.4.120-2_all.deb ... Unpacking libdrm-common (2.4.120-2) ... Selecting previously unselected package libdrm2:amd64. Preparing to unpack .../120-libdrm2_2.4.120-2_amd64.deb ... Unpacking libdrm2:amd64 (2.4.120-2) ... Selecting previously unselected package libglapi-mesa:amd64. Preparing to unpack .../121-libglapi-mesa_24.1.0-2_amd64.deb ... Unpacking libglapi-mesa:amd64 (24.1.0-2) ... Selecting previously unselected package libx11-xcb1:amd64. Preparing to unpack .../122-libx11-xcb1_2%3a1.8.7-1+b1_amd64.deb ... Unpacking libx11-xcb1:amd64 (2:1.8.7-1+b1) ... Selecting previously unselected package libxcb-dri2-0:amd64. Preparing to unpack .../123-libxcb-dri2-0_1.17.0-2_amd64.deb ... Unpacking libxcb-dri2-0:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-dri3-0:amd64. Preparing to unpack .../124-libxcb-dri3-0_1.17.0-2_amd64.deb ... Unpacking libxcb-dri3-0:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-glx0:amd64. Preparing to unpack .../125-libxcb-glx0_1.17.0-2_amd64.deb ... Unpacking libxcb-glx0:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-present0:amd64. Preparing to unpack .../126-libxcb-present0_1.17.0-2_amd64.deb ... Unpacking libxcb-present0:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-randr0:amd64. Preparing to unpack .../127-libxcb-randr0_1.17.0-2_amd64.deb ... Unpacking libxcb-randr0:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-sync1:amd64. Preparing to unpack .../128-libxcb-sync1_1.17.0-2_amd64.deb ... Unpacking libxcb-sync1:amd64 (1.17.0-2) ... Selecting previously unselected package libxcb-xfixes0:amd64. Preparing to unpack .../129-libxcb-xfixes0_1.17.0-2_amd64.deb ... Unpacking libxcb-xfixes0:amd64 (1.17.0-2) ... Selecting previously unselected package libxshmfence1:amd64. Preparing to unpack .../130-libxshmfence1_1.3-1+b1_amd64.deb ... Unpacking libxshmfence1:amd64 (1.3-1+b1) ... Selecting previously unselected package libxxf86vm1:amd64. Preparing to unpack .../131-libxxf86vm1_1%3a1.1.4-1+b2_amd64.deb ... Unpacking libxxf86vm1:amd64 (1:1.1.4-1+b2) ... Selecting previously unselected package libvulkan1:amd64. Preparing to unpack .../132-libvulkan1_1.3.283.0-1_amd64.deb ... Unpacking libvulkan1:amd64 (1.3.283.0-1) ... Selecting previously unselected package libdrm-amdgpu1:amd64. Preparing to unpack .../133-libdrm-amdgpu1_2.4.120-2_amd64.deb ... Unpacking libdrm-amdgpu1:amd64 (2.4.120-2) ... Selecting previously unselected package libpciaccess0:amd64. Preparing to unpack .../134-libpciaccess0_0.17-3+b1_amd64.deb ... Unpacking libpciaccess0:amd64 (0.17-3+b1) ... Selecting previously unselected package libdrm-intel1:amd64. Preparing to unpack .../135-libdrm-intel1_2.4.120-2_amd64.deb ... Unpacking libdrm-intel1:amd64 (2.4.120-2) ... Selecting previously unselected package libdrm-radeon1:amd64. Preparing to unpack .../136-libdrm-radeon1_2.4.120-2_amd64.deb ... Unpacking libdrm-radeon1:amd64 (2.4.120-2) ... Selecting previously unselected package libedit2:amd64. Preparing to unpack .../137-libedit2_3.1-20240517-1_amd64.deb ... Unpacking libedit2:amd64 (3.1-20240517-1) ... Selecting previously unselected package libz3-4:amd64. Preparing to unpack .../138-libz3-4_4.8.12-3.1+b2_amd64.deb ... Unpacking libz3-4:amd64 (4.8.12-3.1+b2) ... Selecting previously unselected package libllvm17t64:amd64. Preparing to unpack .../139-libllvm17t64_1%3a17.0.6-12_amd64.deb ... Unpacking libllvm17t64:amd64 (1:17.0.6-12) ... Selecting previously unselected package libsensors-config. Preparing to unpack .../140-libsensors-config_1%3a3.6.0-10_all.deb ... Unpacking libsensors-config (1:3.6.0-10) ... Selecting previously unselected package libsensors5:amd64. Preparing to unpack .../141-libsensors5_1%3a3.6.0-10_amd64.deb ... Unpacking libsensors5:amd64 (1:3.6.0-10) ... Selecting previously unselected package libgl1-mesa-dri:amd64. Preparing to unpack .../142-libgl1-mesa-dri_24.1.0-2_amd64.deb ... Unpacking libgl1-mesa-dri:amd64 (24.1.0-2) ... Selecting previously unselected package libglx-mesa0:amd64. Preparing to unpack .../143-libglx-mesa0_24.1.0-2_amd64.deb ... Unpacking libglx-mesa0:amd64 (24.1.0-2) ... Selecting previously unselected package libglx0:amd64. Preparing to unpack .../144-libglx0_1.7.0-1+b1_amd64.deb ... Unpacking libglx0:amd64 (1.7.0-1+b1) ... Selecting previously unselected package libgl1:amd64. Preparing to unpack .../145-libgl1_1.7.0-1+b1_amd64.deb ... Unpacking libgl1:amd64 (1.7.0-1+b1) ... Selecting previously unselected package libasound2-data. Preparing to unpack .../146-libasound2-data_1.2.11-1_all.deb ... Unpacking libasound2-data (1.2.11-1) ... Selecting previously unselected package libasound2t64:amd64. Preparing to unpack .../147-libasound2t64_1.2.11-1+b1_amd64.deb ... Unpacking libasound2t64:amd64 (1.2.11-1+b1) ... Selecting previously unselected package libgif7:amd64. Preparing to unpack .../148-libgif7_5.2.2-1_amd64.deb ... Unpacking libgif7:amd64 (5.2.2-1) ... Selecting previously unselected package x11-common. Preparing to unpack .../149-x11-common_1%3a7.7+23_all.deb ... Unpacking x11-common (1:7.7+23) ... Selecting previously unselected package libxtst6:amd64. Preparing to unpack .../150-libxtst6_2%3a1.2.3-1.1+b1_amd64.deb ... Unpacking libxtst6:amd64 (2:1.2.3-1.1+b1) ... Selecting previously unselected package openjdk-17-jre:amd64. Preparing to unpack .../151-openjdk-17-jre_17.0.11+9-1_amd64.deb ... Unpacking openjdk-17-jre:amd64 (17.0.11+9-1) ... Selecting previously unselected package default-jre. Preparing to unpack .../152-default-jre_2%3a1.17-75_amd64.deb ... Unpacking default-jre (2:1.17-75) ... Selecting previously unselected package openjdk-17-jdk-headless:amd64. Preparing to unpack .../153-openjdk-17-jdk-headless_17.0.11+9-1_amd64.deb ... Unpacking openjdk-17-jdk-headless:amd64 (17.0.11+9-1) ... Selecting previously unselected package default-jdk-headless. Preparing to unpack .../154-default-jdk-headless_2%3a1.17-75_amd64.deb ... Unpacking default-jdk-headless (2:1.17-75) ... Selecting previously unselected package openjdk-17-jdk:amd64. Preparing to unpack .../155-openjdk-17-jdk_17.0.11+9-1_amd64.deb ... Unpacking openjdk-17-jdk:amd64 (17.0.11+9-1) ... Selecting previously unselected package default-jdk. Preparing to unpack .../156-default-jdk_2%3a1.17-75_amd64.deb ... Unpacking default-jdk (2:1.17-75) ... Selecting previously unselected package libfile-dirlist-perl. Preparing to unpack .../157-libfile-dirlist-perl_0.05-3_all.deb ... Unpacking libfile-dirlist-perl (0.05-3) ... Selecting previously unselected package libfile-which-perl. Preparing to unpack .../158-libfile-which-perl_1.27-2_all.deb ... Unpacking libfile-which-perl (1.27-2) ... Selecting previously unselected package libfile-homedir-perl. Preparing to unpack .../159-libfile-homedir-perl_1.006-2_all.deb ... Unpacking libfile-homedir-perl (1.006-2) ... Selecting previously unselected package libfile-touch-perl. Preparing to unpack .../160-libfile-touch-perl_0.12-2_all.deb ... Unpacking libfile-touch-perl (0.12-2) ... Selecting previously unselected package libio-pty-perl. Preparing to unpack .../161-libio-pty-perl_1.20-1+b2_amd64.deb ... Unpacking libio-pty-perl (1:1.20-1+b2) ... Selecting previously unselected package libipc-run-perl. Preparing to unpack .../162-libipc-run-perl_20231003.0-2_all.deb ... Unpacking libipc-run-perl (20231003.0-2) ... Selecting previously unselected package libclass-method-modifiers-perl. Preparing to unpack .../163-libclass-method-modifiers-perl_2.15-1_all.deb ... Unpacking libclass-method-modifiers-perl (2.15-1) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../164-libclass-xsaccessor-perl_1.19-4+b4_amd64.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b4) ... Selecting previously unselected package libb-hooks-op-check-perl:amd64. Preparing to unpack .../165-libb-hooks-op-check-perl_0.22-3+b2_amd64.deb ... Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../166-libdynaloader-functions-perl_0.003-3_all.deb ... Unpacking libdynaloader-functions-perl (0.003-3) ... Selecting previously unselected package libdevel-callchecker-perl:amd64. Preparing to unpack .../167-libdevel-callchecker-perl_0.009-1+b1_amd64.deb ... Unpacking libdevel-callchecker-perl:amd64 (0.009-1+b1) ... Selecting previously unselected package libparams-classify-perl:amd64. Preparing to unpack .../168-libparams-classify-perl_0.015-2+b4_amd64.deb ... Unpacking libparams-classify-perl:amd64 (0.015-2+b4) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../169-libmodule-runtime-perl_0.016-2_all.deb ... Unpacking libmodule-runtime-perl (0.016-2) ... Selecting previously unselected package libimport-into-perl. Preparing to unpack .../170-libimport-into-perl_1.002005-2_all.deb ... Unpacking libimport-into-perl (1.002005-2) ... Selecting previously unselected package librole-tiny-perl. Preparing to unpack .../171-librole-tiny-perl_2.002004-1_all.deb ... Unpacking librole-tiny-perl (2.002004-1) ... Selecting previously unselected package libsub-quote-perl. Preparing to unpack .../172-libsub-quote-perl_2.006008-1_all.deb ... Unpacking libsub-quote-perl (2.006008-1) ... Selecting previously unselected package libmoo-perl. Preparing to unpack .../173-libmoo-perl_2.005005-1_all.deb ... Unpacking libmoo-perl (2.005005-1) ... Selecting previously unselected package libencode-locale-perl. Preparing to unpack .../174-libencode-locale-perl_1.05-3_all.deb ... Unpacking libencode-locale-perl (1.05-3) ... Selecting previously unselected package libtimedate-perl. Preparing to unpack .../175-libtimedate-perl_2.3300-2_all.deb ... Unpacking libtimedate-perl (2.3300-2) ... Selecting previously unselected package libhttp-date-perl. Preparing to unpack .../176-libhttp-date-perl_6.06-1_all.deb ... Unpacking libhttp-date-perl (6.06-1) ... Selecting previously unselected package libfile-listing-perl. Preparing to unpack .../177-libfile-listing-perl_6.16-1_all.deb ... Unpacking libfile-listing-perl (6.16-1) ... Selecting previously unselected package libhtml-tagset-perl. Preparing to unpack .../178-libhtml-tagset-perl_3.24-1_all.deb ... Unpacking libhtml-tagset-perl (3.24-1) ... Selecting previously unselected package liburi-perl. Preparing to unpack .../179-liburi-perl_5.28-1_all.deb ... Unpacking liburi-perl (5.28-1) ... Selecting previously unselected package libhtml-parser-perl:amd64. Preparing to unpack .../180-libhtml-parser-perl_3.82-1+b1_amd64.deb ... Unpacking libhtml-parser-perl:amd64 (3.82-1+b1) ... Selecting previously unselected package libhtml-tree-perl. Preparing to unpack .../181-libhtml-tree-perl_5.07-3_all.deb ... Unpacking libhtml-tree-perl (5.07-3) ... Selecting previously unselected package libclone-perl:amd64. Preparing to unpack .../182-libclone-perl_0.46-1+b3_amd64.deb ... Unpacking libclone-perl:amd64 (0.46-1+b3) ... Selecting previously unselected package libio-html-perl. Preparing to unpack .../183-libio-html-perl_1.004-3_all.deb ... Unpacking libio-html-perl (1.004-3) ... Selecting previously unselected package liblwp-mediatypes-perl. Preparing to unpack .../184-liblwp-mediatypes-perl_6.04-2_all.deb ... Unpacking liblwp-mediatypes-perl (6.04-2) ... Selecting previously unselected package libhttp-message-perl. Preparing to unpack .../185-libhttp-message-perl_6.46-1_all.deb ... Unpacking libhttp-message-perl (6.46-1) ... Selecting previously unselected package libhttp-cookies-perl. Preparing to unpack .../186-libhttp-cookies-perl_6.11-1_all.deb ... Unpacking libhttp-cookies-perl (6.11-1) ... Selecting previously unselected package libhttp-negotiate-perl. Preparing to unpack .../187-libhttp-negotiate-perl_6.01-2_all.deb ... Unpacking libhttp-negotiate-perl (6.01-2) ... Selecting previously unselected package perl-openssl-defaults:amd64. Preparing to unpack .../188-perl-openssl-defaults_7+b2_amd64.deb ... Unpacking perl-openssl-defaults:amd64 (7+b2) ... Selecting previously unselected package libnet-ssleay-perl:amd64. Preparing to unpack .../189-libnet-ssleay-perl_1.94-1+b2_amd64.deb ... Unpacking libnet-ssleay-perl:amd64 (1.94-1+b2) ... Selecting previously unselected package libio-socket-ssl-perl. Preparing to unpack .../190-libio-socket-ssl-perl_2.085-1_all.deb ... Unpacking libio-socket-ssl-perl (2.085-1) ... Selecting previously unselected package libnet-http-perl. Preparing to unpack .../191-libnet-http-perl_6.23-1_all.deb ... Unpacking libnet-http-perl (6.23-1) ... Selecting previously unselected package liblwp-protocol-https-perl. Preparing to unpack .../192-liblwp-protocol-https-perl_6.14-1_all.deb ... Unpacking liblwp-protocol-https-perl (6.14-1) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../193-libtry-tiny-perl_0.31-2_all.deb ... Unpacking libtry-tiny-perl (0.31-2) ... Selecting previously unselected package libwww-robotrules-perl. Preparing to unpack .../194-libwww-robotrules-perl_6.02-1_all.deb ... Unpacking libwww-robotrules-perl (6.02-1) ... Selecting previously unselected package libwww-perl. Preparing to unpack .../195-libwww-perl_6.77-1_all.deb ... Unpacking libwww-perl (6.77-1) ... Selecting previously unselected package patchutils. Preparing to unpack .../196-patchutils_0.4.2-1_amd64.deb ... Unpacking patchutils (0.4.2-1) ... Selecting previously unselected package wdiff. Preparing to unpack .../197-wdiff_1.2.2-6_amd64.deb ... Unpacking wdiff (1.2.2-6) ... Selecting previously unselected package devscripts. Preparing to unpack .../198-devscripts_2.23.7_all.deb ... Unpacking devscripts (2.23.7) ... Selecting previously unselected package libfakeroot:amd64. Preparing to unpack .../199-libfakeroot_1.34-1_amd64.deb ... Unpacking libfakeroot:amd64 (1.34-1) ... Selecting previously unselected package fakeroot. Preparing to unpack .../200-fakeroot_1.34-1_amd64.deb ... Unpacking fakeroot (1.34-1) ... Selecting previously unselected package fastjar. Preparing to unpack .../201-fastjar_2%3a0.98-7_amd64.deb ... Unpacking fastjar (2:0.98-7) ... Selecting previously unselected package jaligner. Preparing to unpack .../202-jaligner_1.0+dfsg-11_all.deb ... Unpacking jaligner (1.0+dfsg-11) ... Selecting previously unselected package jarwrapper. Preparing to unpack .../203-jarwrapper_0.80_all.deb ... Unpacking jarwrapper (0.80) ... Selecting previously unselected package javahelper. Preparing to unpack .../204-javahelper_0.80_all.deb ... Unpacking javahelper (0.80) ... Selecting previously unselected package libatinject-jsr330-api-java. Preparing to unpack .../205-libatinject-jsr330-api-java_1.0+ds1-5_all.deb ... Unpacking libatinject-jsr330-api-java (1.0+ds1-5) ... Selecting previously unselected package libcurl3t64-gnutls:amd64. Preparing to unpack .../206-libcurl3t64-gnutls_8.8.0-1_amd64.deb ... Unpacking libcurl3t64-gnutls:amd64 (8.8.0-1) ... Selecting previously unselected package libcurl4-gnutls-dev:amd64. Preparing to unpack .../207-libcurl4-gnutls-dev_8.8.0-1_amd64.deb ... Unpacking libcurl4-gnutls-dev:amd64 (8.8.0-1) ... Selecting previously unselected package libdeflate-dev:amd64. Preparing to unpack .../208-libdeflate-dev_1.20-1_amd64.deb ... Unpacking libdeflate-dev:amd64 (1.20-1) ... Selecting previously unselected package libjsr305-java. Preparing to unpack .../209-libjsr305-java_0.1~+svn49-11_all.deb ... Unpacking libjsr305-java (0.1~+svn49-11) ... Selecting previously unselected package libguava-java. Preparing to unpack .../210-libguava-java_32.0.1-1_all.deb ... Unpacking libguava-java (32.0.1-1) ... Selecting previously unselected package liberror-prone-java. Preparing to unpack .../211-liberror-prone-java_2.18.0-1_all.deb ... Unpacking liberror-prone-java (2.18.0-1) ... Selecting previously unselected package libgetopt-java. Preparing to unpack .../212-libgetopt-java_1.0.14+dfsg-6_all.deb ... Unpacking libgetopt-java (1.0.14+dfsg-6) ... Selecting previously unselected package libhtscodecs2:amd64. Preparing to unpack .../213-libhtscodecs2_1.6.0-1+b1_amd64.deb ... Unpacking libhtscodecs2:amd64 (1.6.0-1+b1) ... Selecting previously unselected package libhts3t64:amd64. Preparing to unpack .../214-libhts3t64_1.20+ds-1_amd64.deb ... Unpacking libhts3t64:amd64 (1.20+ds-1) ... Selecting previously unselected package liblzma-dev:amd64. Preparing to unpack .../215-liblzma-dev_5.6.1+really5.4.5-1_amd64.deb ... Unpacking liblzma-dev:amd64 (5.6.1+really5.4.5-1) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../216-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1) ... Selecting previously unselected package libhts-dev:amd64. Preparing to unpack .../217-libhts-dev_1.20+ds-1_amd64.deb ... Unpacking libhts-dev:amd64 (1.20+ds-1) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../218-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libjung-free-java. Preparing to unpack .../219-libjung-free-java_2.1.1-2_all.deb ... Unpacking libjung-free-java (2.1.1-2) ... Selecting previously unselected package sbuild-build-depends-main-dummy. Preparing to unpack .../220-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ... Setting up libhtscodecs2:amd64 (1.6.0-1+b1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.7-2) ... Setting up fastjar (2:0.98-7) ... Setting up libgraphite2-3:amd64 (1.3.14-2) ... Setting up liblcms2-2:amd64 (2.14-2+b1) ... Setting up libpixman-1-0:amd64 (0.42.2-1+b1) ... Setting up wdiff (1.2.2-6) ... Setting up libsharpyuv0:amd64 (1.4.0-0.1) ... Setting up libpciaccess0:amd64 (0.17-3+b1) ... Setting up libfile-which-perl (1.27-2) ... Setting up libxau6:amd64 (1:1.0.9-1+b1) ... Setting up libkeyutils1:amd64 (1.6.3-3) ... Setting up libicu72:amd64 (72.1-4+b1) ... Setting up liblerc4:amd64 (4.0.0+ds-4+b1) ... Setting up libjsr305-java (0.1~+svn49-11) ... Setting up bsdextrautils (2.40.1-8) ... Setting up hicolor-icon-theme (0.18-1) ... Setting up java-common (0.75) ... Setting up libdynaloader-functions-perl (0.003-3) ... Setting up libdatrie1:amd64 (0.2.13-3) ... Setting up libclass-method-modifiers-perl (2.15-1) ... Setting up libio-pty-perl (1:1.20-1+b2) ... Setting up libmagic-mgc (1:5.45-3) ... Setting up libclone-perl:amd64 (0.46-1+b3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libgetopt-java (1.0.14+dfsg-6) ... Setting up libglvnd0:amd64 (1.7.0-1+b1) ... Setting up libhtml-tagset-perl (3.24-1) ... Setting up libdebhelper-perl (13.15.3) ... Setting up libbrotli1:amd64 (1.1.0-2+b3) ... Setting up liblwp-mediatypes-perl (6.04-2) ... Setting up libgdk-pixbuf2.0-common (2.42.12+dfsg-1) ... Setting up libuv1t64:amd64 (1.48.0-4) ... Setting up libmagic1t64:amd64 (1:5.45-3) ... Setting up x11-common (1:7.7+23) ... invoke-rc.d: could not determine current runlevel invoke-rc.d: WARNING: No init system and policy-rc.d missing! Defaulting to block. Setting up libtry-tiny-perl (0.31-2) ... Setting up libsensors-config (1:3.6.0-10) ... Setting up libpsl5t64:amd64 (0.21.2-1.1) ... Setting up libnghttp2-14:amd64 (1.61.0-1+b1) ... Setting up libdeflate0:amd64 (1.20-1) ... Setting up perl-openssl-defaults:amd64 (7+b2) ... Setting up gettext-base (0.21-14+b1) ... Setting up m4 (1.4.19-4) ... Setting up libencode-locale-perl (1.05-3) ... Setting up libcom-err2:amd64 (1.47.1-1) ... Setting up file (1:5.45-3) ... Setting up libjbig0:amd64 (2.1-6.1+b1) ... Setting up libfakeroot:amd64 (1.34-1) ... Setting up libelf1t64:amd64 (0.191-1+b1) ... Setting up libkrb5support0:amd64 (1.20.1-6+b1) ... Setting up tzdata (2024a-4) ... Current default time zone: 'Etc/UTC' Local time is now: Wed Jun 5 11:50:52 UTC 2024. Universal Time is now: Wed Jun 5 11:50:52 UTC 2024. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up fakeroot (1.34-1) ... update-alternatives: using /usr/bin/fakeroot-sysv to provide /usr/bin/fakeroot (fakeroot) in auto mode Setting up libasound2-data (1.2.11-1) ... Setting up autotools-dev (20220109.1) ... Setting up libz3-4:amd64 (4.8.12-3.1+b2) ... Setting up libglib2.0-0t64:amd64 (2.80.2-2) ... No schema files found: doing nothing. Setting up libasound2t64:amd64 (1.2.11-1+b1) ... Setting up libjpeg62-turbo:amd64 (1:2.1.5-3) ... Setting up libx11-data (2:1.8.7-1) ... Setting up libnspr4:amd64 (2:4.35-1.1+b1) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b4) ... Setting up libavahi-common-data:amd64 (0.8-13+b2) ... Setting up libatinject-jsr330-api-java (1.0+ds1-5) ... Setting up libdbus-1-3:amd64 (1.14.10-4+b1) ... Setting up libfribidi0:amd64 (1.0.13-3+b1) ... Setting up libproc2-0:amd64 (2:4.0.4-4) ... Setting up fonts-dejavu-mono (2.37-8) ... Setting up libpng16-16t64:amd64 (1.6.43-5) ... Setting up libio-html-perl (1.004-3) ... Setting up autopoint (0.21-14) ... Setting up binfmt-support (2.2.2-7) ... invoke-rc.d: could not determine current runlevel invoke-rc.d: WARNING: No init system and policy-rc.d missing! Defaulting to block. Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Setting up libjsoncpp25:amd64 (1.9.5-6+b2) ... Setting up fonts-dejavu-core (2.37-8) ... Setting up libipc-run-perl (20231003.0-2) ... Setting up libpcsclite1:amd64 (2.2.3-1) ... Setting up libsensors5:amd64 (1:3.6.0-10) ... Setting up libk5crypto3:amd64 (1.20.1-6+b1) ... Setting up libglapi-mesa:amd64 (24.1.0-2) ... Setting up libvulkan1:amd64 (1.3.283.0-1) ... Setting up autoconf (2.71-3) ... Setting up libwebp7:amd64 (1.4.0-0.1) ... Setting up libtimedate-perl (2.3300-2) ... Setting up liblzma-dev:amd64 (5.6.1+really5.4.5-1) ... Setting up libgif7:amd64 (5.2.2-1) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.22) ... Setting up libxshmfence1:amd64 (1.3-1+b1) ... Setting up at-spi2-common (2.52.0-1) ... Setting up librhash0:amd64 (1.4.3-3+b1) ... Setting up libtiff6:amd64 (4.5.1+git230720-4) ... Setting up libuchardet0:amd64 (0.0.8-1+b1) ... Setting up procps (2:4.0.4-4) ... Configuration file '/etc/protocols' ==> File on system created by you or by a script. ==> File also in package provided by package maintainer. ==> Using current old file as you requested. Configuration file '/etc/services' ==> File on system created by you or by a script. ==> File also in package provided by package maintainer. ==> Using current old file as you requested. Setting up librole-tiny-perl (2.002004-1) ... Setting up libthai-data (0.1.29-2) ... Setting up netbase (6.4) ... Setting up libsub-quote-perl (2.006008-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b4) ... Setting up libgtk2.0-common (2.24.33-4) ... Setting up cmake-data (3.29.4-1) ... Setting up libkrb5-3:amd64 (1.20.1-6+b1) ... Setting up libssh2-1t64:amd64 (1.11.0-5) ... Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Setting up libfile-dirlist-perl (0.05-3) ... Setting up libfile-homedir-perl (1.006-2) ... Setting up openssl (3.2.2-1) ... Setting up libbsd0:amd64 (0.12.2-1) ... Setting up libdeflate-dev:amd64 (1.20-1) ... Setting up libdrm-common (2.4.120-2) ... Setting up libxml2:amd64 (2.12.7+dfsg-3) ... Setting up liburi-perl (5.28-1) ... Setting up libfile-touch-perl (0.12-2) ... Setting up dctrl-tools (2.24-3+b1) ... Setting up libnet-ssleay-perl:amd64 (1.94-1+b2) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up libhttp-date-perl (6.06-1) ... Setting up libxdmcp6:amd64 (1:1.1.2-3+b1) ... Setting up libxcb1:amd64 (1.17.0-2) ... Setting up gettext (0.21-14+b1) ... Setting up libxcb-xfixes0:amd64 (1.17.0-2) ... Setting up libatk1.0-0t64:amd64 (2.52.0-1) ... Setting up libfile-listing-perl (6.16-1) ... Setting up jarwrapper (0.80) ... Setting up libtool (2.4.7-7) ... Setting up libxcb-render0:amd64 (1.17.0-2) ... Setting up fontconfig-config (2.15.0-1.1) ... Setting up libxcb-glx0:amd64 (1.17.0-2) ... Setting up libpython3.11-stdlib:amd64 (3.11.9-1) ... Setting up libedit2:amd64 (3.1-20240517-1) ... Setting up libavahi-common3:amd64 (0.8-13+b2) ... Setting up libnet-http-perl (6.23-1) ... Setting up libnss3:amd64 (2:3.100-1) ... Setting up libxcb-shm0:amd64 (1.17.0-2) ... Setting up libdevel-callchecker-perl:amd64 (0.009-1+b1) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up libxcb-present0:amd64 (1.17.0-2) ... Setting up dh-autoreconf (20) ... Setting up patchutils (0.4.2-1) ... Setting up libthai0:amd64 (0.1.29-2) ... Setting up ca-certificates (20240203) ... Updating certificates in /etc/ssl/certs... 146 added, 0 removed; done. Setting up libllvm17t64:amd64 (1:17.0.6-12) ... Setting up libfreetype6:amd64 (2.13.2+dfsg-1+b4) ... Setting up libxcb-sync1:amd64 (1.17.0-2) ... Setting up shared-mime-info (2.4-5) ... Setting up libgssapi-krb5-2:amd64 (1.20.1-6+b1) ... Setting up libxcb-dri2-0:amd64 (1.17.0-2) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up libwww-robotrules-perl (6.02-1) ... Setting up libdrm2:amd64 (2.4.120-2) ... Setting up groff-base (1.23.0-4) ... Setting up libxcb-randr0:amd64 (1.17.0-2) ... Setting up libhtml-parser-perl:amd64 (3.82-1+b1) ... Setting up libx11-6:amd64 (2:1.8.7-1+b1) ... Setting up libharfbuzz0b:amd64 (8.3.0-2+b1) ... Setting up libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-1) ... Setting up libfontconfig1:amd64 (2.15.0-1.1) ... Setting up ca-certificates-java (20240118) ... No JRE found. Skipping Java certificates setup. Setting up libxcomposite1:amd64 (1:0.4.5-1+b1) ... Setting up libarchive13t64:amd64 (3.7.2-2.1) ... Setting up libavahi-client3:amd64 (0.8-13+b2) ... Setting up libio-socket-ssl-perl (2.085-1) ... Setting up libpython3-stdlib:amd64 (3.11.8-1) ... Setting up libhttp-message-perl (6.46-1) ... Setting up libdrm-amdgpu1:amd64 (2.4.120-2) ... Setting up libxcb-dri3-0:amd64 (1.17.0-2) ... Setting up gtk-update-icon-cache (3.24.42-1) ... Setting up libx11-xcb1:amd64 (2:1.8.7-1+b1) ... Setting up python3.11 (3.11.9-1) ... Setting up libhttp-negotiate-perl (6.01-2) ... Setting up fontconfig (2.15.0-1.1) ... Regenerating fonts cache... done. Setting up libxdamage1:amd64 (1:1.1.6-1+b1) ... Setting up libxrender1:amd64 (1:0.9.10-1.1+b1) ... Setting up libcurl4t64:amd64 (8.8.0-1) ... Setting up libhttp-cookies-perl (6.11-1) ... Setting up libdrm-radeon1:amd64 (2.4.120-2) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libhtml-tree-perl (5.07-3) ... Setting up libparams-classify-perl:amd64 (0.015-2+b4) ... Setting up libpango-1.0-0:amd64 (1.52.2+ds-1) ... Setting up libdrm-intel1:amd64 (2.4.120-2) ... Setting up libgl1-mesa-dri:amd64 (24.1.0-2) ... Setting up libcurl3t64-gnutls:amd64 (8.8.0-1) ... Setting up libxext6:amd64 (2:1.3.4-1+b1) ... Setting up python3 (3.11.8-1) ... Setting up libcurl4-gnutls-dev:amd64 (8.8.0-1) ... Setting up man-db (2.12.1-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libcairo2:amd64 (1.18.0-3+b1) ... Setting up libxxf86vm1:amd64 (1:1.1.4-1+b2) ... Setting up adwaita-icon-theme (46.0-1) ... update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode Setting up libmodule-runtime-perl (0.016-2) ... Setting up libxfixes3:amd64 (1:6.0.0-2+b1) ... Setting up libxinerama1:amd64 (2:1.1.4-3+b1) ... Setting up libxrandr2:amd64 (2:1.5.4-1) ... Setting up openjdk-17-jre-headless:amd64 (17.0.11+9-1) ... update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/java to provide /usr/bin/java (java) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jpackage to provide /usr/bin/jpackage (jpackage) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode Setting up cmake (3.29.4-1) ... Setting up libhts3t64:amd64 (1.20+ds-1) ... Setting up libpangoft2-1.0-0:amd64 (1.52.2+ds-1) ... Setting up libcups2t64:amd64 (2.4.7-1.2+b1) ... Setting up libpangocairo-1.0-0:amd64 (1.52.2+ds-1) ... Setting up libglx-mesa0:amd64 (24.1.0-2) ... Setting up libxi6:amd64 (2:1.8.1-1) ... Setting up libglx0:amd64 (1.7.0-1+b1) ... Setting up libimport-into-perl (1.002005-2) ... Setting up libxtst6:amd64 (2:1.2.3-1.1+b1) ... Setting up libmoo-perl (2.005005-1) ... Setting up libxcursor1:amd64 (1:1.2.2-1) ... Setting up libhts-dev:amd64 (1.20+ds-1) ... Setting up debhelper (13.15.3) ... Setting up libgl1:amd64 (1.7.0-1+b1) ... Setting up libgtk2.0-0t64:amd64 (2.24.33-4) ... Setting up libwww-perl (6.77-1) ... Setting up devscripts (2.23.7) ... Setting up libguava-java (32.0.1-1) ... Setting up javahelper (0.80) ... Setting up liblwp-protocol-https-perl (6.14-1) ... Setting up liberror-prone-java (2.18.0-1) ... Setting up libjung-free-java (2.1.1-2) ... Processing triggers for libc-bin (2.38-12) ... Processing triggers for ca-certificates-java (20240118) ... Adding debian:ACCVRAIZ1.pem Adding debian:AC_RAIZ_FNMT-RCM.pem Adding debian:AC_RAIZ_FNMT-RCM_SERVIDORES_SEGUROS.pem Adding debian:Actalis_Authentication_Root_CA.pem Adding debian:AffirmTrust_Commercial.pem Adding debian:AffirmTrust_Networking.pem Adding debian:AffirmTrust_Premium_ECC.pem Adding debian:AffirmTrust_Premium.pem Adding debian:Amazon_Root_CA_1.pem Adding debian:Amazon_Root_CA_2.pem Adding debian:Amazon_Root_CA_3.pem Adding debian:Amazon_Root_CA_4.pem Adding debian:ANF_Secure_Server_Root_CA.pem Adding debian:Atos_TrustedRoot_2011.pem Adding debian:Atos_TrustedRoot_Root_CA_ECC_TLS_2021.pem Adding debian:Atos_TrustedRoot_Root_CA_RSA_TLS_2021.pem Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem Adding debian:Baltimore_CyberTrust_Root.pem Adding debian:BJCA_Global_Root_CA1.pem Adding debian:BJCA_Global_Root_CA2.pem Adding debian:Buypass_Class_2_Root_CA.pem Adding debian:Buypass_Class_3_Root_CA.pem Adding debian:CA_Disig_Root_R2.pem Adding debian:Certainly_Root_E1.pem Adding debian:Certainly_Root_R1.pem Adding debian:Certigna.pem Adding debian:Certigna_Root_CA.pem Adding debian:certSIGN_Root_CA_G2.pem Adding debian:certSIGN_ROOT_CA.pem Adding debian:Certum_EC-384_CA.pem Adding debian:Certum_Trusted_Network_CA_2.pem Adding debian:Certum_Trusted_Network_CA.pem Adding debian:Certum_Trusted_Root_CA.pem Adding debian:CFCA_EV_ROOT.pem Adding debian:CommScope_Public_Trust_ECC_Root-01.pem Adding debian:CommScope_Public_Trust_ECC_Root-02.pem Adding debian:CommScope_Public_Trust_RSA_Root-01.pem Adding debian:CommScope_Public_Trust_RSA_Root-02.pem Adding debian:Comodo_AAA_Services_root.pem Adding debian:COMODO_Certification_Authority.pem Adding debian:COMODO_ECC_Certification_Authority.pem Adding debian:COMODO_RSA_Certification_Authority.pem Adding debian:DigiCert_Assured_ID_Root_CA.pem Adding debian:DigiCert_Assured_ID_Root_G2.pem Adding debian:DigiCert_Assured_ID_Root_G3.pem Adding debian:DigiCert_Global_Root_CA.pem Adding debian:DigiCert_Global_Root_G2.pem Adding debian:DigiCert_Global_Root_G3.pem Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem Adding debian:DigiCert_TLS_ECC_P384_Root_G5.pem Adding debian:DigiCert_TLS_RSA4096_Root_G5.pem Adding debian:DigiCert_Trusted_Root_G4.pem Adding debian:D-TRUST_BR_Root_CA_1_2020.pem Adding debian:D-TRUST_EV_Root_CA_1_2020.pem Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem Adding debian:emSign_ECC_Root_CA_-_C3.pem Adding debian:emSign_ECC_Root_CA_-_G3.pem Adding debian:emSign_Root_CA_-_C1.pem Adding debian:emSign_Root_CA_-_G1.pem Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem Adding debian:Entrust_Root_Certification_Authority_-_G2.pem Adding debian:Entrust_Root_Certification_Authority_-_G4.pem Adding debian:Entrust_Root_Certification_Authority.pem Adding debian:ePKI_Root_Certification_Authority.pem Adding debian:e-Szigno_Root_CA_2017.pem Adding debian:GDCA_TrustAUTH_R5_ROOT.pem Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem Adding debian:GlobalSign_Root_CA.pem Adding debian:GlobalSign_Root_CA_-_R3.pem Adding debian:GlobalSign_Root_CA_-_R6.pem Adding debian:GlobalSign_Root_E46.pem Adding debian:GlobalSign_Root_R46.pem Adding debian:GLOBALTRUST_2020.pem Adding debian:Go_Daddy_Class_2_CA.pem Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem Adding debian:GTS_Root_R1.pem Adding debian:GTS_Root_R2.pem Adding debian:GTS_Root_R3.pem Adding debian:GTS_Root_R4.pem Adding debian:HARICA_TLS_ECC_Root_CA_2021.pem Adding debian:HARICA_TLS_RSA_Root_CA_2021.pem Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem Adding debian:HiPKI_Root_CA_-_G1.pem Adding debian:Hongkong_Post_Root_CA_3.pem Adding debian:IdenTrust_Commercial_Root_CA_1.pem Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem Adding debian:ISRG_Root_X1.pem Adding debian:ISRG_Root_X2.pem Adding debian:Izenpe.com.pem Adding debian:Microsec_e-Szigno_Root_CA_2009.pem Adding debian:Microsoft_ECC_Root_Certificate_Authority_2017.pem Adding debian:Microsoft_RSA_Root_Certificate_Authority_2017.pem Adding debian:NAVER_Global_Root_Certification_Authority.pem Adding debian:NetLock_Arany_=Class_Gold=_Főtanúsítvány.pem Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem Adding debian:OISTE_WISeKey_Global_Root_GC_CA.pem Adding debian:QuoVadis_Root_CA_1_G3.pem Adding debian:QuoVadis_Root_CA_2_G3.pem Adding debian:QuoVadis_Root_CA_2.pem Adding debian:QuoVadis_Root_CA_3_G3.pem Adding debian:QuoVadis_Root_CA_3.pem Adding debian:Sectigo_Public_Server_Authentication_Root_E46.pem Adding debian:Sectigo_Public_Server_Authentication_Root_R46.pem Adding debian:Secure_Global_CA.pem Adding debian:SecureSign_RootCA11.pem Adding debian:SecureTrust_CA.pem Adding debian:Security_Communication_ECC_RootCA1.pem Adding debian:Security_Communication_RootCA2.pem Adding debian:Security_Communication_RootCA3.pem Adding debian:Security_Communication_Root_CA.pem Adding debian:SSL.com_EV_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_EV_Root_Certification_Authority_RSA_R2.pem Adding debian:SSL.com_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_Root_Certification_Authority_RSA.pem Adding debian:SSL.com_TLS_ECC_Root_CA_2022.pem Adding debian:SSL.com_TLS_RSA_Root_CA_2022.pem Adding debian:Starfield_Class_2_CA.pem Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem Adding debian:SwissSign_Gold_CA_-_G2.pem Adding debian:SwissSign_Silver_CA_-_G2.pem Adding debian:SZAFIR_ROOT_CA2.pem Adding debian:Telia_Root_CA_v2.pem Adding debian:TeliaSonera_Root_CA_v1.pem Adding debian:TrustAsia_Global_Root_CA_G3.pem Adding debian:TrustAsia_Global_Root_CA_G4.pem Adding debian:Trustwave_Global_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P256_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P384_Certification_Authority.pem Adding debian:T-TeleSec_GlobalRoot_Class_2.pem Adding debian:T-TeleSec_GlobalRoot_Class_3.pem Adding debian:TUBITAK_Kamu_SM_SSL_Kok_Sertifikasi_-_Surum_1.pem Adding debian:TunTrust_Root_CA.pem Adding debian:TWCA_Global_Root_CA.pem Adding debian:TWCA_Root_Certification_Authority.pem Adding debian:UCA_Extended_Validation_Root.pem Adding debian:UCA_Global_G2_Root.pem Adding debian:USERTrust_ECC_Certification_Authority.pem Adding debian:USERTrust_RSA_Certification_Authority.pem Adding debian:vTrus_ECC_Root_CA.pem Adding debian:vTrus_Root_CA.pem Adding debian:XRamp_Global_CA_Root.pem done. Setting up openjdk-17-jdk-headless:amd64 (17.0.11+9-1) ... update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jar to provide /usr/bin/jar (jar) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jarsigner to provide /usr/bin/jarsigner (jarsigner) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/javac to provide /usr/bin/javac (javac) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/javadoc to provide /usr/bin/javadoc (javadoc) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/javap to provide /usr/bin/javap (javap) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jcmd to provide /usr/bin/jcmd (jcmd) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jdb to provide /usr/bin/jdb (jdb) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jdeprscan to provide /usr/bin/jdeprscan (jdeprscan) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jdeps to provide /usr/bin/jdeps (jdeps) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jfr to provide /usr/bin/jfr (jfr) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jimage to provide /usr/bin/jimage (jimage) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jinfo to provide /usr/bin/jinfo (jinfo) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jlink to provide /usr/bin/jlink (jlink) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jmap to provide /usr/bin/jmap (jmap) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jmod to provide /usr/bin/jmod (jmod) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jps to provide /usr/bin/jps (jps) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jrunscript to provide /usr/bin/jrunscript (jrunscript) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jshell to provide /usr/bin/jshell (jshell) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jstack to provide /usr/bin/jstack (jstack) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jstat to provide /usr/bin/jstat (jstat) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jstatd to provide /usr/bin/jstatd (jstatd) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/serialver to provide /usr/bin/serialver (serialver) in auto mode update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jhsdb to provide /usr/bin/jhsdb (jhsdb) in auto mode Setting up default-jre-headless (2:1.17-75) ... Setting up openjdk-17-jre:amd64 (17.0.11+9-1) ... Setting up jaligner (1.0+dfsg-11) ... Setting up default-jre (2:1.17-75) ... Setting up openjdk-17-jdk:amd64 (17.0.11+9-1) ... update-alternatives: using /usr/lib/jvm/java-17-openjdk-amd64/bin/jconsole to provide /usr/bin/jconsole (jconsole) in auto mode Setting up default-jdk-headless (2:1.17-75) ... Setting up default-jdk (2:1.17-75) ... Setting up sbuild-build-depends-main-dummy (0.invalid.0) ... Processing triggers for ca-certificates (20240203) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. Processing triggers for ca-certificates-java (20240118) ... done. +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (amd64 included in amd64 arm64 ppc64el riscv64 loong64) +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 6.1.0-21-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.90-1 (2024-05-03) amd64 (x86_64) Toolchain package versions: binutils_2.42-4 dpkg-dev_1.22.6 g++-13_13.2.0-25 gcc-13_13.2.0-25 libc6-dev_2.38-12 libstdc++-13-dev_13.2.0-25 libstdc++6_14.1.0-1 linux-libc-dev_6.8.12-1 Package versions: adduser_3.137 adwaita-icon-theme_46.0-1 apt_2.9.4 at-spi2-common_2.52.0-1 autoconf_2.71-3 automake_1:1.16.5-1.3 autopoint_0.21-14 autotools-dev_20220109.1 base-files_13.2 base-passwd_3.6.3 bash_5.2.21-2+b1 binfmt-support_2.2.2-7 binutils_2.42-4 binutils-common_2.42-4 binutils-x86-64-linux-gnu_2.42-4 bsdextrautils_2.40.1-8 bsdutils_1:2.40.1-8 build-essential_12.10 bzip2_1.0.8-5.1 ca-certificates_20240203 ca-certificates-java_20240118 cmake_3.29.4-1 cmake-data_3.29.4-1 coreutils_9.4-3.1 cpp_4:13.2.0-7 cpp-13_13.2.0-25 cpp-13-x86-64-linux-gnu_13.2.0-25 cpp-x86-64-linux-gnu_4:13.2.0-7 dash_0.5.12-8 dctrl-tools_2.24-3+b1 debconf_1.5.86 debhelper_13.15.3 debian-archive-keyring_2023.4 debianutils_5.17 default-jdk_2:1.17-75 default-jdk-headless_2:1.17-75 default-jre_2:1.17-75 default-jre-headless_2:1.17-75 devscripts_2.23.7 dh-autoreconf_20 dh-strip-nondeterminism_1.14.0-1 diffutils_1:3.10-1 dirmngr_2.2.43-7 dpkg_1.22.6 dpkg-dev_1.22.6 dwz_0.15-1+b1 eatmydata_131-2 fakeroot_1.34-1 fastjar_2:0.98-7 file_1:5.45-3 findutils_4.9.0-6 fontconfig_2.15.0-1.1 fontconfig-config_2.15.0-1.1 fonts-dejavu-core_2.37-8 fonts-dejavu-mono_2.37-8 g++_4:13.2.0-7 g++-13_13.2.0-25 g++-13-x86-64-linux-gnu_13.2.0-25 g++-x86-64-linux-gnu_4:13.2.0-7 gcc_4:13.2.0-7 gcc-13_13.2.0-25 gcc-13-base_13.2.0-25 gcc-13-x86-64-linux-gnu_13.2.0-25 gcc-14-base_14.1.0-1 gcc-x86-64-linux-gnu_4:13.2.0-7 gettext_0.21-14+b1 gettext-base_0.21-14+b1 gnupg_2.2.43-7 gnupg-l10n_2.2.43-7 gnupg-utils_2.2.43-7 gpg_2.2.43-7 gpg-agent_2.2.43-7 gpg-wks-client_2.2.43-7 gpgconf_2.2.43-7 gpgsm_2.2.43-7 gpgv_2.2.43-7 grep_3.11-4 groff-base_1.23.0-4 gtk-update-icon-cache_3.24.42-1 gzip_1.12-1.1 hicolor-icon-theme_0.18-1 hostname_3.23+nmu2 init-system-helpers_1.66 intltool-debian_0.35.0+20060710.6 jaligner_1.0+dfsg-11 jarwrapper_0.80 java-common_0.75 javahelper_0.80 libacl1_2.3.2-2 libapt-pkg6.0t64_2.9.4 libarchive-zip-perl_1.68-1 libarchive13t64_3.7.2-2.1 libasan8_14.1.0-1 libasound2-data_1.2.11-1 libasound2t64_1.2.11-1+b1 libassuan0_2.5.6-1+b1 libatinject-jsr330-api-java_1.0+ds1-5 libatk1.0-0t64_2.52.0-1 libatomic1_14.1.0-1 libattr1_1:2.5.2-1 libaudit-common_1:3.1.2-2.1 libaudit1_1:3.1.2-2.1 libavahi-client3_0.8-13+b2 libavahi-common-data_0.8-13+b2 libavahi-common3_0.8-13+b2 libb-hooks-op-check-perl_0.22-3+b2 libbinutils_2.42-4 libblkid1_2.40.1-8 libbrotli1_1.1.0-2+b3 libbsd0_0.12.2-1 libbz2-1.0_1.0.8-5.1 libc-bin_2.38-12 libc-dev-bin_2.38-12 libc-l10n_2.38-12 libc6_2.38-12 libc6-dev_2.38-12 libcairo2_1.18.0-3+b1 libcap-ng0_0.8.5-1 libcap2_1:2.66-5 libcc1-0_14.1.0-1 libclass-method-modifiers-perl_2.15-1 libclass-xsaccessor-perl_1.19-4+b4 libclone-perl_0.46-1+b3 libcom-err2_1.47.1-1 libcrypt-dev_1:4.4.36-4 libcrypt1_1:4.4.36-4 libctf-nobfd0_2.42-4 libctf0_2.42-4 libcups2t64_2.4.7-1.2+b1 libcurl3t64-gnutls_8.8.0-1 libcurl4-gnutls-dev_8.8.0-1 libcurl4t64_8.8.0-1 libdatrie1_0.2.13-3 libdb5.3t64_5.3.28+dfsg2-7 libdbus-1-3_1.14.10-4+b1 libdebconfclient0_0.272 libdebhelper-perl_13.15.3 libdeflate-dev_1.20-1 libdeflate0_1.20-1 libdevel-callchecker-perl_0.009-1+b1 libdpkg-perl_1.22.6 libdrm-amdgpu1_2.4.120-2 libdrm-common_2.4.120-2 libdrm-intel1_2.4.120-2 libdrm-radeon1_2.4.120-2 libdrm2_2.4.120-2 libdynaloader-functions-perl_0.003-3 libeatmydata1_131-2 libedit2_3.1-20240517-1 libelf1t64_0.191-1+b1 libencode-locale-perl_1.05-3 liberror-prone-java_2.18.0-1 libexpat1_2.6.2-1 libfakeroot_1.34-1 libffi8_3.4.6-1 libfile-dirlist-perl_0.05-3 libfile-homedir-perl_1.006-2 libfile-listing-perl_6.16-1 libfile-stripnondeterminism-perl_1.14.0-1 libfile-touch-perl_0.12-2 libfile-which-perl_1.27-2 libfontconfig1_2.15.0-1.1 libfreetype6_2.13.2+dfsg-1+b4 libfribidi0_1.0.13-3+b1 libgcc-13-dev_13.2.0-25 libgcc-s1_14.1.0-1 libgcrypt20_1.10.3-3 libgdbm-compat4t64_1.23-5.1+b1 libgdbm6t64_1.23-5.1+b1 libgdk-pixbuf-2.0-0_2.42.12+dfsg-1 libgdk-pixbuf2.0-common_2.42.12+dfsg-1 libgetopt-java_1.0.14+dfsg-6 libgif7_5.2.2-1 libgl1_1.7.0-1+b1 libgl1-mesa-dri_24.1.0-2 libglapi-mesa_24.1.0-2 libglib2.0-0t64_2.80.2-2 libglvnd0_1.7.0-1+b1 libglx-mesa0_24.1.0-2 libglx0_1.7.0-1+b1 libgmp10_2:6.3.0+dfsg-2+b1 libgnutls30t64_3.8.5-4 libgomp1_14.1.0-1 libgpg-error0_1.49-2 libgprofng0_2.42-4 libgraphite2-3_1.3.14-2 libgssapi-krb5-2_1.20.1-6+b1 libgtk2.0-0t64_2.24.33-4 libgtk2.0-common_2.24.33-4 libguava-java_32.0.1-1 libharfbuzz0b_8.3.0-2+b1 libhogweed6t64_3.9.1-2.2 libhtml-parser-perl_3.82-1+b1 libhtml-tagset-perl_3.24-1 libhtml-tree-perl_5.07-3 libhts-dev_1.20+ds-1 libhts3t64_1.20+ds-1 libhtscodecs2_1.6.0-1+b1 libhttp-cookies-perl_6.11-1 libhttp-date-perl_6.06-1 libhttp-message-perl_6.46-1 libhttp-negotiate-perl_6.01-2 libhwasan0_14.1.0-1 libicu72_72.1-4+b1 libidn2-0_2.3.7-2 libimport-into-perl_1.002005-2 libio-html-perl_1.004-3 libio-pty-perl_1:1.20-1+b2 libio-socket-ssl-perl_2.085-1 libipc-run-perl_20231003.0-2 libisl23_0.26-3+b2 libitm1_14.1.0-1 libjansson4_2.14-2+b2 libjbig0_2.1-6.1+b1 libjpeg62-turbo_1:2.1.5-3 libjs-jquery_3.6.1+dfsg+~3.5.14-1 libjsoncpp25_1.9.5-6+b2 libjsr305-java_0.1~+svn49-11 libjung-free-java_2.1.1-2 libk5crypto3_1.20.1-6+b1 libkeyutils1_1.6.3-3 libkrb5-3_1.20.1-6+b1 libkrb5support0_1.20.1-6+b1 libksba8_1.6.6-1 liblcms2-2_2.14-2+b1 libldap-2.5-0_2.5.17+dfsg-1+b1 liblerc4_4.0.0+ds-4+b1 libllvm17t64_1:17.0.6-12 liblsan0_14.1.0-1 liblwp-mediatypes-perl_6.04-2 liblwp-protocol-https-perl_6.14-1 liblz4-1_1.9.4-2 liblzma-dev_5.6.1+really5.4.5-1 liblzma5_5.6.1+really5.4.5-1 libmagic-mgc_1:5.45-3 libmagic1t64_1:5.45-3 libmd0_1.1.0-2 libmodule-runtime-perl_0.016-2 libmoo-perl_2.005005-1 libmount1_2.40.1-8 libmpc3_1.3.1-1+b2 libmpfr6_4.2.1-1+b1 libncursesw6_6.5-2 libnet-http-perl_6.23-1 libnet-ssleay-perl_1.94-1+b2 libnettle8t64_3.9.1-2.2 libnghttp2-14_1.61.0-1+b1 libnpth0t64_1.6-3.1 libnspr4_2:4.35-1.1+b1 libnss3_2:3.100-1 libp11-kit0_0.25.3-5 libpam-modules_1.5.3-7 libpam-modules-bin_1.5.3-7 libpam-runtime_1.5.3-7 libpam0g_1.5.3-7 libpango-1.0-0_1.52.2+ds-1 libpangocairo-1.0-0_1.52.2+ds-1 libpangoft2-1.0-0_1.52.2+ds-1 libparams-classify-perl_0.015-2+b4 libpciaccess0_0.17-3+b1 libpcre2-8-0_10.42-4+b1 libpcsclite1_2.2.3-1 libperl5.38t64_5.38.2-5 libperl5.40_5.40.0~rc1-1 libpipeline1_1.5.7-2 libpixman-1-0_0.42.2-1+b1 libpng16-16t64_1.6.43-5 libproc2-0_2:4.0.4-4 libpsl5t64_0.21.2-1.1 libpython3-stdlib_3.11.8-1 libpython3.11-minimal_3.11.9-1 libpython3.11-stdlib_3.11.9-1 libquadmath0_14.1.0-1 libreadline8t64_8.2-4 librhash0_1.4.3-3+b1 librole-tiny-perl_2.002004-1 librtmp1_2.4+20151223.gitfa8646d.1-2+b4 libsasl2-2_2.1.28+dfsg1-6 libsasl2-modules-db_2.1.28+dfsg1-6 libseccomp2_2.5.5-1 libselinux1_3.5-2+b2 libsemanage-common_3.5-1 libsemanage2_3.5-1+b3 libsensors-config_1:3.6.0-10 libsensors5_1:3.6.0-10 libsepol2_3.5-2+b1 libsframe1_2.42-4 libsharpyuv0_1.4.0-0.1 libsmartcols1_2.40.1-8 libsqlite3-0_3.46.0-1 libssh2-1t64_1.11.0-5 libssl3t64_3.2.2-1 libstdc++-13-dev_13.2.0-25 libstdc++6_14.1.0-1 libsub-quote-perl_2.006008-1 libsystemd0_256~rc3-7 libtasn1-6_4.19.0-3+b2 libthai-data_0.1.29-2 libthai0_0.1.29-2 libtiff6_4.5.1+git230720-4 libtimedate-perl_2.3300-2 libtinfo6_6.5-2 libtool_2.4.7-7 libtry-tiny-perl_0.31-2 libtsan2_14.1.0-1 libubsan1_14.1.0-1 libuchardet0_0.0.8-1+b1 libudev1_256~rc3-7 libunistring5_1.2-1 liburi-perl_5.28-1 libuuid1_2.40.1-8 libuv1t64_1.48.0-4 libvulkan1_1.3.283.0-1 libwebp7_1.4.0-0.1 libwww-perl_6.77-1 libwww-robotrules-perl_6.02-1 libx11-6_2:1.8.7-1+b1 libx11-data_2:1.8.7-1 libx11-xcb1_2:1.8.7-1+b1 libxau6_1:1.0.9-1+b1 libxcb-dri2-0_1.17.0-2 libxcb-dri3-0_1.17.0-2 libxcb-glx0_1.17.0-2 libxcb-present0_1.17.0-2 libxcb-randr0_1.17.0-2 libxcb-render0_1.17.0-2 libxcb-shm0_1.17.0-2 libxcb-sync1_1.17.0-2 libxcb-xfixes0_1.17.0-2 libxcb1_1.17.0-2 libxcomposite1_1:0.4.5-1+b1 libxcursor1_1:1.2.2-1 libxdamage1_1:1.1.6-1+b1 libxdmcp6_1:1.1.2-3+b1 libxext6_2:1.3.4-1+b1 libxfixes3_1:6.0.0-2+b1 libxi6_2:1.8.1-1 libxinerama1_2:1.1.4-3+b1 libxml2_2.12.7+dfsg-3 libxrandr2_2:1.5.4-1 libxrender1_1:0.9.10-1.1+b1 libxshmfence1_1.3-1+b1 libxtst6_2:1.2.3-1.1+b1 libxxf86vm1_1:1.1.4-1+b2 libxxhash0_0.8.2-2+b1 libz3-4_4.8.12-3.1+b2 libzstd1_1.5.5+dfsg2-2 linux-libc-dev_6.8.12-1 locales-all_2.38-12 login_1:4.13+dfsg1-5 m4_1.4.19-4 make_4.3-4.1 man-db_2.12.1-1 mawk_1.3.4.20240123-1 media-types_10.1.0 ncurses-base_6.5-2 ncurses-bin_6.5-2 netbase_6.4 openjdk-17-jdk_17.0.11+9-1 openjdk-17-jdk-headless_17.0.11+9-1 openjdk-17-jre_17.0.11+9-1 openjdk-17-jre-headless_17.0.11+9-1 openssl_3.2.2-1 passwd_1:4.13+dfsg1-5 patch_2.7.6-7 patchutils_0.4.2-1 perl_5.40.0~rc1-1 perl-base_5.40.0~rc1-1 perl-modules-5.38_5.38.2-5 perl-modules-5.40_5.40.0~rc1-1 perl-openssl-defaults_7+b2 pinentry-curses_1.2.1-3+b2 po-debconf_1.0.21+nmu1 procps_2:4.0.4-4 python3_3.11.8-1 python3-minimal_3.11.8-1 python3.11_3.11.9-1 python3.11-minimal_3.11.9-1 readline-common_8.2-4 rpcsvc-proto_1.4.3-1 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2 sensible-utils_0.0.22 shared-mime-info_2.4-5 sysvinit-utils_3.09-1 tar_1.35+dfsg-3 tzdata_2024a-4 usr-is-merged_39 util-linux_2.40.1-8 wdiff_1.2.2-6 x11-common_1:7.7+23 xz-utils_5.6.1+really5.4.5-1 zlib1g_1:1.3.dfsg+really1.3.1-1 zlib1g-dev_1:1.3.dfsg+really1.3.1-1 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: trinityrnaseq Binary: trinityrnaseq, trinityrnaseq-examples Architecture: amd64 arm64 ppc64el riscv64 loong64 Version: 2.15.1+dfsg-5 Maintainer: Debian Med Packaging Team Uploaders: Michael R. Crusoe Homepage: https://github.com/trinityrnaseq/trinityrnaseq Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/trinityrnaseq Vcs-Git: https://salsa.debian.org/med-team/trinityrnaseq.git Testsuite: autopkgtest Testsuite-Triggers: hisat2, libpicard-java, python3-hisat2, r-bioc-deseq2, r-bioc-dexseq, r-bioc-edger, r-bioc-goseq, r-bioc-qvalue, r-cran-argparse, r-cran-cluster, r-cran-fastcluster, r-cran-goplot, r-cran-kernsmooth, r-cran-tidyverse, salmon Build-Depends: debhelper-compat (= 13), libjung-free-java (>= 2.1.1), javahelper, libgetopt-java, default-jdk, libjs-jquery, jaligner, libhts-dev, zlib1g-dev, cmake Package-List: trinityrnaseq deb science optional arch=amd64,arm64,ppc64el,riscv64,loong64 trinityrnaseq-examples deb science optional arch=amd64,arm64,ppc64el,riscv64,loong64 Checksums-Sha1: 0857b38a12ed7b84799ff870397a752991b8d618 307318092 trinityrnaseq_2.15.1+dfsg.orig.tar.xz 0ce99db551777c616526db8ae5ddbae1d64c3b39 39352 trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz Checksums-Sha256: b4892295ab2e92cf77b3f1022dac79945238436a81210538446e88b93e71c362 307318092 trinityrnaseq_2.15.1+dfsg.orig.tar.xz aabf9b51f963d4149fba77327a1588591020b620128cd330cf0429e926f379cd 39352 trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz Files: 5c0c9a8ab99b6f2593bea6029d56dfa3 307318092 trinityrnaseq_2.15.1+dfsg.orig.tar.xz fda10dbb9b5b348e0f0081edd75e7e86 39352 trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJCBAEBCgAsFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmWHYicOHHRpbGxlYUBy a2kuZGUACgkQV4oElNHGRtE2LA/9FMMAgIcWWch4rKhBVJBUxc5Qg0b8sciID6tC m1U22hjz2vGGAuytyW1LWEOUyujIOfXAUgmqXZjW/q+j9bRPe5twj75rQ+/wZgDp 4D/3xy3rtt5EjPnUXFqtsTi0/UpSHuAFvEQ5umdzqtuSGpyKQWMQKEwayCMcm2pK NKOcTyFmc5NFzE1fk8YHs6mGNYKn94O5pVq9ICs2WsVpVFOCHcFZE0mmS+TYFS9w Iz98fT18+eCbbCvC0MbTTMdwXkGTsG93Zs2lgqNt6CtnUj+yVEdV4vpO85b/EqBD Ko3z3ged5+LxnMSGY6aRIcCyyJAjBIszTBLJSdm0M0p+DoKTJTBH8IehotMgQtTA tTMQXpOsB4OaJtCnjHehbVYdBlNFIDfkalYKzI++bTDUjQC743NA6TKuvT2reihN aNQL+JNu1Nz+AOJRchb+MYNU2QsmiGtOfujJZt057fc236nHAVpipd5DwGeqzYRw pHupYIQeE+l2C1oZ4CDUNrq0fnhVBuz/TKvkDklysleBjFWn5U+PO563ebL8C8Oj IInhwGillKcc1wRWBUwKBMG89toQ1Q7lipA6vkf+v/I7owfDKKdpee4e5dlhM0nF PiLb2KFpOgfVEjdhvvdhCHhZx4e/i0a7ZaMm7B1T47U9mTA4/xOBNVKAnLxsmkk8 T+Rr9OU= =10OT -----END PGP SIGNATURE----- gpgv: Signature made Sat Dec 23 22:41:43 2023 UTC gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tillea@rki.de" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./trinityrnaseq_2.15.1+dfsg-5.dsc: no acceptable signature found dpkg-source: info: extracting trinityrnaseq in /<> dpkg-source: info: unpacking trinityrnaseq_2.15.1+dfsg.orig.tar.xz dpkg-source: info: unpacking trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying update-paths dpkg-source: info: applying collections15-to-4 dpkg-source: info: applying 0002-fix_istream_failure_call.patch dpkg-source: info: applying fix_system_paths dpkg-source: info: applying disable-version-check dpkg-source: info: applying adjust-trimmomatic-adapters-path dpkg-source: info: applying NeedlemanWunschGotohBanded.patch dpkg-source: info: applying python3 dpkg-source: info: applying unfix_num_of_cores dpkg-source: info: applying hardening dpkg-source: info: applying seqtk-trinity-hardening dpkg-source: info: applying skip_gatk_test dpkg-source: info: applying skip_tximportData_tests dpkg-source: info: applying submake dpkg-source: info: applying skip_blat dpkg-source: info: applying fix-gcc-10.patch dpkg-source: info: applying bamsifter_build dpkg-source: info: applying strip_m64 dpkg-source: info: applying extending_Function_in_jung.patch dpkg-source: info: applying R_4.2_fix Check disk space ---------------- Sufficient free space for build +------------------------------------------------------------------------------+ | Starting Timed Build Commands | +------------------------------------------------------------------------------+ /usr/share/debomatic/sbuildcommands/starting-build-commands/no-network trinityrnaseq_2.15.1+dfsg-5 perl-5.40-throwaway amd64 ---------------------------------------------------------------------------------------------------------------------------- I: Finished running '/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network trinityrnaseq_2.15.1+dfsg-5 perl-5.40-throwaway amd64'. Finished processing commands. -------------------------------------------------------------------------------- User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf HOME=/sbuild-nonexistent LANG=en_GB.UTF-8 LANGUAGE=en_GB:en LC_ALL=C.UTF-8 LD_LIBRARY_PATH=/usr/lib/libeatmydata LD_PRELOAD=libeatmydata.so LOGNAME=debomatic PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games PWD=/<> SCHROOT_ALIAS_NAME=perl-5.40-throwaway-amd64-debomatic SCHROOT_CHROOT_NAME=perl-5.40-amd64-debomatic SCHROOT_COMMAND=env SCHROOT_GID=110 SCHROOT_GROUP=sbuild SCHROOT_SESSION_ID=perl-5.40-amd64-debomatic-c4432663-5099-4aa0-bc0e-6acbd76e645f SCHROOT_UID=1002 SCHROOT_USER=debomatic SHELL=/bin/sh USER=debomatic dpkg-buildpackage ----------------- Command: dpkg-buildpackage --sanitize-env -us -uc -rfakeroot -Zxz dpkg-buildpackage: info: source package trinityrnaseq dpkg-buildpackage: info: source version 2.15.1+dfsg-5 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source -Zxz --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean --with javahelper debian/rules override_dh_auto_clean make[1]: Entering directory '/<>' for target in Inchworm Chrysalis; do dh_auto_clean \ --sourcedirectory=${target} --builddirectory=${target}_build; done for target in trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs trinity-plugins/bamsifter; do dh_auto_clean \ --sourcedirectory=${target}; done cd trinity-plugins/slclust && make -j2 clean make[2]: Entering directory '/<>/trinity-plugins/slclust' X=`pwd`; \ for i in src; \ do echo '<<<' $i '>>>'; cd $X/$i; make clean; done <<< src >>> make[3]: Entering directory '/<>/trinity-plugins/slclust/src' rm -f slcluster.o graph.o graphnode.o cmd_line_opts.o core a.out *~ \#* slclust Makefile.bak \ ../bin/slclust make[3]: Leaving directory '/<>/trinity-plugins/slclust/src' make[2]: Leaving directory '/<>/trinity-plugins/slclust' cd trinity-plugins/scaffold_iworm_contigs && make -j2 clean make[2]: Entering directory '/<>/trinity-plugins/scaffold_iworm_contigs' rm -f scaffold_iworm_contigs make[2]: Leaving directory '/<>/trinity-plugins/scaffold_iworm_contigs' rm --force Chrysalis/Makefile_auto rm --force trinity-plugins/slclust/bin/slclust cd trinity-plugins && /usr/bin/make clean || true make[2]: Entering directory '/<>/trinity-plugins' cd seqtk-trinity && /usr/bin/make clean make[3]: Entering directory '/<>/trinity-plugins/seqtk-trinity' rm -fr gmon.out *.o ext/*.o a.out seqtk trimadap *~ *.a *.dSYM session* make[3]: Leaving directory '/<>/trinity-plugins/seqtk-trinity' cd scaffold_iworm_contigs && /usr/bin/make clean make[3]: Entering directory '/<>/trinity-plugins/scaffold_iworm_contigs' rm -f scaffold_iworm_contigs make[3]: Leaving directory '/<>/trinity-plugins/scaffold_iworm_contigs' cd "ParaFly" && /usr/bin/make clean make[3]: Entering directory '/<>/trinity-plugins/ParaFly' Making clean in src make[4]: Entering directory '/<>/trinity-plugins/ParaFly/src' test -z "ParaFly" || rm -f ParaFly rm -f *.o make[4]: Leaving directory '/<>/trinity-plugins/ParaFly/src' Making clean in . make[4]: Entering directory '/<>/trinity-plugins/ParaFly' make[4]: Nothing to be done for 'clean-am'. make[4]: Leaving directory '/<>/trinity-plugins/ParaFly' make[3]: Leaving directory '/<>/trinity-plugins/ParaFly' rm -f ./Trimmomatic # rm symlink cd slclust && /usr/bin/make clean make[3]: Entering directory '/<>/trinity-plugins/slclust' X=`pwd`; \ for i in src; \ do echo '<<<' $i '>>>'; cd $X/$i; /usr/bin/make clean; done <<< src >>> make[4]: Entering directory '/<>/trinity-plugins/slclust/src' rm -f slcluster.o graph.o graphnode.o cmd_line_opts.o core a.out *~ \#* slclust Makefile.bak \ ../bin/slclust make[4]: Leaving directory '/<>/trinity-plugins/slclust/src' make[3]: Leaving directory '/<>/trinity-plugins/slclust' cd COLLECTL && rm -rf "collectl-4.1.0" && rm -f collectl cd htslib && /usr/bin/make clean /bin/sh: 1: cd: can't cd to htslib make[2]: *** [Makefile:54: clean] Error 2 make[2]: Leaving directory '/<>/trinity-plugins' make[1]: Leaving directory '/<>' jh_clean Duplicate specification "u=s" for option "u" dh_clean dpkg-source -Zxz -b . dpkg-source: info: using source format '3.0 (quilt)' dpkg-source: info: building trinityrnaseq using existing ./trinityrnaseq_2.15.1+dfsg.orig.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: warning: ignoring deletion of file trinity-plugins/ParaFly/config.log, use --include-removal to override dpkg-source: warning: ignoring deletion of file trinity-plugins/ParaFly/config.status, use --include-removal to override dpkg-source: info: building trinityrnaseq in trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz dpkg-source: info: building trinityrnaseq in trinityrnaseq_2.15.1+dfsg-5.dsc debian/rules binary dh binary --with javahelper dh_update_autotools_config debian/rules override_dh_autoreconf make[1]: Entering directory '/<>' echo No need to run autoreconf No need to run autoreconf make[1]: Leaving directory '/<>' debian/rules override_dh_auto_configure make[1]: Entering directory '/<>' rm -f Chrysalis/Makefile for target in Inchworm Chrysalis; do dh_auto_configure \ --sourcedirectory=${target} --builddirectory=${target}_build; done cd Inchworm_build && DEB_PYTHON_INSTALL_LAYOUT=deb cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_USE_PACKAGE_REGISTRY=OFF -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DFETCHCONTENT_FULLY_DISCONNECTED=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/x86_64-linux-gnu ../Inchworm CMake Deprecation Warning at CMakeLists.txt:1 (cmake_minimum_required): Compatibility with CMake < 3.5 will be removed from a future version of CMake. Update the VERSION argument value or use a ... suffix to tell CMake that the project does not need compatibility with older versions. -- The C compiler identification is GNU 13.2.0 -- The CXX compiler identification is GNU 13.2.0 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/gcc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/g++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- system: Linux -- Configuring done (0.5s) -- Generating done (0.0s) CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_FIND_USE_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR FETCHCONTENT_FULLY_DISCONNECTED -- Build files have been written to: /<>/Inchworm_build cd Chrysalis_build && DEB_PYTHON_INSTALL_LAYOUT=deb cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_USE_PACKAGE_REGISTRY=OFF -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DFETCHCONTENT_FULLY_DISCONNECTED=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/x86_64-linux-gnu ../Chrysalis CMake Deprecation Warning at CMakeLists.txt:1 (cmake_minimum_required): Compatibility with CMake < 3.5 will be removed from a future version of CMake. Update the VERSION argument value or use a ... suffix to tell CMake that the project does not need compatibility with older versions. -- The C compiler identification is GNU 13.2.0 -- The CXX compiler identification is GNU 13.2.0 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/gcc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/g++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- system: Linux -- Configuring done (0.4s) -- Generating done (0.0s) CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_FIND_USE_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR FETCHCONTENT_FULLY_DISCONNECTED -- Build files have been written to: /<>/Chrysalis_build make[1]: Leaving directory '/<>' jh_linkjars debian/rules override_dh_auto_build make[1]: Entering directory '/<>' for target in Inchworm Chrysalis; do dh_auto_build \ --sourcedirectory=${target} --builddirectory=${target}_build; done cd Inchworm_build && make -j2 "INSTALL=install --strip-program=true" VERBOSE=1 make[2]: Entering directory '/<>/Inchworm_build' /usr/bin/cmake -S/<>/Inchworm -B/<>/Inchworm_build --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /<>/Inchworm_build/CMakeFiles /<>/Inchworm_build//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[3]: Entering directory '/<>/Inchworm_build' make -f CMakeFiles/inchworm.dir/build.make CMakeFiles/inchworm.dir/depend make -f CMakeFiles/FastaToDeBruijn.dir/build.make CMakeFiles/FastaToDeBruijn.dir/depend make[4]: Entering directory '/<>/Inchworm_build' cd /<>/Inchworm_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Inchworm /<>/Inchworm /<>/Inchworm_build /<>/Inchworm_build /<>/Inchworm_build/CMakeFiles/inchworm.dir/DependInfo.cmake "--color=" make[4]: Entering directory '/<>/Inchworm_build' cd /<>/Inchworm_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Inchworm /<>/Inchworm /<>/Inchworm_build /<>/Inchworm_build /<>/Inchworm_build/CMakeFiles/FastaToDeBruijn.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Inchworm_build' make -f CMakeFiles/inchworm.dir/build.make CMakeFiles/inchworm.dir/build make[4]: Entering directory '/<>/Inchworm_build' make[4]: Leaving directory '/<>/Inchworm_build' make -f CMakeFiles/FastaToDeBruijn.dir/build.make CMakeFiles/FastaToDeBruijn.dir/build make[4]: Entering directory '/<>/Inchworm_build' [ 3%] Building CXX object CMakeFiles/inchworm.dir/src/Fasta_entry.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/Fasta_entry.cpp.o -MF CMakeFiles/inchworm.dir/src/Fasta_entry.cpp.o.d -o CMakeFiles/inchworm.dir/src/Fasta_entry.cpp.o -c /<>/Inchworm/src/Fasta_entry.cpp [ 7%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/FastaToDeBruijn.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/FastaToDeBruijn.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/FastaToDeBruijn.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/FastaToDeBruijn.cpp.o -c /<>/Inchworm/src/FastaToDeBruijn.cpp [ 10%] Building CXX object CMakeFiles/inchworm.dir/src/IRKE_run.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/IRKE_run.cpp.o -MF CMakeFiles/inchworm.dir/src/IRKE_run.cpp.o.d -o CMakeFiles/inchworm.dir/src/IRKE_run.cpp.o -c /<>/Inchworm/src/IRKE_run.cpp /<>/Inchworm/src/FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector >, int, bool, ArgProcessor)’: /<>/Inchworm/src/FastaToDeBruijn.cpp:215:39: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 215 | if (seq_region.size() < kmer_length) { continue; } // can be encountered in jaccard-clip mode (rarely) | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~ In file included from /usr/include/c++/13/ext/hash_map:60, from /<>/Inchworm/src/KmerCounter.hpp:53, from /<>/Inchworm/src/IRKE.hpp:7, from /<>/Inchworm/src/IRKE_run.cpp:11: /usr/include/c++/13/backward/backward_warning.h:32:2: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. [-Wcpp] 32 | #warning \ | ^~~~~~~ [ 14%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/argProcessor.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/argProcessor.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/argProcessor.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/argProcessor.cpp.o -c /<>/Inchworm/src/argProcessor.cpp [ 17%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/Fasta_reader.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/Fasta_reader.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/Fasta_reader.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/Fasta_reader.cpp.o -c /<>/Inchworm/src/Fasta_reader.cpp [ 21%] Building CXX object CMakeFiles/inchworm.dir/src/sequenceUtil.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/sequenceUtil.cpp.o -MF CMakeFiles/inchworm.dir/src/sequenceUtil.cpp.o.d -o CMakeFiles/inchworm.dir/src/sequenceUtil.cpp.o -c /<>/Inchworm/src/sequenceUtil.cpp [ 25%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/Fasta_entry.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/Fasta_entry.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/Fasta_entry.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/Fasta_entry.cpp.o -c /<>/Inchworm/src/Fasta_entry.cpp [ 28%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/sequenceUtil.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/sequenceUtil.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/sequenceUtil.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/sequenceUtil.cpp.o -c /<>/Inchworm/src/sequenceUtil.cpp [ 32%] Building CXX object CMakeFiles/inchworm.dir/src/IRKE.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/IRKE.cpp.o -MF CMakeFiles/inchworm.dir/src/IRKE.cpp.o.d -o CMakeFiles/inchworm.dir/src/IRKE.cpp.o -c /<>/Inchworm/src/IRKE.cpp In file included from /usr/include/c++/13/ext/hash_map:60, from /<>/Inchworm/src/KmerCounter.hpp:53, from /<>/Inchworm/src/IRKE.hpp:7, from /<>/Inchworm/src/IRKE.cpp:21: /usr/include/c++/13/backward/backward_warning.h:32:2: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. [-Wcpp] 32 | #warning \ | ^~~~~~~ [ 35%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/string_util.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/string_util.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/string_util.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/string_util.cpp.o -c /<>/Inchworm/src/string_util.cpp [ 39%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/stacktrace.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/stacktrace.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/stacktrace.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/stacktrace.cpp.o -c /<>/Inchworm/src/stacktrace.cpp In file included from /usr/include/x86_64-linux-gnu/c++/13/bits/c++allocator.h:33, from /usr/include/c++/13/bits/allocator.h:46, from /usr/include/c++/13/bits/stl_tree.h:64, from /usr/include/c++/13/map:62, from /<>/Inchworm/src/IRKE.cpp:2: In member function ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = iworm_tmp_file; _Args = {const iworm_tmp_file&}; _Tp = iworm_tmp_file]’, inlined from ‘static void std::allocator_traits >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = iworm_tmp_file; _Args = {const iworm_tmp_file&}; _Tp = iworm_tmp_file]’ at /usr/include/c++/13/bits/alloc_traits.h:538:17, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = iworm_tmp_file; _Alloc = std::allocator]’ at /usr/include/c++/13/bits/stl_vector.h:1286:30, inlined from ‘void IRKE::compute_sequence_assemblies(KmerCounter&, float, unsigned int, unsigned int, bool, bool, std::string)’ at /<>/Inchworm/src/IRKE.cpp:484:27: /usr/include/c++/13/bits/new_allocator.h:191:11: warning: ‘tmpfile_struct’ may be used uninitialized [-Wmaybe-uninitialized] 191 | { ::new((void *)__p) _Up(std::forward<_Args>(__args)...); } | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/Inchworm/src/IRKE.cpp: In member function ‘void IRKE::compute_sequence_assemblies(KmerCounter&, float, unsigned int, unsigned int, bool, bool, std::string)’: /<>/Inchworm/src/IRKE.cpp:483:24: note: ‘tmpfile_struct’ declared here 483 | iworm_tmp_file tmpfile_struct; | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/13/vector:66, from /<>/Inchworm/src/IRKE.cpp:10: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = iworm_tmp_file; _Alloc = std::allocator]’, inlined from ‘void IRKE::compute_sequence_assemblies(KmerCounter&, float, unsigned int, unsigned int, bool, bool, std::string)’ at /<>/Inchworm/src/IRKE.cpp:484:27: /usr/include/c++/13/bits/stl_vector.h:1292:28: warning: ‘tmpfile_struct’ may be used uninitialized [-Wmaybe-uninitialized] 1292 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In file included from /usr/include/c++/13/vector:72: /usr/include/c++/13/bits/vector.tcc: In member function ‘void IRKE::compute_sequence_assemblies(KmerCounter&, float, unsigned int, unsigned int, bool, bool, std::string)’: /usr/include/c++/13/bits/vector.tcc:445:7: note: by argument 3 of type ‘const iworm_tmp_file&’ to ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const iworm_tmp_file&}; _Tp = iworm_tmp_file; _Alloc = std::allocator]’ declared here 445 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ /<>/Inchworm/src/IRKE.cpp:483:24: note: ‘tmpfile_struct’ declared here 483 | iworm_tmp_file tmpfile_struct; | ^~~~~~~~~~~~~~ [ 42%] Building CXX object CMakeFiles/FastaToDeBruijn.dir/src/DeBruijnGraph.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/FastaToDeBruijn.dir/src/DeBruijnGraph.cpp.o -MF CMakeFiles/FastaToDeBruijn.dir/src/DeBruijnGraph.cpp.o.d -o CMakeFiles/FastaToDeBruijn.dir/src/DeBruijnGraph.cpp.o -c /<>/Inchworm/src/DeBruijnGraph.cpp /<>/Inchworm/src/DeBruijnGraph.cpp: In member function ‘std::string DeBruijnKmer::get_annotations_string()’: /<>/Inchworm/src/DeBruijnGraph.cpp:66:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 66 | for (int i=0; i < _annotations.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~~~ /<>/Inchworm/src/DeBruijnGraph.cpp: In member function ‘std::string DeBruijnGraph::toDOT(bool)’: /<>/Inchworm/src/DeBruijnGraph.cpp:445:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 445 | for (int i=0; i < prev_kmers.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~ /<>/Inchworm/src/DeBruijnGraph.cpp:494:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 494 | for (int i=0; i < next_kmers.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~ /<>/Inchworm/src/DeBruijnGraph.cpp: In member function ‘std::string DeBruijnGraph::toChrysalisFormat(int, bool)’: /<>/Inchworm/src/DeBruijnGraph.cpp:725:35: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 725 | for (int i = 0; i < collected_kmers.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~~ [ 46%] Building CXX object CMakeFiles/inchworm.dir/src/KmerCounter.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/KmerCounter.cpp.o -MF CMakeFiles/inchworm.dir/src/KmerCounter.cpp.o.d -o CMakeFiles/inchworm.dir/src/KmerCounter.cpp.o -c /<>/Inchworm/src/KmerCounter.cpp In file included from /usr/include/c++/13/ext/hash_map:60, from /<>/Inchworm/src/KmerCounter.hpp:53, from /<>/Inchworm/src/KmerCounter.cpp:1: /usr/include/c++/13/backward/backward_warning.h:32:2: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. [-Wcpp] 32 | #warning \ | ^~~~~~~ [ 50%] Building CXX object CMakeFiles/inchworm.dir/src/string_util.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/string_util.cpp.o -MF CMakeFiles/inchworm.dir/src/string_util.cpp.o.d -o CMakeFiles/inchworm.dir/src/string_util.cpp.o -c /<>/Inchworm/src/string_util.cpp [ 53%] Building CXX object CMakeFiles/inchworm.dir/src/Fasta_reader.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/Fasta_reader.cpp.o -MF CMakeFiles/inchworm.dir/src/Fasta_reader.cpp.o.d -o CMakeFiles/inchworm.dir/src/Fasta_reader.cpp.o -c /<>/Inchworm/src/Fasta_reader.cpp [ 57%] Linking CXX executable FastaToDeBruijn /usr/bin/cmake -E cmake_link_script CMakeFiles/FastaToDeBruijn.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/FastaToDeBruijn.dir/src/FastaToDeBruijn.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/argProcessor.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/Fasta_reader.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/Fasta_entry.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/sequenceUtil.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/string_util.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/stacktrace.cpp.o CMakeFiles/FastaToDeBruijn.dir/src/DeBruijnGraph.cpp.o -o FastaToDeBruijn make[4]: Leaving directory '/<>/Inchworm_build' [ 57%] Built target FastaToDeBruijn make -f CMakeFiles/fastaToKmerCoverageStats.dir/build.make CMakeFiles/fastaToKmerCoverageStats.dir/depend make[4]: Entering directory '/<>/Inchworm_build' cd /<>/Inchworm_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Inchworm /<>/Inchworm /<>/Inchworm_build /<>/Inchworm_build /<>/Inchworm_build/CMakeFiles/fastaToKmerCoverageStats.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Inchworm_build' make -f CMakeFiles/fastaToKmerCoverageStats.dir/build.make CMakeFiles/fastaToKmerCoverageStats.dir/build make[4]: Entering directory '/<>/Inchworm_build' [ 60%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/fastaToKmerCoverageStats.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/fastaToKmerCoverageStats.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/fastaToKmerCoverageStats.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/fastaToKmerCoverageStats.cpp.o -c /<>/Inchworm/src/fastaToKmerCoverageStats.cpp In file included from /usr/include/c++/13/ext/hash_map:60, from /<>/Inchworm/src/KmerCounter.hpp:53, from /<>/Inchworm/src/IRKE.hpp:7, from /<>/Inchworm/src/fastaToKmerCoverageStats.cpp:20: /usr/include/c++/13/backward/backward_warning.h:32:2: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. [-Wcpp] 32 | #warning \ | ^~~~~~~ [ 64%] Building CXX object CMakeFiles/inchworm.dir/src/stacktrace.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/stacktrace.cpp.o -MF CMakeFiles/inchworm.dir/src/stacktrace.cpp.o.d -o CMakeFiles/inchworm.dir/src/stacktrace.cpp.o -c /<>/Inchworm/src/stacktrace.cpp /<>/Inchworm/src/fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&, std::string&)’: /<>/Inchworm/src/fastaToKmerCoverageStats.cpp:231:18: warning: unused variable ‘kmer_length’ [-Wunused-variable] 231 | unsigned int kmer_length = kcounter.get_kmer_length(); | ^~~~~~~~~~~ [ 67%] Building CXX object CMakeFiles/inchworm.dir/src/argProcessor.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/inchworm.dir/src/argProcessor.cpp.o -MF CMakeFiles/inchworm.dir/src/argProcessor.cpp.o.d -o CMakeFiles/inchworm.dir/src/argProcessor.cpp.o -c /<>/Inchworm/src/argProcessor.cpp /<>/Inchworm/src/fastaToKmerCoverageStats.cpp:250:9: warning: ‘end’ may be used uninitialized [-Wmaybe-uninitialized] 250 | #pragma omp parallel private (myTid) | ^~~ /<>/Inchworm/src/fastaToKmerCoverageStats.cpp:235:26: note: ‘end’ was declared here 235 | unsigned long start, end; | ^~~ [ 71%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/argProcessor.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/argProcessor.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/argProcessor.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/argProcessor.cpp.o -c /<>/Inchworm/src/argProcessor.cpp [ 75%] Linking CXX executable inchworm /usr/bin/cmake -E cmake_link_script CMakeFiles/inchworm.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/inchworm.dir/src/Fasta_entry.cpp.o CMakeFiles/inchworm.dir/src/IRKE_run.cpp.o CMakeFiles/inchworm.dir/src/sequenceUtil.cpp.o CMakeFiles/inchworm.dir/src/IRKE.cpp.o CMakeFiles/inchworm.dir/src/KmerCounter.cpp.o CMakeFiles/inchworm.dir/src/string_util.cpp.o CMakeFiles/inchworm.dir/src/Fasta_reader.cpp.o CMakeFiles/inchworm.dir/src/stacktrace.cpp.o CMakeFiles/inchworm.dir/src/argProcessor.cpp.o -o inchworm make[4]: Leaving directory '/<>/Inchworm_build' [ 75%] Built target inchworm [ 78%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_reader.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_reader.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_reader.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_reader.cpp.o -c /<>/Inchworm/src/Fasta_reader.cpp [ 82%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_entry.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_entry.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_entry.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_entry.cpp.o -c /<>/Inchworm/src/Fasta_entry.cpp [ 85%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/sequenceUtil.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/sequenceUtil.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/sequenceUtil.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/sequenceUtil.cpp.o -c /<>/Inchworm/src/sequenceUtil.cpp [ 89%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/string_util.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/string_util.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/string_util.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/string_util.cpp.o -c /<>/Inchworm/src/string_util.cpp [ 92%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/stacktrace.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/stacktrace.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/stacktrace.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/stacktrace.cpp.o -c /<>/Inchworm/src/stacktrace.cpp [ 96%] Building CXX object CMakeFiles/fastaToKmerCoverageStats.dir/src/KmerCounter.cpp.o /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -MD -MT CMakeFiles/fastaToKmerCoverageStats.dir/src/KmerCounter.cpp.o -MF CMakeFiles/fastaToKmerCoverageStats.dir/src/KmerCounter.cpp.o.d -o CMakeFiles/fastaToKmerCoverageStats.dir/src/KmerCounter.cpp.o -c /<>/Inchworm/src/KmerCounter.cpp In file included from /usr/include/c++/13/ext/hash_map:60, from /<>/Inchworm/src/KmerCounter.hpp:53, from /<>/Inchworm/src/KmerCounter.cpp:1: /usr/include/c++/13/backward/backward_warning.h:32:2: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. [-Wcpp] 32 | #warning \ | ^~~~~~~ [100%] Linking CXX executable fastaToKmerCoverageStats /usr/bin/cmake -E cmake_link_script CMakeFiles/fastaToKmerCoverageStats.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/fastaToKmerCoverageStats.dir/src/fastaToKmerCoverageStats.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/argProcessor.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_reader.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/Fasta_entry.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/sequenceUtil.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/string_util.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/stacktrace.cpp.o CMakeFiles/fastaToKmerCoverageStats.dir/src/KmerCounter.cpp.o -o fastaToKmerCoverageStats make[4]: Leaving directory '/<>/Inchworm_build' [100%] Built target fastaToKmerCoverageStats make[3]: Leaving directory '/<>/Inchworm_build' /usr/bin/cmake -E cmake_progress_start /<>/Inchworm_build/CMakeFiles 0 make[2]: Leaving directory '/<>/Inchworm_build' cd Chrysalis_build && make -j2 "INSTALL=install --strip-program=true" VERBOSE=1 make[2]: Entering directory '/<>/Chrysalis_build' /usr/bin/cmake -S/<>/Chrysalis -B/<>/Chrysalis_build --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /<>/Chrysalis_build/CMakeFiles /<>/Chrysalis_build//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[3]: Entering directory '/<>/Chrysalis_build' make -f CMakeFiles/Chrysalis.dir/build.make CMakeFiles/Chrysalis.dir/depend make -f CMakeFiles/GraphFromFasta.dir/build.make CMakeFiles/GraphFromFasta.dir/depend make[4]: Entering directory '/<>/Chrysalis_build' cd /<>/Chrysalis_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Chrysalis /<>/Chrysalis /<>/Chrysalis_build /<>/Chrysalis_build /<>/Chrysalis_build/CMakeFiles/Chrysalis.dir/DependInfo.cmake "--color=" make[4]: Entering directory '/<>/Chrysalis_build' cd /<>/Chrysalis_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Chrysalis /<>/Chrysalis /<>/Chrysalis_build /<>/Chrysalis_build /<>/Chrysalis_build/CMakeFiles/GraphFromFasta.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Chrysalis_build' make -f CMakeFiles/Chrysalis.dir/build.make CMakeFiles/Chrysalis.dir/build make[4]: Entering directory '/<>/Chrysalis_build' make[4]: Leaving directory '/<>/Chrysalis_build' make -f CMakeFiles/GraphFromFasta.dir/build.make CMakeFiles/GraphFromFasta.dir/build [ 1%] Building CXX object CMakeFiles/Chrysalis.dir/aligns/KmerAlignCore.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/aligns/KmerAlignCore.cc.o -MF CMakeFiles/Chrysalis.dir/aligns/KmerAlignCore.cc.o.d -o CMakeFiles/Chrysalis.dir/aligns/KmerAlignCore.cc.o -c /<>/Chrysalis/aligns/KmerAlignCore.cc make[4]: Entering directory '/<>/Chrysalis_build' [ 2%] Building CXX object CMakeFiles/GraphFromFasta.dir/aligns/KmerAlignCore.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/aligns/KmerAlignCore.cc.o -MF CMakeFiles/GraphFromFasta.dir/aligns/KmerAlignCore.cc.o.d -o CMakeFiles/GraphFromFasta.dir/aligns/KmerAlignCore.cc.o -c /<>/Chrysalis/aligns/KmerAlignCore.cc /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const vecDNAVector&, const vecNumVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:79:49: warning: unused variable ‘t’ [-Wunused-variable] 79 | KmerAlignCoreRecordStoreTable & t = m_table; // not used? | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:49:9: warning: unused variable ‘i’ [-Wunused-variable] 49 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const DNAVector&, int, int, bool)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:128:9: warning: unused variable ‘i’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:128:12: warning: unused variable ‘j’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::SortAll()’: /<>/Chrysalis/aligns/KmerAlignCore.cc:148:9: warning: unused variable ‘i’ [-Wunused-variable] 148 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘const svec& KmerAlignCore::GetMatchesDirectly(const DNAVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:158:9: warning: unused variable ‘size’ [-Wunused-variable] 158 | int size = m_pTrans->GetSize(); | ^~~~ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:9: warning: unused variable ‘i’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:12: warning: unused variable ‘j’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::MergeSortFilter(svec&, const svec&, const svec&)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:291:9: warning: unused variable ‘i’ [-Wunused-variable] 291 | int i; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const vecDNAVector&, const vecNumVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:79:49: warning: unused variable ‘t’ [-Wunused-variable] 79 | KmerAlignCoreRecordStoreTable & t = m_table; // not used? | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:49:9: warning: unused variable ‘i’ [-Wunused-variable] 49 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const DNAVector&, int, int, bool)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:128:9: warning: unused variable ‘i’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:128:12: warning: unused variable ‘j’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::SortAll()’: /<>/Chrysalis/aligns/KmerAlignCore.cc:148:9: warning: unused variable ‘i’ [-Wunused-variable] 148 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘const svec& KmerAlignCore::GetMatchesDirectly(const DNAVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:158:9: warning: unused variable ‘size’ [-Wunused-variable] 158 | int size = m_pTrans->GetSize(); | ^~~~ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:9: warning: unused variable ‘i’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:12: warning: unused variable ‘j’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::MergeSortFilter(svec&, const svec&, const svec&)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:291:9: warning: unused variable ‘i’ [-Wunused-variable] 291 | int i; | ^ [ 4%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/AACodons.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/AACodons.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/AACodons.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/AACodons.cc.o -c /<>/Chrysalis/analysis/AACodons.cc [ 5%] Building CXX object CMakeFiles/Chrysalis.dir/analysis/AACodons.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/analysis/AACodons.cc.o -MF CMakeFiles/Chrysalis.dir/analysis/AACodons.cc.o.d -o CMakeFiles/Chrysalis.dir/analysis/AACodons.cc.o -c /<>/Chrysalis/analysis/AACodons.cc [ 7%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/DNAVector.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/DNAVector.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/DNAVector.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/DNAVector.cc.o -c /<>/Chrysalis/analysis/DNAVector.cc [ 8%] Building CXX object CMakeFiles/Chrysalis.dir/analysis/Chrysalis.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/analysis/Chrysalis.cc.o -MF CMakeFiles/Chrysalis.dir/analysis/Chrysalis.cc.o.d -o CMakeFiles/Chrysalis.dir/analysis/Chrysalis.cc.o -c /<>/Chrysalis/analysis/Chrysalis.cc /<>/Chrysalis/analysis/Chrysalis.cc: In function ‘int main(int, char**)’: /<>/Chrysalis/analysis/Chrysalis.cc:582:21: warning: unused variable ‘num_iworm_contigs’ [-Wunused-variable] 582 | int num_iworm_contigs = parser.AsInt(2); | ^~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:570:16: warning: unused variable ‘pOut’ [-Wunused-variable] 570 | FILE * pOut = NULL; | ^~~~ /<>/Chrysalis/analysis/Chrysalis.cc:342:10: warning: unused variable ‘bSkip’ [-Wunused-variable] 342 | bool bSkip = P.GetBoolValueFor(skipCmmd); | ^~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:347:9: warning: unused variable ‘pairDist’ [-Wunused-variable] 347 | int pairDist = P.GetIntValueFor(distCmmd); | ^~~~~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:354:10: warning: variable ‘bBreak’ set but not used [-Wunused-but-set-variable] 354 | bool bBreak = true; | ^~~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:359:10: warning: unused variable ‘bButt’ [-Wunused-variable] 359 | bool bButt = P.GetBoolValueFor(buttCmmd); | ^~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:361:10: warning: unused variable ‘max_reads’ [-Wunused-variable] 361 | long max_reads = P.GetLongValueFor(maxReadsCmd); | ^~~~~~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:372:10: warning: unused variable ‘DEBUG’ [-Wunused-variable] 372 | bool DEBUG = P.GetBoolValueFor(debugCmmd); | ^~~~~ /<>/Chrysalis/analysis/Chrysalis.cc:384:11: warning: ignoring return value of ‘int system(const char*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 384 | system(command.c_str()); | ~~~~~~^~~~~~~~~~~~~~~~~ [ 10%] Building CXX object CMakeFiles/Chrysalis.dir/analysis/DNAVector.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/analysis/DNAVector.cc.o -MF CMakeFiles/Chrysalis.dir/analysis/DNAVector.cc.o.d -o CMakeFiles/Chrysalis.dir/analysis/DNAVector.cc.o -c /<>/Chrysalis/analysis/DNAVector.cc [ 11%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/DeBruijnGraph.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/DeBruijnGraph.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/DeBruijnGraph.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/DeBruijnGraph.cc.o -c /<>/Chrysalis/analysis/DeBruijnGraph.cc /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnKmer::add_next_kmer(kmer_int_type_t, unsigned int)’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:154:66: warning: unused parameter ‘kmer_length’ [-Wunused-parameter] 154 | void DeBruijnKmer::add_next_kmer(kmer_int_type_t k, unsigned int kmer_length) { | ~~~~~~~~~~~~~^~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘std::vector DeBruijnGraph::deconvolute_DS_mirror_graph()’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:355:22: warning: variable ‘rdk’ set but not used [-Wunused-but-set-variable] 355 | DeBruijnKmer rdk = _kmer_map.find(rk)->second; | ^~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘std::vector > DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 473 | for (int i = 0; i < left_extensions.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc:476:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 476 | for (int j = 0; j < right_extensions.size(); j++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&, std::vector >&, char, std::map&, int)’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:513:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 513 | for (int i = 0; i < adjacent_kmers.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc:527:41: warning: comparison of integer expressions of different signedness: ‘std::vector::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 527 | if (kmer_extension_chars.size() == flank_extension_length) { | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ [ 12%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/GraphFromFasta.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/GraphFromFasta.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/GraphFromFasta.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/GraphFromFasta.cc.o -c /<>/Chrysalis/analysis/GraphFromFasta.cc /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:272:15: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses] 271 | ( (! DISABLE_REPEAT_CHECK) | ~~~~~~~~~~~~~~~~~~~~~~~~ 272 | && | ^~ 273 | is_simple_repeat(left) || is_simple_repeat(right) ) | ~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘float align_get_per_id(const DNAVector&, const DNAVector&, int, int, int)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:351:94: warning: unused parameter ‘k’ [-Wunused-parameter] 351 | float align_get_per_id(const DNAVector & a, const DNAVector & b, int startA, int startB, int k) | ~~~~^ /<>/Chrysalis/analysis/GraphFromFasta.cc: In member function ‘bool Welder::Weldable(const DNAVector&, int, const DNAVector&, int, int, std::string&, unsigned int&)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:523:13: warning: unused variable ‘i’ [-Wunused-variable] 523 | int i; | ^ /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map&, std::map&, std::map&)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:713:31: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 713 | for (int j = 0; j < adjacent_nodes.size(); j++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘svec sl_cluster_pools(std::map&, std::map&)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:847:40: warning: implicitly-declared ‘Pool& Pool::operator=(const Pool&)’ is deprecated [-Wdeprecated-copy] 847 | pool_vec[oldpool_id] = tmp; | ^~~ In file included from /<>/Chrysalis/analysis/GraphFromFasta.cc:19: /<>/Chrysalis/analysis/Pool.h:24:5: note: because ‘Pool’ has user-provided ‘Pool::Pool(const Pool&)’ 24 | Pool(const Pool& p) { | ^~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘void add_scaffolds_to_clusters(std::map&, std::string, vecDNAVector&, int, float)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:961:33: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 961 | if (pair_link_count >= minCov) { | ~~~~~~~~~~~~~~~~^~~~~~~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘void add_iworm_link(std::map&, int, int)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:1006:55: warning: implicitly-declared ‘Pool& Pool::operator=(const Pool&)’ is deprecated [-Wdeprecated-copy] 1006 | weld_reinforced_iworm_clusters[iworm_index] = p; | ^ /<>/Chrysalis/analysis/Pool.h:24:5: note: because ‘Pool’ has user-provided ‘Pool::Pool(const Pool&)’ 24 | Pool(const Pool& p) { | ^~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’: /<>/Chrysalis/analysis/GraphFromFasta.cc:1310:20: warning: comparison of integer expressions of different signedness: ‘int’ and ‘size_t’ {aka ‘long unsigned int’} [-Wsign-compare] 1310 | for (i=0; i>/Chrysalis/analysis/GraphFromFasta.cc:1316:60: warning: comparison of integer expressions of different signedness: ‘int’ and ‘size_t’ {aka ‘long unsigned int’} [-Wsign-compare] 1316 | if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) { | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc:1442:16: warning: comparison of integer expressions of different signedness: ‘int’ and ‘size_t’ {aka ‘long unsigned int’} [-Wsign-compare] 1442 | for (i=0; i>/Chrysalis/analysis/GraphFromFasta.cc:1454:13: warning: unused variable ‘cutoff’ [-Wunused-variable] 1454 | int cutoff = 0; | ^~~~~~ /<>/Chrysalis/analysis/GraphFromFasta.cc:1268:9: warning: unused variable ‘total_iworm_contigs’ [-Wunused-variable] 1268 | int total_iworm_contigs = dna.size(); | ^~~~~~~~~~~~~~~~~~~ [ 14%] Building CXX object CMakeFiles/Chrysalis.dir/analysis/TranscriptomeGraph.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/analysis/TranscriptomeGraph.cc.o -MF CMakeFiles/Chrysalis.dir/analysis/TranscriptomeGraph.cc.o.d -o CMakeFiles/Chrysalis.dir/analysis/TranscriptomeGraph.cc.o -c /<>/Chrysalis/analysis/TranscriptomeGraph.cc /<>/Chrysalis/analysis/TranscriptomeGraph.cc: In member function ‘void KmerSequence::Setup()’: /<>/Chrysalis/analysis/TranscriptomeGraph.cc:177:19: warning: unused variable ‘i’ [-Wunused-variable] 177 | long long i; | ^ /<>/Chrysalis/analysis/TranscriptomeGraph.cc: In member function ‘void KmerSearch::Extend(long long int, DNAVector&, const svec&, DNAVector&)’: /<>/Chrysalis/analysis/TranscriptomeGraph.cc:547:16: warning: unused variable ‘plusminus’ [-Wunused-variable] 547 | static int plusminus = 0; | ^~~~~~~~~ /<>/Chrysalis/analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&, FILE*, int, bool)’: /<>/Chrysalis/analysis/TranscriptomeGraph.cc:668:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 668 | for (i=0; i<=d.isize()-k; i++) { | ~^~~~~~~~~~~~~ /<>/Chrysalis/analysis/TranscriptomeGraph.cc:647:10: warning: unused variable ‘bAppend’ [-Wunused-variable] 647 | bool bAppend = true; | ^~~~~~~ [ 15%] Building CXX object CMakeFiles/Chrysalis.dir/base/ErrorHandling.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/base/ErrorHandling.cc.o -MF CMakeFiles/Chrysalis.dir/base/ErrorHandling.cc.o.d -o CMakeFiles/Chrysalis.dir/base/ErrorHandling.cc.o -c /<>/Chrysalis/base/ErrorHandling.cc /<>/Chrysalis/base/ErrorHandling.cc: In function ‘void print_trace(FILE*, const char*, int)’: /<>/Chrysalis/base/ErrorHandling.cc:7:24: warning: unused parameter ‘out’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~^~~ /<>/Chrysalis/base/ErrorHandling.cc:7:41: warning: unused parameter ‘file’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~~~~~~~^~~~ /<>/Chrysalis/base/ErrorHandling.cc:7:51: warning: unused parameter ‘line’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~^~~~ [ 17%] Building CXX object CMakeFiles/Chrysalis.dir/base/FileParser.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/base/FileParser.cc.o -MF CMakeFiles/Chrysalis.dir/base/FileParser.cc.o.d -o CMakeFiles/Chrysalis.dir/base/FileParser.cc.o -c /<>/Chrysalis/base/FileParser.cc [ 18%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/KmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/KmerTable.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/KmerTable.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/KmerTable.cc.o -c /<>/Chrysalis/analysis/KmerTable.cc /<>/Chrysalis/base/FileParser.cc: In member function ‘bool StringParser::IsString(int)’: /<>/Chrysalis/base/FileParser.cc:50:33: warning: unused parameter ‘index’ [-Wunused-parameter] 50 | bool StringParser::IsString(int index) | ~~~~^~~~~ /<>/Chrysalis/analysis/KmerTable.cc: In member function ‘long long int KmerSequence::BasesToNumber(const DNAVector&, int)’: /<>/Chrysalis/analysis/KmerTable.cc:27:13: warning: unused variable ‘i’ [-Wunused-variable] 27 | long long i; | ^ [ 20%] Building CXX object CMakeFiles/Chrysalis.dir/base/StringUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/base/StringUtil.cc.o -MF CMakeFiles/Chrysalis.dir/base/StringUtil.cc.o.d -o CMakeFiles/Chrysalis.dir/base/StringUtil.cc.o -c /<>/Chrysalis/base/StringUtil.cc [ 21%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/NonRedKmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/NonRedKmerTable.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/NonRedKmerTable.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/NonRedKmerTable.cc.o -c /<>/Chrysalis/analysis/NonRedKmerTable.cc [ 22%] Building CXX object CMakeFiles/Chrysalis.dir/util/mutil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/Chrysalis.dir/util/mutil.cc.o -MF CMakeFiles/Chrysalis.dir/util/mutil.cc.o.d -o CMakeFiles/Chrysalis.dir/util/mutil.cc.o -c /<>/Chrysalis/util/mutil.cc /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::SetUp(const vecDNAVector&, bool)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:46:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 46 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:56:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 56 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:79:18: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 79 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(const vecDNAVector&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:109:16: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 109 | for (j=0; j<= d.isize()-m_k; j++) { | ~^~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(vecDNAVectorStream&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:125:9: warning: unused variable ‘i’ [-Wunused-variable] 125 | int i, j; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc:303:51: warning: unused parameter ‘pData’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:303:63: warning: unused parameter ‘lenInBytes’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadString(CMString&)’: /<>/Chrysalis/util/mutil.cc:436:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 436 | if (fscanf(m_pFile, pData, len, m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiWriteFileStream::WriteBlob(const void*, long int, long int)’: /<>/Chrysalis/util/mutil.cc:526:53: warning: unused parameter ‘pData’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~~~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:526:65: warning: unused parameter ‘lenInElements’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:526:85: warning: unused parameter ‘elSize’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:738:53: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 738 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, long int, bool)’: /<>/Chrysalis/util/mutil.cc:761:63: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 761 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, long val, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:787:80: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 787 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, const MCL_TCHAR * szText2, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MCLSetUTF8Encode(bool)’: /<>/Chrysalis/util/mutil.cc:1288:39: warning: unused parameter ‘b’ [-Wunused-parameter] 1288 | MDLLEXPORT void MCLSetUTF8Encode(bool b) | ~~~~~^ /<>/Chrysalis/util/mutil.cc: In function ‘bool AddUTF8Sig(CMString&)’: /<>/Chrysalis/util/mutil.cc:1688:16: warning: unused variable ‘p’ [-Wunused-variable] 1688 | const char * p = (const char*)string; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:13: warning: ‘szText’ may be used uninitialized [-Wmaybe-uninitialized] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/features.h:502, from /usr/include/x86_64-linux-gnu/bits/libc-header-start.h:33, from /usr/include/string.h:26, from /<>/Chrysalis/util/mutil.h:19, from /<>/Chrysalis/util/mutil.cc:9: /usr/include/stdio.h:440:12: note: by argument 2 of type ‘const char*’ to ‘int fscanf(FILE*, const char*, ...)’ declared here 440 | extern int __REDIRECT (fscanf, (FILE *__restrict __stream, | ^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:311:8: note: ‘szText’ declared here 311 | char szText[2048 * 10]; | ^~~~~~ [ 24%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/sequenceUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/sequenceUtil.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/sequenceUtil.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/sequenceUtil.cc.o -c /<>/Chrysalis/analysis/sequenceUtil.cc [ 25%] Linking CXX executable Chrysalis /usr/bin/cmake -E cmake_link_script CMakeFiles/Chrysalis.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/Chrysalis.dir/aligns/KmerAlignCore.cc.o CMakeFiles/Chrysalis.dir/analysis/AACodons.cc.o CMakeFiles/Chrysalis.dir/analysis/Chrysalis.cc.o CMakeFiles/Chrysalis.dir/analysis/DNAVector.cc.o CMakeFiles/Chrysalis.dir/analysis/TranscriptomeGraph.cc.o CMakeFiles/Chrysalis.dir/base/ErrorHandling.cc.o CMakeFiles/Chrysalis.dir/base/FileParser.cc.o CMakeFiles/Chrysalis.dir/base/StringUtil.cc.o CMakeFiles/Chrysalis.dir/util/mutil.cc.o -o Chrysalis make[4]: Leaving directory '/<>/Chrysalis_build' [ 25%] Built target Chrysalis make -f CMakeFiles/QuantifyGraph.dir/build.make CMakeFiles/QuantifyGraph.dir/depend make[4]: Entering directory '/<>/Chrysalis_build' cd /<>/Chrysalis_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Chrysalis /<>/Chrysalis /<>/Chrysalis_build /<>/Chrysalis_build /<>/Chrysalis_build/CMakeFiles/QuantifyGraph.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Chrysalis_build' make -f CMakeFiles/QuantifyGraph.dir/build.make CMakeFiles/QuantifyGraph.dir/build make[4]: Entering directory '/<>/Chrysalis_build' [ 27%] Building CXX object CMakeFiles/QuantifyGraph.dir/aligns/KmerAlignCore.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/aligns/KmerAlignCore.cc.o -MF CMakeFiles/QuantifyGraph.dir/aligns/KmerAlignCore.cc.o.d -o CMakeFiles/QuantifyGraph.dir/aligns/KmerAlignCore.cc.o -c /<>/Chrysalis/aligns/KmerAlignCore.cc /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:33:26: warning: array subscript has type ‘char’ [-Wchar-subscripts] 33 | if (_base_to_int[c] > 3) | ^ /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:264:32: warning: array subscript has type ‘char’ [-Wchar-subscripts] 264 | int val = _base_to_int[c]; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const vecDNAVector&, const vecNumVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:79:49: warning: unused variable ‘t’ [-Wunused-variable] 79 | KmerAlignCoreRecordStoreTable & t = m_table; // not used? | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:49:9: warning: unused variable ‘i’ [-Wunused-variable] 49 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const DNAVector&, int, int, bool)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:128:9: warning: unused variable ‘i’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:128:12: warning: unused variable ‘j’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::SortAll()’: /<>/Chrysalis/aligns/KmerAlignCore.cc:148:9: warning: unused variable ‘i’ [-Wunused-variable] 148 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘const svec& KmerAlignCore::GetMatchesDirectly(const DNAVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:158:9: warning: unused variable ‘size’ [-Wunused-variable] 158 | int size = m_pTrans->GetSize(); | ^~~~ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:9: warning: unused variable ‘i’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:12: warning: unused variable ‘j’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::MergeSortFilter(svec&, const svec&, const svec&)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:291:9: warning: unused variable ‘i’ [-Wunused-variable] 291 | int i; | ^ [ 28%] Building CXX object CMakeFiles/GraphFromFasta.dir/analysis/stacktrace.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/analysis/stacktrace.cc.o -MF CMakeFiles/GraphFromFasta.dir/analysis/stacktrace.cc.o.d -o CMakeFiles/GraphFromFasta.dir/analysis/stacktrace.cc.o -c /<>/Chrysalis/analysis/stacktrace.cc [ 30%] Building CXX object CMakeFiles/GraphFromFasta.dir/base/ErrorHandling.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/base/ErrorHandling.cc.o -MF CMakeFiles/GraphFromFasta.dir/base/ErrorHandling.cc.o.d -o CMakeFiles/GraphFromFasta.dir/base/ErrorHandling.cc.o -c /<>/Chrysalis/base/ErrorHandling.cc [ 31%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/AACodons.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/AACodons.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/AACodons.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/AACodons.cc.o -c /<>/Chrysalis/analysis/AACodons.cc /<>/Chrysalis/base/ErrorHandling.cc: In function ‘void print_trace(FILE*, const char*, int)’: /<>/Chrysalis/base/ErrorHandling.cc:7:24: warning: unused parameter ‘out’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~^~~ /<>/Chrysalis/base/ErrorHandling.cc:7:41: warning: unused parameter ‘file’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~~~~~~~^~~~ /<>/Chrysalis/base/ErrorHandling.cc:7:51: warning: unused parameter ‘line’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~^~~~ [ 32%] Building CXX object CMakeFiles/GraphFromFasta.dir/base/FileParser.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/base/FileParser.cc.o -MF CMakeFiles/GraphFromFasta.dir/base/FileParser.cc.o.d -o CMakeFiles/GraphFromFasta.dir/base/FileParser.cc.o -c /<>/Chrysalis/base/FileParser.cc /<>/Chrysalis/base/FileParser.cc: In member function ‘bool StringParser::IsString(int)’: /<>/Chrysalis/base/FileParser.cc:50:33: warning: unused parameter ‘index’ [-Wunused-parameter] 50 | bool StringParser::IsString(int index) | ~~~~^~~~~ [ 34%] Building CXX object CMakeFiles/GraphFromFasta.dir/base/StringUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/base/StringUtil.cc.o -MF CMakeFiles/GraphFromFasta.dir/base/StringUtil.cc.o.d -o CMakeFiles/GraphFromFasta.dir/base/StringUtil.cc.o -c /<>/Chrysalis/base/StringUtil.cc [ 35%] Building CXX object CMakeFiles/GraphFromFasta.dir/util/mutil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/GraphFromFasta.dir/util/mutil.cc.o -MF CMakeFiles/GraphFromFasta.dir/util/mutil.cc.o.d -o CMakeFiles/GraphFromFasta.dir/util/mutil.cc.o -c /<>/Chrysalis/util/mutil.cc [ 37%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/DNAVector.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/DNAVector.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/DNAVector.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/DNAVector.cc.o -c /<>/Chrysalis/analysis/DNAVector.cc /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc:303:51: warning: unused parameter ‘pData’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:303:63: warning: unused parameter ‘lenInBytes’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadString(CMString&)’: /<>/Chrysalis/util/mutil.cc:436:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 436 | if (fscanf(m_pFile, pData, len, m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiWriteFileStream::WriteBlob(const void*, long int, long int)’: /<>/Chrysalis/util/mutil.cc:526:53: warning: unused parameter ‘pData’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~~~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:526:65: warning: unused parameter ‘lenInElements’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:526:85: warning: unused parameter ‘elSize’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:738:53: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 738 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, long int, bool)’: /<>/Chrysalis/util/mutil.cc:761:63: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 761 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, long val, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:787:80: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 787 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, const MCL_TCHAR * szText2, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MCLSetUTF8Encode(bool)’: /<>/Chrysalis/util/mutil.cc:1288:39: warning: unused parameter ‘b’ [-Wunused-parameter] 1288 | MDLLEXPORT void MCLSetUTF8Encode(bool b) | ~~~~~^ /<>/Chrysalis/util/mutil.cc: In function ‘bool AddUTF8Sig(CMString&)’: /<>/Chrysalis/util/mutil.cc:1688:16: warning: unused variable ‘p’ [-Wunused-variable] 1688 | const char * p = (const char*)string; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:13: warning: ‘szText’ may be used uninitialized [-Wmaybe-uninitialized] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/features.h:502, from /usr/include/x86_64-linux-gnu/bits/libc-header-start.h:33, from /usr/include/string.h:26, from /<>/Chrysalis/util/mutil.h:19, from /<>/Chrysalis/util/mutil.cc:9: /usr/include/stdio.h:440:12: note: by argument 2 of type ‘const char*’ to ‘int fscanf(FILE*, const char*, ...)’ declared here 440 | extern int __REDIRECT (fscanf, (FILE *__restrict __stream, | ^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:311:8: note: ‘szText’ declared here 311 | char szText[2048 * 10]; | ^~~~~~ [ 38%] Linking CXX executable GraphFromFasta /usr/bin/cmake -E cmake_link_script CMakeFiles/GraphFromFasta.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/GraphFromFasta.dir/aligns/KmerAlignCore.cc.o CMakeFiles/GraphFromFasta.dir/analysis/AACodons.cc.o CMakeFiles/GraphFromFasta.dir/analysis/DNAVector.cc.o CMakeFiles/GraphFromFasta.dir/analysis/DeBruijnGraph.cc.o CMakeFiles/GraphFromFasta.dir/analysis/GraphFromFasta.cc.o CMakeFiles/GraphFromFasta.dir/analysis/KmerTable.cc.o CMakeFiles/GraphFromFasta.dir/analysis/NonRedKmerTable.cc.o CMakeFiles/GraphFromFasta.dir/analysis/sequenceUtil.cc.o CMakeFiles/GraphFromFasta.dir/analysis/stacktrace.cc.o CMakeFiles/GraphFromFasta.dir/base/ErrorHandling.cc.o CMakeFiles/GraphFromFasta.dir/base/FileParser.cc.o CMakeFiles/GraphFromFasta.dir/base/StringUtil.cc.o CMakeFiles/GraphFromFasta.dir/util/mutil.cc.o -o GraphFromFasta make[4]: Leaving directory '/<>/Chrysalis_build' [ 38%] Built target GraphFromFasta make -f CMakeFiles/ReadsToTranscripts.dir/build.make CMakeFiles/ReadsToTranscripts.dir/depend make[4]: Entering directory '/<>/Chrysalis_build' cd /<>/Chrysalis_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Chrysalis /<>/Chrysalis /<>/Chrysalis_build /<>/Chrysalis_build /<>/Chrysalis_build/CMakeFiles/ReadsToTranscripts.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Chrysalis_build' make -f CMakeFiles/ReadsToTranscripts.dir/build.make CMakeFiles/ReadsToTranscripts.dir/build make[4]: Entering directory '/<>/Chrysalis_build' [ 40%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/analysis/AACodons.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/analysis/AACodons.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/analysis/AACodons.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/analysis/AACodons.cc.o -c /<>/Chrysalis/analysis/AACodons.cc [ 41%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/analysis/DNAVector.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/analysis/DNAVector.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/analysis/DNAVector.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/analysis/DNAVector.cc.o -c /<>/Chrysalis/analysis/DNAVector.cc [ 42%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/KmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/KmerTable.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/KmerTable.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/KmerTable.cc.o -c /<>/Chrysalis/analysis/KmerTable.cc /<>/Chrysalis/analysis/KmerTable.cc: In member function ‘long long int KmerSequence::BasesToNumber(const DNAVector&, int)’: /<>/Chrysalis/analysis/KmerTable.cc:27:13: warning: unused variable ‘i’ [-Wunused-variable] 27 | long long i; | ^ [ 44%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/NonRedKmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/NonRedKmerTable.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/NonRedKmerTable.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/NonRedKmerTable.cc.o -c /<>/Chrysalis/analysis/NonRedKmerTable.cc /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::SetUp(const vecDNAVector&, bool)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:46:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 46 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:56:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 56 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:79:18: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 79 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(const vecDNAVector&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:109:16: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 109 | for (j=0; j<= d.isize()-m_k; j++) { | ~^~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(vecDNAVectorStream&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:125:9: warning: unused variable ‘i’ [-Wunused-variable] 125 | int i, j; | ^ [ 45%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/QuantifyGraph.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/QuantifyGraph.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/QuantifyGraph.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/QuantifyGraph.cc.o -c /<>/Chrysalis/analysis/QuantifyGraph.cc [ 47%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/analysis/NonRedKmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/analysis/NonRedKmerTable.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/analysis/NonRedKmerTable.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/analysis/NonRedKmerTable.cc.o -c /<>/Chrysalis/analysis/NonRedKmerTable.cc /<>/Chrysalis/analysis/QuantifyGraph.cc: In function ‘long long int BasesToNumberCountPlus(const std::vector >&, svec&, long long int&, const DNAVector&, int, const vecDNAVector&, int)’: /<>/Chrysalis/analysis/QuantifyGraph.cc:250:10: warning: ISO C++ forbids variable length array ‘kmerseq’ [-Wvla] 250 | char kmerseq [kmer_length + 1]; | ^~~~~~~ /<>/Chrysalis/analysis/QuantifyGraph.cc: In function ‘int main(int, char**)’: /<>/Chrysalis/analysis/QuantifyGraph.cc:372:29: warning: unused variable ‘prevNode’ [-Wunused-variable] 372 | int prevNode = parser.AsInt(1); | ^~~~~~~~ /<>/Chrysalis/analysis/QuantifyGraph.cc:409:13: warning: unused variable ‘node’ [-Wunused-variable] 409 | int node = parser.AsInt(0); | ^~~~ /<>/Chrysalis/analysis/QuantifyGraph.cc:412:30: warning: unused variable ‘p2’ [-Wunused-variable] 412 | const char * p2 = s.c_str(); | ^~ /<>/Chrysalis/analysis/QuantifyGraph.cc:337:16: warning: unused variable ‘j’ [-Wunused-variable] 337 | int i, j; | ^ /<>/Chrysalis/analysis/QuantifyGraph.cc:350:16: warning: unused variable ‘m’ [-Wunused-variable] 350 | size_t m = kmers.size(); | ^ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::SetUp(const vecDNAVector&, bool)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:46:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 46 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:56:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 56 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:79:18: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 79 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(const vecDNAVector&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:109:16: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 109 | for (j=0; j<= d.isize()-m_k; j++) { | ~^~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(vecDNAVectorStream&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:125:9: warning: unused variable ‘i’ [-Wunused-variable] 125 | int i, j; | ^ [ 48%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/analysis/ReadsToTranscripts.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/analysis/ReadsToTranscripts.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/analysis/ReadsToTranscripts.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/analysis/ReadsToTranscripts.cc.o -c /<>/Chrysalis/analysis/ReadsToTranscripts.cc [ 50%] Building CXX object CMakeFiles/QuantifyGraph.dir/base/ErrorHandling.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/base/ErrorHandling.cc.o -MF CMakeFiles/QuantifyGraph.dir/base/ErrorHandling.cc.o.d -o CMakeFiles/QuantifyGraph.dir/base/ErrorHandling.cc.o -c /<>/Chrysalis/base/ErrorHandling.cc /<>/Chrysalis/base/ErrorHandling.cc: In function ‘void print_trace(FILE*, const char*, int)’: /<>/Chrysalis/base/ErrorHandling.cc:7:24: warning: unused parameter ‘out’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~^~~ /<>/Chrysalis/base/ErrorHandling.cc:7:41: warning: unused parameter ‘file’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~~~~~~~^~~~ /<>/Chrysalis/base/ErrorHandling.cc:7:51: warning: unused parameter ‘line’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~^~~~ [ 51%] Building CXX object CMakeFiles/QuantifyGraph.dir/base/FileParser.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/base/FileParser.cc.o -MF CMakeFiles/QuantifyGraph.dir/base/FileParser.cc.o.d -o CMakeFiles/QuantifyGraph.dir/base/FileParser.cc.o -c /<>/Chrysalis/base/FileParser.cc /<>/Chrysalis/base/FileParser.cc: In member function ‘bool StringParser::IsString(int)’: /<>/Chrysalis/base/FileParser.cc:50:33: warning: unused parameter ‘index’ [-Wunused-parameter] 50 | bool StringParser::IsString(int index) | ~~~~^~~~~ [ 52%] Building CXX object CMakeFiles/QuantifyGraph.dir/base/StringUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/base/StringUtil.cc.o -MF CMakeFiles/QuantifyGraph.dir/base/StringUtil.cc.o.d -o CMakeFiles/QuantifyGraph.dir/base/StringUtil.cc.o -c /<>/Chrysalis/base/StringUtil.cc [ 54%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/analysis/sequenceUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/analysis/sequenceUtil.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/analysis/sequenceUtil.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/analysis/sequenceUtil.cc.o -c /<>/Chrysalis/analysis/sequenceUtil.cc /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:33:26: warning: array subscript has type ‘char’ [-Wchar-subscripts] 33 | if (_base_to_int[c] > 3) | ^ /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:264:32: warning: array subscript has type ‘char’ [-Wchar-subscripts] 264 | int val = _base_to_int[c]; | ^ [ 55%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/sequenceUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/sequenceUtil.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/sequenceUtil.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/sequenceUtil.cc.o -c /<>/Chrysalis/analysis/sequenceUtil.cc [ 57%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/analysis/stacktrace.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/analysis/stacktrace.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/analysis/stacktrace.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/analysis/stacktrace.cc.o -c /<>/Chrysalis/analysis/stacktrace.cc /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:33:26: warning: array subscript has type ‘char’ [-Wchar-subscripts] 33 | if (_base_to_int[c] > 3) | ^ /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:264:32: warning: array subscript has type ‘char’ [-Wchar-subscripts] 264 | int val = _base_to_int[c]; | ^ [ 58%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/base/ErrorHandling.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/base/ErrorHandling.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/base/ErrorHandling.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/base/ErrorHandling.cc.o -c /<>/Chrysalis/base/ErrorHandling.cc [ 60%] Building CXX object CMakeFiles/QuantifyGraph.dir/analysis/stacktrace.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/analysis/stacktrace.cc.o -MF CMakeFiles/QuantifyGraph.dir/analysis/stacktrace.cc.o.d -o CMakeFiles/QuantifyGraph.dir/analysis/stacktrace.cc.o -c /<>/Chrysalis/analysis/stacktrace.cc /<>/Chrysalis/base/ErrorHandling.cc: In function ‘void print_trace(FILE*, const char*, int)’: /<>/Chrysalis/base/ErrorHandling.cc:7:24: warning: unused parameter ‘out’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~^~~ /<>/Chrysalis/base/ErrorHandling.cc:7:41: warning: unused parameter ‘file’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~~~~~~~^~~~ /<>/Chrysalis/base/ErrorHandling.cc:7:51: warning: unused parameter ‘line’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~^~~~ [ 61%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/base/FileParser.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/base/FileParser.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/base/FileParser.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/base/FileParser.cc.o -c /<>/Chrysalis/base/FileParser.cc [ 62%] Building CXX object CMakeFiles/QuantifyGraph.dir/util/mutil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/QuantifyGraph.dir/util/mutil.cc.o -MF CMakeFiles/QuantifyGraph.dir/util/mutil.cc.o.d -o CMakeFiles/QuantifyGraph.dir/util/mutil.cc.o -c /<>/Chrysalis/util/mutil.cc /<>/Chrysalis/base/FileParser.cc: In member function ‘bool StringParser::IsString(int)’: /<>/Chrysalis/base/FileParser.cc:50:33: warning: unused parameter ‘index’ [-Wunused-parameter] 50 | bool StringParser::IsString(int index) | ~~~~^~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc:303:51: warning: unused parameter ‘pData’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:303:63: warning: unused parameter ‘lenInBytes’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadString(CMString&)’: /<>/Chrysalis/util/mutil.cc:436:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 436 | if (fscanf(m_pFile, pData, len, m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiWriteFileStream::WriteBlob(const void*, long int, long int)’: /<>/Chrysalis/util/mutil.cc:526:53: warning: unused parameter ‘pData’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~~~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:526:65: warning: unused parameter ‘lenInElements’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:526:85: warning: unused parameter ‘elSize’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:738:53: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 738 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, long int, bool)’: /<>/Chrysalis/util/mutil.cc:761:63: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 761 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, long val, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:787:80: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 787 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, const MCL_TCHAR * szText2, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MCLSetUTF8Encode(bool)’: /<>/Chrysalis/util/mutil.cc:1288:39: warning: unused parameter ‘b’ [-Wunused-parameter] 1288 | MDLLEXPORT void MCLSetUTF8Encode(bool b) | ~~~~~^ /<>/Chrysalis/util/mutil.cc: In function ‘bool AddUTF8Sig(CMString&)’: /<>/Chrysalis/util/mutil.cc:1688:16: warning: unused variable ‘p’ [-Wunused-variable] 1688 | const char * p = (const char*)string; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:13: warning: ‘szText’ may be used uninitialized [-Wmaybe-uninitialized] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/features.h:502, from /usr/include/x86_64-linux-gnu/bits/libc-header-start.h:33, from /usr/include/string.h:26, from /<>/Chrysalis/util/mutil.h:19, from /<>/Chrysalis/util/mutil.cc:9: /usr/include/stdio.h:440:12: note: by argument 2 of type ‘const char*’ to ‘int fscanf(FILE*, const char*, ...)’ declared here 440 | extern int __REDIRECT (fscanf, (FILE *__restrict __stream, | ^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:311:8: note: ‘szText’ declared here 311 | char szText[2048 * 10]; | ^~~~~~ [ 64%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/base/StringUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/base/StringUtil.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/base/StringUtil.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/base/StringUtil.cc.o -c /<>/Chrysalis/base/StringUtil.cc [ 65%] Linking CXX executable QuantifyGraph /usr/bin/cmake -E cmake_link_script CMakeFiles/QuantifyGraph.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/QuantifyGraph.dir/aligns/KmerAlignCore.cc.o CMakeFiles/QuantifyGraph.dir/analysis/AACodons.cc.o CMakeFiles/QuantifyGraph.dir/analysis/DNAVector.cc.o CMakeFiles/QuantifyGraph.dir/analysis/KmerTable.cc.o CMakeFiles/QuantifyGraph.dir/analysis/NonRedKmerTable.cc.o CMakeFiles/QuantifyGraph.dir/analysis/QuantifyGraph.cc.o CMakeFiles/QuantifyGraph.dir/base/ErrorHandling.cc.o CMakeFiles/QuantifyGraph.dir/base/FileParser.cc.o CMakeFiles/QuantifyGraph.dir/base/StringUtil.cc.o CMakeFiles/QuantifyGraph.dir/analysis/sequenceUtil.cc.o CMakeFiles/QuantifyGraph.dir/analysis/stacktrace.cc.o CMakeFiles/QuantifyGraph.dir/util/mutil.cc.o -o QuantifyGraph [ 67%] Building CXX object CMakeFiles/ReadsToTranscripts.dir/util/mutil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/ReadsToTranscripts.dir/util/mutil.cc.o -MF CMakeFiles/ReadsToTranscripts.dir/util/mutil.cc.o.d -o CMakeFiles/ReadsToTranscripts.dir/util/mutil.cc.o -c /<>/Chrysalis/util/mutil.cc make[4]: Leaving directory '/<>/Chrysalis_build' [ 67%] Built target QuantifyGraph make -f CMakeFiles/BubbleUpClustering.dir/build.make CMakeFiles/BubbleUpClustering.dir/depend make[4]: Entering directory '/<>/Chrysalis_build' cd /<>/Chrysalis_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Chrysalis /<>/Chrysalis /<>/Chrysalis_build /<>/Chrysalis_build /<>/Chrysalis_build/CMakeFiles/BubbleUpClustering.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Chrysalis_build' make -f CMakeFiles/BubbleUpClustering.dir/build.make CMakeFiles/BubbleUpClustering.dir/build make[4]: Entering directory '/<>/Chrysalis_build' [ 68%] Building CXX object CMakeFiles/BubbleUpClustering.dir/aligns/KmerAlignCore.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/aligns/KmerAlignCore.cc.o -MF CMakeFiles/BubbleUpClustering.dir/aligns/KmerAlignCore.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/aligns/KmerAlignCore.cc.o -c /<>/Chrysalis/aligns/KmerAlignCore.cc /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc:303:51: warning: unused parameter ‘pData’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:303:63: warning: unused parameter ‘lenInBytes’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadString(CMString&)’: /<>/Chrysalis/util/mutil.cc:436:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 436 | if (fscanf(m_pFile, pData, len, m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiWriteFileStream::WriteBlob(const void*, long int, long int)’: /<>/Chrysalis/util/mutil.cc:526:53: warning: unused parameter ‘pData’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~~~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:526:65: warning: unused parameter ‘lenInElements’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:526:85: warning: unused parameter ‘elSize’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:738:53: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 738 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, long int, bool)’: /<>/Chrysalis/util/mutil.cc:761:63: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 761 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, long val, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:787:80: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 787 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, const MCL_TCHAR * szText2, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MCLSetUTF8Encode(bool)’: /<>/Chrysalis/util/mutil.cc:1288:39: warning: unused parameter ‘b’ [-Wunused-parameter] 1288 | MDLLEXPORT void MCLSetUTF8Encode(bool b) | ~~~~~^ /<>/Chrysalis/util/mutil.cc: In function ‘bool AddUTF8Sig(CMString&)’: /<>/Chrysalis/util/mutil.cc:1688:16: warning: unused variable ‘p’ [-Wunused-variable] 1688 | const char * p = (const char*)string; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:13: warning: ‘szText’ may be used uninitialized [-Wmaybe-uninitialized] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/features.h:502, from /usr/include/x86_64-linux-gnu/bits/libc-header-start.h:33, from /usr/include/string.h:26, from /<>/Chrysalis/util/mutil.h:19, from /<>/Chrysalis/util/mutil.cc:9: /usr/include/stdio.h:440:12: note: by argument 2 of type ‘const char*’ to ‘int fscanf(FILE*, const char*, ...)’ declared here 440 | extern int __REDIRECT (fscanf, (FILE *__restrict __stream, | ^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:311:8: note: ‘szText’ declared here 311 | char szText[2048 * 10]; | ^~~~~~ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const vecDNAVector&, const vecNumVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:79:49: warning: unused variable ‘t’ [-Wunused-variable] 79 | KmerAlignCoreRecordStoreTable & t = m_table; // not used? | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:49:9: warning: unused variable ‘i’ [-Wunused-variable] 49 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::AddData(const DNAVector&, int, int, bool)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:128:9: warning: unused variable ‘i’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:128:12: warning: unused variable ‘j’ [-Wunused-variable] 128 | int i, j, k; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::SortAll()’: /<>/Chrysalis/aligns/KmerAlignCore.cc:148:9: warning: unused variable ‘i’ [-Wunused-variable] 148 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘const svec& KmerAlignCore::GetMatchesDirectly(const DNAVector&, int)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:158:9: warning: unused variable ‘size’ [-Wunused-variable] 158 | int size = m_pTrans->GetSize(); | ^~~~ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:9: warning: unused variable ‘i’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc:159:12: warning: unused variable ‘j’ [-Wunused-variable] 159 | int i, j; | ^ /<>/Chrysalis/aligns/KmerAlignCore.cc: In member function ‘void KmerAlignCore::MergeSortFilter(svec&, const svec&, const svec&)’: /<>/Chrysalis/aligns/KmerAlignCore.cc:291:9: warning: unused variable ‘i’ [-Wunused-variable] 291 | int i; | ^ [ 70%] Linking CXX executable ReadsToTranscripts /usr/bin/cmake -E cmake_link_script CMakeFiles/ReadsToTranscripts.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/ReadsToTranscripts.dir/analysis/AACodons.cc.o CMakeFiles/ReadsToTranscripts.dir/analysis/DNAVector.cc.o CMakeFiles/ReadsToTranscripts.dir/analysis/NonRedKmerTable.cc.o CMakeFiles/ReadsToTranscripts.dir/analysis/ReadsToTranscripts.cc.o CMakeFiles/ReadsToTranscripts.dir/analysis/sequenceUtil.cc.o CMakeFiles/ReadsToTranscripts.dir/analysis/stacktrace.cc.o CMakeFiles/ReadsToTranscripts.dir/base/ErrorHandling.cc.o CMakeFiles/ReadsToTranscripts.dir/base/FileParser.cc.o CMakeFiles/ReadsToTranscripts.dir/base/StringUtil.cc.o CMakeFiles/ReadsToTranscripts.dir/util/mutil.cc.o -o ReadsToTranscripts make[4]: Leaving directory '/<>/Chrysalis_build' [ 70%] Built target ReadsToTranscripts make -f CMakeFiles/CreateIwormFastaBundle.dir/build.make CMakeFiles/CreateIwormFastaBundle.dir/depend make[4]: Entering directory '/<>/Chrysalis_build' cd /<>/Chrysalis_build && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<>/Chrysalis /<>/Chrysalis /<>/Chrysalis_build /<>/Chrysalis_build /<>/Chrysalis_build/CMakeFiles/CreateIwormFastaBundle.dir/DependInfo.cmake "--color=" make[4]: Leaving directory '/<>/Chrysalis_build' make -f CMakeFiles/CreateIwormFastaBundle.dir/build.make CMakeFiles/CreateIwormFastaBundle.dir/build make[4]: Entering directory '/<>/Chrysalis_build' [ 71%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/analysis/AACodons.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/analysis/AACodons.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/analysis/AACodons.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/analysis/AACodons.cc.o -c /<>/Chrysalis/analysis/AACodons.cc [ 72%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/AACodons.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/AACodons.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/AACodons.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/AACodons.cc.o -c /<>/Chrysalis/analysis/AACodons.cc [ 74%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/analysis/CreateIwormFastaBundle.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/analysis/CreateIwormFastaBundle.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/analysis/CreateIwormFastaBundle.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/analysis/CreateIwormFastaBundle.cc.o -c /<>/Chrysalis/analysis/CreateIwormFastaBundle.cc [ 75%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/BubbleUpClustering.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/BubbleUpClustering.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/BubbleUpClustering.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/BubbleUpClustering.cc.o -c /<>/Chrysalis/analysis/BubbleUpClustering.cc /<>/Chrysalis/analysis/CreateIwormFastaBundle.cc: In function ‘int main(int, char**)’: /<>/Chrysalis/analysis/CreateIwormFastaBundle.cc:181:17: warning: unused variable ‘num_iworm_contigs’ [-Wunused-variable] 181 | int num_iworm_contigs = parser.AsInt(2); | ^~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/CreateIwormFastaBundle.cc:143:10: warning: unused variable ‘DEBUG’ [-Wunused-variable] 143 | bool DEBUG = P.GetBoolValueFor(debugCmmd); | ^~~~~ /<>/Chrysalis/analysis/CreateIwormFastaBundle.cc:166:12: warning: unused variable ‘pOut’ [-Wunused-variable] 166 | FILE * pOut = NULL; | ^~~~ /<>/Chrysalis/analysis/BubbleUpClustering.cc: In function ‘svec grow_prioritized_clusters(std::string&, std::map&)’: /<>/Chrysalis/analysis/BubbleUpClustering.cc:111:78: warning: unused parameter ‘weld_reinforced_iworm_clusters’ [-Wunused-parameter] 111 | svec grow_prioritized_clusters(string& weld_graph_file, map& weld_reinforced_iworm_clusters) { | ~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/BubbleUpClustering.cc: In function ‘svec sl_cluster_pools(std::map&, std::map&)’: /<>/Chrysalis/analysis/BubbleUpClustering.cc:326:40: warning: implicitly-declared ‘Pool& Pool::operator=(const Pool&)’ is deprecated [-Wdeprecated-copy] 326 | pool_vec[oldpool_id] = tmp; | ^~~ In file included from /<>/Chrysalis/analysis/BubbleUpClustering.cc:19: /<>/Chrysalis/analysis/Pool.h:24:5: note: because ‘Pool’ has user-provided ‘Pool::Pool(const Pool&)’ 24 | Pool(const Pool& p) { | ^~~~ /<>/Chrysalis/analysis/BubbleUpClustering.cc: In function ‘void populate_weld_reinforced_iworm_clusters(std::string&, std::map&)’: /<>/Chrysalis/analysis/BubbleUpClustering.cc:525:57: warning: implicitly-declared ‘Pool& Pool::operator=(const Pool&)’ is deprecated [-Wdeprecated-copy] 525 | weld_reinforced_iworm_clusters[ node_id ] = p; | ^ /<>/Chrysalis/analysis/Pool.h:24:5: note: because ‘Pool’ has user-provided ‘Pool::Pool(const Pool&)’ 24 | Pool(const Pool& p) { | ^~~~ /<>/Chrysalis/analysis/BubbleUpClustering.cc: In function ‘int main(int, char**)’: /<>/Chrysalis/analysis/BubbleUpClustering.cc:628:30: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 628 | for (size_t j = 0; j < p.size(); j++) { | ~~^~~~~~~~~~ /<>/Chrysalis/analysis/BubbleUpClustering.cc:641:30: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 641 | for (size_t j = 0; j < p.size(); j++) { | ~~^~~~~~~~~~ [ 77%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/analysis/DNAVector.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/analysis/DNAVector.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/analysis/DNAVector.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/analysis/DNAVector.cc.o -c /<>/Chrysalis/analysis/DNAVector.cc [ 78%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/DNAVector.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/DNAVector.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/DNAVector.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/DNAVector.cc.o -c /<>/Chrysalis/analysis/DNAVector.cc [ 80%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/base/ErrorHandling.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/base/ErrorHandling.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/base/ErrorHandling.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/base/ErrorHandling.cc.o -c /<>/Chrysalis/base/ErrorHandling.cc /<>/Chrysalis/base/ErrorHandling.cc: In function ‘void print_trace(FILE*, const char*, int)’: /<>/Chrysalis/base/ErrorHandling.cc:7:24: warning: unused parameter ‘out’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~^~~ /<>/Chrysalis/base/ErrorHandling.cc:7:41: warning: unused parameter ‘file’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~~~~~~~^~~~ /<>/Chrysalis/base/ErrorHandling.cc:7:51: warning: unused parameter ‘line’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~^~~~ [ 81%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/base/FileParser.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/base/FileParser.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/base/FileParser.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/base/FileParser.cc.o -c /<>/Chrysalis/base/FileParser.cc /<>/Chrysalis/base/FileParser.cc: In member function ‘bool StringParser::IsString(int)’: /<>/Chrysalis/base/FileParser.cc:50:33: warning: unused parameter ‘index’ [-Wunused-parameter] 50 | bool StringParser::IsString(int index) | ~~~~^~~~~ [ 82%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/base/StringUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/base/StringUtil.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/base/StringUtil.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/base/StringUtil.cc.o -c /<>/Chrysalis/base/StringUtil.cc [ 84%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/DeBruijnGraph.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/DeBruijnGraph.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/DeBruijnGraph.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/DeBruijnGraph.cc.o -c /<>/Chrysalis/analysis/DeBruijnGraph.cc /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnKmer::add_next_kmer(kmer_int_type_t, unsigned int)’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:154:66: warning: unused parameter ‘kmer_length’ [-Wunused-parameter] 154 | void DeBruijnKmer::add_next_kmer(kmer_int_type_t k, unsigned int kmer_length) { | ~~~~~~~~~~~~~^~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘std::vector DeBruijnGraph::deconvolute_DS_mirror_graph()’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:355:22: warning: variable ‘rdk’ set but not used [-Wunused-but-set-variable] 355 | DeBruijnKmer rdk = _kmer_map.find(rk)->second; | ^~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘std::vector > DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 473 | for (int i = 0; i < left_extensions.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc:476:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 476 | for (int j = 0; j < right_extensions.size(); j++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&, std::vector >&, char, std::map&, int)’: /<>/Chrysalis/analysis/DeBruijnGraph.cc:513:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 513 | for (int i = 0; i < adjacent_kmers.size(); i++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/DeBruijnGraph.cc:527:41: warning: comparison of integer expressions of different signedness: ‘std::vector::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 527 | if (kmer_extension_chars.size() == flank_extension_length) { | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ [ 85%] Building CXX object CMakeFiles/CreateIwormFastaBundle.dir/util/mutil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/CreateIwormFastaBundle.dir/util/mutil.cc.o -MF CMakeFiles/CreateIwormFastaBundle.dir/util/mutil.cc.o.d -o CMakeFiles/CreateIwormFastaBundle.dir/util/mutil.cc.o -c /<>/Chrysalis/util/mutil.cc /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc:303:51: warning: unused parameter ‘pData’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:303:63: warning: unused parameter ‘lenInBytes’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadString(CMString&)’: /<>/Chrysalis/util/mutil.cc:436:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 436 | if (fscanf(m_pFile, pData, len, m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiWriteFileStream::WriteBlob(const void*, long int, long int)’: /<>/Chrysalis/util/mutil.cc:526:53: warning: unused parameter ‘pData’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~~~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:526:65: warning: unused parameter ‘lenInElements’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:526:85: warning: unused parameter ‘elSize’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:738:53: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 738 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, long int, bool)’: /<>/Chrysalis/util/mutil.cc:761:63: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 761 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, long val, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:787:80: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 787 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, const MCL_TCHAR * szText2, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MCLSetUTF8Encode(bool)’: /<>/Chrysalis/util/mutil.cc:1288:39: warning: unused parameter ‘b’ [-Wunused-parameter] 1288 | MDLLEXPORT void MCLSetUTF8Encode(bool b) | ~~~~~^ /<>/Chrysalis/util/mutil.cc: In function ‘bool AddUTF8Sig(CMString&)’: /<>/Chrysalis/util/mutil.cc:1688:16: warning: unused variable ‘p’ [-Wunused-variable] 1688 | const char * p = (const char*)string; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:13: warning: ‘szText’ may be used uninitialized [-Wmaybe-uninitialized] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/features.h:502, from /usr/include/x86_64-linux-gnu/bits/libc-header-start.h:33, from /usr/include/string.h:26, from /<>/Chrysalis/util/mutil.h:19, from /<>/Chrysalis/util/mutil.cc:9: /usr/include/stdio.h:440:12: note: by argument 2 of type ‘const char*’ to ‘int fscanf(FILE*, const char*, ...)’ declared here 440 | extern int __REDIRECT (fscanf, (FILE *__restrict __stream, | ^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:311:8: note: ‘szText’ declared here 311 | char szText[2048 * 10]; | ^~~~~~ [ 87%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/KmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/KmerTable.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/KmerTable.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/KmerTable.cc.o -c /<>/Chrysalis/analysis/KmerTable.cc /<>/Chrysalis/analysis/KmerTable.cc: In member function ‘long long int KmerSequence::BasesToNumber(const DNAVector&, int)’: /<>/Chrysalis/analysis/KmerTable.cc:27:13: warning: unused variable ‘i’ [-Wunused-variable] 27 | long long i; | ^ [ 88%] Linking CXX executable CreateIwormFastaBundle /usr/bin/cmake -E cmake_link_script CMakeFiles/CreateIwormFastaBundle.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/CreateIwormFastaBundle.dir/analysis/AACodons.cc.o CMakeFiles/CreateIwormFastaBundle.dir/analysis/CreateIwormFastaBundle.cc.o CMakeFiles/CreateIwormFastaBundle.dir/analysis/DNAVector.cc.o CMakeFiles/CreateIwormFastaBundle.dir/base/ErrorHandling.cc.o CMakeFiles/CreateIwormFastaBundle.dir/base/FileParser.cc.o CMakeFiles/CreateIwormFastaBundle.dir/base/StringUtil.cc.o CMakeFiles/CreateIwormFastaBundle.dir/util/mutil.cc.o -o CreateIwormFastaBundle make[4]: Leaving directory '/<>/Chrysalis_build' [ 88%] Built target CreateIwormFastaBundle [ 90%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/NonRedKmerTable.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/NonRedKmerTable.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/NonRedKmerTable.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/NonRedKmerTable.cc.o -c /<>/Chrysalis/analysis/NonRedKmerTable.cc /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::SetUp(const vecDNAVector&, bool)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:46:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 46 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:56:20: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 56 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc:79:18: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 79 | for (j=0; j<=d.size()-m_k; j++) { | ~^~~~~~~~~~~~~~ [ 91%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/sequenceUtil.cc.o /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(const vecDNAVector&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:109:16: warning: comparison of integer expressions of different signedness: ‘size_t’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 109 | for (j=0; j<= d.isize()-m_k; j++) { | ~^~~~~~~~~~~~~~~~ /<>/Chrysalis/analysis/NonRedKmerTable.cc: In member function ‘void NonRedKmerTable::AddData(vecDNAVectorStream&)’: /<>/Chrysalis/analysis/NonRedKmerTable.cc:125:9: warning: unused variable ‘i’ [-Wunused-variable] 125 | int i, j; | ^ /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/sequenceUtil.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/sequenceUtil.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/sequenceUtil.cc.o -c /<>/Chrysalis/analysis/sequenceUtil.cc /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:33:26: warning: array subscript has type ‘char’ [-Wchar-subscripts] 33 | if (_base_to_int[c] > 3) | ^ /<>/Chrysalis/analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::string)’: /<>/Chrysalis/analysis/sequenceUtil.cc:264:32: warning: array subscript has type ‘char’ [-Wchar-subscripts] 264 | int val = _base_to_int[c]; | ^ [ 92%] Building CXX object CMakeFiles/BubbleUpClustering.dir/analysis/stacktrace.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/analysis/stacktrace.cc.o -MF CMakeFiles/BubbleUpClustering.dir/analysis/stacktrace.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/analysis/stacktrace.cc.o -c /<>/Chrysalis/analysis/stacktrace.cc [ 94%] Building CXX object CMakeFiles/BubbleUpClustering.dir/base/ErrorHandling.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/base/ErrorHandling.cc.o -MF CMakeFiles/BubbleUpClustering.dir/base/ErrorHandling.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/base/ErrorHandling.cc.o -c /<>/Chrysalis/base/ErrorHandling.cc [ 95%] Building CXX object CMakeFiles/BubbleUpClustering.dir/base/FileParser.cc.o /<>/Chrysalis/base/ErrorHandling.cc: In function ‘void print_trace(FILE*, const char*, int)’: /<>/Chrysalis/base/ErrorHandling.cc:7:24: warning: unused parameter ‘out’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~^~~ /<>/Chrysalis/base/ErrorHandling.cc:7:41: warning: unused parameter ‘file’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~~~~~~~~~^~~~ /<>/Chrysalis/base/ErrorHandling.cc:7:51: warning: unused parameter ‘line’ [-Wunused-parameter] 7 | void print_trace(FILE *out, const char *file, int line) | ~~~~^~~~ /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/base/FileParser.cc.o -MF CMakeFiles/BubbleUpClustering.dir/base/FileParser.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/base/FileParser.cc.o -c /<>/Chrysalis/base/FileParser.cc [ 97%] Building CXX object CMakeFiles/BubbleUpClustering.dir/base/StringUtil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/base/StringUtil.cc.o -MF CMakeFiles/BubbleUpClustering.dir/base/StringUtil.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/base/StringUtil.cc.o -c /<>/Chrysalis/base/StringUtil.cc /<>/Chrysalis/base/FileParser.cc: In member function ‘bool StringParser::IsString(int)’: /<>/Chrysalis/base/FileParser.cc:50:33: warning: unused parameter ‘index’ [-Wunused-parameter] 50 | bool StringParser::IsString(int index) | ~~~~^~~~~ [ 98%] Building CXX object CMakeFiles/BubbleUpClustering.dir/util/mutil.cc.o /usr/bin/g++ -I/<>/Chrysalis -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -MD -MT CMakeFiles/BubbleUpClustering.dir/util/mutil.cc.o -MF CMakeFiles/BubbleUpClustering.dir/util/mutil.cc.o.d -o CMakeFiles/BubbleUpClustering.dir/util/mutil.cc.o -c /<>/Chrysalis/util/mutil.cc /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc:303:51: warning: unused parameter ‘pData’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:303:63: warning: unused parameter ‘lenInBytes’ [-Wunused-parameter] 303 | bool CMAsciiReadFileStream::ReadSimpleType(void * pData, long lenInBytes) | ~~~~~^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadString(CMString&)’: /<>/Chrysalis/util/mutil.cc:436:14: warning: passing argument 1 to ‘restrict’-qualified parameter aliases with argument 4 [-Wrestrict] 436 | if (fscanf(m_pFile, pData, len, m_pFile) == EOF) { | ^~~~~~~ ~~~~~~~ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiWriteFileStream::WriteBlob(const void*, long int, long int)’: /<>/Chrysalis/util/mutil.cc:526:53: warning: unused parameter ‘pData’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~~~~~~~~~^~~~~ /<>/Chrysalis/util/mutil.cc:526:65: warning: unused parameter ‘lenInElements’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:526:85: warning: unused parameter ‘elSize’ [-Wunused-parameter] 526 | bool CMAsciiWriteFileStream::WriteBlob(const void * pData, long lenInElements, long elSize) | ~~~~~^~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:738:53: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 738 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, long int, bool)’: /<>/Chrysalis/util/mutil.cc:761:63: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 761 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, long val, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MLog(const MCL_TCHAR*, const MCL_TCHAR*, bool)’: /<>/Chrysalis/util/mutil.cc:787:80: warning: unused parameter ‘bLineFeed’ [-Wunused-parameter] 787 | MDLLEXPORT void MLog(const MCL_TCHAR * szText, const MCL_TCHAR * szText2, bool bLineFeed) | ~~~~~^~~~~~~~~ /<>/Chrysalis/util/mutil.cc: In function ‘void MCLSetUTF8Encode(bool)’: /<>/Chrysalis/util/mutil.cc:1288:39: warning: unused parameter ‘b’ [-Wunused-parameter] 1288 | MDLLEXPORT void MCLSetUTF8Encode(bool b) | ~~~~~^ /<>/Chrysalis/util/mutil.cc: In function ‘bool AddUTF8Sig(CMString&)’: /<>/Chrysalis/util/mutil.cc:1688:16: warning: unused variable ‘p’ [-Wunused-variable] 1688 | const char * p = (const char*)string; | ^ /<>/Chrysalis/util/mutil.cc: In member function ‘virtual bool CMAsciiReadFileStream::ReadSimpleType(void*, long int)’: /<>/Chrysalis/util/mutil.cc:313:13: warning: ‘szText’ may be used uninitialized [-Wmaybe-uninitialized] 313 | if (fscanf(m_pFile, szText, sizeof(szText), m_pFile) == EOF) { | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/features.h:502, from /usr/include/x86_64-linux-gnu/bits/libc-header-start.h:33, from /usr/include/string.h:26, from /<>/Chrysalis/util/mutil.h:19, from /<>/Chrysalis/util/mutil.cc:9: /usr/include/stdio.h:440:12: note: by argument 2 of type ‘const char*’ to ‘int fscanf(FILE*, const char*, ...)’ declared here 440 | extern int __REDIRECT (fscanf, (FILE *__restrict __stream, | ^~~~~~~~~~ /<>/Chrysalis/util/mutil.cc:311:8: note: ‘szText’ declared here 311 | char szText[2048 * 10]; | ^~~~~~ [100%] Linking CXX executable BubbleUpClustering /usr/bin/cmake -E cmake_link_script CMakeFiles/BubbleUpClustering.dir/link.txt --verbose=1 /usr/bin/g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -pipe -W -Wall -Wpedantic -fopenmp -pthread -Wl,-z,relro -Wl,-z,now -lm -ldl -lrt -rdynamic CMakeFiles/BubbleUpClustering.dir/aligns/KmerAlignCore.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/AACodons.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/BubbleUpClustering.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/DNAVector.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/DeBruijnGraph.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/KmerTable.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/NonRedKmerTable.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/sequenceUtil.cc.o CMakeFiles/BubbleUpClustering.dir/analysis/stacktrace.cc.o CMakeFiles/BubbleUpClustering.dir/base/ErrorHandling.cc.o CMakeFiles/BubbleUpClustering.dir/base/FileParser.cc.o CMakeFiles/BubbleUpClustering.dir/base/StringUtil.cc.o CMakeFiles/BubbleUpClustering.dir/util/mutil.cc.o -o BubbleUpClustering make[4]: Leaving directory '/<>/Chrysalis_build' [100%] Built target BubbleUpClustering make[3]: Leaving directory '/<>/Chrysalis_build' /usr/bin/cmake -E cmake_progress_start /<>/Chrysalis_build/CMakeFiles 0 make[2]: Leaving directory '/<>/Chrysalis_build' for target in trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs trinity-plugins/bamsifter trinity-plugins/seqtk-trinity; do dh_auto_build \ --sourcedirectory=${target}; done cd trinity-plugins/slclust && make -j2 "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/trinity-plugins/slclust' X=`pwd`; \ for i in src; \ do echo '<<<' $i '>>>'; cd $X/$i; make all; done <<< src >>> make[3]: Entering directory '/<>/trinity-plugins/slclust/src' g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I../include -Wall -Wdate-time -D_FORTIFY_SOURCE=2 -c -o slcluster.o slcluster.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I../include -Wall -Wdate-time -D_FORTIFY_SOURCE=2 -c -o graph.o graph.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I../include -Wall -Wdate-time -D_FORTIFY_SOURCE=2 -c -o graphnode.o graphnode.cpp g++ -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I../include -Wall -Wdate-time -D_FORTIFY_SOURCE=2 -c -o cmd_line_opts.o cmd_line_opts.cpp g++ -Wl,-z,relro -Wl,-z,now slcluster.o graph.o graphnode.o cmd_line_opts.o -o slclust chmod 755 slclust make[3]: Leaving directory '/<>/trinity-plugins/slclust/src' make[2]: Leaving directory '/<>/trinity-plugins/slclust' cd trinity-plugins/scaffold_iworm_contigs && make -j2 "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/trinity-plugins/scaffold_iworm_contigs' g++ -Wl,-z,relro -Wl,-z,now -I../htslib -L../htslib -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection ScaffoldIwormContigs.cpp error_checker.cpp -lhts -o scaffold_iworm_contigs make[2]: Leaving directory '/<>/trinity-plugins/scaffold_iworm_contigs' cd trinity-plugins/bamsifter && make -j2 "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/trinity-plugins/bamsifter' g++ -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -std=c++11 -o bamsifter sift_bam_max_cov.cpp -Wall -O2 -L./htslib/build/lib/ -I./htslib/build/include -lhts cc1plus: warning: ‘-Werror=’ argument ‘-Werror=implicit-function-declaration’ is not valid for C++ make[2]: Leaving directory '/<>/trinity-plugins/bamsifter' cd trinity-plugins/seqtk-trinity && make -j2 "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/trinity-plugins/seqtk-trinity' cc -Wl,-z,relro -Wl,-z,now -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -g -Wall -O2 -Wno-unused-function -Wdate-time -D_FORTIFY_SOURCE=2 seqtk.c -o seqtk-trinity -lz -lm make[2]: Leaving directory '/<>/trinity-plugins/seqtk-trinity' make[1]: Leaving directory '/<>' jh_build warning: [options] bootstrap class path not set in conjunction with -source 7 warning: [options] source value 7 is obsolete and will be removed in a future release warning: [options] target value 7 is obsolete and will be removed in a future release warning: [options] To suppress warnings about obsolete options, use -Xlint:-options. ./Butterfly/Butterfly/src/src/IsoformExpressionLearning.java:396: warning: [removal] Double(double) in Double has been deprecated and marked for removal Double len = new Double(0); ^ ./Butterfly/Butterfly/src/src/IsoformExpressionLearning.java:515: warning: [removal] Double(double) in Double has been deprecated and marked for removal Double sum = new Double(0); ^ ./Butterfly/Butterfly/src/src/IsoformExpressionLearning.java:576: warning: [removal] Double(double) in Double has been deprecated and marked for removal vec.set(i, new Double(0)); ^ ./Butterfly/Butterfly/src/src/AlignmentStats.java:54: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal alignedBaseCounter.put(nameA, new Integer(0)); ^ ./Butterfly/Butterfly/src/src/AlignmentStats.java:55: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal alignedBaseCounter.put(nameB, new Integer(0)); ^ ./Butterfly/Butterfly/src/src/AlignmentStats.java:126: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal alignedBaseCounter.put(nameA, new Integer(alignedBaseCounter.get(nameA) + 1)); ^ ./Butterfly/Butterfly/src/src/AlignmentStats.java:130: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal alignedBaseCounter.put(nameB, new Integer (alignedBaseCounter.get(nameB) + 1)); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:4043: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal transcripts.put(path, new Pair(new Integer(1), new Integer(1))); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:4043: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal transcripts.put(path, new Pair(new Integer(1), new Integer(1))); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:4067: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal transcripts.put(pp.getPath1(), new Pair(new Integer(1), new Integer(1))); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:4067: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal transcripts.put(pp.getPath1(), new Pair(new Integer(1), new Integer(1))); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:5998: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal readParts.put(part_pairpath, new Integer(1)); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:8311: warning: [removal] Boolean(boolean) in Boolean has been deprecated and marked for removal seen.put(p_pos, new Boolean(true)); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:8345: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal transcripts.put(collapsed_path, new Pair(new Integer(1), new Integer(1))); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:8345: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal transcripts.put(collapsed_path, new Pair(new Integer(1), new Integer(1))); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:15068: warning: [removal] Boolean(boolean) in Boolean has been deprecated and marked for removal path_index.put(x, new Boolean(true)); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:15095: warning: [removal] Boolean(boolean) in Boolean has been deprecated and marked for removal path_index.put(pathA.get(i), new Boolean(true)); ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:15118: warning: [removal] Boolean(boolean) in Boolean has been deprecated and marked for removal path_index.put(node, new Boolean(true)); ^ ./Butterfly/Butterfly/src/src/ZipperAlignment.java:39: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal as.alignedBaseCounter.put(nameA, new Integer(shorter_len)); ^ ./Butterfly/Butterfly/src/src/ZipperAlignment.java:40: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal as.alignedBaseCounter.put(nameB, new Integer(shorter_len)); ^ ./Butterfly/Butterfly/src/src/ZipperAlignment.java:71: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal as.alignedBaseCounter.put(nameA, new Integer(shorter_len)); ^ ./Butterfly/Butterfly/src/src/ZipperAlignment.java:72: warning: [removal] Integer(int) in Integer has been deprecated and marked for removal as.alignedBaseCounter.put(nameB, new Integer(shorter_len)); ^ Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. 26 warnings ./Butterfly/Butterfly/src/src/My_DFS.java:30: warning: @param argument "roots" is not a parameter name. * @param roots ^ ./Butterfly/Butterfly/src/src/PairPath.java:124: warning: @param argument "isCircular" is not a parameter name. * @param isCircular the _isCircular to set ^ ./Butterfly/Butterfly/src/src/Read.java:18: warning: @param argument "toV" is not a parameter name. * @param toV ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:80: warning: @param argument "nextID" is not a parameter name. * @param nextID ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:81: warning: @param argument "l" is not a parameter name. * @param l ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:155: warning: @param argument "_origButterflyID" is not a parameter name. * @param _origButterflyID the _origButterflyID to set ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:766: warning: @param argument "name" is not a parameter name. * @param name ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:767: warning: @param argument "weight" is not a parameter name. * @param weight ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:768: warning: @param argument "name2" is not a parameter name. * @param name2 ^ ./Butterfly/Butterfly/src/src/SeqVertex.java:769: warning: @param argument "weight2" is not a parameter name. * @param weight2 ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:15040: warning: @param argument "candidateNodes" is not a parameter name. * @param candidateNodes ^ ./Butterfly/Butterfly/src/src/TransAssembly_allProbPaths.java:15041: warning: @param argument "l" is not a parameter name. * @param l ^ 12 warnings debian/rules override_dh_auto_test make[1]: Entering directory '/<>' java -cp Butterfly.jar TransAssembly_allProbPaths -N 10000 -L 300 \ -F 300 -C Butterfly/Butterfly/src/sample_data/c1.graph --stderr -V 20 Started using Path alignment for path comparisons combine paths if (identity=(numberOfMatches/shorterLen) > 98.0% or if we have <= 2 mismatches) and if we have internal gap lengths <= 10 path reinforcement distance computed based on 25% of max pair distance: 300 = 75 bases SECTION ================ Parsing de Bruijn graph ====================== preProcessGraphFile: Butterfly/Butterfly/src/sample_data/c1.graph.out SECTION ================== buildNewGraph ======================== buildNewGraphFirstLetter: Butterfly/Butterfly/src/sample_data/c1.graph.out KMER_SIZE=24 [17] [34] [51] [68] [85] [102] [119] [136] [153] [170] [187] [204] [221] [238] [255] [272] [289] [306] [323] [340] [357] [374] [391] [408] [425] [442] [459] [476] [493] Graph is built NODE_DESCR: GGCCACACGATGGCTTATCACGTC:W0(V380_D-1) Preds: [] Succ: [C:W-1(V381_D-1) ] NODE_DESCR: C:W-1(V381_D-1) Preds: [GGCCACACGATGGCTTATCACGTC:W0(V380_D-1) ] Succ: [A:W-1(V382_D-1) ] NODE_DESCR: A:W-1(V382_D-1) Preds: [C:W-1(V381_D-1) ] Succ: [C:W-1(V383_D-1) ] NODE_DESCR: C:W-1(V383_D-1) Preds: [A:W-1(V382_D-1) ] Succ: [A:W-1(V384_D-1) ] NODE_DESCR: A:W-1(V384_D-1) Preds: [C:W-1(V383_D-1) ] Succ: [T:W-1(V385_D-1) ] NODE_DESCR: T:W-1(V385_D-1) Preds: [A:W-1(V384_D-1) ] Succ: [T:W-1(V386_D-1) ] NODE_DESCR: T:W-1(V386_D-1) Preds: [T:W-1(V385_D-1) ] Succ: [T:W-1(V387_D-1) ] NODE_DESCR: T:W-1(V387_D-1) Preds: [T:W-1(V386_D-1) ] Succ: [C:W-1(V388_D-1) ] NODE_DESCR: C:W-1(V388_D-1) Preds: [T:W-1(V387_D-1) ] Succ: [T:W-1(V389_D-1) ] NODE_DESCR: T:W-1(V389_D-1) Preds: [C:W-1(V388_D-1) ] Succ: [A:W-1(V390_D-1) ] NODE_DESCR: A:W-1(V390_D-1) Preds: [T:W-1(V389_D-1) ] Succ: [C:W-1(V391_D-1) ] NODE_DESCR: C:W-1(V391_D-1) Preds: [A:W-1(V390_D-1) ] Succ: [T:W-1(V392_D-1) ] NODE_DESCR: T:W-1(V392_D-1) Preds: [C:W-1(V391_D-1) ] Succ: [G:W-1(V393_D-1) ] NODE_DESCR: G:W-1(V393_D-1) Preds: [T:W-1(V392_D-1) ] Succ: [G:W-1(V394_D-1) ] NODE_DESCR: G:W-1(V394_D-1) Preds: [G:W-1(V393_D-1) ] Succ: [C:W-1(V395_D-1) ] NODE_DESCR: C:W-1(V395_D-1) Preds: [G:W-1(V394_D-1) ] Succ: [T:W-1(V396_D-1) ] NODE_DESCR: T:W-1(V396_D-1) Preds: [C:W-1(V395_D-1) ] Succ: [A:W-1(V397_D-1) ] NODE_DESCR: A:W-1(V397_D-1) Preds: [T:W-1(V396_D-1) ] Succ: [C:W-1(V398_D-1) ] NODE_DESCR: C:W-1(V398_D-1) Preds: [A:W-1(V397_D-1) ] Succ: [A:W-1(V399_D-1) ] NODE_DESCR: A:W-1(V399_D-1) Preds: [C:W-1(V398_D-1) ] Succ: [A:W-1(V400_D-1) ] NODE_DESCR: A:W-1(V400_D-1) Preds: [A:W-1(V399_D-1) ] Succ: [A:W-1(V401_D-1) ] NODE_DESCR: A:W-1(V401_D-1) Preds: [A:W-1(V400_D-1) ] Succ: [C:W-1(V402_D-1) ] NODE_DESCR: C:W-1(V402_D-1) Preds: [A:W-1(V401_D-1) ] Succ: [A:W-1(V403_D-1) ] NODE_DESCR: A:W-1(V403_D-1) Preds: [C:W-1(V402_D-1) ] Succ: [G:W-1(V404_D-1) ] NODE_DESCR: G:W-1(V404_D-1) Preds: [A:W-1(V403_D-1) ] Succ: [A:W-1(V405_D-1) ] NODE_DESCR: A:W-1(V405_D-1) Preds: [G:W-1(V404_D-1) ] Succ: [C:W-1(V406_D-1) ] NODE_DESCR: C:W-1(V406_D-1) Preds: [A:W-1(V405_D-1) ] Succ: [T:W-1(V407_D-1) ] NODE_DESCR: T:W-1(V407_D-1) Preds: [C:W-1(V406_D-1) ] Succ: [T:W-1(V408_D-1) ] NODE_DESCR: T:W-1(V408_D-1) Preds: [T:W-1(V407_D-1) ] Succ: [C:W-1(V409_D-1) ] NODE_DESCR: C:W-1(V409_D-1) Preds: [T:W-1(V408_D-1) ] Succ: [C:W-1(V410_D-1) ] NODE_DESCR: C:W-1(V410_D-1) Preds: [C:W-1(V409_D-1) ] Succ: [T:W-1(V411_D-1) ] NODE_DESCR: T:W-1(V411_D-1) Preds: [C:W-1(V410_D-1) ] Succ: [C:W-1(V412_D-1) ] NODE_DESCR: C:W-1(V412_D-1) Preds: [T:W-1(V411_D-1) ] Succ: [A:W-1(V413_D-1) ] NODE_DESCR: A:W-1(V413_D-1) Preds: [C:W-1(V412_D-1) ] Succ: [A:W-1(V414_D-1) ] NODE_DESCR: A:W-1(V414_D-1) Preds: [A:W-1(V413_D-1) ] Succ: [G:W-1(V415_D-1) ] NODE_DESCR: G:W-1(V415_D-1) Preds: [A:W-1(V414_D-1) ] Succ: [C:W-1(V416_D-1) G:W-1(V885_D-1) ] NODE_DESCR: C:W-1(V416_D-1) Preds: [G:W-1(V415_D-1) ] Succ: [C:W-1(V417_D-1) ] NODE_DESCR: C:W-1(V417_D-1) Preds: [C:W-1(V416_D-1) ] Succ: [T:W-1(V418_D-1) ] NODE_DESCR: T:W-1(V418_D-1) Preds: [C:W-1(V417_D-1) ] Succ: [C:W-1(V419_D-1) ] NODE_DESCR: C:W-1(V419_D-1) Preds: [T:W-1(V418_D-1) ] Succ: [A:W-1(V420_D-1) ] NODE_DESCR: A:W-1(V420_D-1) Preds: [C:W-1(V419_D-1) ] Succ: [T:W-1(V421_D-1) ] NODE_DESCR: T:W-1(V421_D-1) Preds: [A:W-1(V420_D-1) ] Succ: [C:W-1(V422_D-1) ] NODE_DESCR: C:W-1(V422_D-1) Preds: [T:W-1(V421_D-1) ] Succ: [A:W-1(V423_D-1) ] NODE_DESCR: A:W-1(V423_D-1) Preds: [C:W-1(V422_D-1) ] Succ: [G:W-1(V424_D-1) ] NODE_DESCR: G:W-1(V424_D-1) Preds: [A:W-1(V423_D-1) ] Succ: [C:W-1(V425_D-1) ] NODE_DESCR: C:W-1(V425_D-1) Preds: [G:W-1(V424_D-1) ] Succ: [A:W-1(V426_D-1) ] NODE_DESCR: A:W-1(V426_D-1) Preds: [C:W-1(V425_D-1) ] Succ: [A:W-1(V427_D-1) ] NODE_DESCR: A:W-1(V427_D-1) Preds: [A:W-1(V426_D-1) ] Succ: [G:W-1(V428_D-1) ] NODE_DESCR: G:W-1(V428_D-1) Preds: [A:W-1(V427_D-1) ] Succ: [A:W-1(V429_D-1) ] NODE_DESCR: A:W-1(V429_D-1) Preds: [G:W-1(V428_D-1) ] Succ: [A:W-1(V430_D-1) ] NODE_DESCR: A:W-1(V430_D-1) Preds: [A:W-1(V429_D-1) ] Succ: [G:W-1(V431_D-1) ] NODE_DESCR: G:W-1(V431_D-1) Preds: [A:W-1(V430_D-1) ] Succ: [A:W-1(V432_D-1) ] NODE_DESCR: A:W-1(V432_D-1) Preds: [G:W-1(V431_D-1) ] Succ: [A:W-1(V433_D-1) ] NODE_DESCR: A:W-1(V433_D-1) Preds: [A:W-1(V432_D-1) ] Succ: [A:W-1(V434_D-1) ] NODE_DESCR: A:W-1(V434_D-1) Preds: [A:W-1(V433_D-1) ] Succ: [T:W-1(V435_D-1) ] NODE_DESCR: T:W-1(V435_D-1) Preds: [A:W-1(V434_D-1) ] Succ: [C:W-1(V436_D-1) ] NODE_DESCR: C:W-1(V436_D-1) Preds: [T:W-1(V435_D-1) ] Succ: [T:W-1(V437_D-1) ] NODE_DESCR: T:W-1(V437_D-1) Preds: [C:W-1(V436_D-1) ] Succ: [T:W-1(V438_D-1) ] NODE_DESCR: T:W-1(V438_D-1) Preds: [T:W-1(V437_D-1) ] Succ: [T:W-1(V439_D-1) ] NODE_DESCR: T:W-1(V439_D-1) Preds: [T:W-1(V438_D-1) ] Succ: [C:W-1(V440_D-1) ] NODE_DESCR: C:W-1(V440_D-1) Preds: [T:W-1(V439_D-1) T:W-1(V908_D-1) ] Succ: [T:W-1(V441_D-1) ] NODE_DESCR: T:W-1(V441_D-1) Preds: [C:W-1(V440_D-1) ] Succ: [T:W-1(V442_D-1) ] NODE_DESCR: T:W-1(V442_D-1) Preds: [T:W-1(V441_D-1) ] Succ: [T:W-1(V443_D-1) ] NODE_DESCR: T:W-1(V443_D-1) Preds: [T:W-1(V442_D-1) ] Succ: [C:W-1(V444_D-1) ] NODE_DESCR: C:W-1(V444_D-1) Preds: [T:W-1(V443_D-1) ] Succ: [C:W-1(V445_D-1) ] NODE_DESCR: C:W-1(V445_D-1) Preds: [C:W-1(V444_D-1) ] Succ: [A:W-1(V446_D-1) ] NODE_DESCR: A:W-1(V446_D-1) Preds: [C:W-1(V445_D-1) ] Succ: [A:W-1(V447_D-1) ] NODE_DESCR: A:W-1(V447_D-1) Preds: [A:W-1(V446_D-1) ] Succ: [G:W-1(V448_D-1) ] NODE_DESCR: G:W-1(V448_D-1) Preds: [A:W-1(V447_D-1) ] Succ: [T:W-1(V449_D-1) ] NODE_DESCR: T:W-1(V449_D-1) Preds: [G:W-1(V448_D-1) ] Succ: [A:W-1(V450_D-1) ] NODE_DESCR: A:W-1(V450_D-1) Preds: [T:W-1(V449_D-1) ] Succ: [G:W-1(V451_D-1) ] NODE_DESCR: G:W-1(V451_D-1) Preds: [A:W-1(V450_D-1) A:W-1(V980_D-1) ] Succ: [T:W-1(V452_D-1) ] NODE_DESCR: T:W-1(V452_D-1) Preds: [G:W-1(V451_D-1) ] Succ: [G:W-1(V453_D-1) ] NODE_DESCR: G:W-1(V453_D-1) Preds: [T:W-1(V452_D-1) ] Succ: [T:W-1(V454_D-1) ] NODE_DESCR: T:W-1(V454_D-1) Preds: [G:W-1(V453_D-1) ] Succ: [C:W-1(V455_D-1) ] NODE_DESCR: C:W-1(V455_D-1) Preds: [T:W-1(V454_D-1) ] Succ: [T:W-1(V456_D-1) ] NODE_DESCR: T:W-1(V456_D-1) Preds: [C:W-1(V455_D-1) ] Succ: [T:W-1(V457_D-1) ] NODE_DESCR: T:W-1(V457_D-1) Preds: [T:W-1(V456_D-1) ] Succ: [A:W-1(V458_D-1) ] NODE_DESCR: A:W-1(V458_D-1) Preds: [T:W-1(V457_D-1) ] Succ: [A:W-1(V459_D-1) ] NODE_DESCR: A:W-1(V459_D-1) Preds: [A:W-1(V458_D-1) ] Succ: [C:W-1(V460_D-1) ] NODE_DESCR: C:W-1(V460_D-1) Preds: [A:W-1(V459_D-1) ] Succ: [T:W-1(V461_D-1) ] NODE_DESCR: T:W-1(V461_D-1) Preds: [C:W-1(V460_D-1) ] Succ: [C:W-1(V462_D-1) ] NODE_DESCR: C:W-1(V462_D-1) Preds: [T:W-1(V461_D-1) ] Succ: [A:W-1(V463_D-1) ] NODE_DESCR: A:W-1(V463_D-1) Preds: [C:W-1(V462_D-1) ] Succ: [G:W-1(V464_D-1) ] NODE_DESCR: G:W-1(V464_D-1) Preds: [A:W-1(V463_D-1) ] Succ: [G:W-1(V465_D-1) ] NODE_DESCR: G:W-1(V465_D-1) Preds: [G:W-1(V464_D-1) ] Succ: [A:W-1(V466_D-1) ] NODE_DESCR: A:W-1(V466_D-1) Preds: [G:W-1(V465_D-1) ] Succ: [G:W-1(V467_D-1) ] NODE_DESCR: G:W-1(V467_D-1) Preds: [A:W-1(V466_D-1) ] Succ: [A:W-1(V468_D-1) ] NODE_DESCR: A:W-1(V468_D-1) Preds: [G:W-1(V467_D-1) ] Succ: [T:W-1(V469_D-1) ] NODE_DESCR: T:W-1(V469_D-1) Preds: [A:W-1(V468_D-1) ] Succ: [C:W-1(V470_D-1) ] NODE_DESCR: C:W-1(V470_D-1) Preds: [T:W-1(V469_D-1) ] Succ: [A:W-1(V471_D-1) ] NODE_DESCR: A:W-1(V471_D-1) Preds: [C:W-1(V470_D-1) ] Succ: [T:W-1(V472_D-1) ] NODE_DESCR: T:W-1(V472_D-1) Preds: [A:W-1(V471_D-1) ] Succ: [G:W-1(V473_D-1) ] NODE_DESCR: G:W-1(V473_D-1) Preds: [T:W-1(V472_D-1) ] Succ: [G:W-1(V474_D-1) ] NODE_DESCR: G:W-1(V474_D-1) Preds: [G:W-1(V473_D-1) ] Succ: [T:W-1(V475_D-1) ] NODE_DESCR: T:W-1(V475_D-1) Preds: [G:W-1(V474_D-1) ] Succ: [A:W-1(V476_D-1) ] NODE_DESCR: A:W-1(V476_D-1) Preds: [T:W-1(V475_D-1) ] Succ: [G:W-1(V477_D-1) ] NODE_DESCR: G:W-1(V477_D-1) Preds: [A:W-1(V476_D-1) ] Succ: [G:W-1(V478_D-1) ] NODE_DESCR: G:W-1(V478_D-1) Preds: [G:W-1(V477_D-1) ] Succ: [G:W-1(V479_D-1) ] NODE_DESCR: G:W-1(V479_D-1) Preds: [G:W-1(V478_D-1) ] Succ: [A:W-1(V480_D-1) ] NODE_DESCR: A:W-1(V480_D-1) Preds: [G:W-1(V479_D-1) ] Succ: [A:W-1(V481_D-1) ] NODE_DESCR: A:W-1(V481_D-1) Preds: [A:W-1(V480_D-1) ] Succ: [G:W-1(V482_D-1) ] NODE_DESCR: G:W-1(V482_D-1) Preds: [A:W-1(V481_D-1) ] Succ: [G:W-1(V483_D-1) ] NODE_DESCR: G:W-1(V483_D-1) Preds: [G:W-1(V482_D-1) ] Succ: [G:W-1(V484_D-1) ] NODE_DESCR: G:W-1(V484_D-1) Preds: [G:W-1(V483_D-1) ] Succ: [G:W-1(V485_D-1) ] NODE_DESCR: G:W-1(V485_D-1) Preds: [G:W-1(V484_D-1) ] Succ: [T:W-1(V486_D-1) ] NODE_DESCR: T:W-1(V486_D-1) Preds: [G:W-1(V485_D-1) ] Succ: [C:W-1(V487_D-1) ] NODE_DESCR: C:W-1(V487_D-1) Preds: [T:W-1(V486_D-1) ] Succ: [A:W-1(V488_D-1) ] NODE_DESCR: A:W-1(V488_D-1) Preds: [C:W-1(V487_D-1) ] Succ: [G:W-1(V489_D-1) ] NODE_DESCR: G:W-1(V489_D-1) Preds: [A:W-1(V488_D-1) ] Succ: [G:W-1(V490_D-1) ] NODE_DESCR: G:W-1(V490_D-1) Preds: [G:W-1(V489_D-1) ] Succ: [C:W-1(V491_D-1) ] NODE_DESCR: C:W-1(V491_D-1) Preds: [G:W-1(V490_D-1) ] Succ: [C:W-1(V492_D-1) ] NODE_DESCR: C:W-1(V492_D-1) Preds: [C:W-1(V491_D-1) ] Succ: [A:W-1(V493_D-1) ] NODE_DESCR: A:W-1(V493_D-1) Preds: [C:W-1(V492_D-1) ] Succ: [C:W-1(V494_D-1) ] NODE_DESCR: C:W-1(V494_D-1) Preds: [A:W-1(V493_D-1) ] Succ: [T:W-1(V495_D-1) ] NODE_DESCR: T:W-1(V495_D-1) Preds: [C:W-1(V494_D-1) ] Succ: [T:W-1(V496_D-1) ] NODE_DESCR: T:W-1(V496_D-1) Preds: [T:W-1(V495_D-1) ] Succ: [C:W-1(V497_D-1) ] NODE_DESCR: C:W-1(V497_D-1) Preds: [T:W-1(V496_D-1) ] Succ: [A:W-1(V498_D-1) ] NODE_DESCR: A:W-1(V498_D-1) Preds: [C:W-1(V497_D-1) ] Succ: [C:W-1(V499_D-1) ] NODE_DESCR: C:W-1(V499_D-1) Preds: [A:W-1(V498_D-1) ] Succ: [A:W-1(V500_D-1) ] NODE_DESCR: A:W-1(V500_D-1) Preds: [C:W-1(V499_D-1) ] Succ: [A:W-1(V501_D-1) ] NODE_DESCR: A:W-1(V501_D-1) Preds: [A:W-1(V500_D-1) ] Succ: [G:W-1(V502_D-1) ] NODE_DESCR: G:W-1(V502_D-1) Preds: [A:W-1(V501_D-1) ] Succ: [G:W-1(V503_D-1) ] NODE_DESCR: G:W-1(V503_D-1) Preds: [G:W-1(V502_D-1) ] Succ: [A:W-1(V504_D-1) ] NODE_DESCR: A:W-1(V504_D-1) Preds: [G:W-1(V503_D-1) ] Succ: [G:W-1(V505_D-1) ] NODE_DESCR: G:W-1(V505_D-1) Preds: [A:W-1(V504_D-1) ] Succ: [C:W-1(V506_D-1) ] NODE_DESCR: C:W-1(V506_D-1) Preds: [G:W-1(V505_D-1) ] Succ: [A:W-1(V507_D-1) ] NODE_DESCR: A:W-1(V507_D-1) Preds: [C:W-1(V506_D-1) ] Succ: [G:W-1(V508_D-1) ] NODE_DESCR: G:W-1(V508_D-1) Preds: [A:W-1(V507_D-1) ] Succ: [A:W-1(V509_D-1) ] NODE_DESCR: A:W-1(V509_D-1) Preds: [G:W-1(V508_D-1) ] Succ: [G:W-1(V510_D-1) ] NODE_DESCR: G:W-1(V510_D-1) Preds: [A:W-1(V509_D-1) ] Succ: [T:W-1(V511_D-1) ] NODE_DESCR: T:W-1(V511_D-1) Preds: [G:W-1(V510_D-1) ] Succ: [T:W-1(V512_D-1) ] NODE_DESCR: T:W-1(V512_D-1) Preds: [T:W-1(V511_D-1) ] Succ: [A:W-1(V513_D-1) ] NODE_DESCR: A:W-1(V513_D-1) Preds: [T:W-1(V512_D-1) ] Succ: [G:W-1(V514_D-1) ] NODE_DESCR: G:W-1(V514_D-1) Preds: [A:W-1(V513_D-1) ] Succ: [G:W-1(V515_D-1) ] NODE_DESCR: G:W-1(V515_D-1) Preds: [G:W-1(V514_D-1) ] Succ: [A:W-1(V516_D-1) ] NODE_DESCR: A:W-1(V516_D-1) Preds: [G:W-1(V515_D-1) ] Succ: [A:W-1(V517_D-1) ] NODE_DESCR: A:W-1(V517_D-1) Preds: [A:W-1(V516_D-1) ] Succ: [G:W-1(V518_D-1) ] NODE_DESCR: G:W-1(V518_D-1) Preds: [A:W-1(V517_D-1) ] Succ: [C:W-1(V519_D-1) ] NODE_DESCR: C:W-1(V519_D-1) Preds: [G:W-1(V518_D-1) ] Succ: [T:W-1(V520_D-1) ] NODE_DESCR: T:W-1(V520_D-1) Preds: [C:W-1(V519_D-1) ] Succ: [C:W-1(V521_D-1) ] NODE_DESCR: C:W-1(V521_D-1) Preds: [T:W-1(V520_D-1) ] Succ: [C:W-1(V522_D-1) ] NODE_DESCR: C:W-1(V522_D-1) Preds: [C:W-1(V521_D-1) ] Succ: [C:W-1(V523_D-1) ] NODE_DESCR: C:W-1(V523_D-1) Preds: [C:W-1(V522_D-1) ] Succ: [T:W-1(V524_D-1) ] NODE_DESCR: T:W-1(V524_D-1) Preds: [C:W-1(V523_D-1) ] Succ: [G:W-1(V525_D-1) C:W-1(V813_D-1) ] NODE_DESCR: G:W-1(V525_D-1) Preds: [T:W-1(V524_D-1) ] Succ: [A:W-1(V526_D-1) ] NODE_DESCR: A:W-1(V526_D-1) Preds: [G:W-1(V525_D-1) ] Succ: [G:W-1(V527_D-1) ] NODE_DESCR: G:W-1(V527_D-1) Preds: [A:W-1(V526_D-1) ] Succ: [C:W-1(V528_D-1) ] NODE_DESCR: C:W-1(V528_D-1) Preds: [G:W-1(V527_D-1) ] Succ: [A:W-1(V529_D-1) ] NODE_DESCR: A:W-1(V529_D-1) Preds: [C:W-1(V528_D-1) ] Succ: [C:W-1(V530_D-1) ] NODE_DESCR: C:W-1(V530_D-1) Preds: [A:W-1(V529_D-1) ] Succ: [T:W-1(V531_D-1) ] NODE_DESCR: T:W-1(V531_D-1) Preds: [C:W-1(V530_D-1) ] Succ: [C:W-1(V532_D-1) ] NODE_DESCR: C:W-1(V532_D-1) Preds: [T:W-1(V531_D-1) ] Succ: [T:W-1(V533_D-1) ] NODE_DESCR: T:W-1(V533_D-1) Preds: [C:W-1(V532_D-1) ] Succ: [G:W-1(V534_D-1) ] NODE_DESCR: G:W-1(V534_D-1) Preds: [T:W-1(V533_D-1) ] Succ: [A:W-1(V535_D-1) ] NODE_DESCR: A:W-1(V535_D-1) Preds: [G:W-1(V534_D-1) ] Succ: [A:W-1(V536_D-1) ] NODE_DESCR: A:W-1(V536_D-1) Preds: [A:W-1(V535_D-1) ] Succ: [C:W-1(V537_D-1) ] NODE_DESCR: C:W-1(V537_D-1) Preds: [A:W-1(V536_D-1) ] Succ: [C:W-1(V538_D-1) ] NODE_DESCR: C:W-1(V538_D-1) Preds: [C:W-1(V537_D-1) ] Succ: [C:W-1(V539_D-1) ] NODE_DESCR: C:W-1(V539_D-1) Preds: [C:W-1(V538_D-1) ] Succ: [T:W-1(V540_D-1) ] NODE_DESCR: T:W-1(V540_D-1) Preds: [C:W-1(V539_D-1) ] Succ: [G:W-1(V541_D-1) ] NODE_DESCR: G:W-1(V541_D-1) Preds: [T:W-1(V540_D-1) ] Succ: [T:W-1(V542_D-1) ] NODE_DESCR: T:W-1(V542_D-1) Preds: [G:W-1(V541_D-1) ] Succ: [G:W-1(V543_D-1) ] NODE_DESCR: G:W-1(V543_D-1) Preds: [T:W-1(V542_D-1) ] Succ: [A:W-1(V544_D-1) ] NODE_DESCR: A:W-1(V544_D-1) Preds: [G:W-1(V543_D-1) ] Succ: [G:W-1(V545_D-1) ] NODE_DESCR: G:W-1(V545_D-1) Preds: [A:W-1(V544_D-1) ] Succ: [G:W-1(V546_D-1) ] NODE_DESCR: G:W-1(V546_D-1) Preds: [G:W-1(V545_D-1) ] Succ: [C:W-1(V547_D-1) ] NODE_DESCR: C:W-1(V547_D-1) Preds: [G:W-1(V546_D-1) ] Succ: [A:W-1(V548_D-1) ] NODE_DESCR: A:W-1(V548_D-1) Preds: [C:W-1(V547_D-1) ] Succ: [A:W-1(V549_D-1) ] NODE_DESCR: A:W-1(V549_D-1) Preds: [A:W-1(V548_D-1) A:W-1(V836_D-1) ] Succ: [G:W-1(V550_D-1) ] NODE_DESCR: G:W-1(V550_D-1) Preds: [A:W-1(V549_D-1) ] Succ: [T:W-1(V551_D-1) ] NODE_DESCR: T:W-1(V551_D-1) Preds: [G:W-1(V550_D-1) ] Succ: [C:W-1(V552_D-1) ] NODE_DESCR: C:W-1(V552_D-1) Preds: [T:W-1(V551_D-1) ] Succ: [C:W-1(V553_D-1) ] NODE_DESCR: C:W-1(V553_D-1) Preds: [C:W-1(V552_D-1) ] Succ: [A:W-1(V554_D-1) ] NODE_DESCR: A:W-1(V554_D-1) Preds: [C:W-1(V553_D-1) ] Succ: [C:W-1(V555_D-1) ] NODE_DESCR: C:W-1(V555_D-1) Preds: [A:W-1(V554_D-1) ] Succ: [C:W-1(V556_D-1) ] NODE_DESCR: C:W-1(V556_D-1) Preds: [C:W-1(V555_D-1) ] Succ: [A:W-1(V557_D-1) ] NODE_DESCR: A:W-1(V557_D-1) Preds: [C:W-1(V556_D-1) ] Succ: [C:W-1(V558_D-1) ] NODE_DESCR: C:W-1(V558_D-1) Preds: [A:W-1(V557_D-1) ] Succ: [C:W-1(V559_D-1) ] NODE_DESCR: C:W-1(V559_D-1) Preds: [C:W-1(V558_D-1) ] Succ: [A:W-1(V560_D-1) ] NODE_DESCR: A:W-1(V560_D-1) Preds: [C:W-1(V559_D-1) ] Succ: [G:W-1(V561_D-1) ] NODE_DESCR: G:W-1(V561_D-1) Preds: [A:W-1(V560_D-1) ] Succ: [C:W-1(V562_D-1) ] NODE_DESCR: C:W-1(V562_D-1) Preds: [G:W-1(V561_D-1) ] Succ: [G:W-1(V563_D-1) ] NODE_DESCR: G:W-1(V563_D-1) Preds: [C:W-1(V562_D-1) ] Succ: [T:W-1(V564_D-1) ] NODE_DESCR: T:W-1(V564_D-1) Preds: [G:W-1(V563_D-1) ] Succ: [A:W-1(V565_D-1) ] NODE_DESCR: A:W-1(V565_D-1) Preds: [T:W-1(V564_D-1) ] Succ: [T:W-1(V566_D-1) ] NODE_DESCR: T:W-1(V566_D-1) Preds: [A:W-1(V565_D-1) ] Succ: [C:W-1(V567_D-1) ] NODE_DESCR: C:W-1(V567_D-1) Preds: [T:W-1(V566_D-1) ] Succ: [T:W-1(V568_D-1) ] NODE_DESCR: T:W-1(V568_D-1) Preds: [C:W-1(V567_D-1) ] Succ: [A:W-1(V569_D-1) ] NODE_DESCR: A:W-1(V569_D-1) Preds: [T:W-1(V568_D-1) ] Succ: [G:W-1(V570_D-1) ] NODE_DESCR: G:W-1(V570_D-1) Preds: [A:W-1(V569_D-1) ] Succ: [A:W-1(V571_D-1) ] NODE_DESCR: A:W-1(V571_D-1) Preds: [G:W-1(V570_D-1) ] Succ: [C:W-1(V572_D-1) ] NODE_DESCR: C:W-1(V572_D-1) Preds: [A:W-1(V571_D-1) ] Succ: [C:W-1(V573_D-1) ] NODE_DESCR: C:W-1(V573_D-1) Preds: [C:W-1(V572_D-1) ] Succ: [C:W-1(V574_D-1) ] NODE_DESCR: C:W-1(V574_D-1) Preds: [C:W-1(V573_D-1) ] Succ: [A:W-1(V575_D-1) ] NODE_DESCR: A:W-1(V575_D-1) Preds: [C:W-1(V574_D-1) ] Succ: [G:W-1(V576_D-1) ] NODE_DESCR: G:W-1(V576_D-1) Preds: [A:W-1(V575_D-1) ] Succ: [G:W-1(V577_D-1) ] NODE_DESCR: G:W-1(V577_D-1) Preds: [G:W-1(V576_D-1) ] Succ: [C:W-1(V578_D-1) ] NODE_DESCR: C:W-1(V578_D-1) Preds: [G:W-1(V577_D-1) ] Succ: [C:W-1(V579_D-1) ] NODE_DESCR: C:W-1(V579_D-1) Preds: [C:W-1(V578_D-1) ] Succ: [A:W-1(V580_D-1) ] NODE_DESCR: A:W-1(V580_D-1) Preds: [C:W-1(V579_D-1) ] Succ: [T:W-1(V581_D-1) ] NODE_DESCR: T:W-1(V581_D-1) Preds: [A:W-1(V580_D-1) ] Succ: [C:W-1(V582_D-1) ] NODE_DESCR: C:W-1(V582_D-1) Preds: [T:W-1(V581_D-1) ] Succ: [T:W-1(V583_D-1) ] NODE_DESCR: T:W-1(V583_D-1) Preds: [C:W-1(V582_D-1) ] Succ: [A:W-1(V584_D-1) ] NODE_DESCR: A:W-1(V584_D-1) Preds: [T:W-1(V583_D-1) ] Succ: [A:W-1(V585_D-1) ] NODE_DESCR: A:W-1(V585_D-1) Preds: [A:W-1(V584_D-1) ] Succ: [T:W-1(V586_D-1) ] NODE_DESCR: T:W-1(V586_D-1) Preds: [A:W-1(V585_D-1) ] Succ: [A:W-1(V587_D-1) ] NODE_DESCR: A:W-1(V587_D-1) Preds: [T:W-1(V586_D-1) ] Succ: [A:W-1(V588_D-1) ] NODE_DESCR: A:W-1(V588_D-1) Preds: [A:W-1(V587_D-1) ] Succ: [A:W-1(V589_D-1) ] NODE_DESCR: A:W-1(V589_D-1) Preds: [A:W-1(V588_D-1) ] Succ: [G:W-1(V590_D-1) ] NODE_DESCR: G:W-1(V590_D-1) Preds: [A:W-1(V589_D-1) ] Succ: [G:W-1(V591_D-1) ] NODE_DESCR: G:W-1(V591_D-1) Preds: [G:W-1(V590_D-1) ] Succ: [A:W-1(V592_D-1) ] NODE_DESCR: A:W-1(V592_D-1) Preds: [G:W-1(V591_D-1) ] Succ: [A:W-1(V593_D-1) ] NODE_DESCR: A:W-1(V593_D-1) Preds: [A:W-1(V592_D-1) ] Succ: [A:W-1(V594_D-1) ] NODE_DESCR: A:W-1(V594_D-1) Preds: [A:W-1(V593_D-1) ] Succ: [A:W-1(V595_D-1) ] NODE_DESCR: A:W-1(V595_D-1) Preds: [A:W-1(V594_D-1) ] Succ: [C:W-1(V596_D-1) ] NODE_DESCR: C:W-1(V596_D-1) Preds: [A:W-1(V595_D-1) ] Succ: [T:W-1(V597_D-1) ] NODE_DESCR: T:W-1(V597_D-1) Preds: [C:W-1(V596_D-1) ] Succ: [G:W-1(V598_D-1) ] NODE_DESCR: G:W-1(V598_D-1) Preds: [T:W-1(V597_D-1) ] Succ: [C:W-1(V599_D-1) ] NODE_DESCR: C:W-1(V599_D-1) Preds: [G:W-1(V598_D-1) ] Succ: [A:W-1(V600_D-1) ] NODE_DESCR: A:W-1(V600_D-1) Preds: [C:W-1(V599_D-1) ] Succ: [T:W-1(V601_D-1) ] NODE_DESCR: T:W-1(V601_D-1) Preds: [A:W-1(V600_D-1) ] Succ: [C:W-1(V602_D-1) ] NODE_DESCR: C:W-1(V602_D-1) Preds: [T:W-1(V601_D-1) ] Succ: [T:W-1(V603_D-1) ] NODE_DESCR: T:W-1(V603_D-1) Preds: [C:W-1(V602_D-1) ] Succ: [T:W-1(V604_D-1) ] NODE_DESCR: T:W-1(V604_D-1) Preds: [T:W-1(V603_D-1) ] Succ: [T:W-1(V605_D-1) ] NODE_DESCR: T:W-1(V605_D-1) Preds: [T:W-1(V604_D-1) ] Succ: [G:W-1(V606_D-1) ] NODE_DESCR: G:W-1(V606_D-1) Preds: [T:W-1(V605_D-1) ] Succ: [C:W-1(V607_D-1) ] NODE_DESCR: C:W-1(V607_D-1) Preds: [G:W-1(V606_D-1) ] Succ: [C:W-1(V608_D-1) ] NODE_DESCR: C:W-1(V608_D-1) Preds: [C:W-1(V607_D-1) ] Succ: [C:W-1(V609_D-1) ] NODE_DESCR: C:W-1(V609_D-1) Preds: [C:W-1(V608_D-1) ] Succ: [A:W-1(V610_D-1) ] NODE_DESCR: A:W-1(V610_D-1) Preds: [C:W-1(V609_D-1) ] Succ: [C:W-1(V611_D-1) ] NODE_DESCR: C:W-1(V611_D-1) Preds: [A:W-1(V610_D-1) ] Succ: [A:W-1(V612_D-1) ] NODE_DESCR: A:W-1(V612_D-1) Preds: [C:W-1(V611_D-1) ] Succ: [T:W-1(V613_D-1) ] NODE_DESCR: T:W-1(V613_D-1) Preds: [A:W-1(V612_D-1) ] Succ: [G:W-1(V614_D-1) ] NODE_DESCR: G:W-1(V614_D-1) Preds: [T:W-1(V613_D-1) ] Succ: [A:W-1(V615_D-1) ] NODE_DESCR: A:W-1(V615_D-1) Preds: [G:W-1(V614_D-1) ] Succ: [T:W-1(V616_D-1) ] NODE_DESCR: T:W-1(V616_D-1) Preds: [A:W-1(V615_D-1) ] Succ: [G:W-1(V617_D-1) ] NODE_DESCR: G:W-1(V617_D-1) Preds: [T:W-1(V616_D-1) ] Succ: [C:W-1(V618_D-1) ] NODE_DESCR: C:W-1(V618_D-1) Preds: [G:W-1(V617_D-1) ] Succ: [T:W-1(V619_D-1) ] NODE_DESCR: T:W-1(V619_D-1) Preds: [C:W-1(V618_D-1) ] Succ: [T:W-1(V620_D-1) ] NODE_DESCR: T:W-1(V620_D-1) Preds: [T:W-1(V619_D-1) ] Succ: [G:W-1(V621_D-1) ] NODE_DESCR: G:W-1(V621_D-1) Preds: [T:W-1(V620_D-1) ] Succ: [G:W-1(V622_D-1) ] NODE_DESCR: G:W-1(V622_D-1) Preds: [G:W-1(V621_D-1) ] Succ: [T:W-1(V623_D-1) ] NODE_DESCR: T:W-1(V623_D-1) Preds: [G:W-1(V622_D-1) ] Succ: [T:W-1(V624_D-1) ] NODE_DESCR: T:W-1(V624_D-1) Preds: [T:W-1(V623_D-1) ] Succ: [A:W-1(V625_D-1) ] NODE_DESCR: A:W-1(V625_D-1) Preds: [T:W-1(V624_D-1) ] Succ: [A:W-1(V626_D-1) ] NODE_DESCR: A:W-1(V626_D-1) Preds: [A:W-1(V625_D-1) ] Succ: [G:W-1(V627_D-1) ] NODE_DESCR: G:W-1(V627_D-1) Preds: [A:W-1(V626_D-1) ] Succ: [A:W-1(V628_D-1) ] NODE_DESCR: A:W-1(V628_D-1) Preds: [G:W-1(V627_D-1) ] Succ: [C:W-1(V629_D-1) ] NODE_DESCR: C:W-1(V629_D-1) Preds: [A:W-1(V628_D-1) ] Succ: [A:W-1(V630_D-1) ] NODE_DESCR: A:W-1(V630_D-1) Preds: [C:W-1(V629_D-1) ] Succ: [A:W-1(V631_D-1) ] NODE_DESCR: A:W-1(V631_D-1) Preds: [A:W-1(V630_D-1) ] Succ: [G:W-1(V632_D-1) ] NODE_DESCR: G:W-1(V632_D-1) Preds: [A:W-1(V631_D-1) ] Succ: [G:W-1(V633_D-1) ] NODE_DESCR: G:W-1(V633_D-1) Preds: [G:W-1(V632_D-1) ] Succ: [G:W-1(V634_D-1) ] NODE_DESCR: G:W-1(V634_D-1) Preds: [G:W-1(V633_D-1) ] Succ: [G:W-1(V635_D-1) ] NODE_DESCR: G:W-1(V635_D-1) Preds: [G:W-1(V634_D-1) ] Succ: [T:W-1(V636_D-1) ] NODE_DESCR: T:W-1(V636_D-1) Preds: [G:W-1(V635_D-1) ] Succ: [T:W-1(V637_D-1) ] NODE_DESCR: T:W-1(V637_D-1) Preds: [T:W-1(V636_D-1) ] Succ: [A:W-1(V638_D-1) ] NODE_DESCR: A:W-1(V638_D-1) Preds: [T:W-1(V637_D-1) ] Succ: [G:W-1(V639_D-1) ] NODE_DESCR: G:W-1(V639_D-1) Preds: [A:W-1(V638_D-1) ] Succ: [T:W-1(V640_D-1) ] NODE_DESCR: T:W-1(V640_D-1) Preds: [G:W-1(V639_D-1) ] Succ: [G:W-1(V641_D-1) ] NODE_DESCR: G:W-1(V641_D-1) Preds: [T:W-1(V640_D-1) ] Succ: [A:W-1(V642_D-1) ] NODE_DESCR: A:W-1(V642_D-1) Preds: [G:W-1(V641_D-1) ] Succ: [C:W-1(V643_D-1) ] NODE_DESCR: C:W-1(V643_D-1) Preds: [A:W-1(V642_D-1) ] Succ: [A:W-1(V644_D-1) ] NODE_DESCR: A:W-1(V644_D-1) Preds: [C:W-1(V643_D-1) ] Succ: [A:W-1(V645_D-1) ] NODE_DESCR: A:W-1(V645_D-1) Preds: [A:W-1(V644_D-1) ] Succ: [A:W-1(V646_D-1) ] NODE_DESCR: A:W-1(V646_D-1) Preds: [A:W-1(V645_D-1) ] Succ: [G:W-1(V647_D-1) ] NODE_DESCR: G:W-1(V647_D-1) Preds: [A:W-1(V646_D-1) ] Succ: [T:W-1(V648_D-1) ] NODE_DESCR: T:W-1(V648_D-1) Preds: [G:W-1(V647_D-1) ] Succ: [A:W-1(V649_D-1) ] NODE_DESCR: A:W-1(V649_D-1) Preds: [T:W-1(V648_D-1) ] Succ: [A:W-1(V650_D-1) ] NODE_DESCR: A:W-1(V650_D-1) Preds: [A:W-1(V649_D-1) ] Succ: [A:W-1(V651_D-1) ] NODE_DESCR: A:W-1(V651_D-1) Preds: [A:W-1(V650_D-1) ] Succ: [G:W-1(V652_D-1) ] NODE_DESCR: G:W-1(V652_D-1) Preds: [A:W-1(V651_D-1) ] Succ: [A:W-1(V653_D-1) ] NODE_DESCR: A:W-1(V653_D-1) Preds: [G:W-1(V652_D-1) ] Succ: [G:W-1(V654_D-1) ] NODE_DESCR: G:W-1(V654_D-1) Preds: [A:W-1(V653_D-1) ] Succ: [G:W-1(V655_D-1) ] NODE_DESCR: G:W-1(V655_D-1) Preds: [G:W-1(V654_D-1) ] Succ: [A:W-1(V656_D-1) ] NODE_DESCR: A:W-1(V656_D-1) Preds: [G:W-1(V655_D-1) ] Succ: [T:W-1(V657_D-1) ] NODE_DESCR: T:W-1(V657_D-1) Preds: [A:W-1(V656_D-1) ] Succ: [G:W-1(V658_D-1) ] NODE_DESCR: G:W-1(V658_D-1) Preds: [T:W-1(V657_D-1) ] Succ: [A:W-1(V659_D-1) ] NODE_DESCR: A:W-1(V659_D-1) Preds: [G:W-1(V658_D-1) ] Succ: [C:W-1(V660_D-1) ] NODE_DESCR: C:W-1(V660_D-1) Preds: [A:W-1(V659_D-1) ] Succ: [A:W-1(V661_D-1) ] NODE_DESCR: A:W-1(V661_D-1) Preds: [C:W-1(V660_D-1) ] Succ: [G:W-1(V662_D-1) ] NODE_DESCR: G:W-1(V662_D-1) Preds: [A:W-1(V661_D-1) ] Succ: [A:W-1(V663_D-1) ] NODE_DESCR: A:W-1(V663_D-1) Preds: [G:W-1(V662_D-1) ] Succ: [C:W-1(V664_D-1) ] NODE_DESCR: C:W-1(V664_D-1) Preds: [A:W-1(V663_D-1) ] Succ: [T:W-1(V665_D-1) ] NODE_DESCR: T:W-1(V665_D-1) Preds: [C:W-1(V664_D-1) ] Succ: [C:W-1(V666_D-1) ] NODE_DESCR: C:W-1(V666_D-1) Preds: [T:W-1(V665_D-1) ] Succ: [T:W-1(V667_D-1) ] NODE_DESCR: T:W-1(V667_D-1) Preds: [C:W-1(V666_D-1) ] Succ: [C:W-1(V668_D-1) ] NODE_DESCR: C:W-1(V668_D-1) Preds: [T:W-1(V667_D-1) ] Succ: [T:W-1(V669_D-1) ] NODE_DESCR: T:W-1(V669_D-1) Preds: [C:W-1(V668_D-1) ] Succ: [A:W-1(V670_D-1) ] NODE_DESCR: A:W-1(V670_D-1) Preds: [T:W-1(V669_D-1) ] Succ: [A:W-1(V671_D-1) ] NODE_DESCR: A:W-1(V671_D-1) Preds: [A:W-1(V670_D-1) ] Succ: [G:W-1(V672_D-1) ] NODE_DESCR: G:W-1(V672_D-1) Preds: [A:W-1(V671_D-1) ] Succ: [G:W-1(V673_D-1) ] NODE_DESCR: G:W-1(V673_D-1) Preds: [G:W-1(V672_D-1) ] Succ: [G:W-1(V674_D-1) ] NODE_DESCR: G:W-1(V674_D-1) Preds: [G:W-1(V673_D-1) ] Succ: [A:W-1(V675_D-1) ] NODE_DESCR: A:W-1(V675_D-1) Preds: [G:W-1(V674_D-1) ] Succ: [C:W-1(V676_D-1) ] NODE_DESCR: C:W-1(V676_D-1) Preds: [A:W-1(V675_D-1) ] Succ: [A:W-1(V677_D-1) ] NODE_DESCR: A:W-1(V677_D-1) Preds: [C:W-1(V676_D-1) ] Succ: [T:W-1(V678_D-1) ] NODE_DESCR: T:W-1(V678_D-1) Preds: [A:W-1(V677_D-1) ] Succ: [A:W-1(V679_D-1) ] NODE_DESCR: A:W-1(V679_D-1) Preds: [T:W-1(V678_D-1) ] Succ: [T:W-1(V680_D-1) ] NODE_DESCR: T:W-1(V680_D-1) Preds: [A:W-1(V679_D-1) ] Succ: [G:W-1(V681_D-1) ] NODE_DESCR: G:W-1(V681_D-1) Preds: [T:W-1(V680_D-1) ] Succ: [G:W-1(V682_D-1) ] NODE_DESCR: G:W-1(V682_D-1) Preds: [G:W-1(V681_D-1) ] Succ: [G:W-1(V683_D-1) ] NODE_DESCR: G:W-1(V683_D-1) Preds: [G:W-1(V682_D-1) ] Succ: [A:W-1(V684_D-1) ] NODE_DESCR: A:W-1(V684_D-1) Preds: [G:W-1(V683_D-1) ] Succ: [G:W-1(V685_D-1) ] NODE_DESCR: G:W-1(V685_D-1) Preds: [A:W-1(V684_D-1) ] Succ: [C:W-1(V686_D-1) ] NODE_DESCR: C:W-1(V686_D-1) Preds: [G:W-1(V685_D-1) ] Succ: [T:W-1(V687_D-1) ] NODE_DESCR: T:W-1(V687_D-1) Preds: [C:W-1(V686_D-1) ] Succ: [A:W-1(V688_D-1) ] NODE_DESCR: A:W-1(V688_D-1) Preds: [T:W-1(V687_D-1) ] Succ: [C:W-1(V689_D-1) ] NODE_DESCR: C:W-1(V689_D-1) Preds: [A:W-1(V688_D-1) ] Succ: [A:W-1(V690_D-1) ] NODE_DESCR: A:W-1(V690_D-1) Preds: [C:W-1(V689_D-1) ] Succ: [T:W-1(V691_D-1) ] NODE_DESCR: T:W-1(V691_D-1) Preds: [A:W-1(V690_D-1) ] Succ: [A:W-1(V692_D-1) ] NODE_DESCR: A:W-1(V692_D-1) Preds: [T:W-1(V691_D-1) ] Succ: [G:W-1(V693_D-1) ] NODE_DESCR: G:W-1(V693_D-1) Preds: [A:W-1(V692_D-1) ] Succ: [C:W-1(V694_D-1) ] NODE_DESCR: C:W-1(V694_D-1) Preds: [G:W-1(V693_D-1) ] Succ: [C:W-1(V695_D-1) ] NODE_DESCR: C:W-1(V695_D-1) Preds: [C:W-1(V694_D-1) ] Succ: [A:W-1(V696_D-1) ] NODE_DESCR: A:W-1(V696_D-1) Preds: [C:W-1(V695_D-1) ] Succ: [G:W-1(V697_D-1) ] NODE_DESCR: G:W-1(V697_D-1) Preds: [A:W-1(V696_D-1) ] Succ: [C:W-1(V698_D-1) ] NODE_DESCR: C:W-1(V698_D-1) Preds: [G:W-1(V697_D-1) ] Succ: [C:W-1(V699_D-1) ] NODE_DESCR: C:W-1(V699_D-1) Preds: [C:W-1(V698_D-1) ] Succ: [C:W-1(V700_D-1) ] NODE_DESCR: C:W-1(V700_D-1) Preds: [C:W-1(V699_D-1) ] Succ: [C:W-1(V701_D-1) ] NODE_DESCR: C:W-1(V701_D-1) Preds: [C:W-1(V700_D-1) ] Succ: [G:W-1(V702_D-1) ] NODE_DESCR: G:W-1(V702_D-1) Preds: [C:W-1(V701_D-1) ] Succ: [T:W-1(V703_D-1) ] NODE_DESCR: T:W-1(V703_D-1) Preds: [G:W-1(V702_D-1) ] Succ: [G:W-1(V704_D-1) ] NODE_DESCR: G:W-1(V704_D-1) Preds: [T:W-1(V703_D-1) ] Succ: [G:W-1(V705_D-1) ] NODE_DESCR: G:W-1(V705_D-1) Preds: [G:W-1(V704_D-1) ] Succ: [A:W-1(V706_D-1) ] NODE_DESCR: A:W-1(V706_D-1) Preds: [G:W-1(V705_D-1) ] Succ: [G:W-1(V707_D-1) ] NODE_DESCR: G:W-1(V707_D-1) Preds: [A:W-1(V706_D-1) ] Succ: [G:W-1(V708_D-1) ] NODE_DESCR: G:W-1(V708_D-1) Preds: [G:W-1(V707_D-1) ] Succ: [G:W-1(V709_D-1) ] NODE_DESCR: G:W-1(V709_D-1) Preds: [G:W-1(V708_D-1) ] Succ: [A:W-1(V710_D-1) ] NODE_DESCR: A:W-1(V710_D-1) Preds: [G:W-1(V709_D-1) ] Succ: [G:W-1(V711_D-1) ] NODE_DESCR: G:W-1(V711_D-1) Preds: [A:W-1(V710_D-1) ] Succ: [C:W-1(V712_D-1) ] NODE_DESCR: C:W-1(V712_D-1) Preds: [G:W-1(V711_D-1) ] Succ: [C:W-1(V713_D-1) ] NODE_DESCR: C:W-1(V713_D-1) Preds: [C:W-1(V712_D-1) ] Succ: [A:W-1(V714_D-1) ] NODE_DESCR: A:W-1(V714_D-1) Preds: [C:W-1(V713_D-1) ] Succ: [C:W-1(V715_D-1) ] NODE_DESCR: C:W-1(V715_D-1) Preds: [A:W-1(V714_D-1) ] Succ: [C:W-1(V716_D-1) ] NODE_DESCR: C:W-1(V716_D-1) Preds: [C:W-1(V715_D-1) ] Succ: [A:W-1(V717_D-1) ] NODE_DESCR: A:W-1(V717_D-1) Preds: [C:W-1(V716_D-1) C:W-1(V812_D-1) ] Succ: [G:W-1(V718_D-1) ] NODE_DESCR: G:W-1(V718_D-1) Preds: [A:W-1(V717_D-1) ] Succ: [C:W-1(V719_D-1) ] NODE_DESCR: C:W-1(V719_D-1) Preds: [G:W-1(V718_D-1) ] Succ: [C:W-1(V720_D-1) ] NODE_DESCR: C:W-1(V720_D-1) Preds: [C:W-1(V719_D-1) ] Succ: [A:W-1(V721_D-1) ] NODE_DESCR: A:W-1(V721_D-1) Preds: [C:W-1(V720_D-1) ] Succ: [C:W-1(V722_D-1) ] NODE_DESCR: C:W-1(V722_D-1) Preds: [A:W-1(V721_D-1) ] Succ: [A:W-1(V723_D-1) ] NODE_DESCR: A:W-1(V723_D-1) Preds: [C:W-1(V722_D-1) ] Succ: [G:W-1(V724_D-1) ] NODE_DESCR: G:W-1(V724_D-1) Preds: [A:W-1(V723_D-1) ] Succ: [G:W-1(V725_D-1) ] NODE_DESCR: G:W-1(V725_D-1) Preds: [G:W-1(V724_D-1) ] Succ: [T:W-1(V726_D-1) ] NODE_DESCR: T:W-1(V726_D-1) Preds: [G:W-1(V725_D-1) ] Succ: [A:W-1(V727_D-1) ] NODE_DESCR: A:W-1(V727_D-1) Preds: [T:W-1(V726_D-1) ] Succ: [C:W-1(V728_D-1) ] NODE_DESCR: C:W-1(V728_D-1) Preds: [A:W-1(V727_D-1) ] Succ: [C:W-1(V729_D-1) ] NODE_DESCR: C:W-1(V729_D-1) Preds: [C:W-1(V728_D-1) ] Succ: [T:W-1(V730_D-1) ] NODE_DESCR: T:W-1(V730_D-1) Preds: [C:W-1(V729_D-1) ] Succ: [G:W-1(V731_D-1) ] NODE_DESCR: G:W-1(V731_D-1) Preds: [T:W-1(V730_D-1) ] Succ: [A:W-1(V732_D-1) ] NODE_DESCR: A:W-1(V732_D-1) Preds: [G:W-1(V731_D-1) ] Succ: [T:W-1(V733_D-1) ] NODE_DESCR: T:W-1(V733_D-1) Preds: [A:W-1(V732_D-1) ] Succ: [G:W-1(V734_D-1) ] NODE_DESCR: G:W-1(V734_D-1) Preds: [T:W-1(V733_D-1) ] Succ: [G:W-1(V735_D-1) ] NODE_DESCR: G:W-1(V735_D-1) Preds: [G:W-1(V734_D-1) ] Succ: [A:W-1(V736_D-1) ] NODE_DESCR: A:W-1(V736_D-1) Preds: [G:W-1(V735_D-1) ] Succ: [A:W-1(V737_D-1) ] NODE_DESCR: A:W-1(V737_D-1) Preds: [A:W-1(V736_D-1) ] Succ: [A:W-1(V738_D-1) ] NODE_DESCR: A:W-1(V738_D-1) Preds: [A:W-1(V737_D-1) ] Succ: [T:W-1(V739_D-1) ] NODE_DESCR: T:W-1(V739_D-1) Preds: [A:W-1(V738_D-1) ] Succ: [G:W-1(V740_D-1) ] NODE_DESCR: G:W-1(V740_D-1) Preds: [T:W-1(V739_D-1) ] Succ: [C:W-1(V741_D-1) ] NODE_DESCR: C:W-1(V741_D-1) Preds: [G:W-1(V740_D-1) ] Succ: [C:W-1(V742_D-1) ] NODE_DESCR: C:W-1(V742_D-1) Preds: [C:W-1(V741_D-1) ] Succ: [G:W-1(V743_D-1) ] NODE_DESCR: G:W-1(V743_D-1) Preds: [C:W-1(V742_D-1) ] Succ: [G:W-1(V744_D-1) ] NODE_DESCR: G:W-1(V744_D-1) Preds: [G:W-1(V743_D-1) ] Succ: [C:W-1(V745_D-1) ] NODE_DESCR: C:W-1(V745_D-1) Preds: [G:W-1(V744_D-1) ] Succ: [T:W-1(V746_D-1) ] NODE_DESCR: T:W-1(V746_D-1) Preds: [C:W-1(V745_D-1) ] Succ: [C:W-1(V747_D-1) ] NODE_DESCR: C:W-1(V747_D-1) Preds: [T:W-1(V746_D-1) ] Succ: [A:W-1(V748_D-1) ] NODE_DESCR: A:W-1(V748_D-1) Preds: [C:W-1(V747_D-1) ] Succ: [C:W-1(V749_D-1) ] NODE_DESCR: C:W-1(V749_D-1) Preds: [A:W-1(V748_D-1) ] Succ: [T:W-1(V750_D-1) ] NODE_DESCR: T:W-1(V750_D-1) Preds: [C:W-1(V749_D-1) ] Succ: [T:W-1(V751_D-1) ] NODE_DESCR: T:W-1(V751_D-1) Preds: [T:W-1(V750_D-1) ] Succ: [C:W-1(V752_D-1) ] NODE_DESCR: C:W-1(V752_D-1) Preds: [T:W-1(V751_D-1) ] Succ: [C:W-1(V753_D-1) ] NODE_DESCR: C:W-1(V753_D-1) Preds: [C:W-1(V752_D-1) ] Succ: [T:W-1(V754_D-1) ] NODE_DESCR: T:W-1(V754_D-1) Preds: [C:W-1(V753_D-1) ] Succ: [G:W-1(V755_D-1) ] NODE_DESCR: G:W-1(V755_D-1) Preds: [T:W-1(V754_D-1) ] Succ: [T:W-1(V756_D-1) ] NODE_DESCR: T:W-1(V756_D-1) Preds: [G:W-1(V755_D-1) ] Succ: [G:W-1(V757_D-1) ] NODE_DESCR: G:W-1(V757_D-1) Preds: [T:W-1(V756_D-1) ] Succ: [A:W-1(V758_D-1) ] NODE_DESCR: A:W-1(V758_D-1) Preds: [G:W-1(V757_D-1) ] Succ: [] NODE_DESCR: GCTAGGGGAAATAGGGGAGCTCCA:W0(V786_D-1) Preds: [] Succ: [A:W-1(V787_D-1) ] NODE_DESCR: A:W-1(V787_D-1) Preds: [GCTAGGGGAAATAGGGGAGCTCCA:W0(V786_D-1) ] Succ: [A:W-1(V788_D-1) ] NODE_DESCR: A:W-1(V788_D-1) Preds: [A:W-1(V787_D-1) ] Succ: [C:W-1(V789_D-1) ] NODE_DESCR: C:W-1(V789_D-1) Preds: [A:W-1(V788_D-1) ] Succ: [C:W-1(V790_D-1) ] NODE_DESCR: C:W-1(V790_D-1) Preds: [C:W-1(V789_D-1) ] Succ: [C:W-1(V791_D-1) ] NODE_DESCR: C:W-1(V791_D-1) Preds: [C:W-1(V790_D-1) ] Succ: [A:W-1(V792_D-1) ] NODE_DESCR: A:W-1(V792_D-1) Preds: [C:W-1(V791_D-1) ] Succ: [G:W-1(V793_D-1) ] NODE_DESCR: G:W-1(V793_D-1) Preds: [A:W-1(V792_D-1) ] Succ: [C:W-1(V794_D-1) ] NODE_DESCR: C:W-1(V794_D-1) Preds: [G:W-1(V793_D-1) ] Succ: [C:W-1(V795_D-1) ] NODE_DESCR: C:W-1(V795_D-1) Preds: [C:W-1(V794_D-1) ] Succ: [C:W-1(V796_D-1) ] NODE_DESCR: C:W-1(V796_D-1) Preds: [C:W-1(V795_D-1) ] Succ: [C:W-1(V797_D-1) ] NODE_DESCR: C:W-1(V797_D-1) Preds: [C:W-1(V796_D-1) ] Succ: [G:W-1(V798_D-1) ] NODE_DESCR: G:W-1(V798_D-1) Preds: [C:W-1(V797_D-1) ] Succ: [T:W-1(V799_D-1) ] NODE_DESCR: T:W-1(V799_D-1) Preds: [G:W-1(V798_D-1) ] Succ: [G:W-1(V800_D-1) ] NODE_DESCR: G:W-1(V800_D-1) Preds: [T:W-1(V799_D-1) ] Succ: [G:W-1(V801_D-1) ] NODE_DESCR: G:W-1(V801_D-1) Preds: [G:W-1(V800_D-1) ] Succ: [A:W-1(V802_D-1) ] NODE_DESCR: A:W-1(V802_D-1) Preds: [G:W-1(V801_D-1) ] Succ: [G:W-1(V803_D-1) ] NODE_DESCR: G:W-1(V803_D-1) Preds: [A:W-1(V802_D-1) ] Succ: [G:W-1(V804_D-1) ] NODE_DESCR: G:W-1(V804_D-1) Preds: [G:W-1(V803_D-1) ] Succ: [G:W-1(V805_D-1) ] NODE_DESCR: G:W-1(V805_D-1) Preds: [G:W-1(V804_D-1) ] Succ: [A:W-1(V806_D-1) ] NODE_DESCR: A:W-1(V806_D-1) Preds: [G:W-1(V805_D-1) ] Succ: [G:W-1(V807_D-1) ] NODE_DESCR: G:W-1(V807_D-1) Preds: [A:W-1(V806_D-1) ] Succ: [C:W-1(V808_D-1) ] NODE_DESCR: C:W-1(V808_D-1) Preds: [G:W-1(V807_D-1) ] Succ: [C:W-1(V809_D-1) ] NODE_DESCR: C:W-1(V809_D-1) Preds: [C:W-1(V808_D-1) ] Succ: [A:W-1(V810_D-1) ] NODE_DESCR: A:W-1(V810_D-1) Preds: [C:W-1(V809_D-1) ] Succ: [C:W-1(V811_D-1) ] NODE_DESCR: C:W-1(V811_D-1) Preds: [A:W-1(V810_D-1) ] Succ: [C:W-1(V812_D-1) ] NODE_DESCR: C:W-1(V812_D-1) Preds: [C:W-1(V811_D-1) ] Succ: [A:W-1(V717_D-1) ] NODE_DESCR: C:W-1(V813_D-1) Preds: [T:W-1(V524_D-1) ] Succ: [A:W-1(V814_D-1) ] NODE_DESCR: A:W-1(V814_D-1) Preds: [C:W-1(V813_D-1) ] Succ: [G:W-1(V815_D-1) ] NODE_DESCR: G:W-1(V815_D-1) Preds: [A:W-1(V814_D-1) ] Succ: [C:W-1(V816_D-1) ] NODE_DESCR: C:W-1(V816_D-1) Preds: [G:W-1(V815_D-1) ] Succ: [A:W-1(V817_D-1) ] NODE_DESCR: A:W-1(V817_D-1) Preds: [C:W-1(V816_D-1) ] Succ: [C:W-1(V818_D-1) ] NODE_DESCR: C:W-1(V818_D-1) Preds: [A:W-1(V817_D-1) ] Succ: [T:W-1(V819_D-1) ] NODE_DESCR: T:W-1(V819_D-1) Preds: [C:W-1(V818_D-1) ] Succ: [C:W-1(V820_D-1) ] NODE_DESCR: C:W-1(V820_D-1) Preds: [T:W-1(V819_D-1) ] Succ: [T:W-1(V821_D-1) ] NODE_DESCR: T:W-1(V821_D-1) Preds: [C:W-1(V820_D-1) ] Succ: [G:W-1(V822_D-1) ] NODE_DESCR: G:W-1(V822_D-1) Preds: [T:W-1(V821_D-1) ] Succ: [A:W-1(V823_D-1) ] NODE_DESCR: A:W-1(V823_D-1) Preds: [G:W-1(V822_D-1) ] Succ: [A:W-1(V824_D-1) ] NODE_DESCR: A:W-1(V824_D-1) Preds: [A:W-1(V823_D-1) ] Succ: [C:W-1(V825_D-1) ] NODE_DESCR: C:W-1(V825_D-1) Preds: [A:W-1(V824_D-1) ] Succ: [C:W-1(V826_D-1) ] NODE_DESCR: C:W-1(V826_D-1) Preds: [C:W-1(V825_D-1) ] Succ: [C:W-1(V827_D-1) ] NODE_DESCR: C:W-1(V827_D-1) Preds: [C:W-1(V826_D-1) ] Succ: [T:W-1(V828_D-1) ] NODE_DESCR: T:W-1(V828_D-1) Preds: [C:W-1(V827_D-1) ] Succ: [G:W-1(V829_D-1) ] NODE_DESCR: G:W-1(V829_D-1) Preds: [T:W-1(V828_D-1) ] Succ: [T:W-1(V830_D-1) ] NODE_DESCR: T:W-1(V830_D-1) Preds: [G:W-1(V829_D-1) ] Succ: [G:W-1(V831_D-1) ] NODE_DESCR: G:W-1(V831_D-1) Preds: [T:W-1(V830_D-1) ] Succ: [A:W-1(V832_D-1) ] NODE_DESCR: A:W-1(V832_D-1) Preds: [G:W-1(V831_D-1) ] Succ: [G:W-1(V833_D-1) ] NODE_DESCR: G:W-1(V833_D-1) Preds: [A:W-1(V832_D-1) ] Succ: [G:W-1(V834_D-1) ] NODE_DESCR: G:W-1(V834_D-1) Preds: [G:W-1(V833_D-1) ] Succ: [C:W-1(V835_D-1) ] NODE_DESCR: C:W-1(V835_D-1) Preds: [G:W-1(V834_D-1) ] Succ: [A:W-1(V836_D-1) ] NODE_DESCR: A:W-1(V836_D-1) Preds: [C:W-1(V835_D-1) ] Succ: [A:W-1(V549_D-1) ] NODE_DESCR: G:W-1(V885_D-1) Preds: [G:W-1(V415_D-1) ] Succ: [C:W-1(V886_D-1) ] NODE_DESCR: C:W-1(V886_D-1) Preds: [G:W-1(V885_D-1) ] Succ: [T:W-1(V887_D-1) ] NODE_DESCR: T:W-1(V887_D-1) Preds: [C:W-1(V886_D-1) ] Succ: [C:W-1(V888_D-1) ] NODE_DESCR: C:W-1(V888_D-1) Preds: [T:W-1(V887_D-1) ] Succ: [A:W-1(V889_D-1) ] NODE_DESCR: A:W-1(V889_D-1) Preds: [C:W-1(V888_D-1) ] Succ: [T:W-1(V890_D-1) ] NODE_DESCR: T:W-1(V890_D-1) Preds: [A:W-1(V889_D-1) ] Succ: [C:W-1(V891_D-1) ] NODE_DESCR: C:W-1(V891_D-1) Preds: [T:W-1(V890_D-1) ] Succ: [A:W-1(V892_D-1) ] NODE_DESCR: A:W-1(V892_D-1) Preds: [C:W-1(V891_D-1) ] Succ: [G:W-1(V893_D-1) ] NODE_DESCR: G:W-1(V893_D-1) Preds: [A:W-1(V892_D-1) ] Succ: [C:W-1(V894_D-1) ] NODE_DESCR: C:W-1(V894_D-1) Preds: [G:W-1(V893_D-1) ] Succ: [A:W-1(V895_D-1) ] NODE_DESCR: A:W-1(V895_D-1) Preds: [C:W-1(V894_D-1) ] Succ: [A:W-1(V896_D-1) ] NODE_DESCR: A:W-1(V896_D-1) Preds: [A:W-1(V895_D-1) ] Succ: [G:W-1(V897_D-1) ] NODE_DESCR: G:W-1(V897_D-1) Preds: [A:W-1(V896_D-1) ] Succ: [A:W-1(V898_D-1) ] NODE_DESCR: A:W-1(V898_D-1) Preds: [G:W-1(V897_D-1) ] Succ: [A:W-1(V899_D-1) ] NODE_DESCR: A:W-1(V899_D-1) Preds: [A:W-1(V898_D-1) ] Succ: [G:W-1(V900_D-1) ] NODE_DESCR: G:W-1(V900_D-1) Preds: [A:W-1(V899_D-1) ] Succ: [A:W-1(V901_D-1) ] NODE_DESCR: A:W-1(V901_D-1) Preds: [G:W-1(V900_D-1) ] Succ: [A:W-1(V902_D-1) ] NODE_DESCR: A:W-1(V902_D-1) Preds: [A:W-1(V901_D-1) ] Succ: [A:W-1(V903_D-1) ] NODE_DESCR: A:W-1(V903_D-1) Preds: [A:W-1(V902_D-1) ] Succ: [T:W-1(V904_D-1) ] NODE_DESCR: T:W-1(V904_D-1) Preds: [A:W-1(V903_D-1) ] Succ: [C:W-1(V905_D-1) ] NODE_DESCR: C:W-1(V905_D-1) Preds: [T:W-1(V904_D-1) ] Succ: [T:W-1(V906_D-1) ] NODE_DESCR: T:W-1(V906_D-1) Preds: [C:W-1(V905_D-1) ] Succ: [T:W-1(V907_D-1) ] NODE_DESCR: T:W-1(V907_D-1) Preds: [T:W-1(V906_D-1) ] Succ: [T:W-1(V908_D-1) ] NODE_DESCR: T:W-1(V908_D-1) Preds: [T:W-1(V907_D-1) ] Succ: [C:W-1(V440_D-1) ] NODE_DESCR: AGAATACAAAATGCCTTCCTCCAG:W0(V945_D-1) Preds: [] Succ: [C:W-1(V946_D-1) ] NODE_DESCR: C:W-1(V946_D-1) Preds: [AGAATACAAAATGCCTTCCTCCAG:W0(V945_D-1) ] Succ: [C:W-1(V947_D-1) ] NODE_DESCR: C:W-1(V947_D-1) Preds: [C:W-1(V946_D-1) ] Succ: [T:W-1(V948_D-1) ] NODE_DESCR: T:W-1(V948_D-1) Preds: [C:W-1(V947_D-1) ] Succ: [C:W-1(V949_D-1) ] NODE_DESCR: C:W-1(V949_D-1) Preds: [T:W-1(V948_D-1) ] Succ: [A:W-1(V950_D-1) ] NODE_DESCR: A:W-1(V950_D-1) Preds: [C:W-1(V949_D-1) ] Succ: [T:W-1(V951_D-1) ] NODE_DESCR: T:W-1(V951_D-1) Preds: [A:W-1(V950_D-1) ] Succ: [C:W-1(V952_D-1) ] NODE_DESCR: C:W-1(V952_D-1) Preds: [T:W-1(V951_D-1) ] Succ: [A:W-1(V953_D-1) ] NODE_DESCR: A:W-1(V953_D-1) Preds: [C:W-1(V952_D-1) ] Succ: [G:W-1(V954_D-1) ] NODE_DESCR: G:W-1(V954_D-1) Preds: [A:W-1(V953_D-1) ] Succ: [C:W-1(V955_D-1) ] NODE_DESCR: C:W-1(V955_D-1) Preds: [G:W-1(V954_D-1) ] Succ: [A:W-1(V956_D-1) ] NODE_DESCR: A:W-1(V956_D-1) Preds: [C:W-1(V955_D-1) ] Succ: [G:W-1(V957_D-1) ] NODE_DESCR: G:W-1(V957_D-1) Preds: [A:W-1(V956_D-1) ] Succ: [G:W-1(V958_D-1) ] NODE_DESCR: G:W-1(V958_D-1) Preds: [G:W-1(V957_D-1) ] Succ: [A:W-1(V959_D-1) ] NODE_DESCR: A:W-1(V959_D-1) Preds: [G:W-1(V958_D-1) ] Succ: [A:W-1(V960_D-1) ] NODE_DESCR: A:W-1(V960_D-1) Preds: [A:W-1(V959_D-1) ] Succ: [G:W-1(V961_D-1) ] NODE_DESCR: G:W-1(V961_D-1) Preds: [A:W-1(V960_D-1) ] Succ: [A:W-1(V962_D-1) ] NODE_DESCR: A:W-1(V962_D-1) Preds: [G:W-1(V961_D-1) ] Succ: [A:W-1(V963_D-1) ] NODE_DESCR: A:W-1(V963_D-1) Preds: [A:W-1(V962_D-1) ] Succ: [A:W-1(V964_D-1) ] NODE_DESCR: A:W-1(V964_D-1) Preds: [A:W-1(V963_D-1) ] Succ: [T:W-1(V965_D-1) ] NODE_DESCR: T:W-1(V965_D-1) Preds: [A:W-1(V964_D-1) ] Succ: [C:W-1(V966_D-1) ] NODE_DESCR: C:W-1(V966_D-1) Preds: [T:W-1(V965_D-1) ] Succ: [T:W-1(V967_D-1) ] NODE_DESCR: T:W-1(V967_D-1) Preds: [C:W-1(V966_D-1) ] Succ: [T:W-1(V968_D-1) ] NODE_DESCR: T:W-1(V968_D-1) Preds: [T:W-1(V967_D-1) ] Succ: [T:W-1(V969_D-1) ] NODE_DESCR: T:W-1(V969_D-1) Preds: [T:W-1(V968_D-1) ] Succ: [C:W-1(V970_D-1) ] NODE_DESCR: C:W-1(V970_D-1) Preds: [T:W-1(V969_D-1) ] Succ: [T:W-1(V971_D-1) ] NODE_DESCR: T:W-1(V971_D-1) Preds: [C:W-1(V970_D-1) ] Succ: [T:W-1(V972_D-1) ] NODE_DESCR: T:W-1(V972_D-1) Preds: [T:W-1(V971_D-1) ] Succ: [T:W-1(V973_D-1) ] NODE_DESCR: T:W-1(V973_D-1) Preds: [T:W-1(V972_D-1) ] Succ: [C:W-1(V974_D-1) ] NODE_DESCR: C:W-1(V974_D-1) Preds: [T:W-1(V973_D-1) ] Succ: [C:W-1(V975_D-1) ] NODE_DESCR: C:W-1(V975_D-1) Preds: [C:W-1(V974_D-1) ] Succ: [A:W-1(V976_D-1) ] NODE_DESCR: A:W-1(V976_D-1) Preds: [C:W-1(V975_D-1) ] Succ: [A:W-1(V977_D-1) ] NODE_DESCR: A:W-1(V977_D-1) Preds: [A:W-1(V976_D-1) ] Succ: [G:W-1(V978_D-1) ] NODE_DESCR: G:W-1(V978_D-1) Preds: [A:W-1(V977_D-1) ] Succ: [T:W-1(V979_D-1) ] NODE_DESCR: T:W-1(V979_D-1) Preds: [G:W-1(V978_D-1) ] Succ: [A:W-1(V980_D-1) ] NODE_DESCR: A:W-1(V980_D-1) Preds: [T:W-1(V979_D-1) ] Succ: [G:W-1(V451_D-1) ] ORIGINAL GRAPH NODE: GGCCACACGATGGCTTATCACGTC with ID: 380 ORIGINAL GRAPH NODE: GCCACACGATGGCTTATCACGTCC with ID: 381 ORIGINAL GRAPH NODE: CCACACGATGGCTTATCACGTCCA with ID: 382 ORIGINAL GRAPH NODE: CACACGATGGCTTATCACGTCCAC with ID: 383 ORIGINAL GRAPH NODE: ACACGATGGCTTATCACGTCCACA with ID: 384 ORIGINAL GRAPH NODE: CACGATGGCTTATCACGTCCACAT with ID: 385 ORIGINAL GRAPH NODE: ACGATGGCTTATCACGTCCACATT with ID: 386 ORIGINAL GRAPH NODE: CGATGGCTTATCACGTCCACATTT with ID: 387 ORIGINAL GRAPH NODE: GATGGCTTATCACGTCCACATTTC with ID: 388 ORIGINAL GRAPH NODE: ATGGCTTATCACGTCCACATTTCT with ID: 389 ORIGINAL GRAPH NODE: TGGCTTATCACGTCCACATTTCTA with ID: 390 ORIGINAL GRAPH NODE: GGCTTATCACGTCCACATTTCTAC with ID: 391 ORIGINAL GRAPH NODE: GCTTATCACGTCCACATTTCTACT with ID: 392 ORIGINAL GRAPH NODE: CTTATCACGTCCACATTTCTACTG with ID: 393 ORIGINAL GRAPH NODE: TTATCACGTCCACATTTCTACTGG with ID: 394 ORIGINAL GRAPH NODE: TATCACGTCCACATTTCTACTGGC with ID: 395 ORIGINAL GRAPH NODE: ATCACGTCCACATTTCTACTGGCT with ID: 396 ORIGINAL GRAPH NODE: TCACGTCCACATTTCTACTGGCTA with ID: 397 ORIGINAL GRAPH NODE: CACGTCCACATTTCTACTGGCTAC with ID: 398 ORIGINAL GRAPH NODE: ACGTCCACATTTCTACTGGCTACA with ID: 399 ORIGINAL GRAPH NODE: CGTCCACATTTCTACTGGCTACAA with ID: 400 ORIGINAL GRAPH NODE: GTCCACATTTCTACTGGCTACAAA with ID: 401 ORIGINAL GRAPH NODE: TCCACATTTCTACTGGCTACAAAC with ID: 402 ORIGINAL GRAPH NODE: CCACATTTCTACTGGCTACAAACA with ID: 403 ORIGINAL GRAPH NODE: CACATTTCTACTGGCTACAAACAG with ID: 404 ORIGINAL GRAPH NODE: ACATTTCTACTGGCTACAAACAGA with ID: 405 ORIGINAL GRAPH NODE: CATTTCTACTGGCTACAAACAGAC with ID: 406 ORIGINAL GRAPH NODE: ATTTCTACTGGCTACAAACAGACT with ID: 407 ORIGINAL GRAPH NODE: TTTCTACTGGCTACAAACAGACTT with ID: 408 ORIGINAL GRAPH NODE: TTCTACTGGCTACAAACAGACTTC with ID: 409 ORIGINAL GRAPH NODE: TCTACTGGCTACAAACAGACTTCC with ID: 410 ORIGINAL GRAPH NODE: CTACTGGCTACAAACAGACTTCCT with ID: 411 ORIGINAL GRAPH NODE: TACTGGCTACAAACAGACTTCCTC with ID: 412 ORIGINAL GRAPH NODE: ACTGGCTACAAACAGACTTCCTCA with ID: 413 ORIGINAL GRAPH NODE: CTGGCTACAAACAGACTTCCTCAA with ID: 414 ORIGINAL GRAPH NODE: TGGCTACAAACAGACTTCCTCAAG with ID: 415 ORIGINAL GRAPH NODE: GGCTACAAACAGACTTCCTCAAGC with ID: 416 ORIGINAL GRAPH NODE: GCTACAAACAGACTTCCTCAAGCC with ID: 417 ORIGINAL GRAPH NODE: CTACAAACAGACTTCCTCAAGCCT with ID: 418 ORIGINAL GRAPH NODE: TACAAACAGACTTCCTCAAGCCTC with ID: 419 ORIGINAL GRAPH NODE: ACAAACAGACTTCCTCAAGCCTCA with ID: 420 ORIGINAL GRAPH NODE: CAAACAGACTTCCTCAAGCCTCAT with ID: 421 ORIGINAL GRAPH NODE: AAACAGACTTCCTCAAGCCTCATC with ID: 422 ORIGINAL GRAPH NODE: AACAGACTTCCTCAAGCCTCATCA with ID: 423 ORIGINAL GRAPH NODE: ACAGACTTCCTCAAGCCTCATCAG with ID: 424 ORIGINAL GRAPH NODE: CAGACTTCCTCAAGCCTCATCAGC with ID: 425 ORIGINAL GRAPH NODE: AGACTTCCTCAAGCCTCATCAGCA with ID: 426 ORIGINAL GRAPH NODE: GACTTCCTCAAGCCTCATCAGCAA with ID: 427 ORIGINAL GRAPH NODE: ACTTCCTCAAGCCTCATCAGCAAG with ID: 428 ORIGINAL GRAPH NODE: CTTCCTCAAGCCTCATCAGCAAGA with ID: 429 ORIGINAL GRAPH NODE: TTCCTCAAGCCTCATCAGCAAGAA with ID: 430 ORIGINAL GRAPH NODE: TCCTCAAGCCTCATCAGCAAGAAG with ID: 431 ORIGINAL GRAPH NODE: CCTCAAGCCTCATCAGCAAGAAGA with ID: 432 ORIGINAL GRAPH NODE: CTCAAGCCTCATCAGCAAGAAGAA with ID: 433 ORIGINAL GRAPH NODE: TCAAGCCTCATCAGCAAGAAGAAA with ID: 434 ORIGINAL GRAPH NODE: CAAGCCTCATCAGCAAGAAGAAAT with ID: 435 ORIGINAL GRAPH NODE: AAGCCTCATCAGCAAGAAGAAATC with ID: 436 ORIGINAL GRAPH NODE: AGCCTCATCAGCAAGAAGAAATCT with ID: 437 ORIGINAL GRAPH NODE: GCCTCATCAGCAAGAAGAAATCTT with ID: 438 ORIGINAL GRAPH NODE: CCTCATCAGCAAGAAGAAATCTTT with ID: 439 ORIGINAL GRAPH NODE: CTCATCAGCAAGAAGAAATCTTTC with ID: 440 ORIGINAL GRAPH NODE: TCATCAGCAAGAAGAAATCTTTCT with ID: 441 ORIGINAL GRAPH NODE: CATCAGCAAGAAGAAATCTTTCTT with ID: 442 ORIGINAL GRAPH NODE: ATCAGCAAGAAGAAATCTTTCTTT with ID: 443 ORIGINAL GRAPH NODE: TCAGCAAGAAGAAATCTTTCTTTC with ID: 444 ORIGINAL GRAPH NODE: CAGCAAGAAGAAATCTTTCTTTCC with ID: 445 ORIGINAL GRAPH NODE: AGCAAGAAGAAATCTTTCTTTCCA with ID: 446 ORIGINAL GRAPH NODE: GCAAGAAGAAATCTTTCTTTCCAA with ID: 447 ORIGINAL GRAPH NODE: CAAGAAGAAATCTTTCTTTCCAAG with ID: 448 ORIGINAL GRAPH NODE: AAGAAGAAATCTTTCTTTCCAAGT with ID: 449 ORIGINAL GRAPH NODE: AGAAGAAATCTTTCTTTCCAAGTA with ID: 450 ORIGINAL GRAPH NODE: GAAGAAATCTTTCTTTCCAAGTAG with ID: 451 ORIGINAL GRAPH NODE: AAGAAATCTTTCTTTCCAAGTAGT with ID: 452 ORIGINAL GRAPH NODE: AGAAATCTTTCTTTCCAAGTAGTG with ID: 453 ORIGINAL GRAPH NODE: GAAATCTTTCTTTCCAAGTAGTGT with ID: 454 ORIGINAL GRAPH NODE: AAATCTTTCTTTCCAAGTAGTGTC with ID: 455 ORIGINAL GRAPH NODE: AATCTTTCTTTCCAAGTAGTGTCT with ID: 456 ORIGINAL GRAPH NODE: ATCTTTCTTTCCAAGTAGTGTCTT with ID: 457 ORIGINAL GRAPH NODE: TCTTTCTTTCCAAGTAGTGTCTTA with ID: 458 ORIGINAL GRAPH NODE: CTTTCTTTCCAAGTAGTGTCTTAA with ID: 459 ORIGINAL GRAPH NODE: TTTCTTTCCAAGTAGTGTCTTAAC with ID: 460 ORIGINAL GRAPH NODE: TTCTTTCCAAGTAGTGTCTTAACT with ID: 461 ORIGINAL GRAPH NODE: TCTTTCCAAGTAGTGTCTTAACTC with ID: 462 ORIGINAL GRAPH NODE: CTTTCCAAGTAGTGTCTTAACTCA with ID: 463 ORIGINAL GRAPH NODE: TTTCCAAGTAGTGTCTTAACTCAG with ID: 464 ORIGINAL GRAPH NODE: TTCCAAGTAGTGTCTTAACTCAGG with ID: 465 ORIGINAL GRAPH NODE: TCCAAGTAGTGTCTTAACTCAGGA with ID: 466 ORIGINAL GRAPH NODE: CCAAGTAGTGTCTTAACTCAGGAG with ID: 467 ORIGINAL GRAPH NODE: CAAGTAGTGTCTTAACTCAGGAGA with ID: 468 ORIGINAL GRAPH NODE: AAGTAGTGTCTTAACTCAGGAGAT with ID: 469 ORIGINAL GRAPH NODE: AGTAGTGTCTTAACTCAGGAGATC with ID: 470 ORIGINAL GRAPH NODE: GTAGTGTCTTAACTCAGGAGATCA with ID: 471 ORIGINAL GRAPH NODE: TAGTGTCTTAACTCAGGAGATCAT with ID: 472 ORIGINAL GRAPH NODE: AGTGTCTTAACTCAGGAGATCATG with ID: 473 ORIGINAL GRAPH NODE: GTGTCTTAACTCAGGAGATCATGG with ID: 474 ORIGINAL GRAPH NODE: TGTCTTAACTCAGGAGATCATGGT with ID: 475 ORIGINAL GRAPH NODE: GTCTTAACTCAGGAGATCATGGTA with ID: 476 ORIGINAL GRAPH NODE: TCTTAACTCAGGAGATCATGGTAG with ID: 477 ORIGINAL GRAPH NODE: CTTAACTCAGGAGATCATGGTAGG with ID: 478 ORIGINAL GRAPH NODE: TTAACTCAGGAGATCATGGTAGGG with ID: 479 ORIGINAL GRAPH NODE: TAACTCAGGAGATCATGGTAGGGA with ID: 480 ORIGINAL GRAPH NODE: AACTCAGGAGATCATGGTAGGGAA with ID: 481 ORIGINAL GRAPH NODE: ACTCAGGAGATCATGGTAGGGAAG with ID: 482 ORIGINAL GRAPH NODE: CTCAGGAGATCATGGTAGGGAAGG with ID: 483 ORIGINAL GRAPH NODE: TCAGGAGATCATGGTAGGGAAGGG with ID: 484 ORIGINAL GRAPH NODE: CAGGAGATCATGGTAGGGAAGGGG with ID: 485 ORIGINAL GRAPH NODE: AGGAGATCATGGTAGGGAAGGGGT with ID: 486 ORIGINAL GRAPH NODE: GGAGATCATGGTAGGGAAGGGGTC with ID: 487 ORIGINAL GRAPH NODE: GAGATCATGGTAGGGAAGGGGTCA with ID: 488 ORIGINAL GRAPH NODE: AGATCATGGTAGGGAAGGGGTCAG with ID: 489 ORIGINAL GRAPH NODE: GATCATGGTAGGGAAGGGGTCAGG with ID: 490 ORIGINAL GRAPH NODE: ATCATGGTAGGGAAGGGGTCAGGC with ID: 491 ORIGINAL GRAPH NODE: TCATGGTAGGGAAGGGGTCAGGCC with ID: 492 ORIGINAL GRAPH NODE: CATGGTAGGGAAGGGGTCAGGCCA with ID: 493 ORIGINAL GRAPH NODE: ATGGTAGGGAAGGGGTCAGGCCAC with ID: 494 ORIGINAL GRAPH NODE: TGGTAGGGAAGGGGTCAGGCCACT with ID: 495 ORIGINAL GRAPH NODE: GGTAGGGAAGGGGTCAGGCCACTT with ID: 496 ORIGINAL GRAPH NODE: GTAGGGAAGGGGTCAGGCCACTTC with ID: 497 ORIGINAL GRAPH NODE: TAGGGAAGGGGTCAGGCCACTTCA with ID: 498 ORIGINAL GRAPH NODE: AGGGAAGGGGTCAGGCCACTTCAC with ID: 499 ORIGINAL GRAPH NODE: GGGAAGGGGTCAGGCCACTTCACA with ID: 500 ORIGINAL GRAPH NODE: GGAAGGGGTCAGGCCACTTCACAA with ID: 501 ORIGINAL GRAPH NODE: GAAGGGGTCAGGCCACTTCACAAG with ID: 502 ORIGINAL GRAPH NODE: AAGGGGTCAGGCCACTTCACAAGG with ID: 503 ORIGINAL GRAPH NODE: AGGGGTCAGGCCACTTCACAAGGA with ID: 504 ORIGINAL GRAPH NODE: GGGGTCAGGCCACTTCACAAGGAG with ID: 505 ORIGINAL GRAPH NODE: GGGTCAGGCCACTTCACAAGGAGC with ID: 506 ORIGINAL GRAPH NODE: GGTCAGGCCACTTCACAAGGAGCA with ID: 507 ORIGINAL GRAPH NODE: GTCAGGCCACTTCACAAGGAGCAG with ID: 508 ORIGINAL GRAPH NODE: TCAGGCCACTTCACAAGGAGCAGA with ID: 509 ORIGINAL GRAPH NODE: CAGGCCACTTCACAAGGAGCAGAG with ID: 510 ORIGINAL GRAPH NODE: AGGCCACTTCACAAGGAGCAGAGT with ID: 511 ORIGINAL GRAPH NODE: GGCCACTTCACAAGGAGCAGAGTT with ID: 512 ORIGINAL GRAPH NODE: GCCACTTCACAAGGAGCAGAGTTA with ID: 513 ORIGINAL GRAPH NODE: CCACTTCACAAGGAGCAGAGTTAG with ID: 514 ORIGINAL GRAPH NODE: CACTTCACAAGGAGCAGAGTTAGG with ID: 515 ORIGINAL GRAPH NODE: ACTTCACAAGGAGCAGAGTTAGGA with ID: 516 ORIGINAL GRAPH NODE: CTTCACAAGGAGCAGAGTTAGGAA with ID: 517 ORIGINAL GRAPH NODE: TTCACAAGGAGCAGAGTTAGGAAG with ID: 518 ORIGINAL GRAPH NODE: TCACAAGGAGCAGAGTTAGGAAGC with ID: 519 ORIGINAL GRAPH NODE: CACAAGGAGCAGAGTTAGGAAGCT with ID: 520 ORIGINAL GRAPH NODE: ACAAGGAGCAGAGTTAGGAAGCTC with ID: 521 ORIGINAL GRAPH NODE: CAAGGAGCAGAGTTAGGAAGCTCC with ID: 522 ORIGINAL GRAPH NODE: AAGGAGCAGAGTTAGGAAGCTCCC with ID: 523 ORIGINAL GRAPH NODE: AGGAGCAGAGTTAGGAAGCTCCCT with ID: 524 ORIGINAL GRAPH NODE: GGAGCAGAGTTAGGAAGCTCCCTG with ID: 525 ORIGINAL GRAPH NODE: GAGCAGAGTTAGGAAGCTCCCTGA with ID: 526 ORIGINAL GRAPH NODE: AGCAGAGTTAGGAAGCTCCCTGAG with ID: 527 ORIGINAL GRAPH NODE: GCAGAGTTAGGAAGCTCCCTGAGC with ID: 528 ORIGINAL GRAPH NODE: CAGAGTTAGGAAGCTCCCTGAGCA with ID: 529 ORIGINAL GRAPH NODE: AGAGTTAGGAAGCTCCCTGAGCAC with ID: 530 ORIGINAL GRAPH NODE: GAGTTAGGAAGCTCCCTGAGCACT with ID: 531 ORIGINAL GRAPH NODE: AGTTAGGAAGCTCCCTGAGCACTC with ID: 532 ORIGINAL GRAPH NODE: GTTAGGAAGCTCCCTGAGCACTCT with ID: 533 ORIGINAL GRAPH NODE: TTAGGAAGCTCCCTGAGCACTCTG with ID: 534 ORIGINAL GRAPH NODE: TAGGAAGCTCCCTGAGCACTCTGA with ID: 535 ORIGINAL GRAPH NODE: AGGAAGCTCCCTGAGCACTCTGAA with ID: 536 ORIGINAL GRAPH NODE: GGAAGCTCCCTGAGCACTCTGAAC with ID: 537 ORIGINAL GRAPH NODE: GAAGCTCCCTGAGCACTCTGAACC with ID: 538 ORIGINAL GRAPH NODE: AAGCTCCCTGAGCACTCTGAACCC with ID: 539 ORIGINAL GRAPH NODE: AGCTCCCTGAGCACTCTGAACCCT with ID: 540 ORIGINAL GRAPH NODE: GCTCCCTGAGCACTCTGAACCCTG with ID: 541 ORIGINAL GRAPH NODE: CTCCCTGAGCACTCTGAACCCTGT with ID: 542 ORIGINAL GRAPH NODE: TCCCTGAGCACTCTGAACCCTGTG with ID: 543 ORIGINAL GRAPH NODE: CCCTGAGCACTCTGAACCCTGTGA with ID: 544 ORIGINAL GRAPH NODE: CCTGAGCACTCTGAACCCTGTGAG with ID: 545 ORIGINAL GRAPH NODE: CTGAGCACTCTGAACCCTGTGAGG with ID: 546 ORIGINAL GRAPH NODE: TGAGCACTCTGAACCCTGTGAGGC with ID: 547 ORIGINAL GRAPH NODE: GAGCACTCTGAACCCTGTGAGGCA with ID: 548 ORIGINAL GRAPH NODE: AGCACTCTGAACCCTGTGAGGCAA with ID: 549 ORIGINAL GRAPH NODE: GCACTCTGAACCCTGTGAGGCAAG with ID: 550 ORIGINAL GRAPH NODE: CACTCTGAACCCTGTGAGGCAAGT with ID: 551 ORIGINAL GRAPH NODE: ACTCTGAACCCTGTGAGGCAAGTC with ID: 552 ORIGINAL GRAPH NODE: CTCTGAACCCTGTGAGGCAAGTCC with ID: 553 ORIGINAL GRAPH NODE: TCTGAACCCTGTGAGGCAAGTCCA with ID: 554 ORIGINAL GRAPH NODE: CTGAACCCTGTGAGGCAAGTCCAC with ID: 555 ORIGINAL GRAPH NODE: TGAACCCTGTGAGGCAAGTCCACC with ID: 556 ORIGINAL GRAPH NODE: GAACCCTGTGAGGCAAGTCCACCA with ID: 557 ORIGINAL GRAPH NODE: AACCCTGTGAGGCAAGTCCACCAC with ID: 558 ORIGINAL GRAPH NODE: ACCCTGTGAGGCAAGTCCACCACC with ID: 559 ORIGINAL GRAPH NODE: CCCTGTGAGGCAAGTCCACCACCA with ID: 560 ORIGINAL GRAPH NODE: CCTGTGAGGCAAGTCCACCACCAG with ID: 561 ORIGINAL GRAPH NODE: CTGTGAGGCAAGTCCACCACCAGC with ID: 562 ORIGINAL GRAPH NODE: TGTGAGGCAAGTCCACCACCAGCG with ID: 563 ORIGINAL GRAPH NODE: GTGAGGCAAGTCCACCACCAGCGT with ID: 564 ORIGINAL GRAPH NODE: TGAGGCAAGTCCACCACCAGCGTA with ID: 565 ORIGINAL GRAPH NODE: GAGGCAAGTCCACCACCAGCGTAT with ID: 566 ORIGINAL GRAPH NODE: AGGCAAGTCCACCACCAGCGTATC with ID: 567 ORIGINAL GRAPH NODE: GGCAAGTCCACCACCAGCGTATCT with ID: 568 ORIGINAL GRAPH NODE: GCAAGTCCACCACCAGCGTATCTA with ID: 569 ORIGINAL GRAPH NODE: CAAGTCCACCACCAGCGTATCTAG with ID: 570 ORIGINAL GRAPH NODE: AAGTCCACCACCAGCGTATCTAGA with ID: 571 ORIGINAL GRAPH NODE: AGTCCACCACCAGCGTATCTAGAC with ID: 572 ORIGINAL GRAPH NODE: GTCCACCACCAGCGTATCTAGACC with ID: 573 ORIGINAL GRAPH NODE: TCCACCACCAGCGTATCTAGACCC with ID: 574 ORIGINAL GRAPH NODE: CCACCACCAGCGTATCTAGACCCA with ID: 575 ORIGINAL GRAPH NODE: CACCACCAGCGTATCTAGACCCAG with ID: 576 ORIGINAL GRAPH NODE: ACCACCAGCGTATCTAGACCCAGG with ID: 577 ORIGINAL GRAPH NODE: CCACCAGCGTATCTAGACCCAGGC with ID: 578 ORIGINAL GRAPH NODE: CACCAGCGTATCTAGACCCAGGCC with ID: 579 ORIGINAL GRAPH NODE: ACCAGCGTATCTAGACCCAGGCCA with ID: 580 ORIGINAL GRAPH NODE: CCAGCGTATCTAGACCCAGGCCAT with ID: 581 ORIGINAL GRAPH NODE: CAGCGTATCTAGACCCAGGCCATC with ID: 582 ORIGINAL GRAPH NODE: AGCGTATCTAGACCCAGGCCATCT with ID: 583 ORIGINAL GRAPH NODE: GCGTATCTAGACCCAGGCCATCTA with ID: 584 ORIGINAL GRAPH NODE: CGTATCTAGACCCAGGCCATCTAA with ID: 585 ORIGINAL GRAPH NODE: GTATCTAGACCCAGGCCATCTAAT with ID: 586 ORIGINAL GRAPH NODE: TATCTAGACCCAGGCCATCTAATA with ID: 587 ORIGINAL GRAPH NODE: ATCTAGACCCAGGCCATCTAATAA with ID: 588 ORIGINAL GRAPH NODE: TCTAGACCCAGGCCATCTAATAAA with ID: 589 ORIGINAL GRAPH NODE: CTAGACCCAGGCCATCTAATAAAG with ID: 590 ORIGINAL GRAPH NODE: TAGACCCAGGCCATCTAATAAAGG with ID: 591 ORIGINAL GRAPH NODE: AGACCCAGGCCATCTAATAAAGGA with ID: 592 ORIGINAL GRAPH NODE: GACCCAGGCCATCTAATAAAGGAA with ID: 593 ORIGINAL GRAPH NODE: ACCCAGGCCATCTAATAAAGGAAA with ID: 594 ORIGINAL GRAPH NODE: CCCAGGCCATCTAATAAAGGAAAA with ID: 595 ORIGINAL GRAPH NODE: CCAGGCCATCTAATAAAGGAAAAC with ID: 596 ORIGINAL GRAPH NODE: CAGGCCATCTAATAAAGGAAAACT with ID: 597 ORIGINAL GRAPH NODE: AGGCCATCTAATAAAGGAAAACTG with ID: 598 ORIGINAL GRAPH NODE: GGCCATCTAATAAAGGAAAACTGC with ID: 599 ORIGINAL GRAPH NODE: GCCATCTAATAAAGGAAAACTGCA with ID: 600 ORIGINAL GRAPH NODE: CCATCTAATAAAGGAAAACTGCAT with ID: 601 ORIGINAL GRAPH NODE: CATCTAATAAAGGAAAACTGCATC with ID: 602 ORIGINAL GRAPH NODE: ATCTAATAAAGGAAAACTGCATCT with ID: 603 ORIGINAL GRAPH NODE: TCTAATAAAGGAAAACTGCATCTT with ID: 604 ORIGINAL GRAPH NODE: CTAATAAAGGAAAACTGCATCTTT with ID: 605 ORIGINAL GRAPH NODE: TAATAAAGGAAAACTGCATCTTTG with ID: 606 ORIGINAL GRAPH NODE: AATAAAGGAAAACTGCATCTTTGC with ID: 607 ORIGINAL GRAPH NODE: ATAAAGGAAAACTGCATCTTTGCC with ID: 608 ORIGINAL GRAPH NODE: TAAAGGAAAACTGCATCTTTGCCC with ID: 609 ORIGINAL GRAPH NODE: AAAGGAAAACTGCATCTTTGCCCA with ID: 610 ORIGINAL GRAPH NODE: AAGGAAAACTGCATCTTTGCCCAC with ID: 611 ORIGINAL GRAPH NODE: AGGAAAACTGCATCTTTGCCCACA with ID: 612 ORIGINAL GRAPH NODE: GGAAAACTGCATCTTTGCCCACAT with ID: 613 ORIGINAL GRAPH NODE: GAAAACTGCATCTTTGCCCACATG with ID: 614 ORIGINAL GRAPH NODE: AAAACTGCATCTTTGCCCACATGA with ID: 615 ORIGINAL GRAPH NODE: AAACTGCATCTTTGCCCACATGAT with ID: 616 ORIGINAL GRAPH NODE: AACTGCATCTTTGCCCACATGATG with ID: 617 ORIGINAL GRAPH NODE: ACTGCATCTTTGCCCACATGATGC with ID: 618 ORIGINAL GRAPH NODE: CTGCATCTTTGCCCACATGATGCT with ID: 619 ORIGINAL GRAPH NODE: TGCATCTTTGCCCACATGATGCTT with ID: 620 ORIGINAL GRAPH NODE: GCATCTTTGCCCACATGATGCTTG with ID: 621 ORIGINAL GRAPH NODE: CATCTTTGCCCACATGATGCTTGG with ID: 622 ORIGINAL GRAPH NODE: ATCTTTGCCCACATGATGCTTGGT with ID: 623 ORIGINAL GRAPH NODE: TCTTTGCCCACATGATGCTTGGTT with ID: 624 ORIGINAL GRAPH NODE: CTTTGCCCACATGATGCTTGGTTA with ID: 625 ORIGINAL GRAPH NODE: TTTGCCCACATGATGCTTGGTTAA with ID: 626 ORIGINAL GRAPH NODE: TTGCCCACATGATGCTTGGTTAAG with ID: 627 ORIGINAL GRAPH NODE: TGCCCACATGATGCTTGGTTAAGA with ID: 628 ORIGINAL GRAPH NODE: GCCCACATGATGCTTGGTTAAGAC with ID: 629 ORIGINAL GRAPH NODE: CCCACATGATGCTTGGTTAAGACA with ID: 630 ORIGINAL GRAPH NODE: CCACATGATGCTTGGTTAAGACAA with ID: 631 ORIGINAL GRAPH NODE: CACATGATGCTTGGTTAAGACAAG with ID: 632 ORIGINAL GRAPH NODE: ACATGATGCTTGGTTAAGACAAGG with ID: 633 ORIGINAL GRAPH NODE: CATGATGCTTGGTTAAGACAAGGG with ID: 634 ORIGINAL GRAPH NODE: ATGATGCTTGGTTAAGACAAGGGG with ID: 635 ORIGINAL GRAPH NODE: TGATGCTTGGTTAAGACAAGGGGT with ID: 636 ORIGINAL GRAPH NODE: GATGCTTGGTTAAGACAAGGGGTT with ID: 637 ORIGINAL GRAPH NODE: ATGCTTGGTTAAGACAAGGGGTTA with ID: 638 ORIGINAL GRAPH NODE: TGCTTGGTTAAGACAAGGGGTTAG with ID: 639 ORIGINAL GRAPH NODE: GCTTGGTTAAGACAAGGGGTTAGT with ID: 640 ORIGINAL GRAPH NODE: CTTGGTTAAGACAAGGGGTTAGTG with ID: 641 ORIGINAL GRAPH NODE: TTGGTTAAGACAAGGGGTTAGTGA with ID: 642 ORIGINAL GRAPH NODE: TGGTTAAGACAAGGGGTTAGTGAC with ID: 643 ORIGINAL GRAPH NODE: GGTTAAGACAAGGGGTTAGTGACA with ID: 644 ORIGINAL GRAPH NODE: GTTAAGACAAGGGGTTAGTGACAA with ID: 645 ORIGINAL GRAPH NODE: TTAAGACAAGGGGTTAGTGACAAA with ID: 646 ORIGINAL GRAPH NODE: TAAGACAAGGGGTTAGTGACAAAG with ID: 647 ORIGINAL GRAPH NODE: AAGACAAGGGGTTAGTGACAAAGT with ID: 648 ORIGINAL GRAPH NODE: AGACAAGGGGTTAGTGACAAAGTA with ID: 649 ORIGINAL GRAPH NODE: GACAAGGGGTTAGTGACAAAGTAA with ID: 650 ORIGINAL GRAPH NODE: ACAAGGGGTTAGTGACAAAGTAAA with ID: 651 ORIGINAL GRAPH NODE: CAAGGGGTTAGTGACAAAGTAAAG with ID: 652 ORIGINAL GRAPH NODE: AAGGGGTTAGTGACAAAGTAAAGA with ID: 653 ORIGINAL GRAPH NODE: AGGGGTTAGTGACAAAGTAAAGAG with ID: 654 ORIGINAL GRAPH NODE: GGGGTTAGTGACAAAGTAAAGAGG with ID: 655 ORIGINAL GRAPH NODE: GGGTTAGTGACAAAGTAAAGAGGA with ID: 656 ORIGINAL GRAPH NODE: GGTTAGTGACAAAGTAAAGAGGAT with ID: 657 ORIGINAL GRAPH NODE: GTTAGTGACAAAGTAAAGAGGATG with ID: 658 ORIGINAL GRAPH NODE: TTAGTGACAAAGTAAAGAGGATGA with ID: 659 ORIGINAL GRAPH NODE: TAGTGACAAAGTAAAGAGGATGAC with ID: 660 ORIGINAL GRAPH NODE: AGTGACAAAGTAAAGAGGATGACA with ID: 661 ORIGINAL GRAPH NODE: GTGACAAAGTAAAGAGGATGACAG with ID: 662 ORIGINAL GRAPH NODE: TGACAAAGTAAAGAGGATGACAGA with ID: 663 ORIGINAL GRAPH NODE: GACAAAGTAAAGAGGATGACAGAC with ID: 664 ORIGINAL GRAPH NODE: ACAAAGTAAAGAGGATGACAGACT with ID: 665 ORIGINAL GRAPH NODE: CAAAGTAAAGAGGATGACAGACTC with ID: 666 ORIGINAL GRAPH NODE: AAAGTAAAGAGGATGACAGACTCT with ID: 667 ORIGINAL GRAPH NODE: AAGTAAAGAGGATGACAGACTCTC with ID: 668 ORIGINAL GRAPH NODE: AGTAAAGAGGATGACAGACTCTCT with ID: 669 ORIGINAL GRAPH NODE: GTAAAGAGGATGACAGACTCTCTA with ID: 670 ORIGINAL GRAPH NODE: TAAAGAGGATGACAGACTCTCTAA with ID: 671 ORIGINAL GRAPH NODE: AAAGAGGATGACAGACTCTCTAAG with ID: 672 ORIGINAL GRAPH NODE: AAGAGGATGACAGACTCTCTAAGG with ID: 673 ORIGINAL GRAPH NODE: AGAGGATGACAGACTCTCTAAGGG with ID: 674 ORIGINAL GRAPH NODE: GAGGATGACAGACTCTCTAAGGGA with ID: 675 ORIGINAL GRAPH NODE: AGGATGACAGACTCTCTAAGGGAC with ID: 676 ORIGINAL GRAPH NODE: GGATGACAGACTCTCTAAGGGACA with ID: 677 ORIGINAL GRAPH NODE: GATGACAGACTCTCTAAGGGACAT with ID: 678 ORIGINAL GRAPH NODE: ATGACAGACTCTCTAAGGGACATA with ID: 679 ORIGINAL GRAPH NODE: TGACAGACTCTCTAAGGGACATAT with ID: 680 ORIGINAL GRAPH NODE: GACAGACTCTCTAAGGGACATATG with ID: 681 ORIGINAL GRAPH NODE: ACAGACTCTCTAAGGGACATATGG with ID: 682 ORIGINAL GRAPH NODE: CAGACTCTCTAAGGGACATATGGG with ID: 683 ORIGINAL GRAPH NODE: AGACTCTCTAAGGGACATATGGGA with ID: 684 ORIGINAL GRAPH NODE: GACTCTCTAAGGGACATATGGGAG with ID: 685 ORIGINAL GRAPH NODE: ACTCTCTAAGGGACATATGGGAGC with ID: 686 ORIGINAL GRAPH NODE: CTCTCTAAGGGACATATGGGAGCT with ID: 687 ORIGINAL GRAPH NODE: TCTCTAAGGGACATATGGGAGCTA with ID: 688 ORIGINAL GRAPH NODE: CTCTAAGGGACATATGGGAGCTAC with ID: 689 ORIGINAL GRAPH NODE: TCTAAGGGACATATGGGAGCTACA with ID: 690 ORIGINAL GRAPH NODE: CTAAGGGACATATGGGAGCTACAT with ID: 691 ORIGINAL GRAPH NODE: TAAGGGACATATGGGAGCTACATA with ID: 692 ORIGINAL GRAPH NODE: AAGGGACATATGGGAGCTACATAG with ID: 693 ORIGINAL GRAPH NODE: AGGGACATATGGGAGCTACATAGC with ID: 694 ORIGINAL GRAPH NODE: GGGACATATGGGAGCTACATAGCC with ID: 695 ORIGINAL GRAPH NODE: GGACATATGGGAGCTACATAGCCA with ID: 696 ORIGINAL GRAPH NODE: GACATATGGGAGCTACATAGCCAG with ID: 697 ORIGINAL GRAPH NODE: ACATATGGGAGCTACATAGCCAGC with ID: 698 ORIGINAL GRAPH NODE: CATATGGGAGCTACATAGCCAGCC with ID: 699 ORIGINAL GRAPH NODE: ATATGGGAGCTACATAGCCAGCCC with ID: 700 ORIGINAL GRAPH NODE: TATGGGAGCTACATAGCCAGCCCC with ID: 701 ORIGINAL GRAPH NODE: ATGGGAGCTACATAGCCAGCCCCG with ID: 702 ORIGINAL GRAPH NODE: TGGGAGCTACATAGCCAGCCCCGT with ID: 703 ORIGINAL GRAPH NODE: GGGAGCTACATAGCCAGCCCCGTG with ID: 704 ORIGINAL GRAPH NODE: GGAGCTACATAGCCAGCCCCGTGG with ID: 705 ORIGINAL GRAPH NODE: GAGCTACATAGCCAGCCCCGTGGA with ID: 706 ORIGINAL GRAPH NODE: AGCTACATAGCCAGCCCCGTGGAG with ID: 707 ORIGINAL GRAPH NODE: GCTACATAGCCAGCCCCGTGGAGG with ID: 708 ORIGINAL GRAPH NODE: CTACATAGCCAGCCCCGTGGAGGG with ID: 709 ORIGINAL GRAPH NODE: TACATAGCCAGCCCCGTGGAGGGA with ID: 710 ORIGINAL GRAPH NODE: ACATAGCCAGCCCCGTGGAGGGAG with ID: 711 ORIGINAL GRAPH NODE: CATAGCCAGCCCCGTGGAGGGAGC with ID: 712 ORIGINAL GRAPH NODE: ATAGCCAGCCCCGTGGAGGGAGCC with ID: 713 ORIGINAL GRAPH NODE: TAGCCAGCCCCGTGGAGGGAGCCA with ID: 714 ORIGINAL GRAPH NODE: AGCCAGCCCCGTGGAGGGAGCCAC with ID: 715 ORIGINAL GRAPH NODE: GCCAGCCCCGTGGAGGGAGCCACC with ID: 716 ORIGINAL GRAPH NODE: CCAGCCCCGTGGAGGGAGCCACCA with ID: 717 ORIGINAL GRAPH NODE: CAGCCCCGTGGAGGGAGCCACCAG with ID: 718 ORIGINAL GRAPH NODE: AGCCCCGTGGAGGGAGCCACCAGC with ID: 719 ORIGINAL GRAPH NODE: GCCCCGTGGAGGGAGCCACCAGCC with ID: 720 ORIGINAL GRAPH NODE: CCCCGTGGAGGGAGCCACCAGCCA with ID: 721 ORIGINAL GRAPH NODE: CCCGTGGAGGGAGCCACCAGCCAC with ID: 722 ORIGINAL GRAPH NODE: CCGTGGAGGGAGCCACCAGCCACA with ID: 723 ORIGINAL GRAPH NODE: CGTGGAGGGAGCCACCAGCCACAG with ID: 724 ORIGINAL GRAPH NODE: GTGGAGGGAGCCACCAGCCACAGG with ID: 725 ORIGINAL GRAPH NODE: TGGAGGGAGCCACCAGCCACAGGT with ID: 726 ORIGINAL GRAPH NODE: GGAGGGAGCCACCAGCCACAGGTA with ID: 727 ORIGINAL GRAPH NODE: GAGGGAGCCACCAGCCACAGGTAC with ID: 728 ORIGINAL GRAPH NODE: AGGGAGCCACCAGCCACAGGTACC with ID: 729 ORIGINAL GRAPH NODE: GGGAGCCACCAGCCACAGGTACCT with ID: 730 ORIGINAL GRAPH NODE: GGAGCCACCAGCCACAGGTACCTG with ID: 731 ORIGINAL GRAPH NODE: GAGCCACCAGCCACAGGTACCTGA with ID: 732 ORIGINAL GRAPH NODE: AGCCACCAGCCACAGGTACCTGAT with ID: 733 ORIGINAL GRAPH NODE: GCCACCAGCCACAGGTACCTGATG with ID: 734 ORIGINAL GRAPH NODE: CCACCAGCCACAGGTACCTGATGG with ID: 735 ORIGINAL GRAPH NODE: CACCAGCCACAGGTACCTGATGGA with ID: 736 ORIGINAL GRAPH NODE: ACCAGCCACAGGTACCTGATGGAA with ID: 737 ORIGINAL GRAPH NODE: CCAGCCACAGGTACCTGATGGAAA with ID: 738 ORIGINAL GRAPH NODE: CAGCCACAGGTACCTGATGGAAAT with ID: 739 ORIGINAL GRAPH NODE: AGCCACAGGTACCTGATGGAAATG with ID: 740 ORIGINAL GRAPH NODE: GCCACAGGTACCTGATGGAAATGC with ID: 741 ORIGINAL GRAPH NODE: CCACAGGTACCTGATGGAAATGCC with ID: 742 ORIGINAL GRAPH NODE: CACAGGTACCTGATGGAAATGCCG with ID: 743 ORIGINAL GRAPH NODE: ACAGGTACCTGATGGAAATGCCGG with ID: 744 ORIGINAL GRAPH NODE: CAGGTACCTGATGGAAATGCCGGC with ID: 745 ORIGINAL GRAPH NODE: AGGTACCTGATGGAAATGCCGGCT with ID: 746 ORIGINAL GRAPH NODE: GGTACCTGATGGAAATGCCGGCTC with ID: 747 ORIGINAL GRAPH NODE: GTACCTGATGGAAATGCCGGCTCA with ID: 748 ORIGINAL GRAPH NODE: TACCTGATGGAAATGCCGGCTCAC with ID: 749 ORIGINAL GRAPH NODE: ACCTGATGGAAATGCCGGCTCACT with ID: 750 ORIGINAL GRAPH NODE: CCTGATGGAAATGCCGGCTCACTT with ID: 751 ORIGINAL GRAPH NODE: CTGATGGAAATGCCGGCTCACTTC with ID: 752 ORIGINAL GRAPH NODE: TGATGGAAATGCCGGCTCACTTCC with ID: 753 ORIGINAL GRAPH NODE: GATGGAAATGCCGGCTCACTTCCT with ID: 754 ORIGINAL GRAPH NODE: ATGGAAATGCCGGCTCACTTCCTG with ID: 755 ORIGINAL GRAPH NODE: TGGAAATGCCGGCTCACTTCCTGT with ID: 756 ORIGINAL GRAPH NODE: GGAAATGCCGGCTCACTTCCTGTG with ID: 757 ORIGINAL GRAPH NODE: GAAATGCCGGCTCACTTCCTGTGA with ID: 758 ORIGINAL GRAPH NODE: GCTAGGGGAAATAGGGGAGCTCCA with ID: 786 ORIGINAL GRAPH NODE: CTAGGGGAAATAGGGGAGCTCCAA with ID: 787 ORIGINAL GRAPH NODE: TAGGGGAAATAGGGGAGCTCCAAA with ID: 788 ORIGINAL GRAPH NODE: AGGGGAAATAGGGGAGCTCCAAAC with ID: 789 ORIGINAL GRAPH NODE: GGGGAAATAGGGGAGCTCCAAACC with ID: 790 ORIGINAL GRAPH NODE: GGGAAATAGGGGAGCTCCAAACCC with ID: 791 ORIGINAL GRAPH NODE: GGAAATAGGGGAGCTCCAAACCCA with ID: 792 ORIGINAL GRAPH NODE: GAAATAGGGGAGCTCCAAACCCAG with ID: 793 ORIGINAL GRAPH NODE: AAATAGGGGAGCTCCAAACCCAGC with ID: 794 ORIGINAL GRAPH NODE: AATAGGGGAGCTCCAAACCCAGCC with ID: 795 ORIGINAL GRAPH NODE: ATAGGGGAGCTCCAAACCCAGCCC with ID: 796 ORIGINAL GRAPH NODE: TAGGGGAGCTCCAAACCCAGCCCC with ID: 797 ORIGINAL GRAPH NODE: AGGGGAGCTCCAAACCCAGCCCCG with ID: 798 ORIGINAL GRAPH NODE: GGGGAGCTCCAAACCCAGCCCCGT with ID: 799 ORIGINAL GRAPH NODE: GGGAGCTCCAAACCCAGCCCCGTG with ID: 800 ORIGINAL GRAPH NODE: GGAGCTCCAAACCCAGCCCCGTGG with ID: 801 ORIGINAL GRAPH NODE: GAGCTCCAAACCCAGCCCCGTGGA with ID: 802 ORIGINAL GRAPH NODE: AGCTCCAAACCCAGCCCCGTGGAG with ID: 803 ORIGINAL GRAPH NODE: GCTCCAAACCCAGCCCCGTGGAGG with ID: 804 ORIGINAL GRAPH NODE: CTCCAAACCCAGCCCCGTGGAGGG with ID: 805 ORIGINAL GRAPH NODE: TCCAAACCCAGCCCCGTGGAGGGA with ID: 806 ORIGINAL GRAPH NODE: CCAAACCCAGCCCCGTGGAGGGAG with ID: 807 ORIGINAL GRAPH NODE: CAAACCCAGCCCCGTGGAGGGAGC with ID: 808 ORIGINAL GRAPH NODE: AAACCCAGCCCCGTGGAGGGAGCC with ID: 809 ORIGINAL GRAPH NODE: AACCCAGCCCCGTGGAGGGAGCCA with ID: 810 ORIGINAL GRAPH NODE: ACCCAGCCCCGTGGAGGGAGCCAC with ID: 811 ORIGINAL GRAPH NODE: CCCAGCCCCGTGGAGGGAGCCACC with ID: 812 ORIGINAL GRAPH NODE: GGAGCAGAGTTAGGAAGCTCCCTC with ID: 813 ORIGINAL GRAPH NODE: GAGCAGAGTTAGGAAGCTCCCTCA with ID: 814 ORIGINAL GRAPH NODE: AGCAGAGTTAGGAAGCTCCCTCAG with ID: 815 ORIGINAL GRAPH NODE: GCAGAGTTAGGAAGCTCCCTCAGC with ID: 816 ORIGINAL GRAPH NODE: CAGAGTTAGGAAGCTCCCTCAGCA with ID: 817 ORIGINAL GRAPH NODE: AGAGTTAGGAAGCTCCCTCAGCAC with ID: 818 ORIGINAL GRAPH NODE: GAGTTAGGAAGCTCCCTCAGCACT with ID: 819 ORIGINAL GRAPH NODE: AGTTAGGAAGCTCCCTCAGCACTC with ID: 820 ORIGINAL GRAPH NODE: GTTAGGAAGCTCCCTCAGCACTCT with ID: 821 ORIGINAL GRAPH NODE: TTAGGAAGCTCCCTCAGCACTCTG with ID: 822 ORIGINAL GRAPH NODE: TAGGAAGCTCCCTCAGCACTCTGA with ID: 823 ORIGINAL GRAPH NODE: AGGAAGCTCCCTCAGCACTCTGAA with ID: 824 ORIGINAL GRAPH NODE: GGAAGCTCCCTCAGCACTCTGAAC with ID: 825 ORIGINAL GRAPH NODE: GAAGCTCCCTCAGCACTCTGAACC with ID: 826 ORIGINAL GRAPH NODE: AAGCTCCCTCAGCACTCTGAACCC with ID: 827 ORIGINAL GRAPH NODE: AGCTCCCTCAGCACTCTGAACCCT with ID: 828 ORIGINAL GRAPH NODE: GCTCCCTCAGCACTCTGAACCCTG with ID: 829 ORIGINAL GRAPH NODE: CTCCCTCAGCACTCTGAACCCTGT with ID: 830 ORIGINAL GRAPH NODE: TCCCTCAGCACTCTGAACCCTGTG with ID: 831 ORIGINAL GRAPH NODE: CCCTCAGCACTCTGAACCCTGTGA with ID: 832 ORIGINAL GRAPH NODE: CCTCAGCACTCTGAACCCTGTGAG with ID: 833 ORIGINAL GRAPH NODE: CTCAGCACTCTGAACCCTGTGAGG with ID: 834 ORIGINAL GRAPH NODE: TCAGCACTCTGAACCCTGTGAGGC with ID: 835 ORIGINAL GRAPH NODE: CAGCACTCTGAACCCTGTGAGGCA with ID: 836 ORIGINAL GRAPH NODE: GGCTACAAACAGACTTCCTCAAGG with ID: 885 ORIGINAL GRAPH NODE: GCTACAAACAGACTTCCTCAAGGC with ID: 886 ORIGINAL GRAPH NODE: CTACAAACAGACTTCCTCAAGGCT with ID: 887 ORIGINAL GRAPH NODE: TACAAACAGACTTCCTCAAGGCTC with ID: 888 ORIGINAL GRAPH NODE: ACAAACAGACTTCCTCAAGGCTCA with ID: 889 ORIGINAL GRAPH NODE: CAAACAGACTTCCTCAAGGCTCAT with ID: 890 ORIGINAL GRAPH NODE: AAACAGACTTCCTCAAGGCTCATC with ID: 891 ORIGINAL GRAPH NODE: AACAGACTTCCTCAAGGCTCATCA with ID: 892 ORIGINAL GRAPH NODE: ACAGACTTCCTCAAGGCTCATCAG with ID: 893 ORIGINAL GRAPH NODE: CAGACTTCCTCAAGGCTCATCAGC with ID: 894 ORIGINAL GRAPH NODE: AGACTTCCTCAAGGCTCATCAGCA with ID: 895 ORIGINAL GRAPH NODE: GACTTCCTCAAGGCTCATCAGCAA with ID: 896 ORIGINAL GRAPH NODE: ACTTCCTCAAGGCTCATCAGCAAG with ID: 897 ORIGINAL GRAPH NODE: CTTCCTCAAGGCTCATCAGCAAGA with ID: 898 ORIGINAL GRAPH NODE: TTCCTCAAGGCTCATCAGCAAGAA with ID: 899 ORIGINAL GRAPH NODE: TCCTCAAGGCTCATCAGCAAGAAG with ID: 900 ORIGINAL GRAPH NODE: CCTCAAGGCTCATCAGCAAGAAGA with ID: 901 ORIGINAL GRAPH NODE: CTCAAGGCTCATCAGCAAGAAGAA with ID: 902 ORIGINAL GRAPH NODE: TCAAGGCTCATCAGCAAGAAGAAA with ID: 903 ORIGINAL GRAPH NODE: CAAGGCTCATCAGCAAGAAGAAAT with ID: 904 ORIGINAL GRAPH NODE: AAGGCTCATCAGCAAGAAGAAATC with ID: 905 ORIGINAL GRAPH NODE: AGGCTCATCAGCAAGAAGAAATCT with ID: 906 ORIGINAL GRAPH NODE: GGCTCATCAGCAAGAAGAAATCTT with ID: 907 ORIGINAL GRAPH NODE: GCTCATCAGCAAGAAGAAATCTTT with ID: 908 ORIGINAL GRAPH NODE: AGAATACAAAATGCCTTCCTCCAG with ID: 945 ORIGINAL GRAPH NODE: GAATACAAAATGCCTTCCTCCAGC with ID: 946 ORIGINAL GRAPH NODE: AATACAAAATGCCTTCCTCCAGCC with ID: 947 ORIGINAL GRAPH NODE: ATACAAAATGCCTTCCTCCAGCCT with ID: 948 ORIGINAL GRAPH NODE: TACAAAATGCCTTCCTCCAGCCTC with ID: 949 ORIGINAL GRAPH NODE: ACAAAATGCCTTCCTCCAGCCTCA with ID: 950 ORIGINAL GRAPH NODE: CAAAATGCCTTCCTCCAGCCTCAT with ID: 951 ORIGINAL GRAPH NODE: AAAATGCCTTCCTCCAGCCTCATC with ID: 952 ORIGINAL GRAPH NODE: AAATGCCTTCCTCCAGCCTCATCA with ID: 953 ORIGINAL GRAPH NODE: AATGCCTTCCTCCAGCCTCATCAG with ID: 954 ORIGINAL GRAPH NODE: ATGCCTTCCTCCAGCCTCATCAGC with ID: 955 ORIGINAL GRAPH NODE: TGCCTTCCTCCAGCCTCATCAGCA with ID: 956 ORIGINAL GRAPH NODE: GCCTTCCTCCAGCCTCATCAGCAG with ID: 957 ORIGINAL GRAPH NODE: CCTTCCTCCAGCCTCATCAGCAGG with ID: 958 ORIGINAL GRAPH NODE: CTTCCTCCAGCCTCATCAGCAGGA with ID: 959 ORIGINAL GRAPH NODE: TTCCTCCAGCCTCATCAGCAGGAA with ID: 960 ORIGINAL GRAPH NODE: TCCTCCAGCCTCATCAGCAGGAAG with ID: 961 ORIGINAL GRAPH NODE: CCTCCAGCCTCATCAGCAGGAAGA with ID: 962 ORIGINAL GRAPH NODE: CTCCAGCCTCATCAGCAGGAAGAA with ID: 963 ORIGINAL GRAPH NODE: TCCAGCCTCATCAGCAGGAAGAAA with ID: 964 ORIGINAL GRAPH NODE: CCAGCCTCATCAGCAGGAAGAAAT with ID: 965 ORIGINAL GRAPH NODE: CAGCCTCATCAGCAGGAAGAAATC with ID: 966 ORIGINAL GRAPH NODE: AGCCTCATCAGCAGGAAGAAATCT with ID: 967 ORIGINAL GRAPH NODE: GCCTCATCAGCAGGAAGAAATCTT with ID: 968 ORIGINAL GRAPH NODE: CCTCATCAGCAGGAAGAAATCTTT with ID: 969 ORIGINAL GRAPH NODE: CTCATCAGCAGGAAGAAATCTTTC with ID: 970 ORIGINAL GRAPH NODE: TCATCAGCAGGAAGAAATCTTTCT with ID: 971 ORIGINAL GRAPH NODE: CATCAGCAGGAAGAAATCTTTCTT with ID: 972 ORIGINAL GRAPH NODE: ATCAGCAGGAAGAAATCTTTCTTT with ID: 973 ORIGINAL GRAPH NODE: TCAGCAGGAAGAAATCTTTCTTTC with ID: 974 ORIGINAL GRAPH NODE: CAGCAGGAAGAAATCTTTCTTTCC with ID: 975 ORIGINAL GRAPH NODE: AGCAGGAAGAAATCTTTCTTTCCA with ID: 976 ORIGINAL GRAPH NODE: GCAGGAAGAAATCTTTCTTTCCAA with ID: 977 ORIGINAL GRAPH NODE: CAGGAAGAAATCTTTCTTTCCAAG with ID: 978 ORIGINAL GRAPH NODE: AGGAAGAAATCTTTCTTTCCAAGT with ID: 979 ORIGINAL GRAPH NODE: GGAAGAAATCTTTCTTTCCAAGTA with ID: 980 fixExtremeleyHighSingleEdges() fixExtremelyHighSingleEdges() removeLightEdges() removeLightEdges() SECTION ================= REMOVING LIGHT In EDGES ================= SECTION ================= REMOVING LIGHT OUT EDGES ================= SECTION ================= REMOVING LIGHT FLOW EDGES ================= FLOW: total in for vertex GGCCACACGATGGCTTATCACGTC:W0(V380_D-1) is 0, total out is 2, averageCov=0 FLOW: total in for vertex C:W-1(V381_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V382_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V383_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V384_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V385_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V386_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V387_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V388_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V389_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V390_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V391_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V392_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V393_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V394_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V395_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V396_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V397_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V398_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V399_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V400_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V401_D-1) is 2, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V402_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V403_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V404_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V405_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V406_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V407_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V408_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V409_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V410_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V411_D-1) is 4, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V412_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V413_D-1) is 6, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V414_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V415_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V416_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V417_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V418_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V419_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V420_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V421_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V422_D-1) is 6, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V423_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V424_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V425_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V426_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V427_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V428_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V429_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V430_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V431_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V432_D-1) is 8, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V433_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V434_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V435_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V436_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V437_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V438_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V439_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V440_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V441_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V442_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V443_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V444_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V445_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V446_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V447_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V448_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V449_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V450_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V451_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex T:W-1(V452_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V453_D-1) is 10, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V454_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V455_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V456_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V457_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V458_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V459_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V460_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V461_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V462_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V463_D-1) is 8, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V464_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V465_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V466_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V467_D-1) is 4, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V468_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V469_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V470_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V471_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V472_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V473_D-1) is 2, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V474_D-1) is 4, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V475_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V476_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V477_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V478_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V479_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V480_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V481_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V482_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V483_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V484_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V485_D-1) is 2, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V486_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V487_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V488_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V489_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V490_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V491_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V492_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V493_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V494_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V495_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V496_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V497_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V498_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V499_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V500_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V501_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V502_D-1) is 4, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V503_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V504_D-1) is 6, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V505_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V506_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V507_D-1) is 8, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V508_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V509_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V510_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex T:W-1(V511_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex T:W-1(V512_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V513_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V514_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V515_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V516_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V517_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V518_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex C:W-1(V519_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex T:W-1(V520_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex C:W-1(V521_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex C:W-1(V522_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex C:W-1(V523_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex T:W-1(V524_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V525_D-1) is 8, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V526_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V527_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V528_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V529_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V530_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V531_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V532_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V533_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V534_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V535_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V536_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V537_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V538_D-1) is 4, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V539_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V540_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V541_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V542_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V543_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V544_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V545_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V546_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V547_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V548_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V549_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V550_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V551_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V552_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V553_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V554_D-1) is 8, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V555_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V556_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V557_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V558_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V559_D-1) is 4, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V560_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V561_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V562_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V563_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V564_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V565_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V566_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V567_D-1) is 2, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V568_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V569_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V570_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V571_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V572_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V573_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V574_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V575_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V576_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V577_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V578_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V579_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V580_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V581_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V582_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V583_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V584_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V585_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V586_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V587_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V588_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V589_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V590_D-1) is 4, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V591_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V592_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V593_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V594_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V595_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V596_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V597_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V598_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V599_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V600_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V601_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V602_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V603_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V604_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V605_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V606_D-1) is 2, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V607_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V608_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V609_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V610_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V611_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V612_D-1) is 4, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V613_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V614_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V615_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V616_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V617_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V618_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V619_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V620_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V621_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V622_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V623_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V624_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V625_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V626_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V627_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V628_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V629_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V630_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V631_D-1) is 4, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V632_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V633_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V634_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V635_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V636_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V637_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V638_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V639_D-1) is 6, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V640_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V641_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V642_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V643_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V644_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V645_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V646_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V647_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V648_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V649_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V650_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V651_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V652_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V653_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V654_D-1) is 8, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V655_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V656_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex T:W-1(V657_D-1) is 10, total out is 12, averageCov=-1 FLOW: total in for vertex G:W-1(V658_D-1) is 12, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V659_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex C:W-1(V660_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V661_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V662_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex A:W-1(V663_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex C:W-1(V664_D-1) is 10, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V665_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V666_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V667_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V668_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V669_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V670_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V671_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V672_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V673_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V674_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V675_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V676_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V677_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V678_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V679_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V680_D-1) is 8, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V681_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V682_D-1) is 10, total out is 10, averageCov=-1 FLOW: total in for vertex G:W-1(V683_D-1) is 10, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V684_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex G:W-1(V685_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex C:W-1(V686_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex T:W-1(V687_D-1) is 8, total out is 8, averageCov=-1 FLOW: total in for vertex A:W-1(V688_D-1) is 8, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V689_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V690_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V691_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V692_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V693_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V694_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V695_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V696_D-1) is 4, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V697_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V698_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V699_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V700_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V701_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V702_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V703_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V704_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V705_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V706_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V707_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V708_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V709_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V710_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V711_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V712_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V713_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V714_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V715_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V716_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V717_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V718_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V719_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V720_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V721_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V722_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V723_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V724_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V725_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V726_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V727_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V728_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V729_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V730_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V731_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V732_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V733_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V734_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V735_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V736_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V737_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex A:W-1(V738_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex T:W-1(V739_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex G:W-1(V740_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V741_D-1) is 6, total out is 6, averageCov=-1 FLOW: total in for vertex C:W-1(V742_D-1) is 6, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V743_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex G:W-1(V744_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V745_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex T:W-1(V746_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex C:W-1(V747_D-1) is 4, total out is 4, averageCov=-1 FLOW: total in for vertex A:W-1(V748_D-1) is 4, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V749_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V750_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V751_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V752_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V753_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V754_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V755_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V756_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V757_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V758_D-1) is 2, total out is 0, averageCov=-1 FLOW: total in for vertex GCTAGGGGAAATAGGGGAGCTCCA:W0(V786_D-1) is 0, total out is 2, averageCov=0 FLOW: total in for vertex A:W-1(V787_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V788_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V789_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V790_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V791_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V792_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V793_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V794_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V795_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V796_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V797_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V798_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V799_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V800_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V801_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V802_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V803_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V804_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V805_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V806_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V807_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V808_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V809_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V810_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V811_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V812_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V813_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V814_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V815_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V816_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V817_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V818_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V819_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V820_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V821_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V822_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V823_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V824_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V825_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V826_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V827_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V828_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V829_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V830_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V831_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V832_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V833_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V834_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V835_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V836_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V885_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V886_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V887_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V888_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V889_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V890_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V891_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V892_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V893_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V894_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V895_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V896_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V897_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V898_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V899_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V900_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V901_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V902_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V903_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V904_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V905_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V906_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V907_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V908_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex AGAATACAAAATGCCTTCCTCCAG:W0(V945_D-1) is 0, total out is 2, averageCov=0 FLOW: total in for vertex C:W-1(V946_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V947_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V948_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V949_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V950_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V951_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V952_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V953_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V954_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V955_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V956_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V957_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V958_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V959_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V960_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V961_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V962_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V963_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V964_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V965_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V966_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V967_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V968_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V969_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V970_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V971_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V972_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V973_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V974_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex C:W-1(V975_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V976_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V977_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex G:W-1(V978_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex T:W-1(V979_D-1) is 2, total out is 2, averageCov=-1 FLOW: total in for vertex A:W-1(V980_D-1) is 2, total out is 2, averageCov=-1 ## Node descriptions before linear compaction: ## Node descriptions: GGCCACACGATGGCTTATCACGTC:W0(V380_D-1) Preds: [] Succ: [C:W-1(V381_D-1) ] C:W-1(V381_D-1) Preds: [GGCCACACGATGGCTTATCACGTC:W0(V380_D-1) ] Succ: [A:W-1(V382_D-1) ] A:W-1(V382_D-1) Preds: [C:W-1(V381_D-1) ] Succ: [C:W-1(V383_D-1) ] C:W-1(V383_D-1) Preds: [A:W-1(V382_D-1) ] Succ: [A:W-1(V384_D-1) ] A:W-1(V384_D-1) Preds: [C:W-1(V383_D-1) ] Succ: [T:W-1(V385_D-1) ] T:W-1(V385_D-1) Preds: [A:W-1(V384_D-1) ] Succ: [T:W-1(V386_D-1) ] T:W-1(V386_D-1) Preds: [T:W-1(V385_D-1) ] Succ: [T:W-1(V387_D-1) ] T:W-1(V387_D-1) Preds: [T:W-1(V386_D-1) ] Succ: [C:W-1(V388_D-1) ] C:W-1(V388_D-1) Preds: [T:W-1(V387_D-1) ] Succ: [T:W-1(V389_D-1) ] T:W-1(V389_D-1) Preds: [C:W-1(V388_D-1) ] Succ: [A:W-1(V390_D-1) ] A:W-1(V390_D-1) Preds: [T:W-1(V389_D-1) ] Succ: [C:W-1(V391_D-1) ] C:W-1(V391_D-1) Preds: [A:W-1(V390_D-1) ] Succ: [T:W-1(V392_D-1) ] T:W-1(V392_D-1) Preds: [C:W-1(V391_D-1) ] Succ: [G:W-1(V393_D-1) ] G:W-1(V393_D-1) Preds: [T:W-1(V392_D-1) ] Succ: [G:W-1(V394_D-1) ] G:W-1(V394_D-1) Preds: [G:W-1(V393_D-1) ] Succ: [C:W-1(V395_D-1) ] C:W-1(V395_D-1) Preds: [G:W-1(V394_D-1) ] Succ: [T:W-1(V396_D-1) ] T:W-1(V396_D-1) Preds: [C:W-1(V395_D-1) ] Succ: [A:W-1(V397_D-1) ] A:W-1(V397_D-1) Preds: [T:W-1(V396_D-1) ] Succ: [C:W-1(V398_D-1) ] C:W-1(V398_D-1) Preds: [A:W-1(V397_D-1) ] Succ: [A:W-1(V399_D-1) ] A:W-1(V399_D-1) Preds: [C:W-1(V398_D-1) ] Succ: [A:W-1(V400_D-1) ] A:W-1(V400_D-1) Preds: [A:W-1(V399_D-1) ] Succ: [A:W-1(V401_D-1) ] A:W-1(V401_D-1) Preds: [A:W-1(V400_D-1) ] Succ: [C:W-1(V402_D-1) ] C:W-1(V402_D-1) Preds: [A:W-1(V401_D-1) ] Succ: [A:W-1(V403_D-1) ] A:W-1(V403_D-1) Preds: [C:W-1(V402_D-1) ] Succ: [G:W-1(V404_D-1) ] G:W-1(V404_D-1) Preds: [A:W-1(V403_D-1) ] Succ: [A:W-1(V405_D-1) ] A:W-1(V405_D-1) Preds: [G:W-1(V404_D-1) ] Succ: [C:W-1(V406_D-1) ] C:W-1(V406_D-1) Preds: [A:W-1(V405_D-1) ] Succ: [T:W-1(V407_D-1) ] T:W-1(V407_D-1) Preds: [C:W-1(V406_D-1) ] Succ: [T:W-1(V408_D-1) ] T:W-1(V408_D-1) Preds: [T:W-1(V407_D-1) ] Succ: [C:W-1(V409_D-1) ] C:W-1(V409_D-1) Preds: [T:W-1(V408_D-1) ] Succ: [C:W-1(V410_D-1) ] C:W-1(V410_D-1) Preds: [C:W-1(V409_D-1) ] Succ: [T:W-1(V411_D-1) ] T:W-1(V411_D-1) Preds: [C:W-1(V410_D-1) ] Succ: [C:W-1(V412_D-1) ] C:W-1(V412_D-1) Preds: [T:W-1(V411_D-1) ] Succ: [A:W-1(V413_D-1) ] A:W-1(V413_D-1) Preds: [C:W-1(V412_D-1) ] Succ: [A:W-1(V414_D-1) ] A:W-1(V414_D-1) Preds: [A:W-1(V413_D-1) ] Succ: [G:W-1(V415_D-1) ] G:W-1(V415_D-1) Preds: [A:W-1(V414_D-1) ] Succ: [C:W-1(V416_D-1) G:W-1(V885_D-1) ] C:W-1(V416_D-1) Preds: [G:W-1(V415_D-1) ] Succ: [C:W-1(V417_D-1) ] C:W-1(V417_D-1) Preds: [C:W-1(V416_D-1) ] Succ: [T:W-1(V418_D-1) ] T:W-1(V418_D-1) Preds: [C:W-1(V417_D-1) ] Succ: [C:W-1(V419_D-1) ] C:W-1(V419_D-1) Preds: [T:W-1(V418_D-1) ] Succ: [A:W-1(V420_D-1) ] A:W-1(V420_D-1) Preds: [C:W-1(V419_D-1) ] Succ: [T:W-1(V421_D-1) ] T:W-1(V421_D-1) Preds: [A:W-1(V420_D-1) ] Succ: [C:W-1(V422_D-1) ] C:W-1(V422_D-1) Preds: [T:W-1(V421_D-1) ] Succ: [A:W-1(V423_D-1) ] A:W-1(V423_D-1) Preds: [C:W-1(V422_D-1) ] Succ: [G:W-1(V424_D-1) ] G:W-1(V424_D-1) Preds: [A:W-1(V423_D-1) ] Succ: [C:W-1(V425_D-1) ] C:W-1(V425_D-1) Preds: [G:W-1(V424_D-1) ] Succ: [A:W-1(V426_D-1) ] A:W-1(V426_D-1) Preds: [C:W-1(V425_D-1) ] Succ: [A:W-1(V427_D-1) ] A:W-1(V427_D-1) Preds: [A:W-1(V426_D-1) ] Succ: [G:W-1(V428_D-1) ] G:W-1(V428_D-1) Preds: [A:W-1(V427_D-1) ] Succ: [A:W-1(V429_D-1) ] A:W-1(V429_D-1) Preds: [G:W-1(V428_D-1) ] Succ: [A:W-1(V430_D-1) ] A:W-1(V430_D-1) Preds: [A:W-1(V429_D-1) ] Succ: [G:W-1(V431_D-1) ] G:W-1(V431_D-1) Preds: [A:W-1(V430_D-1) ] Succ: [A:W-1(V432_D-1) ] A:W-1(V432_D-1) Preds: [G:W-1(V431_D-1) ] Succ: [A:W-1(V433_D-1) ] A:W-1(V433_D-1) Preds: [A:W-1(V432_D-1) ] Succ: [A:W-1(V434_D-1) ] A:W-1(V434_D-1) Preds: [A:W-1(V433_D-1) ] Succ: [T:W-1(V435_D-1) ] T:W-1(V435_D-1) Preds: [A:W-1(V434_D-1) ] Succ: [C:W-1(V436_D-1) ] C:W-1(V436_D-1) Preds: [T:W-1(V435_D-1) ] Succ: [T:W-1(V437_D-1) ] T:W-1(V437_D-1) Preds: [C:W-1(V436_D-1) ] Succ: [T:W-1(V438_D-1) ] T:W-1(V438_D-1) Preds: [T:W-1(V437_D-1) ] Succ: [T:W-1(V439_D-1) ] T:W-1(V439_D-1) Preds: [T:W-1(V438_D-1) ] Succ: [C:W-1(V440_D-1) ] C:W-1(V440_D-1) Preds: [T:W-1(V439_D-1) T:W-1(V908_D-1) ] Succ: [T:W-1(V441_D-1) ] T:W-1(V441_D-1) Preds: [C:W-1(V440_D-1) ] Succ: [T:W-1(V442_D-1) ] T:W-1(V442_D-1) Preds: [T:W-1(V441_D-1) ] Succ: [T:W-1(V443_D-1) ] T:W-1(V443_D-1) Preds: [T:W-1(V442_D-1) ] Succ: [C:W-1(V444_D-1) ] C:W-1(V444_D-1) Preds: [T:W-1(V443_D-1) ] Succ: [C:W-1(V445_D-1) ] C:W-1(V445_D-1) Preds: [C:W-1(V444_D-1) ] Succ: [A:W-1(V446_D-1) ] A:W-1(V446_D-1) Preds: [C:W-1(V445_D-1) ] Succ: [A:W-1(V447_D-1) ] A:W-1(V447_D-1) Preds: [A:W-1(V446_D-1) ] Succ: [G:W-1(V448_D-1) ] G:W-1(V448_D-1) Preds: [A:W-1(V447_D-1) ] Succ: [T:W-1(V449_D-1) ] T:W-1(V449_D-1) Preds: [G:W-1(V448_D-1) ] Succ: [A:W-1(V450_D-1) ] A:W-1(V450_D-1) Preds: [T:W-1(V449_D-1) ] Succ: [G:W-1(V451_D-1) ] G:W-1(V451_D-1) Preds: [A:W-1(V450_D-1) A:W-1(V980_D-1) ] Succ: [T:W-1(V452_D-1) ] T:W-1(V452_D-1) Preds: [G:W-1(V451_D-1) ] Succ: [G:W-1(V453_D-1) ] G:W-1(V453_D-1) Preds: [T:W-1(V452_D-1) ] Succ: [T:W-1(V454_D-1) ] T:W-1(V454_D-1) Preds: [G:W-1(V453_D-1) ] Succ: [C:W-1(V455_D-1) ] C:W-1(V455_D-1) Preds: [T:W-1(V454_D-1) ] Succ: [T:W-1(V456_D-1) ] T:W-1(V456_D-1) Preds: [C:W-1(V455_D-1) ] Succ: [T:W-1(V457_D-1) ] T:W-1(V457_D-1) Preds: [T:W-1(V456_D-1) ] Succ: [A:W-1(V458_D-1) ] A:W-1(V458_D-1) Preds: [T:W-1(V457_D-1) ] Succ: [A:W-1(V459_D-1) ] A:W-1(V459_D-1) Preds: [A:W-1(V458_D-1) ] Succ: [C:W-1(V460_D-1) ] C:W-1(V460_D-1) Preds: [A:W-1(V459_D-1) ] Succ: [T:W-1(V461_D-1) ] T:W-1(V461_D-1) Preds: [C:W-1(V460_D-1) ] Succ: [C:W-1(V462_D-1) ] C:W-1(V462_D-1) Preds: [T:W-1(V461_D-1) ] Succ: [A:W-1(V463_D-1) ] A:W-1(V463_D-1) Preds: [C:W-1(V462_D-1) ] Succ: [G:W-1(V464_D-1) ] G:W-1(V464_D-1) Preds: [A:W-1(V463_D-1) ] Succ: [G:W-1(V465_D-1) ] G:W-1(V465_D-1) Preds: [G:W-1(V464_D-1) ] Succ: [A:W-1(V466_D-1) ] A:W-1(V466_D-1) Preds: [G:W-1(V465_D-1) ] Succ: [G:W-1(V467_D-1) ] G:W-1(V467_D-1) Preds: [A:W-1(V466_D-1) ] Succ: [A:W-1(V468_D-1) ] A:W-1(V468_D-1) Preds: [G:W-1(V467_D-1) ] Succ: [T:W-1(V469_D-1) ] T:W-1(V469_D-1) Preds: [A:W-1(V468_D-1) ] Succ: [C:W-1(V470_D-1) ] C:W-1(V470_D-1) Preds: [T:W-1(V469_D-1) ] Succ: [A:W-1(V471_D-1) ] A:W-1(V471_D-1) Preds: [C:W-1(V470_D-1) ] Succ: [T:W-1(V472_D-1) ] T:W-1(V472_D-1) Preds: [A:W-1(V471_D-1) ] Succ: [G:W-1(V473_D-1) ] G:W-1(V473_D-1) Preds: [T:W-1(V472_D-1) ] Succ: [G:W-1(V474_D-1) ] G:W-1(V474_D-1) Preds: [G:W-1(V473_D-1) ] Succ: [T:W-1(V475_D-1) ] T:W-1(V475_D-1) Preds: [G:W-1(V474_D-1) ] Succ: [A:W-1(V476_D-1) ] A:W-1(V476_D-1) Preds: [T:W-1(V475_D-1) ] Succ: [G:W-1(V477_D-1) ] G:W-1(V477_D-1) Preds: [A:W-1(V476_D-1) ] Succ: [G:W-1(V478_D-1) ] G:W-1(V478_D-1) Preds: [G:W-1(V477_D-1) ] Succ: [G:W-1(V479_D-1) ] G:W-1(V479_D-1) Preds: [G:W-1(V478_D-1) ] Succ: [A:W-1(V480_D-1) ] A:W-1(V480_D-1) Preds: [G:W-1(V479_D-1) ] Succ: [A:W-1(V481_D-1) ] A:W-1(V481_D-1) Preds: [A:W-1(V480_D-1) ] Succ: [G:W-1(V482_D-1) ] G:W-1(V482_D-1) Preds: [A:W-1(V481_D-1) ] Succ: [G:W-1(V483_D-1) ] G:W-1(V483_D-1) Preds: [G:W-1(V482_D-1) ] Succ: [G:W-1(V484_D-1) ] G:W-1(V484_D-1) Preds: [G:W-1(V483_D-1) ] Succ: [G:W-1(V485_D-1) ] G:W-1(V485_D-1) Preds: [G:W-1(V484_D-1) ] Succ: [T:W-1(V486_D-1) ] T:W-1(V486_D-1) Preds: [G:W-1(V485_D-1) ] Succ: [C:W-1(V487_D-1) ] C:W-1(V487_D-1) Preds: [T:W-1(V486_D-1) ] Succ: [A:W-1(V488_D-1) ] A:W-1(V488_D-1) Preds: [C:W-1(V487_D-1) ] Succ: [G:W-1(V489_D-1) ] G:W-1(V489_D-1) Preds: [A:W-1(V488_D-1) ] Succ: [G:W-1(V490_D-1) ] G:W-1(V490_D-1) Preds: [G:W-1(V489_D-1) ] Succ: [C:W-1(V491_D-1) ] C:W-1(V491_D-1) Preds: [G:W-1(V490_D-1) ] Succ: [C:W-1(V492_D-1) ] C:W-1(V492_D-1) Preds: [C:W-1(V491_D-1) ] Succ: [A:W-1(V493_D-1) ] A:W-1(V493_D-1) Preds: [C:W-1(V492_D-1) ] Succ: [C:W-1(V494_D-1) ] C:W-1(V494_D-1) Preds: [A:W-1(V493_D-1) ] Succ: [T:W-1(V495_D-1) ] T:W-1(V495_D-1) Preds: [C:W-1(V494_D-1) ] Succ: [T:W-1(V496_D-1) ] T:W-1(V496_D-1) Preds: [T:W-1(V495_D-1) ] Succ: [C:W-1(V497_D-1) ] C:W-1(V497_D-1) Preds: [T:W-1(V496_D-1) ] Succ: [A:W-1(V498_D-1) ] A:W-1(V498_D-1) Preds: [C:W-1(V497_D-1) ] Succ: [C:W-1(V499_D-1) ] C:W-1(V499_D-1) Preds: [A:W-1(V498_D-1) ] Succ: [A:W-1(V500_D-1) ] A:W-1(V500_D-1) Preds: [C:W-1(V499_D-1) ] Succ: [A:W-1(V501_D-1) ] A:W-1(V501_D-1) Preds: [A:W-1(V500_D-1) ] Succ: [G:W-1(V502_D-1) ] G:W-1(V502_D-1) Preds: [A:W-1(V501_D-1) ] Succ: [G:W-1(V503_D-1) ] G:W-1(V503_D-1) Preds: [G:W-1(V502_D-1) ] Succ: [A:W-1(V504_D-1) ] A:W-1(V504_D-1) Preds: [G:W-1(V503_D-1) ] Succ: [G:W-1(V505_D-1) ] G:W-1(V505_D-1) Preds: [A:W-1(V504_D-1) ] Succ: [C:W-1(V506_D-1) ] C:W-1(V506_D-1) Preds: [G:W-1(V505_D-1) ] Succ: [A:W-1(V507_D-1) ] A:W-1(V507_D-1) Preds: [C:W-1(V506_D-1) ] Succ: [G:W-1(V508_D-1) ] G:W-1(V508_D-1) Preds: [A:W-1(V507_D-1) ] Succ: [A:W-1(V509_D-1) ] A:W-1(V509_D-1) Preds: [G:W-1(V508_D-1) ] Succ: [G:W-1(V510_D-1) ] G:W-1(V510_D-1) Preds: [A:W-1(V509_D-1) ] Succ: [T:W-1(V511_D-1) ] T:W-1(V511_D-1) Preds: [G:W-1(V510_D-1) ] Succ: [T:W-1(V512_D-1) ] T:W-1(V512_D-1) Preds: [T:W-1(V511_D-1) ] Succ: [A:W-1(V513_D-1) ] A:W-1(V513_D-1) Preds: [T:W-1(V512_D-1) ] Succ: [G:W-1(V514_D-1) ] G:W-1(V514_D-1) Preds: [A:W-1(V513_D-1) ] Succ: [G:W-1(V515_D-1) ] G:W-1(V515_D-1) Preds: [G:W-1(V514_D-1) ] Succ: [A:W-1(V516_D-1) ] A:W-1(V516_D-1) Preds: [G:W-1(V515_D-1) ] Succ: [A:W-1(V517_D-1) ] A:W-1(V517_D-1) Preds: [A:W-1(V516_D-1) ] Succ: [G:W-1(V518_D-1) ] G:W-1(V518_D-1) Preds: [A:W-1(V517_D-1) ] Succ: [C:W-1(V519_D-1) ] C:W-1(V519_D-1) Preds: [G:W-1(V518_D-1) ] Succ: [T:W-1(V520_D-1) ] T:W-1(V520_D-1) Preds: [C:W-1(V519_D-1) ] Succ: [C:W-1(V521_D-1) ] C:W-1(V521_D-1) Preds: [T:W-1(V520_D-1) ] Succ: [C:W-1(V522_D-1) ] C:W-1(V522_D-1) Preds: [C:W-1(V521_D-1) ] Succ: [C:W-1(V523_D-1) ] C:W-1(V523_D-1) Preds: [C:W-1(V522_D-1) ] Succ: [T:W-1(V524_D-1) ] T:W-1(V524_D-1) Preds: [C:W-1(V523_D-1) ] Succ: [G:W-1(V525_D-1) C:W-1(V813_D-1) ] G:W-1(V525_D-1) Preds: [T:W-1(V524_D-1) ] Succ: [A:W-1(V526_D-1) ] A:W-1(V526_D-1) Preds: [G:W-1(V525_D-1) ] Succ: [G:W-1(V527_D-1) ] G:W-1(V527_D-1) Preds: [A:W-1(V526_D-1) ] Succ: [C:W-1(V528_D-1) ] C:W-1(V528_D-1) Preds: [G:W-1(V527_D-1) ] Succ: [A:W-1(V529_D-1) ] A:W-1(V529_D-1) Preds: [C:W-1(V528_D-1) ] Succ: [C:W-1(V530_D-1) ] C:W-1(V530_D-1) Preds: [A:W-1(V529_D-1) ] Succ: [T:W-1(V531_D-1) ] T:W-1(V531_D-1) Preds: [C:W-1(V530_D-1) ] Succ: [C:W-1(V532_D-1) ] C:W-1(V532_D-1) Preds: [T:W-1(V531_D-1) ] Succ: [T:W-1(V533_D-1) ] T:W-1(V533_D-1) Preds: [C:W-1(V532_D-1) ] Succ: [G:W-1(V534_D-1) ] G:W-1(V534_D-1) Preds: [T:W-1(V533_D-1) ] Succ: [A:W-1(V535_D-1) ] A:W-1(V535_D-1) Preds: [G:W-1(V534_D-1) ] Succ: [A:W-1(V536_D-1) ] A:W-1(V536_D-1) Preds: [A:W-1(V535_D-1) ] Succ: [C:W-1(V537_D-1) ] C:W-1(V537_D-1) Preds: [A:W-1(V536_D-1) ] Succ: [C:W-1(V538_D-1) ] C:W-1(V538_D-1) Preds: [C:W-1(V537_D-1) ] Succ: [C:W-1(V539_D-1) ] C:W-1(V539_D-1) Preds: [C:W-1(V538_D-1) ] Succ: [T:W-1(V540_D-1) ] T:W-1(V540_D-1) Preds: [C:W-1(V539_D-1) ] Succ: [G:W-1(V541_D-1) ] G:W-1(V541_D-1) Preds: [T:W-1(V540_D-1) ] Succ: [T:W-1(V542_D-1) ] T:W-1(V542_D-1) Preds: [G:W-1(V541_D-1) ] Succ: [G:W-1(V543_D-1) ] G:W-1(V543_D-1) Preds: [T:W-1(V542_D-1) ] Succ: [A:W-1(V544_D-1) ] A:W-1(V544_D-1) Preds: [G:W-1(V543_D-1) ] Succ: [G:W-1(V545_D-1) ] G:W-1(V545_D-1) Preds: [A:W-1(V544_D-1) ] Succ: [G:W-1(V546_D-1) ] G:W-1(V546_D-1) Preds: [G:W-1(V545_D-1) ] Succ: [C:W-1(V547_D-1) ] C:W-1(V547_D-1) Preds: [G:W-1(V546_D-1) ] Succ: [A:W-1(V548_D-1) ] A:W-1(V548_D-1) Preds: [C:W-1(V547_D-1) ] Succ: [A:W-1(V549_D-1) ] A:W-1(V549_D-1) Preds: [A:W-1(V548_D-1) A:W-1(V836_D-1) ] Succ: [G:W-1(V550_D-1) ] G:W-1(V550_D-1) Preds: [A:W-1(V549_D-1) ] Succ: [T:W-1(V551_D-1) ] T:W-1(V551_D-1) Preds: [G:W-1(V550_D-1) ] Succ: [C:W-1(V552_D-1) ] C:W-1(V552_D-1) Preds: [T:W-1(V551_D-1) ] Succ: [C:W-1(V553_D-1) ] C:W-1(V553_D-1) Preds: [C:W-1(V552_D-1) ] Succ: [A:W-1(V554_D-1) ] A:W-1(V554_D-1) Preds: [C:W-1(V553_D-1) ] Succ: [C:W-1(V555_D-1) ] C:W-1(V555_D-1) Preds: [A:W-1(V554_D-1) ] Succ: [C:W-1(V556_D-1) ] C:W-1(V556_D-1) Preds: [C:W-1(V555_D-1) ] Succ: [A:W-1(V557_D-1) ] A:W-1(V557_D-1) Preds: [C:W-1(V556_D-1) ] Succ: [C:W-1(V558_D-1) ] C:W-1(V558_D-1) Preds: [A:W-1(V557_D-1) ] Succ: [C:W-1(V559_D-1) ] C:W-1(V559_D-1) Preds: [C:W-1(V558_D-1) ] Succ: [A:W-1(V560_D-1) ] A:W-1(V560_D-1) Preds: [C:W-1(V559_D-1) ] Succ: [G:W-1(V561_D-1) ] G:W-1(V561_D-1) Preds: [A:W-1(V560_D-1) ] Succ: [C:W-1(V562_D-1) ] C:W-1(V562_D-1) Preds: [G:W-1(V561_D-1) ] Succ: [G:W-1(V563_D-1) ] G:W-1(V563_D-1) Preds: [C:W-1(V562_D-1) ] Succ: [T:W-1(V564_D-1) ] T:W-1(V564_D-1) Preds: [G:W-1(V563_D-1) ] Succ: [A:W-1(V565_D-1) ] A:W-1(V565_D-1) Preds: [T:W-1(V564_D-1) ] Succ: [T:W-1(V566_D-1) ] T:W-1(V566_D-1) Preds: [A:W-1(V565_D-1) ] Succ: [C:W-1(V567_D-1) ] C:W-1(V567_D-1) Preds: [T:W-1(V566_D-1) ] Succ: [T:W-1(V568_D-1) ] T:W-1(V568_D-1) Preds: [C:W-1(V567_D-1) ] Succ: [A:W-1(V569_D-1) ] A:W-1(V569_D-1) Preds: [T:W-1(V568_D-1) ] Succ: [G:W-1(V570_D-1) ] G:W-1(V570_D-1) Preds: [A:W-1(V569_D-1) ] Succ: [A:W-1(V571_D-1) ] A:W-1(V571_D-1) Preds: [G:W-1(V570_D-1) ] Succ: [C:W-1(V572_D-1) ] C:W-1(V572_D-1) Preds: [A:W-1(V571_D-1) ] Succ: [C:W-1(V573_D-1) ] C:W-1(V573_D-1) Preds: [C:W-1(V572_D-1) ] Succ: [C:W-1(V574_D-1) ] C:W-1(V574_D-1) Preds: [C:W-1(V573_D-1) ] Succ: [A:W-1(V575_D-1) ] A:W-1(V575_D-1) Preds: [C:W-1(V574_D-1) ] Succ: [G:W-1(V576_D-1) ] G:W-1(V576_D-1) Preds: [A:W-1(V575_D-1) ] Succ: [G:W-1(V577_D-1) ] G:W-1(V577_D-1) Preds: [G:W-1(V576_D-1) ] Succ: [C:W-1(V578_D-1) ] C:W-1(V578_D-1) Preds: [G:W-1(V577_D-1) ] Succ: [C:W-1(V579_D-1) ] C:W-1(V579_D-1) Preds: [C:W-1(V578_D-1) ] Succ: [A:W-1(V580_D-1) ] A:W-1(V580_D-1) Preds: [C:W-1(V579_D-1) ] Succ: [T:W-1(V581_D-1) ] T:W-1(V581_D-1) Preds: [A:W-1(V580_D-1) ] Succ: [C:W-1(V582_D-1) ] C:W-1(V582_D-1) Preds: [T:W-1(V581_D-1) ] Succ: [T:W-1(V583_D-1) ] T:W-1(V583_D-1) Preds: [C:W-1(V582_D-1) ] Succ: [A:W-1(V584_D-1) ] A:W-1(V584_D-1) Preds: [T:W-1(V583_D-1) ] Succ: [A:W-1(V585_D-1) ] A:W-1(V585_D-1) Preds: [A:W-1(V584_D-1) ] Succ: [T:W-1(V586_D-1) ] T:W-1(V586_D-1) Preds: [A:W-1(V585_D-1) ] Succ: [A:W-1(V587_D-1) ] A:W-1(V587_D-1) Preds: [T:W-1(V586_D-1) ] Succ: [A:W-1(V588_D-1) ] A:W-1(V588_D-1) Preds: [A:W-1(V587_D-1) ] Succ: [A:W-1(V589_D-1) ] A:W-1(V589_D-1) Preds: [A:W-1(V588_D-1) ] Succ: [G:W-1(V590_D-1) ] G:W-1(V590_D-1) Preds: [A:W-1(V589_D-1) ] Succ: [G:W-1(V591_D-1) ] G:W-1(V591_D-1) Preds: [G:W-1(V590_D-1) ] Succ: [A:W-1(V592_D-1) ] A:W-1(V592_D-1) Preds: [G:W-1(V591_D-1) ] Succ: [A:W-1(V593_D-1) ] A:W-1(V593_D-1) Preds: [A:W-1(V592_D-1) ] Succ: [A:W-1(V594_D-1) ] A:W-1(V594_D-1) Preds: [A:W-1(V593_D-1) ] Succ: [A:W-1(V595_D-1) ] A:W-1(V595_D-1) Preds: [A:W-1(V594_D-1) ] Succ: [C:W-1(V596_D-1) ] C:W-1(V596_D-1) Preds: [A:W-1(V595_D-1) ] Succ: [T:W-1(V597_D-1) ] T:W-1(V597_D-1) Preds: [C:W-1(V596_D-1) ] Succ: [G:W-1(V598_D-1) ] G:W-1(V598_D-1) Preds: [T:W-1(V597_D-1) ] Succ: [C:W-1(V599_D-1) ] C:W-1(V599_D-1) Preds: [G:W-1(V598_D-1) ] Succ: [A:W-1(V600_D-1) ] A:W-1(V600_D-1) Preds: [C:W-1(V599_D-1) ] Succ: [T:W-1(V601_D-1) ] T:W-1(V601_D-1) Preds: [A:W-1(V600_D-1) ] Succ: [C:W-1(V602_D-1) ] C:W-1(V602_D-1) Preds: [T:W-1(V601_D-1) ] Succ: [T:W-1(V603_D-1) ] T:W-1(V603_D-1) Preds: [C:W-1(V602_D-1) ] Succ: [T:W-1(V604_D-1) ] T:W-1(V604_D-1) Preds: [T:W-1(V603_D-1) ] Succ: [T:W-1(V605_D-1) ] T:W-1(V605_D-1) Preds: [T:W-1(V604_D-1) ] Succ: [G:W-1(V606_D-1) ] G:W-1(V606_D-1) Preds: [T:W-1(V605_D-1) ] Succ: [C:W-1(V607_D-1) ] C:W-1(V607_D-1) Preds: [G:W-1(V606_D-1) ] Succ: [C:W-1(V608_D-1) ] C:W-1(V608_D-1) Preds: [C:W-1(V607_D-1) ] Succ: [C:W-1(V609_D-1) ] C:W-1(V609_D-1) Preds: [C:W-1(V608_D-1) ] Succ: [A:W-1(V610_D-1) ] A:W-1(V610_D-1) Preds: [C:W-1(V609_D-1) ] Succ: [C:W-1(V611_D-1) ] C:W-1(V611_D-1) Preds: [A:W-1(V610_D-1) ] Succ: [A:W-1(V612_D-1) ] A:W-1(V612_D-1) Preds: [C:W-1(V611_D-1) ] Succ: [T:W-1(V613_D-1) ] T:W-1(V613_D-1) Preds: [A:W-1(V612_D-1) ] Succ: [G:W-1(V614_D-1) ] G:W-1(V614_D-1) Preds: [T:W-1(V613_D-1) ] Succ: [A:W-1(V615_D-1) ] A:W-1(V615_D-1) Preds: [G:W-1(V614_D-1) ] Succ: [T:W-1(V616_D-1) ] T:W-1(V616_D-1) Preds: [A:W-1(V615_D-1) ] Succ: [G:W-1(V617_D-1) ] G:W-1(V617_D-1) Preds: [T:W-1(V616_D-1) ] Succ: [C:W-1(V618_D-1) ] C:W-1(V618_D-1) Preds: [G:W-1(V617_D-1) ] Succ: [T:W-1(V619_D-1) ] T:W-1(V619_D-1) Preds: [C:W-1(V618_D-1) ] Succ: [T:W-1(V620_D-1) ] T:W-1(V620_D-1) Preds: [T:W-1(V619_D-1) ] Succ: [G:W-1(V621_D-1) ] G:W-1(V621_D-1) Preds: [T:W-1(V620_D-1) ] Succ: [G:W-1(V622_D-1) ] G:W-1(V622_D-1) Preds: [G:W-1(V621_D-1) ] Succ: [T:W-1(V623_D-1) ] T:W-1(V623_D-1) Preds: [G:W-1(V622_D-1) ] Succ: [T:W-1(V624_D-1) ] T:W-1(V624_D-1) Preds: [T:W-1(V623_D-1) ] Succ: [A:W-1(V625_D-1) ] A:W-1(V625_D-1) Preds: [T:W-1(V624_D-1) ] Succ: [A:W-1(V626_D-1) ] A:W-1(V626_D-1) Preds: [A:W-1(V625_D-1) ] Succ: [G:W-1(V627_D-1) ] G:W-1(V627_D-1) Preds: [A:W-1(V626_D-1) ] Succ: [A:W-1(V628_D-1) ] A:W-1(V628_D-1) Preds: [G:W-1(V627_D-1) ] Succ: [C:W-1(V629_D-1) ] C:W-1(V629_D-1) Preds: [A:W-1(V628_D-1) ] Succ: [A:W-1(V630_D-1) ] A:W-1(V630_D-1) Preds: [C:W-1(V629_D-1) ] Succ: [A:W-1(V631_D-1) ] A:W-1(V631_D-1) Preds: [A:W-1(V630_D-1) ] Succ: [G:W-1(V632_D-1) ] G:W-1(V632_D-1) Preds: [A:W-1(V631_D-1) ] Succ: [G:W-1(V633_D-1) ] G:W-1(V633_D-1) Preds: [G:W-1(V632_D-1) ] Succ: [G:W-1(V634_D-1) ] G:W-1(V634_D-1) Preds: [G:W-1(V633_D-1) ] Succ: [G:W-1(V635_D-1) ] G:W-1(V635_D-1) Preds: [G:W-1(V634_D-1) ] Succ: [T:W-1(V636_D-1) ] T:W-1(V636_D-1) Preds: [G:W-1(V635_D-1) ] Succ: [T:W-1(V637_D-1) ] T:W-1(V637_D-1) Preds: [T:W-1(V636_D-1) ] Succ: [A:W-1(V638_D-1) ] A:W-1(V638_D-1) Preds: [T:W-1(V637_D-1) ] Succ: [G:W-1(V639_D-1) ] G:W-1(V639_D-1) Preds: [A:W-1(V638_D-1) ] Succ: [T:W-1(V640_D-1) ] T:W-1(V640_D-1) Preds: [G:W-1(V639_D-1) ] Succ: [G:W-1(V641_D-1) ] G:W-1(V641_D-1) Preds: [T:W-1(V640_D-1) ] Succ: [A:W-1(V642_D-1) ] A:W-1(V642_D-1) Preds: [G:W-1(V641_D-1) ] Succ: [C:W-1(V643_D-1) ] C:W-1(V643_D-1) Preds: [A:W-1(V642_D-1) ] Succ: [A:W-1(V644_D-1) ] A:W-1(V644_D-1) Preds: [C:W-1(V643_D-1) ] Succ: [A:W-1(V645_D-1) ] A:W-1(V645_D-1) Preds: [A:W-1(V644_D-1) ] Succ: [A:W-1(V646_D-1) ] A:W-1(V646_D-1) Preds: [A:W-1(V645_D-1) ] Succ: [G:W-1(V647_D-1) ] G:W-1(V647_D-1) Preds: [A:W-1(V646_D-1) ] Succ: [T:W-1(V648_D-1) ] T:W-1(V648_D-1) Preds: [G:W-1(V647_D-1) ] Succ: [A:W-1(V649_D-1) ] A:W-1(V649_D-1) Preds: [T:W-1(V648_D-1) ] Succ: [A:W-1(V650_D-1) ] A:W-1(V650_D-1) Preds: [A:W-1(V649_D-1) ] Succ: [A:W-1(V651_D-1) ] A:W-1(V651_D-1) Preds: [A:W-1(V650_D-1) ] Succ: [G:W-1(V652_D-1) ] G:W-1(V652_D-1) Preds: [A:W-1(V651_D-1) ] Succ: [A:W-1(V653_D-1) ] A:W-1(V653_D-1) Preds: [G:W-1(V652_D-1) ] Succ: [G:W-1(V654_D-1) ] G:W-1(V654_D-1) Preds: [A:W-1(V653_D-1) ] Succ: [G:W-1(V655_D-1) ] G:W-1(V655_D-1) Preds: [G:W-1(V654_D-1) ] Succ: [A:W-1(V656_D-1) ] A:W-1(V656_D-1) Preds: [G:W-1(V655_D-1) ] Succ: [T:W-1(V657_D-1) ] T:W-1(V657_D-1) Preds: [A:W-1(V656_D-1) ] Succ: [G:W-1(V658_D-1) ] G:W-1(V658_D-1) Preds: [T:W-1(V657_D-1) ] Succ: [A:W-1(V659_D-1) ] A:W-1(V659_D-1) Preds: [G:W-1(V658_D-1) ] Succ: [C:W-1(V660_D-1) ] C:W-1(V660_D-1) Preds: [A:W-1(V659_D-1) ] Succ: [A:W-1(V661_D-1) ] A:W-1(V661_D-1) Preds: [C:W-1(V660_D-1) ] Succ: [G:W-1(V662_D-1) ] G:W-1(V662_D-1) Preds: [A:W-1(V661_D-1) ] Succ: [A:W-1(V663_D-1) ] A:W-1(V663_D-1) Preds: [G:W-1(V662_D-1) ] Succ: [C:W-1(V664_D-1) ] C:W-1(V664_D-1) Preds: [A:W-1(V663_D-1) ] Succ: [T:W-1(V665_D-1) ] T:W-1(V665_D-1) Preds: [C:W-1(V664_D-1) ] Succ: [C:W-1(V666_D-1) ] C:W-1(V666_D-1) Preds: [T:W-1(V665_D-1) ] Succ: [T:W-1(V667_D-1) ] T:W-1(V667_D-1) Preds: [C:W-1(V666_D-1) ] Succ: [C:W-1(V668_D-1) ] C:W-1(V668_D-1) Preds: [T:W-1(V667_D-1) ] Succ: [T:W-1(V669_D-1) ] T:W-1(V669_D-1) Preds: [C:W-1(V668_D-1) ] Succ: [A:W-1(V670_D-1) ] A:W-1(V670_D-1) Preds: [T:W-1(V669_D-1) ] Succ: [A:W-1(V671_D-1) ] A:W-1(V671_D-1) Preds: [A:W-1(V670_D-1) ] Succ: [G:W-1(V672_D-1) ] G:W-1(V672_D-1) Preds: [A:W-1(V671_D-1) ] Succ: [G:W-1(V673_D-1) ] G:W-1(V673_D-1) Preds: [G:W-1(V672_D-1) ] Succ: [G:W-1(V674_D-1) ] G:W-1(V674_D-1) Preds: [G:W-1(V673_D-1) ] Succ: [A:W-1(V675_D-1) ] A:W-1(V675_D-1) Preds: [G:W-1(V674_D-1) ] Succ: [C:W-1(V676_D-1) ] C:W-1(V676_D-1) Preds: [A:W-1(V675_D-1) ] Succ: [A:W-1(V677_D-1) ] A:W-1(V677_D-1) Preds: [C:W-1(V676_D-1) ] Succ: [T:W-1(V678_D-1) ] T:W-1(V678_D-1) Preds: [A:W-1(V677_D-1) ] Succ: [A:W-1(V679_D-1) ] A:W-1(V679_D-1) Preds: [T:W-1(V678_D-1) ] Succ: [T:W-1(V680_D-1) ] T:W-1(V680_D-1) Preds: [A:W-1(V679_D-1) ] Succ: [G:W-1(V681_D-1) ] G:W-1(V681_D-1) Preds: [T:W-1(V680_D-1) ] Succ: [G:W-1(V682_D-1) ] G:W-1(V682_D-1) Preds: [G:W-1(V681_D-1) ] Succ: [G:W-1(V683_D-1) ] G:W-1(V683_D-1) Preds: [G:W-1(V682_D-1) ] Succ: [A:W-1(V684_D-1) ] A:W-1(V684_D-1) Preds: [G:W-1(V683_D-1) ] Succ: [G:W-1(V685_D-1) ] G:W-1(V685_D-1) Preds: [A:W-1(V684_D-1) ] Succ: [C:W-1(V686_D-1) ] C:W-1(V686_D-1) Preds: [G:W-1(V685_D-1) ] Succ: [T:W-1(V687_D-1) ] T:W-1(V687_D-1) Preds: [C:W-1(V686_D-1) ] Succ: [A:W-1(V688_D-1) ] A:W-1(V688_D-1) Preds: [T:W-1(V687_D-1) ] Succ: [C:W-1(V689_D-1) ] C:W-1(V689_D-1) Preds: [A:W-1(V688_D-1) ] Succ: [A:W-1(V690_D-1) ] A:W-1(V690_D-1) Preds: [C:W-1(V689_D-1) ] Succ: [T:W-1(V691_D-1) ] T:W-1(V691_D-1) Preds: [A:W-1(V690_D-1) ] Succ: [A:W-1(V692_D-1) ] A:W-1(V692_D-1) Preds: [T:W-1(V691_D-1) ] Succ: [G:W-1(V693_D-1) ] G:W-1(V693_D-1) Preds: [A:W-1(V692_D-1) ] Succ: [C:W-1(V694_D-1) ] C:W-1(V694_D-1) Preds: [G:W-1(V693_D-1) ] Succ: [C:W-1(V695_D-1) ] C:W-1(V695_D-1) Preds: [C:W-1(V694_D-1) ] Succ: [A:W-1(V696_D-1) ] A:W-1(V696_D-1) Preds: [C:W-1(V695_D-1) ] Succ: [G:W-1(V697_D-1) ] G:W-1(V697_D-1) Preds: [A:W-1(V696_D-1) ] Succ: [C:W-1(V698_D-1) ] C:W-1(V698_D-1) Preds: [G:W-1(V697_D-1) ] Succ: [C:W-1(V699_D-1) ] C:W-1(V699_D-1) Preds: [C:W-1(V698_D-1) ] Succ: [C:W-1(V700_D-1) ] C:W-1(V700_D-1) Preds: [C:W-1(V699_D-1) ] Succ: [C:W-1(V701_D-1) ] C:W-1(V701_D-1) Preds: [C:W-1(V700_D-1) ] Succ: [G:W-1(V702_D-1) ] G:W-1(V702_D-1) Preds: [C:W-1(V701_D-1) ] Succ: [T:W-1(V703_D-1) ] T:W-1(V703_D-1) Preds: [G:W-1(V702_D-1) ] Succ: [G:W-1(V704_D-1) ] G:W-1(V704_D-1) Preds: [T:W-1(V703_D-1) ] Succ: [G:W-1(V705_D-1) ] G:W-1(V705_D-1) Preds: [G:W-1(V704_D-1) ] Succ: [A:W-1(V706_D-1) ] A:W-1(V706_D-1) Preds: [G:W-1(V705_D-1) ] Succ: [G:W-1(V707_D-1) ] G:W-1(V707_D-1) Preds: [A:W-1(V706_D-1) ] Succ: [G:W-1(V708_D-1) ] G:W-1(V708_D-1) Preds: [G:W-1(V707_D-1) ] Succ: [G:W-1(V709_D-1) ] G:W-1(V709_D-1) Preds: [G:W-1(V708_D-1) ] Succ: [A:W-1(V710_D-1) ] A:W-1(V710_D-1) Preds: [G:W-1(V709_D-1) ] Succ: [G:W-1(V711_D-1) ] G:W-1(V711_D-1) Preds: [A:W-1(V710_D-1) ] Succ: [C:W-1(V712_D-1) ] C:W-1(V712_D-1) Preds: [G:W-1(V711_D-1) ] Succ: [C:W-1(V713_D-1) ] C:W-1(V713_D-1) Preds: [C:W-1(V712_D-1) ] Succ: [A:W-1(V714_D-1) ] A:W-1(V714_D-1) Preds: [C:W-1(V713_D-1) ] Succ: [C:W-1(V715_D-1) ] C:W-1(V715_D-1) Preds: [A:W-1(V714_D-1) ] Succ: [C:W-1(V716_D-1) ] C:W-1(V716_D-1) Preds: [C:W-1(V715_D-1) ] Succ: [A:W-1(V717_D-1) ] A:W-1(V717_D-1) Preds: [C:W-1(V716_D-1) C:W-1(V812_D-1) ] Succ: [G:W-1(V718_D-1) ] G:W-1(V718_D-1) Preds: [A:W-1(V717_D-1) ] Succ: [C:W-1(V719_D-1) ] C:W-1(V719_D-1) Preds: [G:W-1(V718_D-1) ] Succ: [C:W-1(V720_D-1) ] C:W-1(V720_D-1) Preds: [C:W-1(V719_D-1) ] Succ: [A:W-1(V721_D-1) ] A:W-1(V721_D-1) Preds: [C:W-1(V720_D-1) ] Succ: [C:W-1(V722_D-1) ] C:W-1(V722_D-1) Preds: [A:W-1(V721_D-1) ] Succ: [A:W-1(V723_D-1) ] A:W-1(V723_D-1) Preds: [C:W-1(V722_D-1) ] Succ: [G:W-1(V724_D-1) ] G:W-1(V724_D-1) Preds: [A:W-1(V723_D-1) ] Succ: [G:W-1(V725_D-1) ] G:W-1(V725_D-1) Preds: [G:W-1(V724_D-1) ] Succ: [T:W-1(V726_D-1) ] T:W-1(V726_D-1) Preds: [G:W-1(V725_D-1) ] Succ: [A:W-1(V727_D-1) ] A:W-1(V727_D-1) Preds: [T:W-1(V726_D-1) ] Succ: [C:W-1(V728_D-1) ] C:W-1(V728_D-1) Preds: [A:W-1(V727_D-1) ] Succ: [C:W-1(V729_D-1) ] C:W-1(V729_D-1) Preds: [C:W-1(V728_D-1) ] Succ: [T:W-1(V730_D-1) ] T:W-1(V730_D-1) Preds: [C:W-1(V729_D-1) ] Succ: [G:W-1(V731_D-1) ] G:W-1(V731_D-1) Preds: [T:W-1(V730_D-1) ] Succ: [A:W-1(V732_D-1) ] A:W-1(V732_D-1) Preds: [G:W-1(V731_D-1) ] Succ: [T:W-1(V733_D-1) ] T:W-1(V733_D-1) Preds: [A:W-1(V732_D-1) ] Succ: [G:W-1(V734_D-1) ] G:W-1(V734_D-1) Preds: [T:W-1(V733_D-1) ] Succ: [G:W-1(V735_D-1) ] G:W-1(V735_D-1) Preds: [G:W-1(V734_D-1) ] Succ: [A:W-1(V736_D-1) ] A:W-1(V736_D-1) Preds: [G:W-1(V735_D-1) ] Succ: [A:W-1(V737_D-1) ] A:W-1(V737_D-1) Preds: [A:W-1(V736_D-1) ] Succ: [A:W-1(V738_D-1) ] A:W-1(V738_D-1) Preds: [A:W-1(V737_D-1) ] Succ: [T:W-1(V739_D-1) ] T:W-1(V739_D-1) Preds: [A:W-1(V738_D-1) ] Succ: [G:W-1(V740_D-1) ] G:W-1(V740_D-1) Preds: [T:W-1(V739_D-1) ] Succ: [C:W-1(V741_D-1) ] C:W-1(V741_D-1) Preds: [G:W-1(V740_D-1) ] Succ: [C:W-1(V742_D-1) ] C:W-1(V742_D-1) Preds: [C:W-1(V741_D-1) ] Succ: [G:W-1(V743_D-1) ] G:W-1(V743_D-1) Preds: [C:W-1(V742_D-1) ] Succ: [G:W-1(V744_D-1) ] G:W-1(V744_D-1) Preds: [G:W-1(V743_D-1) ] Succ: [C:W-1(V745_D-1) ] C:W-1(V745_D-1) Preds: [G:W-1(V744_D-1) ] Succ: [T:W-1(V746_D-1) ] T:W-1(V746_D-1) Preds: [C:W-1(V745_D-1) ] Succ: [C:W-1(V747_D-1) ] C:W-1(V747_D-1) Preds: [T:W-1(V746_D-1) ] Succ: [A:W-1(V748_D-1) ] A:W-1(V748_D-1) Preds: [C:W-1(V747_D-1) ] Succ: [C:W-1(V749_D-1) ] C:W-1(V749_D-1) Preds: [A:W-1(V748_D-1) ] Succ: [T:W-1(V750_D-1) ] T:W-1(V750_D-1) Preds: [C:W-1(V749_D-1) ] Succ: [T:W-1(V751_D-1) ] T:W-1(V751_D-1) Preds: [T:W-1(V750_D-1) ] Succ: [C:W-1(V752_D-1) ] C:W-1(V752_D-1) Preds: [T:W-1(V751_D-1) ] Succ: [C:W-1(V753_D-1) ] C:W-1(V753_D-1) Preds: [C:W-1(V752_D-1) ] Succ: [T:W-1(V754_D-1) ] T:W-1(V754_D-1) Preds: [C:W-1(V753_D-1) ] Succ: [G:W-1(V755_D-1) ] G:W-1(V755_D-1) Preds: [T:W-1(V754_D-1) ] Succ: [T:W-1(V756_D-1) ] T:W-1(V756_D-1) Preds: [G:W-1(V755_D-1) ] Succ: [G:W-1(V757_D-1) ] G:W-1(V757_D-1) Preds: [T:W-1(V756_D-1) ] Succ: [A:W-1(V758_D-1) ] A:W-1(V758_D-1) Preds: [G:W-1(V757_D-1) ] Succ: [] GCTAGGGGAAATAGGGGAGCTCCA:W0(V786_D-1) Preds: [] Succ: [A:W-1(V787_D-1) ] A:W-1(V787_D-1) Preds: [GCTAGGGGAAATAGGGGAGCTCCA:W0(V786_D-1) ] Succ: [A:W-1(V788_D-1) ] A:W-1(V788_D-1) Preds: [A:W-1(V787_D-1) ] Succ: [C:W-1(V789_D-1) ] C:W-1(V789_D-1) Preds: [A:W-1(V788_D-1) ] Succ: [C:W-1(V790_D-1) ] C:W-1(V790_D-1) Preds: [C:W-1(V789_D-1) ] Succ: [C:W-1(V791_D-1) ] C:W-1(V791_D-1) Preds: [C:W-1(V790_D-1) ] Succ: [A:W-1(V792_D-1) ] A:W-1(V792_D-1) Preds: [C:W-1(V791_D-1) ] Succ: [G:W-1(V793_D-1) ] G:W-1(V793_D-1) Preds: [A:W-1(V792_D-1) ] Succ: [C:W-1(V794_D-1) ] C:W-1(V794_D-1) Preds: [G:W-1(V793_D-1) ] Succ: [C:W-1(V795_D-1) ] C:W-1(V795_D-1) Preds: [C:W-1(V794_D-1) ] Succ: [C:W-1(V796_D-1) ] C:W-1(V796_D-1) Preds: [C:W-1(V795_D-1) ] Succ: [C:W-1(V797_D-1) ] C:W-1(V797_D-1) Preds: [C:W-1(V796_D-1) ] Succ: [G:W-1(V798_D-1) ] G:W-1(V798_D-1) Preds: [C:W-1(V797_D-1) ] Succ: [T:W-1(V799_D-1) ] T:W-1(V799_D-1) Preds: [G:W-1(V798_D-1) ] Succ: [G:W-1(V800_D-1) ] G:W-1(V800_D-1) Preds: [T:W-1(V799_D-1) ] Succ: [G:W-1(V801_D-1) ] G:W-1(V801_D-1) Preds: [G:W-1(V800_D-1) ] Succ: [A:W-1(V802_D-1) ] A:W-1(V802_D-1) Preds: [G:W-1(V801_D-1) ] Succ: [G:W-1(V803_D-1) ] G:W-1(V803_D-1) Preds: [A:W-1(V802_D-1) ] Succ: [G:W-1(V804_D-1) ] G:W-1(V804_D-1) Preds: [G:W-1(V803_D-1) ] Succ: [G:W-1(V805_D-1) ] G:W-1(V805_D-1) Preds: [G:W-1(V804_D-1) ] Succ: [A:W-1(V806_D-1) ] A:W-1(V806_D-1) Preds: [G:W-1(V805_D-1) ] Succ: [G:W-1(V807_D-1) ] G:W-1(V807_D-1) Preds: [A:W-1(V806_D-1) ] Succ: [C:W-1(V808_D-1) ] C:W-1(V808_D-1) Preds: [G:W-1(V807_D-1) ] Succ: [C:W-1(V809_D-1) ] C:W-1(V809_D-1) Preds: [C:W-1(V808_D-1) ] Succ: [A:W-1(V810_D-1) ] A:W-1(V810_D-1) Preds: [C:W-1(V809_D-1) ] Succ: [C:W-1(V811_D-1) ] C:W-1(V811_D-1) Preds: [A:W-1(V810_D-1) ] Succ: [C:W-1(V812_D-1) ] C:W-1(V812_D-1) Preds: [C:W-1(V811_D-1) ] Succ: [A:W-1(V717_D-1) ] C:W-1(V813_D-1) Preds: [T:W-1(V524_D-1) ] Succ: [A:W-1(V814_D-1) ] A:W-1(V814_D-1) Preds: [C:W-1(V813_D-1) ] Succ: [G:W-1(V815_D-1) ] G:W-1(V815_D-1) Preds: [A:W-1(V814_D-1) ] Succ: [C:W-1(V816_D-1) ] C:W-1(V816_D-1) Preds: [G:W-1(V815_D-1) ] Succ: [A:W-1(V817_D-1) ] A:W-1(V817_D-1) Preds: [C:W-1(V816_D-1) ] Succ: [C:W-1(V818_D-1) ] C:W-1(V818_D-1) Preds: [A:W-1(V817_D-1) ] Succ: [T:W-1(V819_D-1) ] T:W-1(V819_D-1) Preds: [C:W-1(V818_D-1) ] Succ: [C:W-1(V820_D-1) ] C:W-1(V820_D-1) Preds: [T:W-1(V819_D-1) ] Succ: [T:W-1(V821_D-1) ] T:W-1(V821_D-1) Preds: [C:W-1(V820_D-1) ] Succ: [G:W-1(V822_D-1) ] G:W-1(V822_D-1) Preds: [T:W-1(V821_D-1) ] Succ: [A:W-1(V823_D-1) ] A:W-1(V823_D-1) Preds: [G:W-1(V822_D-1) ] Succ: [A:W-1(V824_D-1) ] A:W-1(V824_D-1) Preds: [A:W-1(V823_D-1) ] Succ: [C:W-1(V825_D-1) ] C:W-1(V825_D-1) Preds: [A:W-1(V824_D-1) ] Succ: [C:W-1(V826_D-1) ] C:W-1(V826_D-1) Preds: [C:W-1(V825_D-1) ] Succ: [C:W-1(V827_D-1) ] C:W-1(V827_D-1) Preds: [C:W-1(V826_D-1) ] Succ: [T:W-1(V828_D-1) ] T:W-1(V828_D-1) Preds: [C:W-1(V827_D-1) ] Succ: [G:W-1(V829_D-1) ] G:W-1(V829_D-1) Preds: [T:W-1(V828_D-1) ] Succ: [T:W-1(V830_D-1) ] T:W-1(V830_D-1) Preds: [G:W-1(V829_D-1) ] Succ: [G:W-1(V831_D-1) ] G:W-1(V831_D-1) Preds: [T:W-1(V830_D-1) ] Succ: [A:W-1(V832_D-1) ] A:W-1(V832_D-1) Preds: [G:W-1(V831_D-1) ] Succ: [G:W-1(V833_D-1) ] G:W-1(V833_D-1) Preds: [A:W-1(V832_D-1) ] Succ: [G:W-1(V834_D-1) ] G:W-1(V834_D-1) Preds: [G:W-1(V833_D-1) ] Succ: [C:W-1(V835_D-1) ] C:W-1(V835_D-1) Preds: [G:W-1(V834_D-1) ] Succ: [A:W-1(V836_D-1) ] A:W-1(V836_D-1) Preds: [C:W-1(V835_D-1) ] Succ: [A:W-1(V549_D-1) ] G:W-1(V885_D-1) Preds: [G:W-1(V415_D-1) ] Succ: [C:W-1(V886_D-1) ] C:W-1(V886_D-1) Preds: [G:W-1(V885_D-1) ] Succ: [T:W-1(V887_D-1) ] T:W-1(V887_D-1) Preds: [C:W-1(V886_D-1) ] Succ: [C:W-1(V888_D-1) ] C:W-1(V888_D-1) Preds: [T:W-1(V887_D-1) ] Succ: [A:W-1(V889_D-1) ] A:W-1(V889_D-1) Preds: [C:W-1(V888_D-1) ] Succ: [T:W-1(V890_D-1) ] T:W-1(V890_D-1) Preds: [A:W-1(V889_D-1) ] Succ: [C:W-1(V891_D-1) ] C:W-1(V891_D-1) Preds: [T:W-1(V890_D-1) ] Succ: [A:W-1(V892_D-1) ] A:W-1(V892_D-1) Preds: [C:W-1(V891_D-1) ] Succ: [G:W-1(V893_D-1) ] G:W-1(V893_D-1) Preds: [A:W-1(V892_D-1) ] Succ: [C:W-1(V894_D-1) ] C:W-1(V894_D-1) Preds: [G:W-1(V893_D-1) ] Succ: [A:W-1(V895_D-1) ] A:W-1(V895_D-1) Preds: [C:W-1(V894_D-1) ] Succ: [A:W-1(V896_D-1) ] A:W-1(V896_D-1) Preds: [A:W-1(V895_D-1) ] Succ: [G:W-1(V897_D-1) ] G:W-1(V897_D-1) Preds: [A:W-1(V896_D-1) ] Succ: [A:W-1(V898_D-1) ] A:W-1(V898_D-1) Preds: [G:W-1(V897_D-1) ] Succ: [A:W-1(V899_D-1) ] A:W-1(V899_D-1) Preds: [A:W-1(V898_D-1) ] Succ: [G:W-1(V900_D-1) ] G:W-1(V900_D-1) Preds: [A:W-1(V899_D-1) ] Succ: [A:W-1(V901_D-1) ] A:W-1(V901_D-1) Preds: [G:W-1(V900_D-1) ] Succ: [A:W-1(V902_D-1) ] A:W-1(V902_D-1) Preds: [A:W-1(V901_D-1) ] Succ: [A:W-1(V903_D-1) ] A:W-1(V903_D-1) Preds: [A:W-1(V902_D-1) ] Succ: [T:W-1(V904_D-1) ] T:W-1(V904_D-1) Preds: [A:W-1(V903_D-1) ] Succ: [C:W-1(V905_D-1) ] C:W-1(V905_D-1) Preds: [T:W-1(V904_D-1) ] Succ: [T:W-1(V906_D-1) ] T:W-1(V906_D-1) Preds: [C:W-1(V905_D-1) ] Succ: [T:W-1(V907_D-1) ] T:W-1(V907_D-1) Preds: [T:W-1(V906_D-1) ] Succ: [T:W-1(V908_D-1) ] T:W-1(V908_D-1) Preds: [T:W-1(V907_D-1) ] Succ: [C:W-1(V440_D-1) ] AGAATACAAAATGCCTTCCTCCAG:W0(V945_D-1) Preds: [] Succ: [C:W-1(V946_D-1) ] C:W-1(V946_D-1) Preds: [AGAATACAAAATGCCTTCCTCCAG:W0(V945_D-1) ] Succ: [C:W-1(V947_D-1) ] C:W-1(V947_D-1) Preds: [C:W-1(V946_D-1) ] Succ: [T:W-1(V948_D-1) ] T:W-1(V948_D-1) Preds: [C:W-1(V947_D-1) ] Succ: [C:W-1(V949_D-1) ] C:W-1(V949_D-1) Preds: [T:W-1(V948_D-1) ] Succ: [A:W-1(V950_D-1) ] A:W-1(V950_D-1) Preds: [C:W-1(V949_D-1) ] Succ: [T:W-1(V951_D-1) ] T:W-1(V951_D-1) Preds: [A:W-1(V950_D-1) ] Succ: [C:W-1(V952_D-1) ] C:W-1(V952_D-1) Preds: [T:W-1(V951_D-1) ] Succ: [A:W-1(V953_D-1) ] A:W-1(V953_D-1) Preds: [C:W-1(V952_D-1) ] Succ: [G:W-1(V954_D-1) ] G:W-1(V954_D-1) Preds: [A:W-1(V953_D-1) ] Succ: [C:W-1(V955_D-1) ] C:W-1(V955_D-1) Preds: [G:W-1(V954_D-1) ] Succ: [A:W-1(V956_D-1) ] A:W-1(V956_D-1) Preds: [C:W-1(V955_D-1) ] Succ: [G:W-1(V957_D-1) ] G:W-1(V957_D-1) Preds: [A:W-1(V956_D-1) ] Succ: [G:W-1(V958_D-1) ] G:W-1(V958_D-1) Preds: [G:W-1(V957_D-1) ] Succ: [A:W-1(V959_D-1) ] A:W-1(V959_D-1) Preds: [G:W-1(V958_D-1) ] Succ: [A:W-1(V960_D-1) ] A:W-1(V960_D-1) Preds: [A:W-1(V959_D-1) ] Succ: [G:W-1(V961_D-1) ] G:W-1(V961_D-1) Preds: [A:W-1(V960_D-1) ] Succ: [A:W-1(V962_D-1) ] A:W-1(V962_D-1) Preds: [G:W-1(V961_D-1) ] Succ: [A:W-1(V963_D-1) ] A:W-1(V963_D-1) Preds: [A:W-1(V962_D-1) ] Succ: [A:W-1(V964_D-1) ] A:W-1(V964_D-1) Preds: [A:W-1(V963_D-1) ] Succ: [T:W-1(V965_D-1) ] T:W-1(V965_D-1) Preds: [A:W-1(V964_D-1) ] Succ: [C:W-1(V966_D-1) ] C:W-1(V966_D-1) Preds: [T:W-1(V965_D-1) ] Succ: [T:W-1(V967_D-1) ] T:W-1(V967_D-1) Preds: [C:W-1(V966_D-1) ] Succ: [T:W-1(V968_D-1) ] T:W-1(V968_D-1) Preds: [T:W-1(V967_D-1) ] Succ: [T:W-1(V969_D-1) ] T:W-1(V969_D-1) Preds: [T:W-1(V968_D-1) ] Succ: [C:W-1(V970_D-1) ] C:W-1(V970_D-1) Preds: [T:W-1(V969_D-1) ] Succ: [T:W-1(V971_D-1) ] T:W-1(V971_D-1) Preds: [C:W-1(V970_D-1) ] Succ: [T:W-1(V972_D-1) ] T:W-1(V972_D-1) Preds: [T:W-1(V971_D-1) ] Succ: [T:W-1(V973_D-1) ] T:W-1(V973_D-1) Preds: [T:W-1(V972_D-1) ] Succ: [C:W-1(V974_D-1) ] C:W-1(V974_D-1) Preds: [T:W-1(V973_D-1) ] Succ: [C:W-1(V975_D-1) ] C:W-1(V975_D-1) Preds: [C:W-1(V974_D-1) ] Succ: [A:W-1(V976_D-1) ] A:W-1(V976_D-1) Preds: [C:W-1(V975_D-1) ] Succ: [A:W-1(V977_D-1) ] A:W-1(V977_D-1) Preds: [A:W-1(V976_D-1) ] Succ: [G:W-1(V978_D-1) ] G:W-1(V978_D-1) Preds: [A:W-1(V977_D-1) ] Succ: [T:W-1(V979_D-1) ] T:W-1(V979_D-1) Preds: [G:W-1(V978_D-1) ] Succ: [A:W-1(V980_D-1) ] A:W-1(V980_D-1) Preds: [T:W-1(V979_D-1) ] Succ: [G:W-1(V451_D-1) ] compactLinearPaths() SECTION ================= COMPACTING THE GRAPH ================= Found potential edge: Edge(380->381,w:2.0) between GGCCACACGATGGCTTATCACGTC:W0(V380_D-1) and C:W-1(V381_D-1) removing vertex C:W-1(V381_D-1) was concatenated into GGCCACACGATGGCTTATCACGTCC:W0(V380_D-1) Want to move edge Edge(381->382,w:2.0)(C:W-1(V381_D-1)->A:W-1(V382_D-1)) to (GGCCACACGATGGCTTATCACGTCC:W0(V380_D-1)->A:W-1(V382_D-1) adding edge: GGCCACACGATGGCTTATCACGTCC:W0(V380_D-1) to A:W-1(V382_D-1) removing edge Edge(381->382,w:2.0)(C:W-1(V381_D-1)->A:W-1(V382_D-1)) removing edge Edge(380->381,w:2.0)(GGCCACACGATGGCTTATCACGTCC:W0(V380_D-1)->C:W-1(V381_D-1)) Found potential edge: Edge(380->382,w:2.0) between GGCCACACGATGGCTTATCACGTCC:W0(V380_D-1) and A:W-1(V382_D-1) removing vertex A:W-1(V382_D-1) was concatenated into GGCCACACGATGGCTTATCACGTCCA:W0(V380_D-1) Want to move edge Edge(382->383,w:2.0)(A:W-1(V382_D-1)->C:W-1(V383_D-1)) to (GGCCACACGATGGCTTATCACGTCCA:W0(V380_D-1)->C:W-1(V383_D-1) adding edge: GGCCACACGATGGCTTATCACGTCCA:W0(V380_D-1) to C:W-1(V383_D-1) removing edge Edge(382->383,w:2.0)(A:W-1(V382_D-1)->C:W-1(V383_D-1)) removing edge Edge(380->382,w:2.0)(GGCCACACGATGGCTTATCACGTCCA:W0(V380_D-1)->A:W-1(V382_D-1)) Found potential edge: Edge(380->383,w:2.0) between GGCCACACGATGGCTTATCACGTCCA:W0(V380_D-1) and C:W-1(V383_D-1) removing vertex C:W-1(V383_D-1) was concatenated into GGCCACACGATGGCTTATCACGTCCAC:W0(V380_D-1) Want to move edge Edge(383->384,w:2.0)(C:W-1(V383_D-1)->A:W-1(V384_D-1)) to (GGCCACACGATGGCTTATCACGTCCAC:W0(V380_D-1)->A:W-1(V384_D-1) adding edge: GGCCACACGATGGCTTATCACGTCCAC:W0(V380_D-1) to A:W-1(V384_D-1) removing edge Edge(383->384,w:2.0)(C:W-1(V383_D-1)->A:W-1(V384_D-1)) removing edge Edge(380->383,w:2.0)(GGCCACACGATGGCTTATCACGTCCAC:W0(V380_D-1)->C:W-1(V383_D-1)) Found potential edge: Edge(380->384,w:2.0) between GGCCACACGATGGCTTATCACGTCCAC:W0(V380_D-1) and A:W-1(V384_D-1) removing vertex A:W-1(V384_D-1) was concatenated into GGCCACACGATGGCTTATCACGTCCACA:W0(V380_D-1) Want to move edge Edge(384->385,w:2.0)(A:W-1(V384_D-1)->T:W-1(V385_D-1)) to (GGCCACACGATGGCTTATCACGTCCACA:W0(V380_D-1)->T:W-1(V385_D-1) adding edge: GGCCACACGATGGCTTATCACGTCCACA:W0(V380_D-1) to T:W-1(V385_D-1) removing edge Edge(384->385,w:2.0)(A:W-1(V384_D-1)->T:W-1(V385_D-1)) removing edge Edge(380->384,w:2.0)(GGCCACACGATGGCTTATCACGTCCACA:W0(V380_D-1)->A:W-1(V384_D-1)) Found potential edge: Edge(380->385,w:2.0) between GGCCACACGATGGCTTATCACGTCCACA:W0(V380_D-1) and T:W-1(V385_D-1) removing vertex T:W-1(V385_D-1) was concatenated into GGCCACACGATGGCTTATCACGTCCACAT:W0(V380_D-1) Want to move edge Edge(385->386,w:2.0)(T:W-1(V385_D-1)->T:W-1(V386_D-1)) to (GGCCACACGATGGCTTATCACGTCCACAT:W0(V380_D-1)->T:W-1(V386_D-1) adding edge: GGCCACACGATGGCTTATCACGTCCACAT:W0(V380_D-1) to T:W-1(V386_D-1) removing edge Edge(385->386,w:2.0)(T:W-1(V385_D-1)->T:W-1(V386_D-1)) removing edge Edge(380->385,w:2.0)(GGCCACACGATGGCTTATCACGTCCACAT:W0(V380_D-1)->T:W-1(V385_D-1)) Found potential edge: Edge(380->386,w:2.0) between GGCCACACGATGGCTTATCACGTCCACAT:W0(V380_D-1) and T:W-1(V386_D-1) removing vertex T:W-1(V386_D-1) was concatenated into GGCCACACGATGGCTTATCACGTCCACATT:W0(V380_D-1) Want to move edge Edge(386->387,w:2.0)(T:W-1(V386_D-1)->T:W-1(V387_D-1)) to (GGCCACACGATGGCTTATCACGTCCACATT:W0(V380_D-1)->T:W-1(V387_D-1) adding edge: GGCCACACGATGGCTTATCACGTCCACATT:W0(V380_D-1) to T:W-1(V387_D-1) removing edge Edge(386->387,w:2.0)(T:W-1(V386_D-1)->T:W-1(V387_D-1)) removing edge Edge(380->386,w:2.0)(GGCCACACGATGGCTTATCACGTCCACATT:W0(V380_D-1)->T:W-1(V386_D-1)) Found potential edge: Edge(380->387,w:2.0) between GGCCACACGATGGCTTATCACGTCCACATT:W0(V380_D-1) and T:W-1(V387_D-1) removing vertex T:W-1(V387_D-1) was concatenated into GGCCACACGA...GTCCACATTT:W0(V380_D-1) Want to move edge Edge(387->388,w:2.0)(T:W-1(V387_D-1)->C:W-1(V388_D-1)) to (GGCCACACGA...GTCCACATTT:W0(V380_D-1)->C:W-1(V388_D-1) adding edge: GGCCACACGA...GTCCACATTT:W0(V380_D-1) to C:W-1(V388_D-1) removing edge Edge(387->388,w:2.0)(T:W-1(V387_D-1)->C:W-1(V388_D-1)) removing edge Edge(380->387,w:2.0)(GGCCACACGA...GTCCACATTT:W0(V380_D-1)->T:W-1(V387_D-1)) Found potential edge: Edge(380->388,w:2.0) between GGCCACACGA...GTCCACATTT:W0(V380_D-1) and C:W-1(V388_D-1) removing vertex C:W-1(V388_D-1) was concatenated into GGCCACACGA...TCCACATTTC:W1(V380_D-1) Want to move edge Edge(388->389,w:2.0)(C:W-1(V388_D-1)->T:W-1(V389_D-1)) to (GGCCACACGA...TCCACATTTC:W1(V380_D-1)->T:W-1(V389_D-1) adding edge: GGCCACACGA...TCCACATTTC:W1(V380_D-1) to T:W-1(V389_D-1) removing edge Edge(388->389,w:2.0)(C:W-1(V388_D-1)->T:W-1(V389_D-1)) removing edge Edge(380->388,w:2.0)(GGCCACACGA...TCCACATTTC:W1(V380_D-1)->C:W-1(V388_D-1)) Found potential edge: Edge(380->389,w:2.0) between GGCCACACGA...TCCACATTTC:W1(V380_D-1) and T:W-1(V389_D-1) removing vertex T:W-1(V389_D-1) was concatenated into GGCCACACGA...CCACATTTCT:W1(V380_D-1) Want to move edge Edge(389->390,w:2.0)(T:W-1(V389_D-1)->A:W-1(V390_D-1)) to (GGCCACACGA...CCACATTTCT:W1(V380_D-1)->A:W-1(V390_D-1) adding edge: GGCCACACGA...CCACATTTCT:W1(V380_D-1) to A:W-1(V390_D-1) removing edge Edge(389->390,w:2.0)(T:W-1(V389_D-1)->A:W-1(V390_D-1)) removing edge Edge(380->389,w:2.0)(GGCCACACGA...CCACATTTCT:W1(V380_D-1)->T:W-1(V389_D-1)) Found potential edge: Edge(380->390,w:2.0) between GGCCACACGA...CCACATTTCT:W1(V380_D-1) and A:W-1(V390_D-1) removing vertex A:W-1(V390_D-1) was concatenated into GGCCACACGA...CACATTTCTA:W1(V380_D-1) Want to move edge Edge(390->391,w:2.0)(A:W-1(V390_D-1)->C:W-1(V391_D-1)) to (GGCCACACGA...CACATTTCTA:W1(V380_D-1)->C:W-1(V391_D-1) adding edge: GGCCACACGA...CACATTTCTA:W1(V380_D-1) to C:W-1(V391_D-1) removing edge Edge(390->391,w:2.0)(A:W-1(V390_D-1)->C:W-1(V391_D-1)) removing edge Edge(380->390,w:2.0)(GGCCACACGA...CACATTTCTA:W1(V380_D-1)->A:W-1(V390_D-1)) Found potential edge: Edge(380->391,w:2.0) between GGCCACACGA...CACATTTCTA:W1(V380_D-1) and C:W-1(V391_D-1) removing vertex C:W-1(V391_D-1) was concatenated into GGCCACACGA...ACATTTCTAC:W1(V380_D-1) Want to move edge Edge(391->392,w:2.0)(C:W-1(V391_D-1)->T:W-1(V392_D-1)) to (GGCCACACGA...ACATTTCTAC:W1(V380_D-1)->T:W-1(V392_D-1) adding edge: GGCCACACGA...ACATTTCTAC:W1(V380_D-1) to T:W-1(V392_D-1) removing edge Edge(391->392,w:2.0)(C:W-1(V391_D-1)->T:W-1(V392_D-1)) removing edge Edge(380->391,w:2.0)(GGCCACACGA...ACATTTCTAC:W1(V380_D-1)->C:W-1(V391_D-1)) Found potential edge: Edge(380->392,w:2.0) between GGCCACACGA...ACATTTCTAC:W1(V380_D-1) and T:W-1(V392_D-1) removing vertex T:W-1(V392_D-1) was concatenated into GGCCACACGA...CATTTCTACT:W1(V380_D-1) Want to move edge Edge(392->393,w:2.0)(T:W-1(V392_D-1)->G:W-1(V393_D-1)) to (GGCCACACGA...CATTTCTACT:W1(V380_D-1)->G:W-1(V393_D-1) adding edge: GGCCACACGA...CATTTCTACT:W1(V380_D-1) to G:W-1(V393_D-1) removing edge Edge(392->393,w:2.0)(T:W-1(V392_D-1)->G:W-1(V393_D-1)) removing edge Edge(380->392,w:2.0)(GGCCACACGA...CATTTCTACT:W1(V380_D-1)->T:W-1(V392_D-1)) Found potential edge: Edge(380->393,w:2.0) between GGCCACACGA...CATTTCTACT:W1(V380_D-1) and G:W-1(V393_D-1) removing vertex G:W-1(V393_D-1) was concatenated into GGCCACACGA...ATTTCTACTG:W1(V380_D-1) Want to move edge Edge(393->394,w:2.0)(G:W-1(V393_D-1)->G:W-1(V394_D-1)) to (GGCCACACGA...ATTTCTACTG:W1(V380_D-1)->G:W-1(V394_D-1) adding edge: GGCCACACGA...ATTTCTACTG:W1(V380_D-1) to G:W-1(V394_D-1) removing edge Edge(393->394,w:2.0)(G:W-1(V393_D-1)->G:W-1(V394_D-1)) removing edge Edge(380->393,w:2.0)(GGCCACACGA...ATTTCTACTG:W1(V380_D-1)->G:W-1(V393_D-1)) Found potential edge: Edge(380->394,w:2.0) between GGCCACACGA...ATTTCTACTG:W1(V380_D-1) and G:W-1(V394_D-1) removing vertex G:W-1(V394_D-1) was concatenated into GGCCACACGA...TTTCTACTGG:W1(V380_D-1) Want to move edge Edge(394->395,w:2.0)(G:W-1(V394_D-1)->C:W-1(V395_D-1)) to (GGCCACACGA...TTTCTACTGG:W1(V380_D-1)->C:W-1(V395_D-1) adding edge: GGCCACACGA...TTTCTACTGG:W1(V380_D-1) to C:W-1(V395_D-1) removing edge Edge(394->395,w:2.0)(G:W-1(V394_D-1)->C:W-1(V395_D-1)) removing edge Edge(380->394,w:2.0)(GGCCACACGA...TTTCTACTGG:W1(V380_D-1)->G:W-1(V394_D-1)) Found potential edge: Edge(380->395,w:2.0) between GGCCACACGA...TTTCTACTGG:W1(V380_D-1) and C:W-1(V395_D-1) removing vertex C:W-1(V395_D-1) was concatenated into GGCCACACGA...TTCTACTGGC:W1(V380_D-1) Want to move edge Edge(395->396,w:2.0)(C:W-1(V395_D-1)->T:W-1(V396_D-1)) to (GGCCACACGA...TTCTACTGGC:W1(V380_D-1)->T:W-1(V396_D-1) adding edge: GGCCACACGA...TTCTACTGGC:W1(V380_D-1) to T:W-1(V396_D-1) removing edge Edge(395->396,w:2.0)(C:W-1(V395_D-1)->T:W-1(V396_D-1)) removing edge Edge(380->395,w:2.0)(GGCCACACGA...TTCTACTGGC:W1(V380_D-1)->C:W-1(V395_D-1)) Found potential edge: Edge(380->396,w:2.0) between GGCCACACGA...TTCTACTGGC:W1(V380_D-1) and T:W-1(V396_D-1) removing vertex T:W-1(V396_D-1) was concatenated into GGCCACACGA...TCTACTGGCT:W1(V380_D-1) Want to move edge Edge(396->397,w:2.0)(T:W-1(V396_D-1)->A:W-1(V397_D-1)) to (GGCCACACGA...TCTACTGGCT:W1(V380_D-1)->A:W-1(V397_D-1) adding edge: GGCCACACGA...TCTACTGGCT:W1(V380_D-1) to A:W-1(V397_D-1) removing edge Edge(396->397,w:2.0)(T:W-1(V396_D-1)->A:W-1(V397_D-1)) removing edge Edge(380->396,w:2.0)(GGCCACACGA...TCTACTGGCT:W1(V380_D-1)->T:W-1(V396_D-1)) Found potential edge: Edge(380->397,w:2.0) between GGCCACACGA...TCTACTGGCT:W1(V380_D-1) and A:W-1(V397_D-1) removing vertex A:W-1(V397_D-1) was concatenated into GGCCACACGA...CTACTGGCTA:W1(V380_D-1) Want to move edge Edge(397->398,w:2.0)(A:W-1(V397_D-1)->C:W-1(V398_D-1)) to (GGCCACACGA...CTACTGGCTA:W1(V380_D-1)->C:W-1(V398_D-1) adding edge: GGCCACACGA...CTACTGGCTA:W1(V380_D-1) to C:W-1(V398_D-1) removing edge Edge(397->398,w:2.0)(A:W-1(V397_D-1)->C:W-1(V398_D-1)) removing edge Edge(380->397,w:2.0)(GGCCACACGA...CTACTGGCTA:W1(V380_D-1)->A:W-1(V397_D-1)) Found potential edge: Edge(380->398,w:2.0) between GGCCACACGA...CTACTGGCTA:W1(V380_D-1) and C:W-1(V398_D-1) removing vertex C:W-1(V398_D-1) was concatenated into GGCCACACGA...TACTGGCTAC:W1(V380_D-1) Want to move edge Edge(398->399,w:2.0)(C:W-1(V398_D-1)->A:W-1(V399_D-1)) to (GGCCACACGA...TACTGGCTAC:W1(V380_D-1)->A:W-1(V399_D-1) adding edge: GGCCACACGA...TACTGGCTAC:W1(V380_D-1) to A:W-1(V399_D-1) removing edge Edge(398->399,w:2.0)(C:W-1(V398_D-1)->A:W-1(V399_D-1)) removing edge Edge(380->398,w:2.0)(GGCCACACGA...TACTGGCTAC:W1(V380_D-1)->C:W-1(V398_D-1)) Found potential edge: Edge(380->399,w:2.0) between GGCCACACGA...TACTGGCTAC:W1(V380_D-1) and A:W-1(V399_D-1) removing vertex A:W-1(V399_D-1) was concatenated into GGCCACACGA...ACTGGCTACA:W1(V380_D-1) Want to move edge Edge(399->400,w:2.0)(A:W-1(V399_D-1)->A:W-1(V400_D-1)) to (GGCCACACGA...ACTGGCTACA:W1(V380_D-1)->A:W-1(V400_D-1) adding edge: GGCCACACGA...ACTGGCTACA:W1(V380_D-1) to A:W-1(V400_D-1) removing edge Edge(399->400,w:2.0)(A:W-1(V399_D-1)->A:W-1(V400_D-1)) removing edge Edge(380->399,w:2.0)(GGCCACACGA...ACTGGCTACA:W1(V380_D-1)->A:W-1(V399_D-1)) Found potential edge: Edge(380->400,w:2.0) between GGCCACACGA...ACTGGCTACA:W1(V380_D-1) and A:W-1(V400_D-1) removing vertex A:W-1(V400_D-1) was concatenated into GGCCACACGA...CTGGCTACAA:W1(V380_D-1) Want to move edge Edge(400->401,w:2.0)(A:W-1(V400_D-1)->A:W-1(V401_D-1)) to (GGCCACACGA...CTGGCTACAA:W1(V380_D-1)->A:W-1(V401_D-1) adding edge: GGCCACACGA...CTGGCTACAA:W1(V380_D-1) to A:W-1(V401_D-1) removing edge Edge(400->401,w:2.0)(A:W-1(V400_D-1)->A:W-1(V401_D-1)) removing edge Edge(380->400,w:2.0)(GGCCACACGA...CTGGCTACAA:W1(V380_D-1)->A:W-1(V400_D-1)) Found potential edge: Edge(380->401,w:2.0) between GGCCACACGA...CTGGCTACAA:W1(V380_D-1) and A:W-1(V401_D-1) removing vertex A:W-1(V401_D-1) was concatenated into GGCCACACGA...TGGCTACAAA:W1(V380_D-1) Want to move edge Edge(401->402,w:4.0)(A:W-1(V401_D-1)->C:W-1(V402_D-1)) to (GGCCACACGA...TGGCTACAAA:W1(V380_D-1)->C:W-1(V402_D-1) adding edge: GGCCACACGA...TGGCTACAAA:W1(V380_D-1) to C:W-1(V402_D-1) removing edge Edge(401->402,w:4.0)(A:W-1(V401_D-1)->C:W-1(V402_D-1)) removing edge Edge(380->401,w:2.0)(GGCCACACGA...TGGCTACAAA:W1(V380_D-1)->A:W-1(V401_D-1)) Found potential edge: Edge(380->402,w:4.0) between GGCCACACGA...TGGCTACAAA:W1(V380_D-1) and C:W-1(V402_D-1) removing vertex C:W-1(V402_D-1) was concatenated into GGCCACACGA...GGCTACAAAC:W1(V380_D-1) Want to move edge Edge(402->403,w:4.0)(C:W-1(V402_D-1)->A:W-1(V403_D-1)) to (GGCCACACGA...GGCTACAAAC:W1(V380_D-1)->A:W-1(V403_D-1) adding edge: GGCCACACGA...GGCTACAAAC:W1(V380_D-1) to A:W-1(V403_D-1) removing edge Edge(402->403,w:4.0)(C:W-1(V402_D-1)->A:W-1(V403_D-1)) removing edge Edge(380->402,w:4.0)(GGCCACACGA...GGCTACAAAC:W1(V380_D-1)->C:W-1(V402_D-1)) Found potential edge: Edge(380->403,w:4.0) between GGCCACACGA...GGCTACAAAC:W1(V380_D-1) and A:W-1(V403_D-1) removing vertex A:W-1(V403_D-1) was concatenated into GGCCACACGA...GCTACAAACA:W1(V380_D-1) Want to move edge Edge(403->404,w:4.0)(A:W-1(V403_D-1)->G:W-1(V404_D-1)) to (GGCCACACGA...GCTACAAACA:W1(V380_D-1)->G:W-1(V404_D-1) adding edge: GGCCACACGA...GCTACAAACA:W1(V380_D-1) to G:W-1(V404_D-1) removing edge Edge(403->404,w:4.0)(A:W-1(V403_D-1)->G:W-1(V404_D-1)) removing edge Edge(380->403,w:4.0)(GGCCACACGA...GCTACAAACA:W1(V380_D-1)->A:W-1(V403_D-1)) Found potential edge: Edge(380->404,w:4.0) between GGCCACACGA...GCTACAAACA:W1(V380_D-1) and G:W-1(V404_D-1) removing vertex G:W-1(V404_D-1) was concatenated into GGCCACACGA...CTACAAACAG:W1(V380_D-1) Want to move edge Edge(404->405,w:4.0)(G:W-1(V404_D-1)->A:W-1(V405_D-1)) to (GGCCACACGA...CTACAAACAG:W1(V380_D-1)->A:W-1(V405_D-1) adding edge: GGCCACACGA...CTACAAACAG:W1(V380_D-1) to A:W-1(V405_D-1) removing edge Edge(404->405,w:4.0)(G:W-1(V404_D-1)->A:W-1(V405_D-1)) removing edge Edge(380->404,w:4.0)(GGCCACACGA...CTACAAACAG:W1(V380_D-1)->G:W-1(V404_D-1)) Found potential edge: Edge(380->405,w:4.0) between GGCCACACGA...CTACAAACAG:W1(V380_D-1) and A:W-1(V405_D-1) removing vertex A:W-1(V405_D-1) was concatenated into GGCCACACGA...TACAAACAGA:W1(V380_D-1) Want to move edge Edge(405->406,w:4.0)(A:W-1(V405_D-1)->C:W-1(V406_D-1)) to (GGCCACACGA...TACAAACAGA:W1(V380_D-1)->C:W-1(V406_D-1) adding edge: GGCCACACGA...TACAAACAGA:W1(V380_D-1) to C:W-1(V406_D-1) removing edge Edge(405->406,w:4.0)(A:W-1(V405_D-1)->C:W-1(V406_D-1)) removing edge Edge(380->405,w:4.0)(GGCCACACGA...TACAAACAGA:W1(V380_D-1)->A:W-1(V405_D-1)) Found potential edge: Edge(380->406,w:4.0) between GGCCACACGA...TACAAACAGA:W1(V380_D-1) and C:W-1(V406_D-1) removing vertex C:W-1(V406_D-1) was concatenated into GGCCACACGA...ACAAACAGAC:W1(V380_D-1) Want to move edge Edge(406->407,w:4.0)(C:W-1(V406_D-1)->T:W-1(V407_D-1)) to (GGCCACACGA...ACAAACAGAC:W1(V380_D-1)->T:W-1(V407_D-1) adding edge: GGCCACACGA...ACAAACAGAC:W1(V380_D-1) to T:W-1(V407_D-1) removing edge Edge(406->407,w:4.0)(C:W-1(V406_D-1)->T:W-1(V407_D-1)) removing edge Edge(380->406,w:4.0)(GGCCACACGA...ACAAACAGAC:W1(V380_D-1)->C:W-1(V406_D-1)) Found potential edge: Edge(380->407,w:4.0) between GGCCACACGA...ACAAACAGAC:W1(V380_D-1) and T:W-1(V407_D-1) removing vertex T:W-1(V407_D-1) was concatenated into GGCCACACGA...CAAACAGACT:W1(V380_D-1) Want to move edge Edge(407->408,w:4.0)(T:W-1(V407_D-1)->T:W-1(V408_D-1)) to (GGCCACACGA...CAAACAGACT:W1(V380_D-1)->T:W-1(V408_D-1) adding edge: GGCCACACGA...CAAACAGACT:W1(V380_D-1) to T:W-1(V408_D-1) removing edge Edge(407->408,w:4.0)(T:W-1(V407_D-1)->T:W-1(V408_D-1)) removing edge Edge(380->407,w:4.0)(GGCCACACGA...CAAACAGACT:W1(V380_D-1)->T:W-1(V407_D-1)) Found potential edge: Edge(380->408,w:4.0) between GGCCACACGA...CAAACAGACT:W1(V380_D-1) and T:W-1(V408_D-1) removing vertex T:W-1(V408_D-1) was concatenated into GGCCACACGA...AAACAGACTT:W1(V380_D-1) Want to move edge Edge(408->409,w:4.0)(T:W-1(V408_D-1)->C:W-1(V409_D-1)) to (GGCCACACGA...AAACAGACTT:W1(V380_D-1)->C:W-1(V409_D-1) adding edge: GGCCACACGA...AAACAGACTT:W1(V380_D-1) to C:W-1(V409_D-1) removing edge Edge(408->409,w:4.0)(T:W-1(V408_D-1)->C:W-1(V409_D-1)) removing edge Edge(380->408,w:4.0)(GGCCACACGA...AAACAGACTT:W1(V380_D-1)->T:W-1(V408_D-1)) Found potential edge: Edge(380->409,w:4.0) between GGCCACACGA...AAACAGACTT:W1(V380_D-1) and C:W-1(V409_D-1) removing vertex C:W-1(V409_D-1) was concatenated into GGCCACACGA...AACAGACTTC:W1(V380_D-1) Want to move edge Edge(409->410,w:4.0)(C:W-1(V409_D-1)->C:W-1(V410_D-1)) to (GGCCACACGA...AACAGACTTC:W1(V380_D-1)->C:W-1(V410_D-1) adding edge: GGCCACACGA...AACAGACTTC:W1(V380_D-1) to C:W-1(V410_D-1) removing edge Edge(409->410,w:4.0)(C:W-1(V409_D-1)->C:W-1(V410_D-1)) removing edge Edge(380->409,w:4.0)(GGCCACACGA...AACAGACTTC:W1(V380_D-1)->C:W-1(V409_D-1)) Found potential edge: Edge(380->410,w:4.0) between GGCCACACGA...AACAGACTTC:W1(V380_D-1) and C:W-1(V410_D-1) removing vertex C:W-1(V410_D-1) was concatenated into GGCCACACGA...ACAGACTTCC:W1(V380_D-1) Want to move edge Edge(410->411,w:4.0)(C:W-1(V410_D-1)->T:W-1(V411_D-1)) to (GGCCACACGA...ACAGACTTCC:W1(V380_D-1)->T:W-1(V411_D-1) adding edge: GGCCACACGA...ACAGACTTCC:W1(V380_D-1) to T:W-1(V411_D-1) removing edge Edge(410->411,w:4.0)(C:W-1(V410_D-1)->T:W-1(V411_D-1)) removing edge Edge(380->410,w:4.0)(GGCCACACGA...ACAGACTTCC:W1(V380_D-1)->C:W-1(V410_D-1)) Found potential edge: Edge(380->411,w:4.0) between GGCCACACGA...ACAGACTTCC:W1(V380_D-1) and T:W-1(V411_D-1) removing vertex T:W-1(V411_D-1) was concatenated into GGCCACACGA...CAGACTTCCT:W1(V380_D-1) Want to move edge Edge(411->412,w:6.0)(T:W-1(V411_D-1)->C:W-1(V412_D-1)) to (GGCCACACGA...CAGACTTCCT:W1(V380_D-1)->C:W-1(V412_D-1) adding edge: GGCCACACGA...CAGACTTCCT:W1(V380_D-1) to C:W-1(V412_D-1) removing edge Edge(411->412,w:6.0)(T:W-1(V411_D-1)->C:W-1(V412_D-1)) removing edge Edge(380->411,w:4.0)(GGCCACACGA...CAGACTTCCT:W1(V380_D-1)->T:W-1(V411_D-1)) Found potential edge: Edge(380->412,w:6.0) between GGCCACACGA...CAGACTTCCT:W1(V380_D-1) and C:W-1(V412_D-1) removing vertex C:W-1(V412_D-1) was concatenated into GGCCACACGA...AGACTTCCTC:W2(V380_D-1) Want to move edge Edge(412->413,w:6.0)(C:W-1(V412_D-1)->A:W-1(V413_D-1)) to (GGCCACACGA...AGACTTCCTC:W2(V380_D-1)->A:W-1(V413_D-1) adding edge: GGCCACACGA...AGACTTCCTC:W2(V380_D-1) to A:W-1(V413_D-1) removing edge Edge(412->413,w:6.0)(C:W-1(V412_D-1)->A:W-1(V413_D-1)) removing edge Edge(380->412,w:6.0)(GGCCACACGA...AGACTTCCTC:W2(V380_D-1)->C:W-1(V412_D-1)) Found potential edge: Edge(380->413,w:6.0) between GGCCACACGA...AGACTTCCTC:W2(V380_D-1) and A:W-1(V413_D-1) removing vertex A:W-1(V413_D-1) was concatenated into GGCCACACGA...GACTTCCTCA:W2(V380_D-1) Want to move edge Edge(413->414,w:8.0)(A:W-1(V413_D-1)->A:W-1(V414_D-1)) to (GGCCACACGA...GACTTCCTCA:W2(V380_D-1)->A:W-1(V414_D-1) adding edge: GGCCACACGA...GACTTCCTCA:W2(V380_D-1) to A:W-1(V414_D-1) removing edge Edge(413->414,w:8.0)(A:W-1(V413_D-1)->A:W-1(V414_D-1)) removing edge Edge(380->413,w:6.0)(GGCCACACGA...GACTTCCTCA:W2(V380_D-1)->A:W-1(V413_D-1)) Found potential edge: Edge(380->414,w:8.0) between GGCCACACGA...GACTTCCTCA:W2(V380_D-1) and A:W-1(V414_D-1) removing vertex A:W-1(V414_D-1) was concatenated into GGCCACACGA...ACTTCCTCAA:W2(V380_D-1) Want to move edge Edge(414->415,w:8.0)(A:W-1(V414_D-1)->G:W-1(V415_D-1)) to (GGCCACACGA...ACTTCCTCAA:W2(V380_D-1)->G:W-1(V415_D-1) adding edge: GGCCACACGA...ACTTCCTCAA:W2(V380_D-1) to G:W-1(V415_D-1) removing edge Edge(414->415,w:8.0)(A:W-1(V414_D-1)->G:W-1(V415_D-1)) removing edge Edge(380->414,w:8.0)(GGCCACACGA...ACTTCCTCAA:W2(V380_D-1)->A:W-1(V414_D-1)) Found potential edge: Edge(380->415,w:8.0) between GGCCACACGA...ACTTCCTCAA:W2(V380_D-1) and G:W-1(V415_D-1) removing vertex G:W-1(V415_D-1) was concatenated into GGCCACACGA...CTTCCTCAAG:W2(V380_D-1) Want to move edge Edge(415->416,w:6.0)(G:W-1(V415_D-1)->C:W-1(V416_D-1)) to (GGCCACACGA...CTTCCTCAAG:W2(V380_D-1)->C:W-1(V416_D-1) adding edge: GGCCACACGA...CTTCCTCAAG:W2(V380_D-1) to C:W-1(V416_D-1) Want to move edge Edge(415->885,w:2.0)(G:W-1(V415_D-1)->G:W-1(V885_D-1)) to (GGCCACACGA...CTTCCTCAAG:W2(V380_D-1)->G:W-1(V885_D-1) adding edge: GGCCACACGA...CTTCCTCAAG:W2(V380_D-1) to G:W-1(V885_D-1) removing edge Edge(415->416,w:6.0)(G:W-1(V415_D-1)->C:W-1(V416_D-1)) removing edge Edge(415->885,w:2.0)(G:W-1(V415_D-1)->G:W-1(V885_D-1)) removing edge Edge(380->415,w:8.0)(GGCCACACGA...CTTCCTCAAG:W2(V380_D-1)->G:W-1(V415_D-1)) Found potential edge: Edge(416->417,w:6.0) between C:W-1(V416_D-1) and C:W-1(V417_D-1) removing vertex C:W-1(V417_D-1) was concatenated into CC:W6(V416_D-1) Want to move edge Edge(417->418,w:6.0)(C:W-1(V417_D-1)->T:W-1(V418_D-1)) to (CC:W6(V416_D-1)->T:W-1(V418_D-1) adding edge: CC:W6(V416_D-1) to T:W-1(V418_D-1) removing edge Edge(417->418,w:6.0)(C:W-1(V417_D-1)->T:W-1(V418_D-1)) removing edge Edge(416->417,w:6.0)(CC:W6(V416_D-1)->C:W-1(V417_D-1)) Found potential edge: Edge(416->418,w:6.0) between CC:W6(V416_D-1) and T:W-1(V418_D-1) removing vertex T:W-1(V418_D-1) was concatenated into CCT:W6(V416_D-1) Want to move edge Edge(418->419,w:6.0)(T:W-1(V418_D-1)->C:W-1(V419_D-1)) to (CCT:W6(V416_D-1)->C:W-1(V419_D-1) adding edge: CCT:W6(V416_D-1) to C:W-1(V419_D-1) removing edge Edge(418->419,w:6.0)(T:W-1(V418_D-1)->C:W-1(V419_D-1)) removing edge Edge(416->418,w:6.0)(CCT:W6(V416_D-1)->T:W-1(V418_D-1)) Found potential edge: Edge(416->419,w:6.0) between CCT:W6(V416_D-1) and C:W-1(V419_D-1) removing vertex C:W-1(V419_D-1) was concatenated into CCTC:W6(V416_D-1) Want to move edge Edge(419->420,w:6.0)(C:W-1(V419_D-1)->A:W-1(V420_D-1)) to (CCTC:W6(V416_D-1)->A:W-1(V420_D-1) adding edge: CCTC:W6(V416_D-1) to A:W-1(V420_D-1) removing edge Edge(419->420,w:6.0)(C:W-1(V419_D-1)->A:W-1(V420_D-1)) removing edge Edge(416->419,w:6.0)(CCTC:W6(V416_D-1)->C:W-1(V419_D-1)) Found potential edge: Edge(416->420,w:6.0) between CCTC:W6(V416_D-1) and A:W-1(V420_D-1) removing vertex A:W-1(V420_D-1) was concatenated into CCTCA:W6(V416_D-1) Want to move edge Edge(420->421,w:6.0)(A:W-1(V420_D-1)->T:W-1(V421_D-1)) to (CCTCA:W6(V416_D-1)->T:W-1(V421_D-1) adding edge: CCTCA:W6(V416_D-1) to T:W-1(V421_D-1) removing edge Edge(420->421,w:6.0)(A:W-1(V420_D-1)->T:W-1(V421_D-1)) removing edge Edge(416->420,w:6.0)(CCTCA:W6(V416_D-1)->A:W-1(V420_D-1)) Found potential edge: Edge(416->421,w:6.0) between CCTCA:W6(V416_D-1) and T:W-1(V421_D-1) removing vertex T:W-1(V421_D-1) was concatenated into CCTCAT:W6(V416_D-1) Want to move edge Edge(421->422,w:6.0)(T:W-1(V421_D-1)->C:W-1(V422_D-1)) to (CCTCAT:W6(V416_D-1)->C:W-1(V422_D-1) adding edge: CCTCAT:W6(V416_D-1) to C:W-1(V422_D-1) removing edge Edge(421->422,w:6.0)(T:W-1(V421_D-1)->C:W-1(V422_D-1)) removing edge Edge(416->421,w:6.0)(CCTCAT:W6(V416_D-1)->T:W-1(V421_D-1)) Found potential edge: Edge(416->422,w:6.0) between CCTCAT:W6(V416_D-1) and C:W-1(V422_D-1) removing vertex C:W-1(V422_D-1) was concatenated into CCTCATC:W6(V416_D-1) Want to move edge Edge(422->423,w:8.0)(C:W-1(V422_D-1)->A:W-1(V423_D-1)) to (CCTCATC:W6(V416_D-1)->A:W-1(V423_D-1) adding edge: CCTCATC:W6(V416_D-1) to A:W-1(V423_D-1) removing edge Edge(422->423,w:8.0)(C:W-1(V422_D-1)->A:W-1(V423_D-1)) removing edge Edge(416->422,w:6.0)(CCTCATC:W6(V416_D-1)->C:W-1(V422_D-1)) Found potential edge: Edge(416->423,w:8.0) between CCTCATC:W6(V416_D-1) and A:W-1(V423_D-1) removing vertex A:W-1(V423_D-1) was concatenated into CCTCATCA:W6(V416_D-1) Want to move edge Edge(423->424,w:8.0)(A:W-1(V423_D-1)->G:W-1(V424_D-1)) to (CCTCATCA:W6(V416_D-1)->G:W-1(V424_D-1) adding edge: CCTCATCA:W6(V416_D-1) to G:W-1(V424_D-1) removing edge Edge(423->424,w:8.0)(A:W-1(V423_D-1)->G:W-1(V424_D-1)) removing edge Edge(416->423,w:8.0)(CCTCATCA:W6(V416_D-1)->A:W-1(V423_D-1)) Found potential edge: Edge(416->424,w:8.0) between CCTCATCA:W6(V416_D-1) and G:W-1(V424_D-1) removing vertex G:W-1(V424_D-1) was concatenated into CCTCATCAG:W7(V416_D-1) Want to move edge Edge(424->425,w:8.0)(G:W-1(V424_D-1)->C:W-1(V425_D-1)) to (CCTCATCAG:W7(V416_D-1)->C:W-1(V425_D-1) adding edge: CCTCATCAG:W7(V416_D-1) to C:W-1(V425_D-1) removing edge Edge(424->425,w:8.0)(G:W-1(V424_D-1)->C:W-1(V425_D-1)) removing edge Edge(416->424,w:8.0)(CCTCATCAG:W7(V416_D-1)->G:W-1(V424_D-1)) Found potential edge: Edge(416->425,w:8.0) between CCTCATCAG:W7(V416_D-1) and C:W-1(V425_D-1) removing vertex C:W-1(V425_D-1) was concatenated into CCTCATCAGC:W7(V416_D-1) Want to move edge Edge(425->426,w:8.0)(C:W-1(V425_D-1)->A:W-1(V426_D-1)) to (CCTCATCAGC:W7(V416_D-1)->A:W-1(V426_D-1) adding edge: CCTCATCAGC:W7(V416_D-1) to A:W-1(V426_D-1) removing edge Edge(425->426,w:8.0)(C:W-1(V425_D-1)->A:W-1(V426_D-1)) removing edge Edge(416->425,w:8.0)(CCTCATCAGC:W7(V416_D-1)->C:W-1(V425_D-1)) Found potential edge: Edge(416->426,w:8.0) between CCTCATCAGC:W7(V416_D-1) and A:W-1(V426_D-1) removing vertex A:W-1(V426_D-1) was concatenated into CCTCATCAGCA:W7(V416_D-1) Want to move edge Edge(426->427,w:8.0)(A:W-1(V426_D-1)->A:W-1(V427_D-1)) to (CCTCATCAGCA:W7(V416_D-1)->A:W-1(V427_D-1) adding edge: CCTCATCAGCA:W7(V416_D-1) to A:W-1(V427_D-1) removing edge Edge(426->427,w:8.0)(A:W-1(V426_D-1)->A:W-1(V427_D-1)) removing edge Edge(416->426,w:8.0)(CCTCATCAGCA:W7(V416_D-1)->A:W-1(V426_D-1)) Found potential edge: Edge(416->427,w:8.0) between CCTCATCAGCA:W7(V416_D-1) and A:W-1(V427_D-1) removing vertex A:W-1(V427_D-1) was concatenated into CCTCATCAGCAA:W7(V416_D-1) Want to move edge Edge(427->428,w:8.0)(A:W-1(V427_D-1)->G:W-1(V428_D-1)) to (CCTCATCAGCAA:W7(V416_D-1)->G:W-1(V428_D-1) adding edge: CCTCATCAGCAA:W7(V416_D-1) to G:W-1(V428_D-1) removing edge Edge(427->428,w:8.0)(A:W-1(V427_D-1)->G:W-1(V428_D-1)) removing edge Edge(416->427,w:8.0)(CCTCATCAGCAA:W7(V416_D-1)->A:W-1(V427_D-1)) Found potential edge: Edge(416->428,w:8.0) between CCTCATCAGCAA:W7(V416_D-1) and G:W-1(V428_D-1) removing vertex G:W-1(V428_D-1) was concatenated into CCTCATCAGCAAG:W7(V416_D-1) Want to move edge Edge(428->429,w:8.0)(G:W-1(V428_D-1)->A:W-1(V429_D-1)) to (CCTCATCAGCAAG:W7(V416_D-1)->A:W-1(V429_D-1) adding edge: CCTCATCAGCAAG:W7(V416_D-1) to A:W-1(V429_D-1) removing edge Edge(428->429,w:8.0)(G:W-1(V428_D-1)->A:W-1(V429_D-1)) removing edge Edge(416->428,w:8.0)(CCTCATCAGCAAG:W7(V416_D-1)->G:W-1(V428_D-1)) Found potential edge: Edge(416->429,w:8.0) between CCTCATCAGCAAG:W7(V416_D-1) and A:W-1(V429_D-1) removing vertex A:W-1(V429_D-1) was concatenated into CCTCATCAGCAAGA:W7(V416_D-1) Want to move edge Edge(429->430,w:8.0)(A:W-1(V429_D-1)->A:W-1(V430_D-1)) to (CCTCATCAGCAAGA:W7(V416_D-1)->A:W-1(V430_D-1) adding edge: CCTCATCAGCAAGA:W7(V416_D-1) to A:W-1(V430_D-1) removing edge Edge(429->430,w:8.0)(A:W-1(V429_D-1)->A:W-1(V430_D-1)) removing edge Edge(416->429,w:8.0)(CCTCATCAGCAAGA:W7(V416_D-1)->A:W-1(V429_D-1)) Found potential edge: Edge(416->430,w:8.0) between CCTCATCAGCAAGA:W7(V416_D-1) and A:W-1(V430_D-1) removing vertex A:W-1(V430_D-1) was concatenated into CCTCATCAGCAAGAA:W7(V416_D-1) Want to move edge Edge(430->431,w:8.0)(A:W-1(V430_D-1)->G:W-1(V431_D-1)) to (CCTCATCAGCAAGAA:W7(V416_D-1)->G:W-1(V431_D-1) adding edge: CCTCATCAGCAAGAA:W7(V416_D-1) to G:W-1(V431_D-1) removing edge Edge(430->431,w:8.0)(A:W-1(V430_D-1)->G:W-1(V431_D-1)) removing edge Edge(416->430,w:8.0)(CCTCATCAGCAAGAA:W7(V416_D-1)->A:W-1(V430_D-1)) Found potential edge: Edge(416->431,w:8.0) between CCTCATCAGCAAGAA:W7(V416_D-1) and G:W-1(V431_D-1) removing vertex G:W-1(V431_D-1) was concatenated into CCTCATCAGCAAGAAG:W7(V416_D-1) Want to move edge Edge(431->432,w:8.0)(G:W-1(V431_D-1)->A:W-1(V432_D-1)) to (CCTCATCAGCAAGAAG:W7(V416_D-1)->A:W-1(V432_D-1) adding edge: CCTCATCAGCAAGAAG:W7(V416_D-1) to A:W-1(V432_D-1) removing edge Edge(431->432,w:8.0)(G:W-1(V431_D-1)->A:W-1(V432_D-1)) removing edge Edge(416->431,w:8.0)(CCTCATCAGCAAGAAG:W7(V416_D-1)->G:W-1(V431_D-1)) Found potential edge: Edge(416->432,w:8.0) between CCTCATCAGCAAGAAG:W7(V416_D-1) and A:W-1(V432_D-1) removing vertex A:W-1(V432_D-1) was concatenated into CCTCATCAGCAAGAAGA:W7(V416_D-1) Want to move edge Edge(432->433,w:6.0)(A:W-1(V432_D-1)->A:W-1(V433_D-1)) to (CCTCATCAGCAAGAAGA:W7(V416_D-1)->A:W-1(V433_D-1) adding edge: CCTCATCAGCAAGAAGA:W7(V416_D-1) to A:W-1(V433_D-1) removing edge Edge(432->433,w:6.0)(A:W-1(V432_D-1)->A:W-1(V433_D-1)) removing edge Edge(416->432,w:8.0)(CCTCATCAGCAAGAAGA:W7(V416_D-1)->A:W-1(V432_D-1)) Found potential edge: Edge(416->433,w:6.0) between CCTCATCAGCAAGAAGA:W7(V416_D-1) and A:W-1(V433_D-1) removing vertex A:W-1(V433_D-1) was concatenated into CCTCATCAGCAAGAAGAA:W7(V416_D-1) Want to move edge Edge(433->434,w:6.0)(A:W-1(V433_D-1)->A:W-1(V434_D-1)) to (CCTCATCAGCAAGAAGAA:W7(V416_D-1)->A:W-1(V434_D-1) adding edge: CCTCATCAGCAAGAAGAA:W7(V416_D-1) to A:W-1(V434_D-1) removing edge Edge(433->434,w:6.0)(A:W-1(V433_D-1)->A:W-1(V434_D-1)) removing edge Edge(416->433,w:6.0)(CCTCATCAGCAAGAAGAA:W7(V416_D-1)->A:W-1(V433_D-1)) Found potential edge: Edge(416->434,w:6.0) between CCTCATCAGCAAGAAGAA:W7(V416_D-1) and A:W-1(V434_D-1) removing vertex A:W-1(V434_D-1) was concatenated into CCTCATCAGCAAGAAGAAA:W7(V416_D-1) Want to move edge Edge(434->435,w:6.0)(A:W-1(V434_D-1)->T:W-1(V435_D-1)) to (CCTCATCAGCAAGAAGAAA:W7(V416_D-1)->T:W-1(V435_D-1) adding edge: CCTCATCAGCAAGAAGAAA:W7(V416_D-1) to T:W-1(V435_D-1) removing edge Edge(434->435,w:6.0)(A:W-1(V434_D-1)->T:W-1(V435_D-1)) removing edge Edge(416->434,w:6.0)(CCTCATCAGCAAGAAGAAA:W7(V416_D-1)->A:W-1(V434_D-1)) Found potential edge: Edge(416->435,w:6.0) between CCTCATCAGCAAGAAGAAA:W7(V416_D-1) and T:W-1(V435_D-1) removing vertex T:W-1(V435_D-1) was concatenated into CCTCATCAGCAAGAAGAAAT:W7(V416_D-1) Want to move edge Edge(435->436,w:6.0)(T:W-1(V435_D-1)->C:W-1(V436_D-1)) to (CCTCATCAGCAAGAAGAAAT:W7(V416_D-1)->C:W-1(V436_D-1) adding edge: CCTCATCAGCAAGAAGAAAT:W7(V416_D-1) to C:W-1(V436_D-1) removing edge Edge(435->436,w:6.0)(T:W-1(V435_D-1)->C:W-1(V436_D-1)) removing edge Edge(416->435,w:6.0)(CCTCATCAGCAAGAAGAAAT:W7(V416_D-1)->T:W-1(V435_D-1)) Found potential edge: Edge(416->436,w:6.0) between CCTCATCAGCAAGAAGAAAT:W7(V416_D-1) and C:W-1(V436_D-1) removing vertex C:W-1(V436_D-1) was concatenated into CCTCATCAGCAAGAAGAAATC:W7(V416_D-1) Want to move edge Edge(436->437,w:6.0)(C:W-1(V436_D-1)->T:W-1(V437_D-1)) to (CCTCATCAGCAAGAAGAAATC:W7(V416_D-1)->T:W-1(V437_D-1) adding edge: CCTCATCAGCAAGAAGAAATC:W7(V416_D-1) to T:W-1(V437_D-1) removing edge Edge(436->437,w:6.0)(C:W-1(V436_D-1)->T:W-1(V437_D-1)) removing edge Edge(416->436,w:6.0)(CCTCATCAGCAAGAAGAAATC:W7(V416_D-1)->C:W-1(V436_D-1)) Found potential edge: Edge(416->437,w:6.0) between CCTCATCAGCAAGAAGAAATC:W7(V416_D-1) and T:W-1(V437_D-1) removing vertex T:W-1(V437_D-1) was concatenated into CCTCATCAGCAAGAAGAAATCT:W7(V416_D-1) Want to move edge Edge(437->438,w:6.0)(T:W-1(V437_D-1)->T:W-1(V438_D-1)) to (CCTCATCAGCAAGAAGAAATCT:W7(V416_D-1)->T:W-1(V438_D-1) adding edge: CCTCATCAGCAAGAAGAAATCT:W7(V416_D-1) to T:W-1(V438_D-1) removing edge Edge(437->438,w:6.0)(T:W-1(V437_D-1)->T:W-1(V438_D-1)) removing edge Edge(416->437,w:6.0)(CCTCATCAGCAAGAAGAAATCT:W7(V416_D-1)->T:W-1(V437_D-1)) Found potential edge: Edge(416->438,w:6.0) between CCTCATCAGCAAGAAGAAATCT:W7(V416_D-1) and T:W-1(V438_D-1) removing vertex T:W-1(V438_D-1) was concatenated into CCTCATCAGCAAGAAGAAATCTT:W7(V416_D-1) Want to move edge Edge(438->439,w:6.0)(T:W-1(V438_D-1)->T:W-1(V439_D-1)) to (CCTCATCAGCAAGAAGAAATCTT:W7(V416_D-1)->T:W-1(V439_D-1) adding edge: CCTCATCAGCAAGAAGAAATCTT:W7(V416_D-1) to T:W-1(V439_D-1) removing edge Edge(438->439,w:6.0)(T:W-1(V438_D-1)->T:W-1(V439_D-1)) removing edge Edge(416->438,w:6.0)(CCTCATCAGCAAGAAGAAATCTT:W7(V416_D-1)->T:W-1(V438_D-1)) Found potential edge: Edge(416->439,w:6.0) between CCTCATCAGCAAGAAGAAATCTT:W7(V416_D-1) and T:W-1(V439_D-1) removing vertex T:W-1(V439_D-1) was concatenated into CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1) Want to move edge Edge(439->440,w:6.0)(T:W-1(V439_D-1)->C:W-1(V440_D-1)) to (CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1)->C:W-1(V440_D-1) adding edge: CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1) to C:W-1(V440_D-1) removing edge Edge(439->440,w:6.0)(T:W-1(V439_D-1)->C:W-1(V440_D-1)) removing edge Edge(416->439,w:6.0)(CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1)->T:W-1(V439_D-1)) Found potential edge: Edge(440->441,w:8.0) between C:W-1(V440_D-1) and T:W-1(V441_D-1) removing vertex T:W-1(V441_D-1) was concatenated into CT:W8(V440_D-1) Want to move edge Edge(441->442,w:8.0)(T:W-1(V441_D-1)->T:W-1(V442_D-1)) to (CT:W8(V440_D-1)->T:W-1(V442_D-1) adding edge: CT:W8(V440_D-1) to T:W-1(V442_D-1) removing edge Edge(441->442,w:8.0)(T:W-1(V441_D-1)->T:W-1(V442_D-1)) removing edge Edge(440->441,w:8.0)(CT:W8(V440_D-1)->T:W-1(V441_D-1)) Found potential edge: Edge(440->442,w:8.0) between CT:W8(V440_D-1) and T:W-1(V442_D-1) removing vertex T:W-1(V442_D-1) was concatenated into CTT:W8(V440_D-1) Want to move edge Edge(442->443,w:8.0)(T:W-1(V442_D-1)->T:W-1(V443_D-1)) to (CTT:W8(V440_D-1)->T:W-1(V443_D-1) adding edge: CTT:W8(V440_D-1) to T:W-1(V443_D-1) removing edge Edge(442->443,w:8.0)(T:W-1(V442_D-1)->T:W-1(V443_D-1)) removing edge Edge(440->442,w:8.0)(CTT:W8(V440_D-1)->T:W-1(V442_D-1)) Found potential edge: Edge(440->443,w:8.0) between CTT:W8(V440_D-1) and T:W-1(V443_D-1) removing vertex T:W-1(V443_D-1) was concatenated into CTTT:W8(V440_D-1) Want to move edge Edge(443->444,w:8.0)(T:W-1(V443_D-1)->C:W-1(V444_D-1)) to (CTTT:W8(V440_D-1)->C:W-1(V444_D-1) adding edge: CTTT:W8(V440_D-1) to C:W-1(V444_D-1) removing edge Edge(443->444,w:8.0)(T:W-1(V443_D-1)->C:W-1(V444_D-1)) removing edge Edge(440->443,w:8.0)(CTTT:W8(V440_D-1)->T:W-1(V443_D-1)) Found potential edge: Edge(440->444,w:8.0) between CTTT:W8(V440_D-1) and C:W-1(V444_D-1) removing vertex C:W-1(V444_D-1) was concatenated into CTTTC:W8(V440_D-1) Want to move edge Edge(444->445,w:8.0)(C:W-1(V444_D-1)->C:W-1(V445_D-1)) to (CTTTC:W8(V440_D-1)->C:W-1(V445_D-1) adding edge: CTTTC:W8(V440_D-1) to C:W-1(V445_D-1) removing edge Edge(444->445,w:8.0)(C:W-1(V444_D-1)->C:W-1(V445_D-1)) removing edge Edge(440->444,w:8.0)(CTTTC:W8(V440_D-1)->C:W-1(V444_D-1)) Found potential edge: Edge(440->445,w:8.0) between CTTTC:W8(V440_D-1) and C:W-1(V445_D-1) removing vertex C:W-1(V445_D-1) was concatenated into CTTTCC:W8(V440_D-1) Want to move edge Edge(445->446,w:8.0)(C:W-1(V445_D-1)->A:W-1(V446_D-1)) to (CTTTCC:W8(V440_D-1)->A:W-1(V446_D-1) adding edge: CTTTCC:W8(V440_D-1) to A:W-1(V446_D-1) removing edge Edge(445->446,w:8.0)(C:W-1(V445_D-1)->A:W-1(V446_D-1)) removing edge Edge(440->445,w:8.0)(CTTTCC:W8(V440_D-1)->C:W-1(V445_D-1)) Found potential edge: Edge(440->446,w:8.0) between CTTTCC:W8(V440_D-1) and A:W-1(V446_D-1) removing vertex A:W-1(V446_D-1) was concatenated into CTTTCCA:W8(V440_D-1) Want to move edge Edge(446->447,w:8.0)(A:W-1(V446_D-1)->A:W-1(V447_D-1)) to (CTTTCCA:W8(V440_D-1)->A:W-1(V447_D-1) adding edge: CTTTCCA:W8(V440_D-1) to A:W-1(V447_D-1) removing edge Edge(446->447,w:8.0)(A:W-1(V446_D-1)->A:W-1(V447_D-1)) removing edge Edge(440->446,w:8.0)(CTTTCCA:W8(V440_D-1)->A:W-1(V446_D-1)) Found potential edge: Edge(440->447,w:8.0) between CTTTCCA:W8(V440_D-1) and A:W-1(V447_D-1) removing vertex A:W-1(V447_D-1) was concatenated into CTTTCCAA:W8(V440_D-1) Want to move edge Edge(447->448,w:8.0)(A:W-1(V447_D-1)->G:W-1(V448_D-1)) to (CTTTCCAA:W8(V440_D-1)->G:W-1(V448_D-1) adding edge: CTTTCCAA:W8(V440_D-1) to G:W-1(V448_D-1) removing edge Edge(447->448,w:8.0)(A:W-1(V447_D-1)->G:W-1(V448_D-1)) removing edge Edge(440->447,w:8.0)(CTTTCCAA:W8(V440_D-1)->A:W-1(V447_D-1)) Found potential edge: Edge(440->448,w:8.0) between CTTTCCAA:W8(V440_D-1) and G:W-1(V448_D-1) removing vertex G:W-1(V448_D-1) was concatenated into CTTTCCAAG:W8(V440_D-1) Want to move edge Edge(448->449,w:8.0)(G:W-1(V448_D-1)->T:W-1(V449_D-1)) to (CTTTCCAAG:W8(V440_D-1)->T:W-1(V449_D-1) adding edge: CTTTCCAAG:W8(V440_D-1) to T:W-1(V449_D-1) removing edge Edge(448->449,w:8.0)(G:W-1(V448_D-1)->T:W-1(V449_D-1)) removing edge Edge(440->448,w:8.0)(CTTTCCAAG:W8(V440_D-1)->G:W-1(V448_D-1)) Found potential edge: Edge(440->449,w:8.0) between CTTTCCAAG:W8(V440_D-1) and T:W-1(V449_D-1) removing vertex T:W-1(V449_D-1) was concatenated into CTTTCCAAGT:W8(V440_D-1) Want to move edge Edge(449->450,w:8.0)(T:W-1(V449_D-1)->A:W-1(V450_D-1)) to (CTTTCCAAGT:W8(V440_D-1)->A:W-1(V450_D-1) adding edge: CTTTCCAAGT:W8(V440_D-1) to A:W-1(V450_D-1) removing edge Edge(449->450,w:8.0)(T:W-1(V449_D-1)->A:W-1(V450_D-1)) removing edge Edge(440->449,w:8.0)(CTTTCCAAGT:W8(V440_D-1)->T:W-1(V449_D-1)) Found potential edge: Edge(440->450,w:8.0) between CTTTCCAAGT:W8(V440_D-1) and A:W-1(V450_D-1) removing vertex A:W-1(V450_D-1) was concatenated into CTTTCCAAGTA:W8(V440_D-1) Want to move edge Edge(450->451,w:8.0)(A:W-1(V450_D-1)->G:W-1(V451_D-1)) to (CTTTCCAAGTA:W8(V440_D-1)->G:W-1(V451_D-1) adding edge: CTTTCCAAGTA:W8(V440_D-1) to G:W-1(V451_D-1) removing edge Edge(450->451,w:8.0)(A:W-1(V450_D-1)->G:W-1(V451_D-1)) removing edge Edge(440->450,w:8.0)(CTTTCCAAGTA:W8(V440_D-1)->A:W-1(V450_D-1)) Found potential edge: Edge(451->452,w:10.0) between G:W-1(V451_D-1) and T:W-1(V452_D-1) removing vertex T:W-1(V452_D-1) was concatenated into GT:W10(V451_D-1) Want to move edge Edge(452->453,w:10.0)(T:W-1(V452_D-1)->G:W-1(V453_D-1)) to (GT:W10(V451_D-1)->G:W-1(V453_D-1) adding edge: GT:W10(V451_D-1) to G:W-1(V453_D-1) removing edge Edge(452->453,w:10.0)(T:W-1(V452_D-1)->G:W-1(V453_D-1)) removing edge Edge(451->452,w:10.0)(GT:W10(V451_D-1)->T:W-1(V452_D-1)) Found potential edge: Edge(451->453,w:10.0) between GT:W10(V451_D-1) and G:W-1(V453_D-1) removing vertex G:W-1(V453_D-1) was concatenated into GTG:W10(V451_D-1) Want to move edge Edge(453->454,w:8.0)(G:W-1(V453_D-1)->T:W-1(V454_D-1)) to (GTG:W10(V451_D-1)->T:W-1(V454_D-1) adding edge: GTG:W10(V451_D-1) to T:W-1(V454_D-1) removing edge Edge(453->454,w:8.0)(G:W-1(V453_D-1)->T:W-1(V454_D-1)) removing edge Edge(451->453,w:10.0)(GTG:W10(V451_D-1)->G:W-1(V453_D-1)) Found potential edge: Edge(451->454,w:8.0) between GTG:W10(V451_D-1) and T:W-1(V454_D-1) removing vertex T:W-1(V454_D-1) was concatenated into GTGT:W9(V451_D-1) Want to move edge Edge(454->455,w:8.0)(T:W-1(V454_D-1)->C:W-1(V455_D-1)) to (GTGT:W9(V451_D-1)->C:W-1(V455_D-1) adding edge: GTGT:W9(V451_D-1) to C:W-1(V455_D-1) removing edge Edge(454->455,w:8.0)(T:W-1(V454_D-1)->C:W-1(V455_D-1)) removing edge Edge(451->454,w:8.0)(GTGT:W9(V451_D-1)->T:W-1(V454_D-1)) Found potential edge: Edge(451->455,w:8.0) between GTGT:W9(V451_D-1) and C:W-1(V455_D-1) removing vertex C:W-1(V455_D-1) was concatenated into GTGTC:W9(V451_D-1) Want to move edge Edge(455->456,w:8.0)(C:W-1(V455_D-1)->T:W-1(V456_D-1)) to (GTGTC:W9(V451_D-1)->T:W-1(V456_D-1) adding edge: GTGTC:W9(V451_D-1) to T:W-1(V456_D-1) removing edge Edge(455->456,w:8.0)(C:W-1(V455_D-1)->T:W-1(V456_D-1)) removing edge Edge(451->455,w:8.0)(GTGTC:W9(V451_D-1)->C:W-1(V455_D-1)) Found potential edge: Edge(451->456,w:8.0) between GTGTC:W9(V451_D-1) and T:W-1(V456_D-1) removing vertex T:W-1(V456_D-1) was concatenated into GTGTCT:W9(V451_D-1) Want to move edge Edge(456->457,w:8.0)(T:W-1(V456_D-1)->T:W-1(V457_D-1)) to (GTGTCT:W9(V451_D-1)->T:W-1(V457_D-1) adding edge: GTGTCT:W9(V451_D-1) to T:W-1(V457_D-1) removing edge Edge(456->457,w:8.0)(T:W-1(V456_D-1)->T:W-1(V457_D-1)) removing edge Edge(451->456,w:8.0)(GTGTCT:W9(V451_D-1)->T:W-1(V456_D-1)) Found potential edge: Edge(451->457,w:8.0) between GTGTCT:W9(V451_D-1) and T:W-1(V457_D-1) removing vertex T:W-1(V457_D-1) was concatenated into GTGTCTT:W9(V451_D-1) Want to move edge Edge(457->458,w:8.0)(T:W-1(V457_D-1)->A:W-1(V458_D-1)) to (GTGTCTT:W9(V451_D-1)->A:W-1(V458_D-1) adding edge: GTGTCTT:W9(V451_D-1) to A:W-1(V458_D-1) removing edge Edge(457->458,w:8.0)(T:W-1(V457_D-1)->A:W-1(V458_D-1)) removing edge Edge(451->457,w:8.0)(GTGTCTT:W9(V451_D-1)->T:W-1(V457_D-1)) Found potential edge: Edge(451->458,w:8.0) between GTGTCTT:W9(V451_D-1) and A:W-1(V458_D-1) removing vertex A:W-1(V458_D-1) was concatenated into GTGTCTTA:W9(V451_D-1) Want to move edge Edge(458->459,w:8.0)(A:W-1(V458_D-1)->A:W-1(V459_D-1)) to (GTGTCTTA:W9(V451_D-1)->A:W-1(V459_D-1) adding edge: GTGTCTTA:W9(V451_D-1) to A:W-1(V459_D-1) removing edge Edge(458->459,w:8.0)(A:W-1(V458_D-1)->A:W-1(V459_D-1)) removing edge Edge(451->458,w:8.0)(GTGTCTTA:W9(V451_D-1)->A:W-1(V458_D-1)) Found potential edge: Edge(451->459,w:8.0) between GTGTCTTA:W9(V451_D-1) and A:W-1(V459_D-1) removing vertex A:W-1(V459_D-1) was concatenated into GTGTCTTAA:W9(V451_D-1) Want to move edge Edge(459->460,w:8.0)(A:W-1(V459_D-1)->C:W-1(V460_D-1)) to (GTGTCTTAA:W9(V451_D-1)->C:W-1(V460_D-1) adding edge: GTGTCTTAA:W9(V451_D-1) to C:W-1(V460_D-1) removing edge Edge(459->460,w:8.0)(A:W-1(V459_D-1)->C:W-1(V460_D-1)) removing edge Edge(451->459,w:8.0)(GTGTCTTAA:W9(V451_D-1)->A:W-1(V459_D-1)) Found potential edge: Edge(451->460,w:8.0) between GTGTCTTAA:W9(V451_D-1) and C:W-1(V460_D-1) removing vertex C:W-1(V460_D-1) was concatenated into GTGTCTTAAC:W8(V451_D-1) Want to move edge Edge(460->461,w:8.0)(C:W-1(V460_D-1)->T:W-1(V461_D-1)) to (GTGTCTTAAC:W8(V451_D-1)->T:W-1(V461_D-1) adding edge: GTGTCTTAAC:W8(V451_D-1) to T:W-1(V461_D-1) removing edge Edge(460->461,w:8.0)(C:W-1(V460_D-1)->T:W-1(V461_D-1)) removing edge Edge(451->460,w:8.0)(GTGTCTTAAC:W8(V451_D-1)->C:W-1(V460_D-1)) Found potential edge: Edge(451->461,w:8.0) between GTGTCTTAAC:W8(V451_D-1) and T:W-1(V461_D-1) removing vertex T:W-1(V461_D-1) was concatenated into GTGTCTTAACT:W8(V451_D-1) Want to move edge Edge(461->462,w:8.0)(T:W-1(V461_D-1)->C:W-1(V462_D-1)) to (GTGTCTTAACT:W8(V451_D-1)->C:W-1(V462_D-1) adding edge: GTGTCTTAACT:W8(V451_D-1) to C:W-1(V462_D-1) removing edge Edge(461->462,w:8.0)(T:W-1(V461_D-1)->C:W-1(V462_D-1)) removing edge Edge(451->461,w:8.0)(GTGTCTTAACT:W8(V451_D-1)->T:W-1(V461_D-1)) Found potential edge: Edge(451->462,w:8.0) between GTGTCTTAACT:W8(V451_D-1) and C:W-1(V462_D-1) removing vertex C:W-1(V462_D-1) was concatenated into GTGTCTTAACTC:W8(V451_D-1) Want to move edge Edge(462->463,w:8.0)(C:W-1(V462_D-1)->A:W-1(V463_D-1)) to (GTGTCTTAACTC:W8(V451_D-1)->A:W-1(V463_D-1) adding edge: GTGTCTTAACTC:W8(V451_D-1) to A:W-1(V463_D-1) removing edge Edge(462->463,w:8.0)(C:W-1(V462_D-1)->A:W-1(V463_D-1)) removing edge Edge(451->462,w:8.0)(GTGTCTTAACTC:W8(V451_D-1)->C:W-1(V462_D-1)) Found potential edge: Edge(451->463,w:8.0) between GTGTCTTAACTC:W8(V451_D-1) and A:W-1(V463_D-1) removing vertex A:W-1(V463_D-1) was concatenated into GTGTCTTAACTCA:W8(V451_D-1) Want to move edge Edge(463->464,w:6.0)(A:W-1(V463_D-1)->G:W-1(V464_D-1)) to (GTGTCTTAACTCA:W8(V451_D-1)->G:W-1(V464_D-1) adding edge: GTGTCTTAACTCA:W8(V451_D-1) to G:W-1(V464_D-1) removing edge Edge(463->464,w:6.0)(A:W-1(V463_D-1)->G:W-1(V464_D-1)) removing edge Edge(451->463,w:8.0)(GTGTCTTAACTCA:W8(V451_D-1)->A:W-1(V463_D-1)) Found potential edge: Edge(451->464,w:6.0) between GTGTCTTAACTCA:W8(V451_D-1) and G:W-1(V464_D-1) removing vertex G:W-1(V464_D-1) was concatenated into GTGTCTTAACTCAG:W8(V451_D-1) Want to move edge Edge(464->465,w:6.0)(G:W-1(V464_D-1)->G:W-1(V465_D-1)) to (GTGTCTTAACTCAG:W8(V451_D-1)->G:W-1(V465_D-1) adding edge: GTGTCTTAACTCAG:W8(V451_D-1) to G:W-1(V465_D-1) removing edge Edge(464->465,w:6.0)(G:W-1(V464_D-1)->G:W-1(V465_D-1)) removing edge Edge(451->464,w:6.0)(GTGTCTTAACTCAG:W8(V451_D-1)->G:W-1(V464_D-1)) Found potential edge: Edge(451->465,w:6.0) between GTGTCTTAACTCAG:W8(V451_D-1) and G:W-1(V465_D-1) removing vertex G:W-1(V465_D-1) was concatenated into GTGTCTTAACTCAGG:W8(V451_D-1) Want to move edge Edge(465->466,w:4.0)(G:W-1(V465_D-1)->A:W-1(V466_D-1)) to (GTGTCTTAACTCAGG:W8(V451_D-1)->A:W-1(V466_D-1) adding edge: GTGTCTTAACTCAGG:W8(V451_D-1) to A:W-1(V466_D-1) removing edge Edge(465->466,w:4.0)(G:W-1(V465_D-1)->A:W-1(V466_D-1)) removing edge Edge(451->465,w:6.0)(GTGTCTTAACTCAGG:W8(V451_D-1)->G:W-1(V465_D-1)) Found potential edge: Edge(451->466,w:4.0) between GTGTCTTAACTCAGG:W8(V451_D-1) and A:W-1(V466_D-1) removing vertex A:W-1(V466_D-1) was concatenated into GTGTCTTAACTCAGGA:W8(V451_D-1) Want to move edge Edge(466->467,w:4.0)(A:W-1(V466_D-1)->G:W-1(V467_D-1)) to (GTGTCTTAACTCAGGA:W8(V451_D-1)->G:W-1(V467_D-1) adding edge: GTGTCTTAACTCAGGA:W8(V451_D-1) to G:W-1(V467_D-1) removing edge Edge(466->467,w:4.0)(A:W-1(V466_D-1)->G:W-1(V467_D-1)) removing edge Edge(451->466,w:4.0)(GTGTCTTAACTCAGGA:W8(V451_D-1)->A:W-1(V466_D-1)) Found potential edge: Edge(451->467,w:4.0) between GTGTCTTAACTCAGGA:W8(V451_D-1) and G:W-1(V467_D-1) removing vertex G:W-1(V467_D-1) was concatenated into GTGTCTTAACTCAGGAG:W8(V451_D-1) Want to move edge Edge(467->468,w:2.0)(G:W-1(V467_D-1)->A:W-1(V468_D-1)) to (GTGTCTTAACTCAGGAG:W8(V451_D-1)->A:W-1(V468_D-1) adding edge: GTGTCTTAACTCAGGAG:W8(V451_D-1) to A:W-1(V468_D-1) removing edge Edge(467->468,w:2.0)(G:W-1(V467_D-1)->A:W-1(V468_D-1)) removing edge Edge(451->467,w:4.0)(GTGTCTTAACTCAGGAG:W8(V451_D-1)->G:W-1(V467_D-1)) Found potential edge: Edge(451->468,w:2.0) between GTGTCTTAACTCAGGAG:W8(V451_D-1) and A:W-1(V468_D-1) removing vertex A:W-1(V468_D-1) was concatenated into GTGTCTTAACTCAGGAGA:W7(V451_D-1) Want to move edge Edge(468->469,w:2.0)(A:W-1(V468_D-1)->T:W-1(V469_D-1)) to (GTGTCTTAACTCAGGAGA:W7(V451_D-1)->T:W-1(V469_D-1) adding edge: GTGTCTTAACTCAGGAGA:W7(V451_D-1) to T:W-1(V469_D-1) removing edge Edge(468->469,w:2.0)(A:W-1(V468_D-1)->T:W-1(V469_D-1)) removing edge Edge(451->468,w:2.0)(GTGTCTTAACTCAGGAGA:W7(V451_D-1)->A:W-1(V468_D-1)) Found potential edge: Edge(451->469,w:2.0) between GTGTCTTAACTCAGGAGA:W7(V451_D-1) and T:W-1(V469_D-1) removing vertex T:W-1(V469_D-1) was concatenated into GTGTCTTAACTCAGGAGAT:W7(V451_D-1) Want to move edge Edge(469->470,w:2.0)(T:W-1(V469_D-1)->C:W-1(V470_D-1)) to (GTGTCTTAACTCAGGAGAT:W7(V451_D-1)->C:W-1(V470_D-1) adding edge: GTGTCTTAACTCAGGAGAT:W7(V451_D-1) to C:W-1(V470_D-1) removing edge Edge(469->470,w:2.0)(T:W-1(V469_D-1)->C:W-1(V470_D-1)) removing edge Edge(451->469,w:2.0)(GTGTCTTAACTCAGGAGAT:W7(V451_D-1)->T:W-1(V469_D-1)) Found potential edge: Edge(451->470,w:2.0) between GTGTCTTAACTCAGGAGAT:W7(V451_D-1) and C:W-1(V470_D-1) removing vertex C:W-1(V470_D-1) was concatenated into GTGTCTTAACTCAGGAGATC:W7(V451_D-1) Want to move edge Edge(470->471,w:2.0)(C:W-1(V470_D-1)->A:W-1(V471_D-1)) to (GTGTCTTAACTCAGGAGATC:W7(V451_D-1)->A:W-1(V471_D-1) adding edge: GTGTCTTAACTCAGGAGATC:W7(V451_D-1) to A:W-1(V471_D-1) removing edge Edge(470->471,w:2.0)(C:W-1(V470_D-1)->A:W-1(V471_D-1)) removing edge Edge(451->470,w:2.0)(GTGTCTTAACTCAGGAGATC:W7(V451_D-1)->C:W-1(V470_D-1)) Found potential edge: Edge(451->471,w:2.0) between GTGTCTTAACTCAGGAGATC:W7(V451_D-1) and A:W-1(V471_D-1) removing vertex A:W-1(V471_D-1) was concatenated into GTGTCTTAACTCAGGAGATCA:W6(V451_D-1) Want to move edge Edge(471->472,w:2.0)(A:W-1(V471_D-1)->T:W-1(V472_D-1)) to (GTGTCTTAACTCAGGAGATCA:W6(V451_D-1)->T:W-1(V472_D-1) adding edge: GTGTCTTAACTCAGGAGATCA:W6(V451_D-1) to T:W-1(V472_D-1) removing edge Edge(471->472,w:2.0)(A:W-1(V471_D-1)->T:W-1(V472_D-1)) removing edge Edge(451->471,w:2.0)(GTGTCTTAACTCAGGAGATCA:W6(V451_D-1)->A:W-1(V471_D-1)) Found potential edge: Edge(451->472,w:2.0) between GTGTCTTAACTCAGGAGATCA:W6(V451_D-1) and T:W-1(V472_D-1) removing vertex T:W-1(V472_D-1) was concatenated into GTGTCTTAACTCAGGAGATCAT:W6(V451_D-1) Want to move edge Edge(472->473,w:2.0)(T:W-1(V472_D-1)->G:W-1(V473_D-1)) to (GTGTCTTAACTCAGGAGATCAT:W6(V451_D-1)->G:W-1(V473_D-1) adding edge: GTGTCTTAACTCAGGAGATCAT:W6(V451_D-1) to G:W-1(V473_D-1) removing edge Edge(472->473,w:2.0)(T:W-1(V472_D-1)->G:W-1(V473_D-1)) removing edge Edge(451->472,w:2.0)(GTGTCTTAACTCAGGAGATCAT:W6(V451_D-1)->T:W-1(V472_D-1)) Found potential edge: Edge(451->473,w:2.0) between GTGTCTTAACTCAGGAGATCAT:W6(V451_D-1) and G:W-1(V473_D-1) removing vertex G:W-1(V473_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATG:W6(V451_D-1) Want to move edge Edge(473->474,w:4.0)(G:W-1(V473_D-1)->G:W-1(V474_D-1)) to (GTGTCTTAACTCAGGAGATCATG:W6(V451_D-1)->G:W-1(V474_D-1) adding edge: GTGTCTTAACTCAGGAGATCATG:W6(V451_D-1) to G:W-1(V474_D-1) removing edge Edge(473->474,w:4.0)(G:W-1(V473_D-1)->G:W-1(V474_D-1)) removing edge Edge(451->473,w:2.0)(GTGTCTTAACTCAGGAGATCATG:W6(V451_D-1)->G:W-1(V473_D-1)) Found potential edge: Edge(451->474,w:4.0) between GTGTCTTAACTCAGGAGATCATG:W6(V451_D-1) and G:W-1(V474_D-1) removing vertex G:W-1(V474_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGG:W6(V451_D-1) Want to move edge Edge(474->475,w:2.0)(G:W-1(V474_D-1)->T:W-1(V475_D-1)) to (GTGTCTTAACTCAGGAGATCATGG:W6(V451_D-1)->T:W-1(V475_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGG:W6(V451_D-1) to T:W-1(V475_D-1) removing edge Edge(474->475,w:2.0)(G:W-1(V474_D-1)->T:W-1(V475_D-1)) removing edge Edge(451->474,w:4.0)(GTGTCTTAACTCAGGAGATCATGG:W6(V451_D-1)->G:W-1(V474_D-1)) Found potential edge: Edge(451->475,w:2.0) between GTGTCTTAACTCAGGAGATCATGG:W6(V451_D-1) and T:W-1(V475_D-1) removing vertex T:W-1(V475_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGGT:W6(V451_D-1) Want to move edge Edge(475->476,w:2.0)(T:W-1(V475_D-1)->A:W-1(V476_D-1)) to (GTGTCTTAACTCAGGAGATCATGGT:W6(V451_D-1)->A:W-1(V476_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGGT:W6(V451_D-1) to A:W-1(V476_D-1) removing edge Edge(475->476,w:2.0)(T:W-1(V475_D-1)->A:W-1(V476_D-1)) removing edge Edge(451->475,w:2.0)(GTGTCTTAACTCAGGAGATCATGGT:W6(V451_D-1)->T:W-1(V475_D-1)) Found potential edge: Edge(451->476,w:2.0) between GTGTCTTAACTCAGGAGATCATGGT:W6(V451_D-1) and A:W-1(V476_D-1) removing vertex A:W-1(V476_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGGTA:W6(V451_D-1) Want to move edge Edge(476->477,w:2.0)(A:W-1(V476_D-1)->G:W-1(V477_D-1)) to (GTGTCTTAACTCAGGAGATCATGGTA:W6(V451_D-1)->G:W-1(V477_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGGTA:W6(V451_D-1) to G:W-1(V477_D-1) removing edge Edge(476->477,w:2.0)(A:W-1(V476_D-1)->G:W-1(V477_D-1)) removing edge Edge(451->476,w:2.0)(GTGTCTTAACTCAGGAGATCATGGTA:W6(V451_D-1)->A:W-1(V476_D-1)) Found potential edge: Edge(451->477,w:2.0) between GTGTCTTAACTCAGGAGATCATGGTA:W6(V451_D-1) and G:W-1(V477_D-1) removing vertex G:W-1(V477_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGGTAG:W5(V451_D-1) Want to move edge Edge(477->478,w:2.0)(G:W-1(V477_D-1)->G:W-1(V478_D-1)) to (GTGTCTTAACTCAGGAGATCATGGTAG:W5(V451_D-1)->G:W-1(V478_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGGTAG:W5(V451_D-1) to G:W-1(V478_D-1) removing edge Edge(477->478,w:2.0)(G:W-1(V477_D-1)->G:W-1(V478_D-1)) removing edge Edge(451->477,w:2.0)(GTGTCTTAACTCAGGAGATCATGGTAG:W5(V451_D-1)->G:W-1(V477_D-1)) Found potential edge: Edge(451->478,w:2.0) between GTGTCTTAACTCAGGAGATCATGGTAG:W5(V451_D-1) and G:W-1(V478_D-1) removing vertex G:W-1(V478_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGGTAGG:W5(V451_D-1) Want to move edge Edge(478->479,w:2.0)(G:W-1(V478_D-1)->G:W-1(V479_D-1)) to (GTGTCTTAACTCAGGAGATCATGGTAGG:W5(V451_D-1)->G:W-1(V479_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGGTAGG:W5(V451_D-1) to G:W-1(V479_D-1) removing edge Edge(478->479,w:2.0)(G:W-1(V478_D-1)->G:W-1(V479_D-1)) removing edge Edge(451->478,w:2.0)(GTGTCTTAACTCAGGAGATCATGGTAGG:W5(V451_D-1)->G:W-1(V478_D-1)) Found potential edge: Edge(451->479,w:2.0) between GTGTCTTAACTCAGGAGATCATGGTAGG:W5(V451_D-1) and G:W-1(V479_D-1) removing vertex G:W-1(V479_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGGTAGGG:W5(V451_D-1) Want to move edge Edge(479->480,w:2.0)(G:W-1(V479_D-1)->A:W-1(V480_D-1)) to (GTGTCTTAACTCAGGAGATCATGGTAGGG:W5(V451_D-1)->A:W-1(V480_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGGTAGGG:W5(V451_D-1) to A:W-1(V480_D-1) removing edge Edge(479->480,w:2.0)(G:W-1(V479_D-1)->A:W-1(V480_D-1)) removing edge Edge(451->479,w:2.0)(GTGTCTTAACTCAGGAGATCATGGTAGGG:W5(V451_D-1)->G:W-1(V479_D-1)) Found potential edge: Edge(451->480,w:2.0) between GTGTCTTAACTCAGGAGATCATGGTAGGG:W5(V451_D-1) and A:W-1(V480_D-1) removing vertex A:W-1(V480_D-1) was concatenated into GTGTCTTAACTCAGGAGATCATGGTAGGGA:W5(V451_D-1) Want to move edge Edge(480->481,w:2.0)(A:W-1(V480_D-1)->A:W-1(V481_D-1)) to (GTGTCTTAACTCAGGAGATCATGGTAGGGA:W5(V451_D-1)->A:W-1(V481_D-1) adding edge: GTGTCTTAACTCAGGAGATCATGGTAGGGA:W5(V451_D-1) to A:W-1(V481_D-1) removing edge Edge(480->481,w:2.0)(A:W-1(V480_D-1)->A:W-1(V481_D-1)) removing edge Edge(451->480,w:2.0)(GTGTCTTAACTCAGGAGATCATGGTAGGGA:W5(V451_D-1)->A:W-1(V480_D-1)) Found potential edge: Edge(451->481,w:2.0) between GTGTCTTAACTCAGGAGATCATGGTAGGGA:W5(V451_D-1) and A:W-1(V481_D-1) removing vertex A:W-1(V481_D-1) was concatenated into GTGTCTTAAC...TGGTAGGGAA:W5(V451_D-1) Want to move edge Edge(481->482,w:2.0)(A:W-1(V481_D-1)->G:W-1(V482_D-1)) to (GTGTCTTAAC...TGGTAGGGAA:W5(V451_D-1)->G:W-1(V482_D-1) adding edge: GTGTCTTAAC...TGGTAGGGAA:W5(V451_D-1) to G:W-1(V482_D-1) removing edge Edge(481->482,w:2.0)(A:W-1(V481_D-1)->G:W-1(V482_D-1)) removing edge Edge(451->481,w:2.0)(GTGTCTTAAC...TGGTAGGGAA:W5(V451_D-1)->A:W-1(V481_D-1)) Found potential edge: Edge(451->482,w:2.0) between GTGTCTTAAC...TGGTAGGGAA:W5(V451_D-1) and G:W-1(V482_D-1) removing vertex G:W-1(V482_D-1) was concatenated into GTGTCTTAAC...GGTAGGGAAG:W5(V451_D-1) Want to move edge Edge(482->483,w:2.0)(G:W-1(V482_D-1)->G:W-1(V483_D-1)) to (GTGTCTTAAC...GGTAGGGAAG:W5(V451_D-1)->G:W-1(V483_D-1) adding edge: GTGTCTTAAC...GGTAGGGAAG:W5(V451_D-1) to G:W-1(V483_D-1) removing edge Edge(482->483,w:2.0)(G:W-1(V482_D-1)->G:W-1(V483_D-1)) removing edge Edge(451->482,w:2.0)(GTGTCTTAAC...GGTAGGGAAG:W5(V451_D-1)->G:W-1(V482_D-1)) Found potential edge: Edge(451->483,w:2.0) between GTGTCTTAAC...GGTAGGGAAG:W5(V451_D-1) and G:W-1(V483_D-1) removing vertex G:W-1(V483_D-1) was concatenated into GTGTCTTAAC...GTAGGGAAGG:W5(V451_D-1) Want to move edge Edge(483->484,w:2.0)(G:W-1(V483_D-1)->G:W-1(V484_D-1)) to (GTGTCTTAAC...GTAGGGAAGG:W5(V451_D-1)->G:W-1(V484_D-1) adding edge: GTGTCTTAAC...GTAGGGAAGG:W5(V451_D-1) to G:W-1(V484_D-1) removing edge Edge(483->484,w:2.0)(G:W-1(V483_D-1)->G:W-1(V484_D-1)) removing edge Edge(451->483,w:2.0)(GTGTCTTAAC...GTAGGGAAGG:W5(V451_D-1)->G:W-1(V483_D-1)) Found potential edge: Edge(451->484,w:2.0) between GTGTCTTAAC...GTAGGGAAGG:W5(V451_D-1) and G:W-1(V484_D-1) removing vertex G:W-1(V484_D-1) was concatenated into GTGTCTTAAC...TAGGGAAGGG:W5(V451_D-1) Want to move edge Edge(484->485,w:2.0)(G:W-1(V484_D-1)->G:W-1(V485_D-1)) to (GTGTCTTAAC...TAGGGAAGGG:W5(V451_D-1)->G:W-1(V485_D-1) adding edge: GTGTCTTAAC...TAGGGAAGGG:W5(V451_D-1) to G:W-1(V485_D-1) removing edge Edge(484->485,w:2.0)(G:W-1(V484_D-1)->G:W-1(V485_D-1)) removing edge Edge(451->484,w:2.0)(GTGTCTTAAC...TAGGGAAGGG:W5(V451_D-1)->G:W-1(V484_D-1)) Found potential edge: Edge(451->485,w:2.0) between GTGTCTTAAC...TAGGGAAGGG:W5(V451_D-1) and G:W-1(V485_D-1) removing vertex G:W-1(V485_D-1) was concatenated into GTGTCTTAAC...AGGGAAGGGG:W5(V451_D-1) Want to move edge Edge(485->486,w:4.0)(G:W-1(V485_D-1)->T:W-1(V486_D-1)) to (GTGTCTTAAC...AGGGAAGGGG:W5(V451_D-1)->T:W-1(V486_D-1) adding edge: GTGTCTTAAC...AGGGAAGGGG:W5(V451_D-1) to T:W-1(V486_D-1) removing edge Edge(485->486,w:4.0)(G:W-1(V485_D-1)->T:W-1(V486_D-1)) removing edge Edge(451->485,w:2.0)(GTGTCTTAAC...AGGGAAGGGG:W5(V451_D-1)->G:W-1(V485_D-1)) Found potential edge: Edge(451->486,w:4.0) between GTGTCTTAAC...AGGGAAGGGG:W5(V451_D-1) and T:W-1(V486_D-1) removing vertex T:W-1(V486_D-1) was concatenated into GTGTCTTAAC...GGGAAGGGGT:W5(V451_D-1) Want to move edge Edge(486->487,w:4.0)(T:W-1(V486_D-1)->C:W-1(V487_D-1)) to (GTGTCTTAAC...GGGAAGGGGT:W5(V451_D-1)->C:W-1(V487_D-1) adding edge: GTGTCTTAAC...GGGAAGGGGT:W5(V451_D-1) to C:W-1(V487_D-1) removing edge Edge(486->487,w:4.0)(T:W-1(V486_D-1)->C:W-1(V487_D-1)) removing edge Edge(451->486,w:4.0)(GTGTCTTAAC...GGGAAGGGGT:W5(V451_D-1)->T:W-1(V486_D-1)) Found potential edge: Edge(451->487,w:4.0) between GTGTCTTAAC...GGGAAGGGGT:W5(V451_D-1) and C:W-1(V487_D-1) removing vertex C:W-1(V487_D-1) was concatenated into GTGTCTTAAC...GGAAGGGGTC:W5(V451_D-1) Want to move edge Edge(487->488,w:4.0)(C:W-1(V487_D-1)->A:W-1(V488_D-1)) to (GTGTCTTAAC...GGAAGGGGTC:W5(V451_D-1)->A:W-1(V488_D-1) adding edge: GTGTCTTAAC...GGAAGGGGTC:W5(V451_D-1) to A:W-1(V488_D-1) removing edge Edge(487->488,w:4.0)(C:W-1(V487_D-1)->A:W-1(V488_D-1)) removing edge Edge(451->487,w:4.0)(GTGTCTTAAC...GGAAGGGGTC:W5(V451_D-1)->C:W-1(V487_D-1)) Found potential edge: Edge(451->488,w:4.0) between GTGTCTTAAC...GGAAGGGGTC:W5(V451_D-1) and A:W-1(V488_D-1) removing vertex A:W-1(V488_D-1) was concatenated into GTGTCTTAAC...GAAGGGGTCA:W5(V451_D-1) Want to move edge Edge(488->489,w:4.0)(A:W-1(V488_D-1)->G:W-1(V489_D-1)) to (GTGTCTTAAC...GAAGGGGTCA:W5(V451_D-1)->G:W-1(V489_D-1) adding edge: GTGTCTTAAC...GAAGGGGTCA:W5(V451_D-1) to G:W-1(V489_D-1) removing edge Edge(488->489,w:4.0)(A:W-1(V488_D-1)->G:W-1(V489_D-1)) removing edge Edge(451->488,w:4.0)(GTGTCTTAAC...GAAGGGGTCA:W5(V451_D-1)->A:W-1(V488_D-1)) Found potential edge: Edge(451->489,w:4.0) between GTGTCTTAAC...GAAGGGGTCA:W5(V451_D-1) and G:W-1(V489_D-1) removing vertex G:W-1(V489_D-1) was concatenated into GTGTCTTAAC...AAGGGGTCAG:W5(V451_D-1) Want to move edge Edge(489->490,w:4.0)(G:W-1(V489_D-1)->G:W-1(V490_D-1)) to (GTGTCTTAAC...AAGGGGTCAG:W5(V451_D-1)->G:W-1(V490_D-1) adding edge: GTGTCTTAAC...AAGGGGTCAG:W5(V451_D-1) to G:W-1(V490_D-1) removing edge Edge(489->490,w:4.0)(G:W-1(V489_D-1)->G:W-1(V490_D-1)) removing edge Edge(451->489,w:4.0)(GTGTCTTAAC...AAGGGGTCAG:W5(V451_D-1)->G:W-1(V489_D-1)) Found potential edge: Edge(451->490,w:4.0) between GTGTCTTAAC...AAGGGGTCAG:W5(V451_D-1) and G:W-1(V490_D-1) removing vertex G:W-1(V490_D-1) was concatenated into GTGTCTTAAC...AGGGGTCAGG:W5(V451_D-1) Want to move edge Edge(490->491,w:4.0)(G:W-1(V490_D-1)->C:W-1(V491_D-1)) to (GTGTCTTAAC...AGGGGTCAGG:W5(V451_D-1)->C:W-1(V491_D-1) adding edge: GTGTCTTAAC...AGGGGTCAGG:W5(V451_D-1) to C:W-1(V491_D-1) removing edge Edge(490->491,w:4.0)(G:W-1(V490_D-1)->C:W-1(V491_D-1)) removing edge Edge(451->490,w:4.0)(GTGTCTTAAC...AGGGGTCAGG:W5(V451_D-1)->G:W-1(V490_D-1)) Found potential edge: Edge(451->491,w:4.0) between GTGTCTTAAC...AGGGGTCAGG:W5(V451_D-1) and C:W-1(V491_D-1) removing vertex C:W-1(V491_D-1) was concatenated into GTGTCTTAAC...GGGGTCAGGC:W5(V451_D-1) Want to move edge Edge(491->492,w:4.0)(C:W-1(V491_D-1)->C:W-1(V492_D-1)) to (GTGTCTTAAC...GGGGTCAGGC:W5(V451_D-1)->C:W-1(V492_D-1) adding edge: GTGTCTTAAC...GGGGTCAGGC:W5(V451_D-1) to C:W-1(V492_D-1) removing edge Edge(491->492,w:4.0)(C:W-1(V491_D-1)->C:W-1(V492_D-1)) removing edge Edge(451->491,w:4.0)(GTGTCTTAAC...GGGGTCAGGC:W5(V451_D-1)->C:W-1(V491_D-1)) Found potential edge: Edge(451->492,w:4.0) between GTGTCTTAAC...GGGGTCAGGC:W5(V451_D-1) and C:W-1(V492_D-1) removing vertex C:W-1(V492_D-1) was concatenated into GTGTCTTAAC...GGGTCAGGCC:W5(V451_D-1) Want to move edge Edge(492->493,w:4.0)(C:W-1(V492_D-1)->A:W-1(V493_D-1)) to (GTGTCTTAAC...GGGTCAGGCC:W5(V451_D-1)->A:W-1(V493_D-1) adding edge: GTGTCTTAAC...GGGTCAGGCC:W5(V451_D-1) to A:W-1(V493_D-1) removing edge Edge(492->493,w:4.0)(C:W-1(V492_D-1)->A:W-1(V493_D-1)) removing edge Edge(451->492,w:4.0)(GTGTCTTAAC...GGGTCAGGCC:W5(V451_D-1)->C:W-1(V492_D-1)) Found potential edge: Edge(451->493,w:4.0) between GTGTCTTAAC...GGGTCAGGCC:W5(V451_D-1) and A:W-1(V493_D-1) removing vertex A:W-1(V493_D-1) was concatenated into GTGTCTTAAC...GGTCAGGCCA:W5(V451_D-1) Want to move edge Edge(493->494,w:4.0)(A:W-1(V493_D-1)->C:W-1(V494_D-1)) to (GTGTCTTAAC...GGTCAGGCCA:W5(V451_D-1)->C:W-1(V494_D-1) adding edge: GTGTCTTAAC...GGTCAGGCCA:W5(V451_D-1) to C:W-1(V494_D-1) removing edge Edge(493->494,w:4.0)(A:W-1(V493_D-1)->C:W-1(V494_D-1)) removing edge Edge(451->493,w:4.0)(GTGTCTTAAC...GGTCAGGCCA:W5(V451_D-1)->A:W-1(V493_D-1)) Found potential edge: Edge(451->494,w:4.0) between GTGTCTTAAC...GGTCAGGCCA:W5(V451_D-1) and C:W-1(V494_D-1) removing vertex C:W-1(V494_D-1) was concatenated into GTGTCTTAAC...GTCAGGCCAC:W5(V451_D-1) Want to move edge Edge(494->495,w:4.0)(C:W-1(V494_D-1)->T:W-1(V495_D-1)) to (GTGTCTTAAC...GTCAGGCCAC:W5(V451_D-1)->T:W-1(V495_D-1) adding edge: GTGTCTTAAC...GTCAGGCCAC:W5(V451_D-1) to T:W-1(V495_D-1) removing edge Edge(494->495,w:4.0)(C:W-1(V494_D-1)->T:W-1(V495_D-1)) removing edge Edge(451->494,w:4.0)(GTGTCTTAAC...GTCAGGCCAC:W5(V451_D-1)->C:W-1(V494_D-1)) Found potential edge: Edge(451->495,w:4.0) between GTGTCTTAAC...GTCAGGCCAC:W5(V451_D-1) and T:W-1(V495_D-1) removing vertex T:W-1(V495_D-1) was concatenated into GTGTCTTAAC...TCAGGCCACT:W5(V451_D-1) Want to move edge Edge(495->496,w:4.0)(T:W-1(V495_D-1)->T:W-1(V496_D-1)) to (GTGTCTTAAC...TCAGGCCACT:W5(V451_D-1)->T:W-1(V496_D-1) adding edge: GTGTCTTAAC...TCAGGCCACT:W5(V451_D-1) to T:W-1(V496_D-1) removing edge Edge(495->496,w:4.0)(T:W-1(V495_D-1)->T:W-1(V496_D-1)) removing edge Edge(451->495,w:4.0)(GTGTCTTAAC...TCAGGCCACT:W5(V451_D-1)->T:W-1(V495_D-1)) Found potential edge: Edge(451->496,w:4.0) between GTGTCTTAAC...TCAGGCCACT:W5(V451_D-1) and T:W-1(V496_D-1) removing vertex T:W-1(V496_D-1) was concatenated into GTGTCTTAAC...CAGGCCACTT:W4(V451_D-1) Want to move edge Edge(496->497,w:4.0)(T:W-1(V496_D-1)->C:W-1(V497_D-1)) to (GTGTCTTAAC...CAGGCCACTT:W4(V451_D-1)->C:W-1(V497_D-1) adding edge: GTGTCTTAAC...CAGGCCACTT:W4(V451_D-1) to C:W-1(V497_D-1) removing edge Edge(496->497,w:4.0)(T:W-1(V496_D-1)->C:W-1(V497_D-1)) removing edge Edge(451->496,w:4.0)(GTGTCTTAAC...CAGGCCACTT:W4(V451_D-1)->T:W-1(V496_D-1)) Found potential edge: Edge(451->497,w:4.0) between GTGTCTTAAC...CAGGCCACTT:W4(V451_D-1) and C:W-1(V497_D-1) removing vertex C:W-1(V497_D-1) was concatenated into GTGTCTTAAC...AGGCCACTTC:W4(V451_D-1) Want to move edge Edge(497->498,w:4.0)(C:W-1(V497_D-1)->A:W-1(V498_D-1)) to (GTGTCTTAAC...AGGCCACTTC:W4(V451_D-1)->A:W-1(V498_D-1) adding edge: GTGTCTTAAC...AGGCCACTTC:W4(V451_D-1) to A:W-1(V498_D-1) removing edge Edge(497->498,w:4.0)(C:W-1(V497_D-1)->A:W-1(V498_D-1)) removing edge Edge(451->497,w:4.0)(GTGTCTTAAC...AGGCCACTTC:W4(V451_D-1)->C:W-1(V497_D-1)) Found potential edge: Edge(451->498,w:4.0) between GTGTCTTAAC...AGGCCACTTC:W4(V451_D-1) and A:W-1(V498_D-1) removing vertex A:W-1(V498_D-1) was concatenated into GTGTCTTAAC...GGCCACTTCA:W4(V451_D-1) Want to move edge Edge(498->499,w:4.0)(A:W-1(V498_D-1)->C:W-1(V499_D-1)) to (GTGTCTTAAC...GGCCACTTCA:W4(V451_D-1)->C:W-1(V499_D-1) adding edge: GTGTCTTAAC...GGCCACTTCA:W4(V451_D-1) to C:W-1(V499_D-1) removing edge Edge(498->499,w:4.0)(A:W-1(V498_D-1)->C:W-1(V499_D-1)) removing edge Edge(451->498,w:4.0)(GTGTCTTAAC...GGCCACTTCA:W4(V451_D-1)->A:W-1(V498_D-1)) Found potential edge: Edge(451->499,w:4.0) between GTGTCTTAAC...GGCCACTTCA:W4(V451_D-1) and C:W-1(V499_D-1) removing vertex C:W-1(V499_D-1) was concatenated into GTGTCTTAAC...GCCACTTCAC:W4(V451_D-1) Want to move edge Edge(499->500,w:4.0)(C:W-1(V499_D-1)->A:W-1(V500_D-1)) to (GTGTCTTAAC...GCCACTTCAC:W4(V451_D-1)->A:W-1(V500_D-1) adding edge: GTGTCTTAAC...GCCACTTCAC:W4(V451_D-1) to A:W-1(V500_D-1) removing edge Edge(499->500,w:4.0)(C:W-1(V499_D-1)->A:W-1(V500_D-1)) removing edge Edge(451->499,w:4.0)(GTGTCTTAAC...GCCACTTCAC:W4(V451_D-1)->C:W-1(V499_D-1)) Found potential edge: Edge(451->500,w:4.0) between GTGTCTTAAC...GCCACTTCAC:W4(V451_D-1) and A:W-1(V500_D-1) removing vertex A:W-1(V500_D-1) was concatenated into GTGTCTTAAC...CCACTTCACA:W4(V451_D-1) Want to move edge Edge(500->501,w:4.0)(A:W-1(V500_D-1)->A:W-1(V501_D-1)) to (GTGTCTTAAC...CCACTTCACA:W4(V451_D-1)->A:W-1(V501_D-1) adding edge: GTGTCTTAAC...CCACTTCACA:W4(V451_D-1) to A:W-1(V501_D-1) removing edge Edge(500->501,w:4.0)(A:W-1(V500_D-1)->A:W-1(V501_D-1)) removing edge Edge(451->500,w:4.0)(GTGTCTTAAC...CCACTTCACA:W4(V451_D-1)->A:W-1(V500_D-1)) Found potential edge: Edge(451->501,w:4.0) between GTGTCTTAAC...CCACTTCACA:W4(V451_D-1) and A:W-1(V501_D-1) removing vertex A:W-1(V501_D-1) was concatenated into GTGTCTTAAC...CACTTCACAA:W4(V451_D-1) Want to move edge Edge(501->502,w:4.0)(A:W-1(V501_D-1)->G:W-1(V502_D-1)) to (GTGTCTTAAC...CACTTCACAA:W4(V451_D-1)->G:W-1(V502_D-1) adding edge: GTGTCTTAAC...CACTTCACAA:W4(V451_D-1) to G:W-1(V502_D-1) removing edge Edge(501->502,w:4.0)(A:W-1(V501_D-1)->G:W-1(V502_D-1)) removing edge Edge(451->501,w:4.0)(GTGTCTTAAC...CACTTCACAA:W4(V451_D-1)->A:W-1(V501_D-1)) Found potential edge: Edge(451->502,w:4.0) between GTGTCTTAAC...CACTTCACAA:W4(V451_D-1) and G:W-1(V502_D-1) removing vertex G:W-1(V502_D-1) was concatenated into GTGTCTTAAC...ACTTCACAAG:W4(V451_D-1) Want to move edge Edge(502->503,w:6.0)(G:W-1(V502_D-1)->G:W-1(V503_D-1)) to (GTGTCTTAAC...ACTTCACAAG:W4(V451_D-1)->G:W-1(V503_D-1) adding edge: GTGTCTTAAC...ACTTCACAAG:W4(V451_D-1) to G:W-1(V503_D-1) removing edge Edge(502->503,w:6.0)(G:W-1(V502_D-1)->G:W-1(V503_D-1)) removing edge Edge(451->502,w:4.0)(GTGTCTTAAC...ACTTCACAAG:W4(V451_D-1)->G:W-1(V502_D-1)) Found potential edge: Edge(451->503,w:6.0) between GTGTCTTAAC...ACTTCACAAG:W4(V451_D-1) and G:W-1(V503_D-1) removing vertex G:W-1(V503_D-1) was concatenated into GTGTCTTAAC...CTTCACAAGG:W4(V451_D-1) Want to move edge Edge(503->504,w:6.0)(G:W-1(V503_D-1)->A:W-1(V504_D-1)) to (GTGTCTTAAC...CTTCACAAGG:W4(V451_D-1)->A:W-1(V504_D-1) adding edge: GTGTCTTAAC...CTTCACAAGG:W4(V451_D-1) to A:W-1(V504_D-1) removing edge Edge(503->504,w:6.0)(G:W-1(V503_D-1)->A:W-1(V504_D-1)) removing edge Edge(451->503,w:6.0)(GTGTCTTAAC...CTTCACAAGG:W4(V451_D-1)->G:W-1(V503_D-1)) Found potential edge: Edge(451->504,w:6.0) between GTGTCTTAAC...CTTCACAAGG:W4(V451_D-1) and A:W-1(V504_D-1) removing vertex A:W-1(V504_D-1) was concatenated into GTGTCTTAAC...TTCACAAGGA:W4(V451_D-1) Want to move edge Edge(504->505,w:8.0)(A:W-1(V504_D-1)->G:W-1(V505_D-1)) to (GTGTCTTAAC...TTCACAAGGA:W4(V451_D-1)->G:W-1(V505_D-1) adding edge: GTGTCTTAAC...TTCACAAGGA:W4(V451_D-1) to G:W-1(V505_D-1) removing edge Edge(504->505,w:8.0)(A:W-1(V504_D-1)->G:W-1(V505_D-1)) removing edge Edge(451->504,w:6.0)(GTGTCTTAAC...TTCACAAGGA:W4(V451_D-1)->A:W-1(V504_D-1)) Found potential edge: Edge(451->505,w:8.0) between GTGTCTTAAC...TTCACAAGGA:W4(V451_D-1) and G:W-1(V505_D-1) removing vertex G:W-1(V505_D-1) was concatenated into GTGTCTTAAC...TCACAAGGAG:W5(V451_D-1) Want to move edge Edge(505->506,w:8.0)(G:W-1(V505_D-1)->C:W-1(V506_D-1)) to (GTGTCTTAAC...TCACAAGGAG:W5(V451_D-1)->C:W-1(V506_D-1) adding edge: GTGTCTTAAC...TCACAAGGAG:W5(V451_D-1) to C:W-1(V506_D-1) removing edge Edge(505->506,w:8.0)(G:W-1(V505_D-1)->C:W-1(V506_D-1)) removing edge Edge(451->505,w:8.0)(GTGTCTTAAC...TCACAAGGAG:W5(V451_D-1)->G:W-1(V505_D-1)) Found potential edge: Edge(451->506,w:8.0) between GTGTCTTAAC...TCACAAGGAG:W5(V451_D-1) and C:W-1(V506_D-1) removing vertex C:W-1(V506_D-1) was concatenated into GTGTCTTAAC...CACAAGGAGC:W5(V451_D-1) Want to move edge Edge(506->507,w:8.0)(C:W-1(V506_D-1)->A:W-1(V507_D-1)) to (GTGTCTTAAC...CACAAGGAGC:W5(V451_D-1)->A:W-1(V507_D-1) adding edge: GTGTCTTAAC...CACAAGGAGC:W5(V451_D-1) to A:W-1(V507_D-1) removing edge Edge(506->507,w:8.0)(C:W-1(V506_D-1)->A:W-1(V507_D-1)) removing edge Edge(451->506,w:8.0)(GTGTCTTAAC...CACAAGGAGC:W5(V451_D-1)->C:W-1(V506_D-1)) Found potential edge: Edge(451->507,w:8.0) between GTGTCTTAAC...CACAAGGAGC:W5(V451_D-1) and A:W-1(V507_D-1) removing vertex A:W-1(V507_D-1) was concatenated into GTGTCTTAAC...ACAAGGAGCA:W5(V451_D-1) Want to move edge Edge(507->508,w:10.0)(A:W-1(V507_D-1)->G:W-1(V508_D-1)) to (GTGTCTTAAC...ACAAGGAGCA:W5(V451_D-1)->G:W-1(V508_D-1) adding edge: GTGTCTTAAC...ACAAGGAGCA:W5(V451_D-1) to G:W-1(V508_D-1) removing edge Edge(507->508,w:10.0)(A:W-1(V507_D-1)->G:W-1(V508_D-1)) removing edge Edge(451->507,w:8.0)(GTGTCTTAAC...ACAAGGAGCA:W5(V451_D-1)->A:W-1(V507_D-1)) Found potential edge: Edge(451->508,w:10.0) between GTGTCTTAAC...ACAAGGAGCA:W5(V451_D-1) and G:W-1(V508_D-1) removing vertex G:W-1(V508_D-1) was concatenated into GTGTCTTAAC...CAAGGAGCAG:W5(V451_D-1) Want to move edge Edge(508->509,w:10.0)(G:W-1(V508_D-1)->A:W-1(V509_D-1)) to (GTGTCTTAAC...CAAGGAGCAG:W5(V451_D-1)->A:W-1(V509_D-1) adding edge: GTGTCTTAAC...CAAGGAGCAG:W5(V451_D-1) to A:W-1(V509_D-1) removing edge Edge(508->509,w:10.0)(G:W-1(V508_D-1)->A:W-1(V509_D-1)) removing edge Edge(451->508,w:10.0)(GTGTCTTAAC...CAAGGAGCAG:W5(V451_D-1)->G:W-1(V508_D-1)) Found potential edge: Edge(451->509,w:10.0) between GTGTCTTAAC...CAAGGAGCAG:W5(V451_D-1) and A:W-1(V509_D-1) removing vertex A:W-1(V509_D-1) was concatenated into GTGTCTTAAC...AAGGAGCAGA:W5(V451_D-1) Want to move edge Edge(509->510,w:10.0)(A:W-1(V509_D-1)->G:W-1(V510_D-1)) to (GTGTCTTAAC...AAGGAGCAGA:W5(V451_D-1)->G:W-1(V510_D-1) adding edge: GTGTCTTAAC...AAGGAGCAGA:W5(V451_D-1) to G:W-1(V510_D-1) removing edge Edge(509->510,w:10.0)(A:W-1(V509_D-1)->G:W-1(V510_D-1)) removing edge Edge(451->509,w:10.0)(GTGTCTTAAC...AAGGAGCAGA:W5(V451_D-1)->A:W-1(V509_D-1)) Found potential edge: Edge(451->510,w:10.0) between GTGTCTTAAC...AAGGAGCAGA:W5(V451_D-1) and G:W-1(V510_D-1) removing vertex G:W-1(V510_D-1) was concatenated into GTGTCTTAAC...AGGAGCAGAG:W5(V451_D-1) Want to move edge Edge(510->511,w:10.0)(G:W-1(V510_D-1)->T:W-1(V511_D-1)) to (GTGTCTTAAC...AGGAGCAGAG:W5(V451_D-1)->T:W-1(V511_D-1) adding edge: GTGTCTTAAC...AGGAGCAGAG:W5(V451_D-1) to T:W-1(V511_D-1) removing edge Edge(510->511,w:10.0)(G:W-1(V510_D-1)->T:W-1(V511_D-1)) removing edge Edge(451->510,w:10.0)(GTGTCTTAAC...AGGAGCAGAG:W5(V451_D-1)->G:W-1(V510_D-1)) Found potential edge: Edge(451->511,w:10.0) between GTGTCTTAAC...AGGAGCAGAG:W5(V451_D-1) and T:W-1(V511_D-1) removing vertex T:W-1(V511_D-1) was concatenated into GTGTCTTAAC...GGAGCAGAGT:W5(V451_D-1) Want to move edge Edge(511->512,w:10.0)(T:W-1(V511_D-1)->T:W-1(V512_D-1)) to (GTGTCTTAAC...GGAGCAGAGT:W5(V451_D-1)->T:W-1(V512_D-1) adding edge: GTGTCTTAAC...GGAGCAGAGT:W5(V451_D-1) to T:W-1(V512_D-1) removing edge Edge(511->512,w:10.0)(T:W-1(V511_D-1)->T:W-1(V512_D-1)) removing edge Edge(451->511,w:10.0)(GTGTCTTAAC...GGAGCAGAGT:W5(V451_D-1)->T:W-1(V511_D-1)) Found potential edge: Edge(451->512,w:10.0) between GTGTCTTAAC...GGAGCAGAGT:W5(V451_D-1) and T:W-1(V512_D-1) removing vertex T:W-1(V512_D-1) was concatenated into GTGTCTTAAC...GAGCAGAGTT:W5(V451_D-1) Want to move edge Edge(512->513,w:10.0)(T:W-1(V512_D-1)->A:W-1(V513_D-1)) to (GTGTCTTAAC...GAGCAGAGTT:W5(V451_D-1)->A:W-1(V513_D-1) adding edge: GTGTCTTAAC...GAGCAGAGTT:W5(V451_D-1) to A:W-1(V513_D-1) removing edge Edge(512->513,w:10.0)(T:W-1(V512_D-1)->A:W-1(V513_D-1)) removing edge Edge(451->512,w:10.0)(GTGTCTTAAC...GAGCAGAGTT:W5(V451_D-1)->T:W-1(V512_D-1)) Found potential edge: Edge(451->513,w:10.0) between GTGTCTTAAC...GAGCAGAGTT:W5(V451_D-1) and A:W-1(V513_D-1) removing vertex A:W-1(V513_D-1) was concatenated into GTGTCTTAAC...AGCAGAGTTA:W5(V451_D-1) Want to move edge Edge(513->514,w:10.0)(A:W-1(V513_D-1)->G:W-1(V514_D-1)) to (GTGTCTTAAC...AGCAGAGTTA:W5(V451_D-1)->G:W-1(V514_D-1) adding edge: GTGTCTTAAC...AGCAGAGTTA:W5(V451_D-1) to G:W-1(V514_D-1) removing edge Edge(513->514,w:10.0)(A:W-1(V513_D-1)->G:W-1(V514_D-1)) removing edge Edge(451->513,w:10.0)(GTGTCTTAAC...AGCAGAGTTA:W5(V451_D-1)->A:W-1(V513_D-1)) Found potential edge: Edge(451->514,w:10.0) between GTGTCTTAAC...AGCAGAGTTA:W5(V451_D-1) and G:W-1(V514_D-1) removing vertex G:W-1(V514_D-1) was concatenated into GTGTCTTAAC...GCAGAGTTAG:W5(V451_D-1) Want to move edge Edge(514->515,w:10.0)(G:W-1(V514_D-1)->G:W-1(V515_D-1)) to (GTGTCTTAAC...GCAGAGTTAG:W5(V451_D-1)->G:W-1(V515_D-1) adding edge: GTGTCTTAAC...GCAGAGTTAG:W5(V451_D-1) to G:W-1(V515_D-1) removing edge Edge(514->515,w:10.0)(G:W-1(V514_D-1)->G:W-1(V515_D-1)) removing edge Edge(451->514,w:10.0)(GTGTCTTAAC...GCAGAGTTAG:W5(V451_D-1)->G:W-1(V514_D-1)) Found potential edge: Edge(451->515,w:10.0) between GTGTCTTAAC...GCAGAGTTAG:W5(V451_D-1) and G:W-1(V515_D-1) removing vertex G:W-1(V515_D-1) was concatenated into GTGTCTTAAC...CAGAGTTAGG:W5(V451_D-1) Want to move edge Edge(515->516,w:10.0)(G:W-1(V515_D-1)->A:W-1(V516_D-1)) to (GTGTCTTAAC...CAGAGTTAGG:W5(V451_D-1)->A:W-1(V516_D-1) adding edge: GTGTCTTAAC...CAGAGTTAGG:W5(V451_D-1) to A:W-1(V516_D-1) removing edge Edge(515->516,w:10.0)(G:W-1(V515_D-1)->A:W-1(V516_D-1)) removing edge Edge(451->515,w:10.0)(GTGTCTTAAC...CAGAGTTAGG:W5(V451_D-1)->G:W-1(V515_D-1)) Found potential edge: Edge(451->516,w:10.0) between GTGTCTTAAC...CAGAGTTAGG:W5(V451_D-1) and A:W-1(V516_D-1) removing vertex A:W-1(V516_D-1) was concatenated into GTGTCTTAAC...AGAGTTAGGA:W5(V451_D-1) Want to move edge Edge(516->517,w:10.0)(A:W-1(V516_D-1)->A:W-1(V517_D-1)) to (GTGTCTTAAC...AGAGTTAGGA:W5(V451_D-1)->A:W-1(V517_D-1) adding edge: GTGTCTTAAC...AGAGTTAGGA:W5(V451_D-1) to A:W-1(V517_D-1) removing edge Edge(516->517,w:10.0)(A:W-1(V516_D-1)->A:W-1(V517_D-1)) removing edge Edge(451->516,w:10.0)(GTGTCTTAAC...AGAGTTAGGA:W5(V451_D-1)->A:W-1(V516_D-1)) Found potential edge: Edge(451->517,w:10.0) between GTGTCTTAAC...AGAGTTAGGA:W5(V451_D-1) and A:W-1(V517_D-1) removing vertex A:W-1(V517_D-1) was concatenated into GTGTCTTAAC...GAGTTAGGAA:W5(V451_D-1) Want to move edge Edge(517->518,w:10.0)(A:W-1(V517_D-1)->G:W-1(V518_D-1)) to (GTGTCTTAAC...GAGTTAGGAA:W5(V451_D-1)->G:W-1(V518_D-1) adding edge: GTGTCTTAAC...GAGTTAGGAA:W5(V451_D-1) to G:W-1(V518_D-1) removing edge Edge(517->518,w:10.0)(A:W-1(V517_D-1)->G:W-1(V518_D-1)) removing edge Edge(451->517,w:10.0)(GTGTCTTAAC...GAGTTAGGAA:W5(V451_D-1)->A:W-1(V517_D-1)) Found potential edge: Edge(451->518,w:10.0) between GTGTCTTAAC...GAGTTAGGAA:W5(V451_D-1) and G:W-1(V518_D-1) removing vertex G:W-1(V518_D-1) was concatenated into GTGTCTTAAC...AGTTAGGAAG:W6(V451_D-1) Want to move edge Edge(518->519,w:10.0)(G:W-1(V518_D-1)->C:W-1(V519_D-1)) to (GTGTCTTAAC...AGTTAGGAAG:W6(V451_D-1)->C:W-1(V519_D-1) adding edge: GTGTCTTAAC...AGTTAGGAAG:W6(V451_D-1) to C:W-1(V519_D-1) removing edge Edge(518->519,w:10.0)(G:W-1(V518_D-1)->C:W-1(V519_D-1)) removing edge Edge(451->518,w:10.0)(GTGTCTTAAC...AGTTAGGAAG:W6(V451_D-1)->G:W-1(V518_D-1)) Found potential edge: Edge(451->519,w:10.0) between GTGTCTTAAC...AGTTAGGAAG:W6(V451_D-1) and C:W-1(V519_D-1) removing vertex C:W-1(V519_D-1) was concatenated into GTGTCTTAAC...GTTAGGAAGC:W6(V451_D-1) Want to move edge Edge(519->520,w:10.0)(C:W-1(V519_D-1)->T:W-1(V520_D-1)) to (GTGTCTTAAC...GTTAGGAAGC:W6(V451_D-1)->T:W-1(V520_D-1) adding edge: GTGTCTTAAC...GTTAGGAAGC:W6(V451_D-1) to T:W-1(V520_D-1) removing edge Edge(519->520,w:10.0)(C:W-1(V519_D-1)->T:W-1(V520_D-1)) removing edge Edge(451->519,w:10.0)(GTGTCTTAAC...GTTAGGAAGC:W6(V451_D-1)->C:W-1(V519_D-1)) Found potential edge: Edge(451->520,w:10.0) between GTGTCTTAAC...GTTAGGAAGC:W6(V451_D-1) and T:W-1(V520_D-1) removing vertex T:W-1(V520_D-1) was concatenated into GTGTCTTAAC...TTAGGAAGCT:W6(V451_D-1) Want to move edge Edge(520->521,w:10.0)(T:W-1(V520_D-1)->C:W-1(V521_D-1)) to (GTGTCTTAAC...TTAGGAAGCT:W6(V451_D-1)->C:W-1(V521_D-1) adding edge: GTGTCTTAAC...TTAGGAAGCT:W6(V451_D-1) to C:W-1(V521_D-1) removing edge Edge(520->521,w:10.0)(T:W-1(V520_D-1)->C:W-1(V521_D-1)) removing edge Edge(451->520,w:10.0)(GTGTCTTAAC...TTAGGAAGCT:W6(V451_D-1)->T:W-1(V520_D-1)) Found potential edge: Edge(451->521,w:10.0) between GTGTCTTAAC...TTAGGAAGCT:W6(V451_D-1) and C:W-1(V521_D-1) removing vertex C:W-1(V521_D-1) was concatenated into GTGTCTTAAC...TAGGAAGCTC:W6(V451_D-1) Want to move edge Edge(521->522,w:10.0)(C:W-1(V521_D-1)->C:W-1(V522_D-1)) to (GTGTCTTAAC...TAGGAAGCTC:W6(V451_D-1)->C:W-1(V522_D-1) adding edge: GTGTCTTAAC...TAGGAAGCTC:W6(V451_D-1) to C:W-1(V522_D-1) removing edge Edge(521->522,w:10.0)(C:W-1(V521_D-1)->C:W-1(V522_D-1)) removing edge Edge(451->521,w:10.0)(GTGTCTTAAC...TAGGAAGCTC:W6(V451_D-1)->C:W-1(V521_D-1)) Found potential edge: Edge(451->522,w:10.0) between GTGTCTTAAC...TAGGAAGCTC:W6(V451_D-1) and C:W-1(V522_D-1) removing vertex C:W-1(V522_D-1) was concatenated into GTGTCTTAAC...AGGAAGCTCC:W6(V451_D-1) Want to move edge Edge(522->523,w:10.0)(C:W-1(V522_D-1)->C:W-1(V523_D-1)) to (GTGTCTTAAC...AGGAAGCTCC:W6(V451_D-1)->C:W-1(V523_D-1) adding edge: GTGTCTTAAC...AGGAAGCTCC:W6(V451_D-1) to C:W-1(V523_D-1) removing edge Edge(522->523,w:10.0)(C:W-1(V522_D-1)->C:W-1(V523_D-1)) removing edge Edge(451->522,w:10.0)(GTGTCTTAAC...AGGAAGCTCC:W6(V451_D-1)->C:W-1(V522_D-1)) Found potential edge: Edge(451->523,w:10.0) between GTGTCTTAAC...AGGAAGCTCC:W6(V451_D-1) and C:W-1(V523_D-1) removing vertex C:W-1(V523_D-1) was concatenated into GTGTCTTAAC...GGAAGCTCCC:W6(V451_D-1) Want to move edge Edge(523->524,w:10.0)(C:W-1(V523_D-1)->T:W-1(V524_D-1)) to (GTGTCTTAAC...GGAAGCTCCC:W6(V451_D-1)->T:W-1(V524_D-1) adding edge: GTGTCTTAAC...GGAAGCTCCC:W6(V451_D-1) to T:W-1(V524_D-1) removing edge Edge(523->524,w:10.0)(C:W-1(V523_D-1)->T:W-1(V524_D-1)) removing edge Edge(451->523,w:10.0)(GTGTCTTAAC...GGAAGCTCCC:W6(V451_D-1)->C:W-1(V523_D-1)) Found potential edge: Edge(451->524,w:10.0) between GTGTCTTAAC...GGAAGCTCCC:W6(V451_D-1) and T:W-1(V524_D-1) removing vertex T:W-1(V524_D-1) was concatenated into GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) Want to move edge Edge(524->525,w:8.0)(T:W-1(V524_D-1)->G:W-1(V525_D-1)) to (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1)->G:W-1(V525_D-1) adding edge: GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) to G:W-1(V525_D-1) Want to move edge Edge(524->813,w:2.0)(T:W-1(V524_D-1)->C:W-1(V813_D-1)) to (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1)->C:W-1(V813_D-1) adding edge: GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) to C:W-1(V813_D-1) removing edge Edge(524->525,w:8.0)(T:W-1(V524_D-1)->G:W-1(V525_D-1)) removing edge Edge(524->813,w:2.0)(T:W-1(V524_D-1)->C:W-1(V813_D-1)) removing edge Edge(451->524,w:10.0)(GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1)->T:W-1(V524_D-1)) Found potential edge: Edge(525->526,w:6.0) between G:W-1(V525_D-1) and A:W-1(V526_D-1) removing vertex A:W-1(V526_D-1) was concatenated into GA:W6(V525_D-1) Want to move edge Edge(526->527,w:6.0)(A:W-1(V526_D-1)->G:W-1(V527_D-1)) to (GA:W6(V525_D-1)->G:W-1(V527_D-1) adding edge: GA:W6(V525_D-1) to G:W-1(V527_D-1) removing edge Edge(526->527,w:6.0)(A:W-1(V526_D-1)->G:W-1(V527_D-1)) removing edge Edge(525->526,w:6.0)(GA:W6(V525_D-1)->A:W-1(V526_D-1)) Found potential edge: Edge(525->527,w:6.0) between GA:W6(V525_D-1) and G:W-1(V527_D-1) removing vertex G:W-1(V527_D-1) was concatenated into GAG:W6(V525_D-1) Want to move edge Edge(527->528,w:6.0)(G:W-1(V527_D-1)->C:W-1(V528_D-1)) to (GAG:W6(V525_D-1)->C:W-1(V528_D-1) adding edge: GAG:W6(V525_D-1) to C:W-1(V528_D-1) removing edge Edge(527->528,w:6.0)(G:W-1(V527_D-1)->C:W-1(V528_D-1)) removing edge Edge(525->527,w:6.0)(GAG:W6(V525_D-1)->G:W-1(V527_D-1)) Found potential edge: Edge(525->528,w:6.0) between GAG:W6(V525_D-1) and C:W-1(V528_D-1) removing vertex C:W-1(V528_D-1) was concatenated into GAGC:W6(V525_D-1) Want to move edge Edge(528->529,w:6.0)(C:W-1(V528_D-1)->A:W-1(V529_D-1)) to (GAGC:W6(V525_D-1)->A:W-1(V529_D-1) adding edge: GAGC:W6(V525_D-1) to A:W-1(V529_D-1) removing edge Edge(528->529,w:6.0)(C:W-1(V528_D-1)->A:W-1(V529_D-1)) removing edge Edge(525->528,w:6.0)(GAGC:W6(V525_D-1)->C:W-1(V528_D-1)) Found potential edge: Edge(525->529,w:6.0) between GAGC:W6(V525_D-1) and A:W-1(V529_D-1) removing vertex A:W-1(V529_D-1) was concatenated into GAGCA:W6(V525_D-1) Want to move edge Edge(529->530,w:6.0)(A:W-1(V529_D-1)->C:W-1(V530_D-1)) to (GAGCA:W6(V525_D-1)->C:W-1(V530_D-1) adding edge: GAGCA:W6(V525_D-1) to C:W-1(V530_D-1) removing edge Edge(529->530,w:6.0)(A:W-1(V529_D-1)->C:W-1(V530_D-1)) removing edge Edge(525->529,w:6.0)(GAGCA:W6(V525_D-1)->A:W-1(V529_D-1)) Found potential edge: Edge(525->530,w:6.0) between GAGCA:W6(V525_D-1) and C:W-1(V530_D-1) removing vertex C:W-1(V530_D-1) was concatenated into GAGCAC:W6(V525_D-1) Want to move edge Edge(530->531,w:6.0)(C:W-1(V530_D-1)->T:W-1(V531_D-1)) to (GAGCAC:W6(V525_D-1)->T:W-1(V531_D-1) adding edge: GAGCAC:W6(V525_D-1) to T:W-1(V531_D-1) removing edge Edge(530->531,w:6.0)(C:W-1(V530_D-1)->T:W-1(V531_D-1)) removing edge Edge(525->530,w:6.0)(GAGCAC:W6(V525_D-1)->C:W-1(V530_D-1)) Found potential edge: Edge(525->531,w:6.0) between GAGCAC:W6(V525_D-1) and T:W-1(V531_D-1) removing vertex T:W-1(V531_D-1) was concatenated into GAGCACT:W6(V525_D-1) Want to move edge Edge(531->532,w:6.0)(T:W-1(V531_D-1)->C:W-1(V532_D-1)) to (GAGCACT:W6(V525_D-1)->C:W-1(V532_D-1) adding edge: GAGCACT:W6(V525_D-1) to C:W-1(V532_D-1) removing edge Edge(531->532,w:6.0)(T:W-1(V531_D-1)->C:W-1(V532_D-1)) removing edge Edge(525->531,w:6.0)(GAGCACT:W6(V525_D-1)->T:W-1(V531_D-1)) Found potential edge: Edge(525->532,w:6.0) between GAGCACT:W6(V525_D-1) and C:W-1(V532_D-1) removing vertex C:W-1(V532_D-1) was concatenated into GAGCACTC:W6(V525_D-1) Want to move edge Edge(532->533,w:6.0)(C:W-1(V532_D-1)->T:W-1(V533_D-1)) to (GAGCACTC:W6(V525_D-1)->T:W-1(V533_D-1) adding edge: GAGCACTC:W6(V525_D-1) to T:W-1(V533_D-1) removing edge Edge(532->533,w:6.0)(C:W-1(V532_D-1)->T:W-1(V533_D-1)) removing edge Edge(525->532,w:6.0)(GAGCACTC:W6(V525_D-1)->C:W-1(V532_D-1)) Found potential edge: Edge(525->533,w:6.0) between GAGCACTC:W6(V525_D-1) and T:W-1(V533_D-1) removing vertex T:W-1(V533_D-1) was concatenated into GAGCACTCT:W6(V525_D-1) Want to move edge Edge(533->534,w:6.0)(T:W-1(V533_D-1)->G:W-1(V534_D-1)) to (GAGCACTCT:W6(V525_D-1)->G:W-1(V534_D-1) adding edge: GAGCACTCT:W6(V525_D-1) to G:W-1(V534_D-1) removing edge Edge(533->534,w:6.0)(T:W-1(V533_D-1)->G:W-1(V534_D-1)) removing edge Edge(525->533,w:6.0)(GAGCACTCT:W6(V525_D-1)->T:W-1(V533_D-1)) Found potential edge: Edge(525->534,w:6.0) between GAGCACTCT:W6(V525_D-1) and G:W-1(V534_D-1) removing vertex G:W-1(V534_D-1) was concatenated into GAGCACTCTG:W6(V525_D-1) Want to move edge Edge(534->535,w:6.0)(G:W-1(V534_D-1)->A:W-1(V535_D-1)) to (GAGCACTCTG:W6(V525_D-1)->A:W-1(V535_D-1) adding edge: GAGCACTCTG:W6(V525_D-1) to A:W-1(V535_D-1) removing edge Edge(534->535,w:6.0)(G:W-1(V534_D-1)->A:W-1(V535_D-1)) removing edge Edge(525->534,w:6.0)(GAGCACTCTG:W6(V525_D-1)->G:W-1(V534_D-1)) Found potential edge: Edge(525->535,w:6.0) between GAGCACTCTG:W6(V525_D-1) and A:W-1(V535_D-1) removing vertex A:W-1(V535_D-1) was concatenated into GAGCACTCTGA:W6(V525_D-1) Want to move edge Edge(535->536,w:6.0)(A:W-1(V535_D-1)->A:W-1(V536_D-1)) to (GAGCACTCTGA:W6(V525_D-1)->A:W-1(V536_D-1) adding edge: GAGCACTCTGA:W6(V525_D-1) to A:W-1(V536_D-1) removing edge Edge(535->536,w:6.0)(A:W-1(V535_D-1)->A:W-1(V536_D-1)) removing edge Edge(525->535,w:6.0)(GAGCACTCTGA:W6(V525_D-1)->A:W-1(V535_D-1)) Found potential edge: Edge(525->536,w:6.0) between GAGCACTCTGA:W6(V525_D-1) and A:W-1(V536_D-1) removing vertex A:W-1(V536_D-1) was concatenated into GAGCACTCTGAA:W6(V525_D-1) Want to move edge Edge(536->537,w:6.0)(A:W-1(V536_D-1)->C:W-1(V537_D-1)) to (GAGCACTCTGAA:W6(V525_D-1)->C:W-1(V537_D-1) adding edge: GAGCACTCTGAA:W6(V525_D-1) to C:W-1(V537_D-1) removing edge Edge(536->537,w:6.0)(A:W-1(V536_D-1)->C:W-1(V537_D-1)) removing edge Edge(525->536,w:6.0)(GAGCACTCTGAA:W6(V525_D-1)->A:W-1(V536_D-1)) Found potential edge: Edge(525->537,w:6.0) between GAGCACTCTGAA:W6(V525_D-1) and C:W-1(V537_D-1) removing vertex C:W-1(V537_D-1) was concatenated into GAGCACTCTGAAC:W6(V525_D-1) Want to move edge Edge(537->538,w:4.0)(C:W-1(V537_D-1)->C:W-1(V538_D-1)) to (GAGCACTCTGAAC:W6(V525_D-1)->C:W-1(V538_D-1) adding edge: GAGCACTCTGAAC:W6(V525_D-1) to C:W-1(V538_D-1) removing edge Edge(537->538,w:4.0)(C:W-1(V537_D-1)->C:W-1(V538_D-1)) removing edge Edge(525->537,w:6.0)(GAGCACTCTGAAC:W6(V525_D-1)->C:W-1(V537_D-1)) Found potential edge: Edge(525->538,w:4.0) between GAGCACTCTGAAC:W6(V525_D-1) and C:W-1(V538_D-1) removing vertex C:W-1(V538_D-1) was concatenated into GAGCACTCTGAACC:W6(V525_D-1) Want to move edge Edge(538->539,w:6.0)(C:W-1(V538_D-1)->C:W-1(V539_D-1)) to (GAGCACTCTGAACC:W6(V525_D-1)->C:W-1(V539_D-1) adding edge: GAGCACTCTGAACC:W6(V525_D-1) to C:W-1(V539_D-1) removing edge Edge(538->539,w:6.0)(C:W-1(V538_D-1)->C:W-1(V539_D-1)) removing edge Edge(525->538,w:4.0)(GAGCACTCTGAACC:W6(V525_D-1)->C:W-1(V538_D-1)) Found potential edge: Edge(525->539,w:6.0) between GAGCACTCTGAACC:W6(V525_D-1) and C:W-1(V539_D-1) removing vertex C:W-1(V539_D-1) was concatenated into GAGCACTCTGAACCC:W6(V525_D-1) Want to move edge Edge(539->540,w:6.0)(C:W-1(V539_D-1)->T:W-1(V540_D-1)) to (GAGCACTCTGAACCC:W6(V525_D-1)->T:W-1(V540_D-1) adding edge: GAGCACTCTGAACCC:W6(V525_D-1) to T:W-1(V540_D-1) removing edge Edge(539->540,w:6.0)(C:W-1(V539_D-1)->T:W-1(V540_D-1)) removing edge Edge(525->539,w:6.0)(GAGCACTCTGAACCC:W6(V525_D-1)->C:W-1(V539_D-1)) Found potential edge: Edge(525->540,w:6.0) between GAGCACTCTGAACCC:W6(V525_D-1) and T:W-1(V540_D-1) removing vertex T:W-1(V540_D-1) was concatenated into GAGCACTCTGAACCCT:W6(V525_D-1) Want to move edge Edge(540->541,w:6.0)(T:W-1(V540_D-1)->G:W-1(V541_D-1)) to (GAGCACTCTGAACCCT:W6(V525_D-1)->G:W-1(V541_D-1) adding edge: GAGCACTCTGAACCCT:W6(V525_D-1) to G:W-1(V541_D-1) removing edge Edge(540->541,w:6.0)(T:W-1(V540_D-1)->G:W-1(V541_D-1)) removing edge Edge(525->540,w:6.0)(GAGCACTCTGAACCCT:W6(V525_D-1)->T:W-1(V540_D-1)) Found potential edge: Edge(525->541,w:6.0) between GAGCACTCTGAACCCT:W6(V525_D-1) and G:W-1(V541_D-1) removing vertex G:W-1(V541_D-1) was concatenated into GAGCACTCTGAACCCTG:W6(V525_D-1) Want to move edge Edge(541->542,w:6.0)(G:W-1(V541_D-1)->T:W-1(V542_D-1)) to (GAGCACTCTGAACCCTG:W6(V525_D-1)->T:W-1(V542_D-1) adding edge: GAGCACTCTGAACCCTG:W6(V525_D-1) to T:W-1(V542_D-1) removing edge Edge(541->542,w:6.0)(G:W-1(V541_D-1)->T:W-1(V542_D-1)) removing edge Edge(525->541,w:6.0)(GAGCACTCTGAACCCTG:W6(V525_D-1)->G:W-1(V541_D-1)) Found potential edge: Edge(525->542,w:6.0) between GAGCACTCTGAACCCTG:W6(V525_D-1) and T:W-1(V542_D-1) removing vertex T:W-1(V542_D-1) was concatenated into GAGCACTCTGAACCCTGT:W6(V525_D-1) Want to move edge Edge(542->543,w:6.0)(T:W-1(V542_D-1)->G:W-1(V543_D-1)) to (GAGCACTCTGAACCCTGT:W6(V525_D-1)->G:W-1(V543_D-1) adding edge: GAGCACTCTGAACCCTGT:W6(V525_D-1) to G:W-1(V543_D-1) removing edge Edge(542->543,w:6.0)(T:W-1(V542_D-1)->G:W-1(V543_D-1)) removing edge Edge(525->542,w:6.0)(GAGCACTCTGAACCCTGT:W6(V525_D-1)->T:W-1(V542_D-1)) Found potential edge: Edge(525->543,w:6.0) between GAGCACTCTGAACCCTGT:W6(V525_D-1) and G:W-1(V543_D-1) removing vertex G:W-1(V543_D-1) was concatenated into GAGCACTCTGAACCCTGTG:W6(V525_D-1) Want to move edge Edge(543->544,w:6.0)(G:W-1(V543_D-1)->A:W-1(V544_D-1)) to (GAGCACTCTGAACCCTGTG:W6(V525_D-1)->A:W-1(V544_D-1) adding edge: GAGCACTCTGAACCCTGTG:W6(V525_D-1) to A:W-1(V544_D-1) removing edge Edge(543->544,w:6.0)(G:W-1(V543_D-1)->A:W-1(V544_D-1)) removing edge Edge(525->543,w:6.0)(GAGCACTCTGAACCCTGTG:W6(V525_D-1)->G:W-1(V543_D-1)) Found potential edge: Edge(525->544,w:6.0) between GAGCACTCTGAACCCTGTG:W6(V525_D-1) and A:W-1(V544_D-1) removing vertex A:W-1(V544_D-1) was concatenated into GAGCACTCTGAACCCTGTGA:W6(V525_D-1) Want to move edge Edge(544->545,w:6.0)(A:W-1(V544_D-1)->G:W-1(V545_D-1)) to (GAGCACTCTGAACCCTGTGA:W6(V525_D-1)->G:W-1(V545_D-1) adding edge: GAGCACTCTGAACCCTGTGA:W6(V525_D-1) to G:W-1(V545_D-1) removing edge Edge(544->545,w:6.0)(A:W-1(V544_D-1)->G:W-1(V545_D-1)) removing edge Edge(525->544,w:6.0)(GAGCACTCTGAACCCTGTGA:W6(V525_D-1)->A:W-1(V544_D-1)) Found potential edge: Edge(525->545,w:6.0) between GAGCACTCTGAACCCTGTGA:W6(V525_D-1) and G:W-1(V545_D-1) removing vertex G:W-1(V545_D-1) was concatenated into GAGCACTCTGAACCCTGTGAG:W6(V525_D-1) Want to move edge Edge(545->546,w:6.0)(G:W-1(V545_D-1)->G:W-1(V546_D-1)) to (GAGCACTCTGAACCCTGTGAG:W6(V525_D-1)->G:W-1(V546_D-1) adding edge: GAGCACTCTGAACCCTGTGAG:W6(V525_D-1) to G:W-1(V546_D-1) removing edge Edge(545->546,w:6.0)(G:W-1(V545_D-1)->G:W-1(V546_D-1)) removing edge Edge(525->545,w:6.0)(GAGCACTCTGAACCCTGTGAG:W6(V525_D-1)->G:W-1(V545_D-1)) Found potential edge: Edge(525->546,w:6.0) between GAGCACTCTGAACCCTGTGAG:W6(V525_D-1) and G:W-1(V546_D-1) removing vertex G:W-1(V546_D-1) was concatenated into GAGCACTCTGAACCCTGTGAGG:W6(V525_D-1) Want to move edge Edge(546->547,w:6.0)(G:W-1(V546_D-1)->C:W-1(V547_D-1)) to (GAGCACTCTGAACCCTGTGAGG:W6(V525_D-1)->C:W-1(V547_D-1) adding edge: GAGCACTCTGAACCCTGTGAGG:W6(V525_D-1) to C:W-1(V547_D-1) removing edge Edge(546->547,w:6.0)(G:W-1(V546_D-1)->C:W-1(V547_D-1)) removing edge Edge(525->546,w:6.0)(GAGCACTCTGAACCCTGTGAGG:W6(V525_D-1)->G:W-1(V546_D-1)) Found potential edge: Edge(525->547,w:6.0) between GAGCACTCTGAACCCTGTGAGG:W6(V525_D-1) and C:W-1(V547_D-1) removing vertex C:W-1(V547_D-1) was concatenated into GAGCACTCTGAACCCTGTGAGGC:W6(V525_D-1) Want to move edge Edge(547->548,w:6.0)(C:W-1(V547_D-1)->A:W-1(V548_D-1)) to (GAGCACTCTGAACCCTGTGAGGC:W6(V525_D-1)->A:W-1(V548_D-1) adding edge: GAGCACTCTGAACCCTGTGAGGC:W6(V525_D-1) to A:W-1(V548_D-1) removing edge Edge(547->548,w:6.0)(C:W-1(V547_D-1)->A:W-1(V548_D-1)) removing edge Edge(525->547,w:6.0)(GAGCACTCTGAACCCTGTGAGGC:W6(V525_D-1)->C:W-1(V547_D-1)) Found potential edge: Edge(525->548,w:6.0) between GAGCACTCTGAACCCTGTGAGGC:W6(V525_D-1) and A:W-1(V548_D-1) removing vertex A:W-1(V548_D-1) was concatenated into GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1) Want to move edge Edge(548->549,w:6.0)(A:W-1(V548_D-1)->A:W-1(V549_D-1)) to (GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1)->A:W-1(V549_D-1) adding edge: GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1) to A:W-1(V549_D-1) removing edge Edge(548->549,w:6.0)(A:W-1(V548_D-1)->A:W-1(V549_D-1)) removing edge Edge(525->548,w:6.0)(GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1)->A:W-1(V548_D-1)) Found potential edge: Edge(549->550,w:8.0) between A:W-1(V549_D-1) and G:W-1(V550_D-1) removing vertex G:W-1(V550_D-1) was concatenated into AG:W8(V549_D-1) Want to move edge Edge(550->551,w:8.0)(G:W-1(V550_D-1)->T:W-1(V551_D-1)) to (AG:W8(V549_D-1)->T:W-1(V551_D-1) adding edge: AG:W8(V549_D-1) to T:W-1(V551_D-1) removing edge Edge(550->551,w:8.0)(G:W-1(V550_D-1)->T:W-1(V551_D-1)) removing edge Edge(549->550,w:8.0)(AG:W8(V549_D-1)->G:W-1(V550_D-1)) Found potential edge: Edge(549->551,w:8.0) between AG:W8(V549_D-1) and T:W-1(V551_D-1) removing vertex T:W-1(V551_D-1) was concatenated into AGT:W8(V549_D-1) Want to move edge Edge(551->552,w:8.0)(T:W-1(V551_D-1)->C:W-1(V552_D-1)) to (AGT:W8(V549_D-1)->C:W-1(V552_D-1) adding edge: AGT:W8(V549_D-1) to C:W-1(V552_D-1) removing edge Edge(551->552,w:8.0)(T:W-1(V551_D-1)->C:W-1(V552_D-1)) removing edge Edge(549->551,w:8.0)(AGT:W8(V549_D-1)->T:W-1(V551_D-1)) Found potential edge: Edge(549->552,w:8.0) between AGT:W8(V549_D-1) and C:W-1(V552_D-1) removing vertex C:W-1(V552_D-1) was concatenated into AGTC:W8(V549_D-1) Want to move edge Edge(552->553,w:8.0)(C:W-1(V552_D-1)->C:W-1(V553_D-1)) to (AGTC:W8(V549_D-1)->C:W-1(V553_D-1) adding edge: AGTC:W8(V549_D-1) to C:W-1(V553_D-1) removing edge Edge(552->553,w:8.0)(C:W-1(V552_D-1)->C:W-1(V553_D-1)) removing edge Edge(549->552,w:8.0)(AGTC:W8(V549_D-1)->C:W-1(V552_D-1)) Found potential edge: Edge(549->553,w:8.0) between AGTC:W8(V549_D-1) and C:W-1(V553_D-1) removing vertex C:W-1(V553_D-1) was concatenated into AGTCC:W8(V549_D-1) Want to move edge Edge(553->554,w:8.0)(C:W-1(V553_D-1)->A:W-1(V554_D-1)) to (AGTCC:W8(V549_D-1)->A:W-1(V554_D-1) adding edge: AGTCC:W8(V549_D-1) to A:W-1(V554_D-1) removing edge Edge(553->554,w:8.0)(C:W-1(V553_D-1)->A:W-1(V554_D-1)) removing edge Edge(549->553,w:8.0)(AGTCC:W8(V549_D-1)->C:W-1(V553_D-1)) Found potential edge: Edge(549->554,w:8.0) between AGTCC:W8(V549_D-1) and A:W-1(V554_D-1) removing vertex A:W-1(V554_D-1) was concatenated into AGTCCA:W8(V549_D-1) Want to move edge Edge(554->555,w:6.0)(A:W-1(V554_D-1)->C:W-1(V555_D-1)) to (AGTCCA:W8(V549_D-1)->C:W-1(V555_D-1) adding edge: AGTCCA:W8(V549_D-1) to C:W-1(V555_D-1) removing edge Edge(554->555,w:6.0)(A:W-1(V554_D-1)->C:W-1(V555_D-1)) removing edge Edge(549->554,w:8.0)(AGTCCA:W8(V549_D-1)->A:W-1(V554_D-1)) Found potential edge: Edge(549->555,w:6.0) between AGTCCA:W8(V549_D-1) and C:W-1(V555_D-1) removing vertex C:W-1(V555_D-1) was concatenated into AGTCCAC:W8(V549_D-1) Want to move edge Edge(555->556,w:6.0)(C:W-1(V555_D-1)->C:W-1(V556_D-1)) to (AGTCCAC:W8(V549_D-1)->C:W-1(V556_D-1) adding edge: AGTCCAC:W8(V549_D-1) to C:W-1(V556_D-1) removing edge Edge(555->556,w:6.0)(C:W-1(V555_D-1)->C:W-1(V556_D-1)) removing edge Edge(549->555,w:6.0)(AGTCCAC:W8(V549_D-1)->C:W-1(V555_D-1)) Found potential edge: Edge(549->556,w:6.0) between AGTCCAC:W8(V549_D-1) and C:W-1(V556_D-1) removing vertex C:W-1(V556_D-1) was concatenated into AGTCCACC:W7(V549_D-1) Want to move edge Edge(556->557,w:4.0)(C:W-1(V556_D-1)->A:W-1(V557_D-1)) to (AGTCCACC:W7(V549_D-1)->A:W-1(V557_D-1) adding edge: AGTCCACC:W7(V549_D-1) to A:W-1(V557_D-1) removing edge Edge(556->557,w:4.0)(C:W-1(V556_D-1)->A:W-1(V557_D-1)) removing edge Edge(549->556,w:6.0)(AGTCCACC:W7(V549_D-1)->C:W-1(V556_D-1)) Found potential edge: Edge(549->557,w:4.0) between AGTCCACC:W7(V549_D-1) and A:W-1(V557_D-1) removing vertex A:W-1(V557_D-1) was concatenated into AGTCCACCA:W7(V549_D-1) Want to move edge Edge(557->558,w:4.0)(A:W-1(V557_D-1)->C:W-1(V558_D-1)) to (AGTCCACCA:W7(V549_D-1)->C:W-1(V558_D-1) adding edge: AGTCCACCA:W7(V549_D-1) to C:W-1(V558_D-1) removing edge Edge(557->558,w:4.0)(A:W-1(V557_D-1)->C:W-1(V558_D-1)) removing edge Edge(549->557,w:4.0)(AGTCCACCA:W7(V549_D-1)->A:W-1(V557_D-1)) Found potential edge: Edge(549->558,w:4.0) between AGTCCACCA:W7(V549_D-1) and C:W-1(V558_D-1) removing vertex C:W-1(V558_D-1) was concatenated into AGTCCACCAC:W7(V549_D-1) Want to move edge Edge(558->559,w:4.0)(C:W-1(V558_D-1)->C:W-1(V559_D-1)) to (AGTCCACCAC:W7(V549_D-1)->C:W-1(V559_D-1) adding edge: AGTCCACCAC:W7(V549_D-1) to C:W-1(V559_D-1) removing edge Edge(558->559,w:4.0)(C:W-1(V558_D-1)->C:W-1(V559_D-1)) removing edge Edge(549->558,w:4.0)(AGTCCACCAC:W7(V549_D-1)->C:W-1(V558_D-1)) Found potential edge: Edge(549->559,w:4.0) between AGTCCACCAC:W7(V549_D-1) and C:W-1(V559_D-1) removing vertex C:W-1(V559_D-1) was concatenated into AGTCCACCACC:W6(V549_D-1) Want to move edge Edge(559->560,w:2.0)(C:W-1(V559_D-1)->A:W-1(V560_D-1)) to (AGTCCACCACC:W6(V549_D-1)->A:W-1(V560_D-1) adding edge: AGTCCACCACC:W6(V549_D-1) to A:W-1(V560_D-1) removing edge Edge(559->560,w:2.0)(C:W-1(V559_D-1)->A:W-1(V560_D-1)) removing edge Edge(549->559,w:4.0)(AGTCCACCACC:W6(V549_D-1)->C:W-1(V559_D-1)) Found potential edge: Edge(549->560,w:2.0) between AGTCCACCACC:W6(V549_D-1) and A:W-1(V560_D-1) removing vertex A:W-1(V560_D-1) was concatenated into AGTCCACCACCA:W6(V549_D-1) Want to move edge Edge(560->561,w:2.0)(A:W-1(V560_D-1)->G:W-1(V561_D-1)) to (AGTCCACCACCA:W6(V549_D-1)->G:W-1(V561_D-1) adding edge: AGTCCACCACCA:W6(V549_D-1) to G:W-1(V561_D-1) removing edge Edge(560->561,w:2.0)(A:W-1(V560_D-1)->G:W-1(V561_D-1)) removing edge Edge(549->560,w:2.0)(AGTCCACCACCA:W6(V549_D-1)->A:W-1(V560_D-1)) Found potential edge: Edge(549->561,w:2.0) between AGTCCACCACCA:W6(V549_D-1) and G:W-1(V561_D-1) removing vertex G:W-1(V561_D-1) was concatenated into AGTCCACCACCAG:W6(V549_D-1) Want to move edge Edge(561->562,w:2.0)(G:W-1(V561_D-1)->C:W-1(V562_D-1)) to (AGTCCACCACCAG:W6(V549_D-1)->C:W-1(V562_D-1) adding edge: AGTCCACCACCAG:W6(V549_D-1) to C:W-1(V562_D-1) removing edge Edge(561->562,w:2.0)(G:W-1(V561_D-1)->C:W-1(V562_D-1)) removing edge Edge(549->561,w:2.0)(AGTCCACCACCAG:W6(V549_D-1)->G:W-1(V561_D-1)) Found potential edge: Edge(549->562,w:2.0) between AGTCCACCACCAG:W6(V549_D-1) and C:W-1(V562_D-1) removing vertex C:W-1(V562_D-1) was concatenated into AGTCCACCACCAGC:W5(V549_D-1) Want to move edge Edge(562->563,w:2.0)(C:W-1(V562_D-1)->G:W-1(V563_D-1)) to (AGTCCACCACCAGC:W5(V549_D-1)->G:W-1(V563_D-1) adding edge: AGTCCACCACCAGC:W5(V549_D-1) to G:W-1(V563_D-1) removing edge Edge(562->563,w:2.0)(C:W-1(V562_D-1)->G:W-1(V563_D-1)) removing edge Edge(549->562,w:2.0)(AGTCCACCACCAGC:W5(V549_D-1)->C:W-1(V562_D-1)) Found potential edge: Edge(549->563,w:2.0) between AGTCCACCACCAGC:W5(V549_D-1) and G:W-1(V563_D-1) removing vertex G:W-1(V563_D-1) was concatenated into AGTCCACCACCAGCG:W5(V549_D-1) Want to move edge Edge(563->564,w:2.0)(G:W-1(V563_D-1)->T:W-1(V564_D-1)) to (AGTCCACCACCAGCG:W5(V549_D-1)->T:W-1(V564_D-1) adding edge: AGTCCACCACCAGCG:W5(V549_D-1) to T:W-1(V564_D-1) removing edge Edge(563->564,w:2.0)(G:W-1(V563_D-1)->T:W-1(V564_D-1)) removing edge Edge(549->563,w:2.0)(AGTCCACCACCAGCG:W5(V549_D-1)->G:W-1(V563_D-1)) Found potential edge: Edge(549->564,w:2.0) between AGTCCACCACCAGCG:W5(V549_D-1) and T:W-1(V564_D-1) removing vertex T:W-1(V564_D-1) was concatenated into AGTCCACCACCAGCGT:W5(V549_D-1) Want to move edge Edge(564->565,w:2.0)(T:W-1(V564_D-1)->A:W-1(V565_D-1)) to (AGTCCACCACCAGCGT:W5(V549_D-1)->A:W-1(V565_D-1) adding edge: AGTCCACCACCAGCGT:W5(V549_D-1) to A:W-1(V565_D-1) removing edge Edge(564->565,w:2.0)(T:W-1(V564_D-1)->A:W-1(V565_D-1)) removing edge Edge(549->564,w:2.0)(AGTCCACCACCAGCGT:W5(V549_D-1)->T:W-1(V564_D-1)) Found potential edge: Edge(549->565,w:2.0) between AGTCCACCACCAGCGT:W5(V549_D-1) and A:W-1(V565_D-1) removing vertex A:W-1(V565_D-1) was concatenated into AGTCCACCACCAGCGTA:W5(V549_D-1) Want to move edge Edge(565->566,w:2.0)(A:W-1(V565_D-1)->T:W-1(V566_D-1)) to (AGTCCACCACCAGCGTA:W5(V549_D-1)->T:W-1(V566_D-1) adding edge: AGTCCACCACCAGCGTA:W5(V549_D-1) to T:W-1(V566_D-1) removing edge Edge(565->566,w:2.0)(A:W-1(V565_D-1)->T:W-1(V566_D-1)) removing edge Edge(549->565,w:2.0)(AGTCCACCACCAGCGTA:W5(V549_D-1)->A:W-1(V565_D-1)) Found potential edge: Edge(549->566,w:2.0) between AGTCCACCACCAGCGTA:W5(V549_D-1) and T:W-1(V566_D-1) removing vertex T:W-1(V566_D-1) was concatenated into AGTCCACCACCAGCGTAT:W5(V549_D-1) Want to move edge Edge(566->567,w:2.0)(T:W-1(V566_D-1)->C:W-1(V567_D-1)) to (AGTCCACCACCAGCGTAT:W5(V549_D-1)->C:W-1(V567_D-1) adding edge: AGTCCACCACCAGCGTAT:W5(V549_D-1) to C:W-1(V567_D-1) removing edge Edge(566->567,w:2.0)(T:W-1(V566_D-1)->C:W-1(V567_D-1)) removing edge Edge(549->566,w:2.0)(AGTCCACCACCAGCGTAT:W5(V549_D-1)->T:W-1(V566_D-1)) Found potential edge: Edge(549->567,w:2.0) between AGTCCACCACCAGCGTAT:W5(V549_D-1) and C:W-1(V567_D-1) removing vertex C:W-1(V567_D-1) was concatenated into AGTCCACCACCAGCGTATC:W4(V549_D-1) Want to move edge Edge(567->568,w:4.0)(C:W-1(V567_D-1)->T:W-1(V568_D-1)) to (AGTCCACCACCAGCGTATC:W4(V549_D-1)->T:W-1(V568_D-1) adding edge: AGTCCACCACCAGCGTATC:W4(V549_D-1) to T:W-1(V568_D-1) removing edge Edge(567->568,w:4.0)(C:W-1(V567_D-1)->T:W-1(V568_D-1)) removing edge Edge(549->567,w:2.0)(AGTCCACCACCAGCGTATC:W4(V549_D-1)->C:W-1(V567_D-1)) Found potential edge: Edge(549->568,w:4.0) between AGTCCACCACCAGCGTATC:W4(V549_D-1) and T:W-1(V568_D-1) removing vertex T:W-1(V568_D-1) was concatenated into AGTCCACCACCAGCGTATCT:W4(V549_D-1) Want to move edge Edge(568->569,w:4.0)(T:W-1(V568_D-1)->A:W-1(V569_D-1)) to (AGTCCACCACCAGCGTATCT:W4(V549_D-1)->A:W-1(V569_D-1) adding edge: AGTCCACCACCAGCGTATCT:W4(V549_D-1) to A:W-1(V569_D-1) removing edge Edge(568->569,w:4.0)(T:W-1(V568_D-1)->A:W-1(V569_D-1)) removing edge Edge(549->568,w:4.0)(AGTCCACCACCAGCGTATCT:W4(V549_D-1)->T:W-1(V568_D-1)) Found potential edge: Edge(549->569,w:4.0) between AGTCCACCACCAGCGTATCT:W4(V549_D-1) and A:W-1(V569_D-1) removing vertex A:W-1(V569_D-1) was concatenated into AGTCCACCACCAGCGTATCTA:W4(V549_D-1) Want to move edge Edge(569->570,w:4.0)(A:W-1(V569_D-1)->G:W-1(V570_D-1)) to (AGTCCACCACCAGCGTATCTA:W4(V549_D-1)->G:W-1(V570_D-1) adding edge: AGTCCACCACCAGCGTATCTA:W4(V549_D-1) to G:W-1(V570_D-1) removing edge Edge(569->570,w:4.0)(A:W-1(V569_D-1)->G:W-1(V570_D-1)) removing edge Edge(549->569,w:4.0)(AGTCCACCACCAGCGTATCTA:W4(V549_D-1)->A:W-1(V569_D-1)) Found potential edge: Edge(549->570,w:4.0) between AGTCCACCACCAGCGTATCTA:W4(V549_D-1) and G:W-1(V570_D-1) removing vertex G:W-1(V570_D-1) was concatenated into AGTCCACCACCAGCGTATCTAG:W4(V549_D-1) Want to move edge Edge(570->571,w:4.0)(G:W-1(V570_D-1)->A:W-1(V571_D-1)) to (AGTCCACCACCAGCGTATCTAG:W4(V549_D-1)->A:W-1(V571_D-1) adding edge: AGTCCACCACCAGCGTATCTAG:W4(V549_D-1) to A:W-1(V571_D-1) removing edge Edge(570->571,w:4.0)(G:W-1(V570_D-1)->A:W-1(V571_D-1)) removing edge Edge(549->570,w:4.0)(AGTCCACCACCAGCGTATCTAG:W4(V549_D-1)->G:W-1(V570_D-1)) Found potential edge: Edge(549->571,w:4.0) between AGTCCACCACCAGCGTATCTAG:W4(V549_D-1) and A:W-1(V571_D-1) removing vertex A:W-1(V571_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGA:W4(V549_D-1) Want to move edge Edge(571->572,w:4.0)(A:W-1(V571_D-1)->C:W-1(V572_D-1)) to (AGTCCACCACCAGCGTATCTAGA:W4(V549_D-1)->C:W-1(V572_D-1) adding edge: AGTCCACCACCAGCGTATCTAGA:W4(V549_D-1) to C:W-1(V572_D-1) removing edge Edge(571->572,w:4.0)(A:W-1(V571_D-1)->C:W-1(V572_D-1)) removing edge Edge(549->571,w:4.0)(AGTCCACCACCAGCGTATCTAGA:W4(V549_D-1)->A:W-1(V571_D-1)) Found potential edge: Edge(549->572,w:4.0) between AGTCCACCACCAGCGTATCTAGA:W4(V549_D-1) and C:W-1(V572_D-1) removing vertex C:W-1(V572_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGAC:W4(V549_D-1) Want to move edge Edge(572->573,w:4.0)(C:W-1(V572_D-1)->C:W-1(V573_D-1)) to (AGTCCACCACCAGCGTATCTAGAC:W4(V549_D-1)->C:W-1(V573_D-1) adding edge: AGTCCACCACCAGCGTATCTAGAC:W4(V549_D-1) to C:W-1(V573_D-1) removing edge Edge(572->573,w:4.0)(C:W-1(V572_D-1)->C:W-1(V573_D-1)) removing edge Edge(549->572,w:4.0)(AGTCCACCACCAGCGTATCTAGAC:W4(V549_D-1)->C:W-1(V572_D-1)) Found potential edge: Edge(549->573,w:4.0) between AGTCCACCACCAGCGTATCTAGAC:W4(V549_D-1) and C:W-1(V573_D-1) removing vertex C:W-1(V573_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGACC:W4(V549_D-1) Want to move edge Edge(573->574,w:4.0)(C:W-1(V573_D-1)->C:W-1(V574_D-1)) to (AGTCCACCACCAGCGTATCTAGACC:W4(V549_D-1)->C:W-1(V574_D-1) adding edge: AGTCCACCACCAGCGTATCTAGACC:W4(V549_D-1) to C:W-1(V574_D-1) removing edge Edge(573->574,w:4.0)(C:W-1(V573_D-1)->C:W-1(V574_D-1)) removing edge Edge(549->573,w:4.0)(AGTCCACCACCAGCGTATCTAGACC:W4(V549_D-1)->C:W-1(V573_D-1)) Found potential edge: Edge(549->574,w:4.0) between AGTCCACCACCAGCGTATCTAGACC:W4(V549_D-1) and C:W-1(V574_D-1) removing vertex C:W-1(V574_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGACCC:W4(V549_D-1) Want to move edge Edge(574->575,w:4.0)(C:W-1(V574_D-1)->A:W-1(V575_D-1)) to (AGTCCACCACCAGCGTATCTAGACCC:W4(V549_D-1)->A:W-1(V575_D-1) adding edge: AGTCCACCACCAGCGTATCTAGACCC:W4(V549_D-1) to A:W-1(V575_D-1) removing edge Edge(574->575,w:4.0)(C:W-1(V574_D-1)->A:W-1(V575_D-1)) removing edge Edge(549->574,w:4.0)(AGTCCACCACCAGCGTATCTAGACCC:W4(V549_D-1)->C:W-1(V574_D-1)) Found potential edge: Edge(549->575,w:4.0) between AGTCCACCACCAGCGTATCTAGACCC:W4(V549_D-1) and A:W-1(V575_D-1) removing vertex A:W-1(V575_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGACCCA:W4(V549_D-1) Want to move edge Edge(575->576,w:4.0)(A:W-1(V575_D-1)->G:W-1(V576_D-1)) to (AGTCCACCACCAGCGTATCTAGACCCA:W4(V549_D-1)->G:W-1(V576_D-1) adding edge: AGTCCACCACCAGCGTATCTAGACCCA:W4(V549_D-1) to G:W-1(V576_D-1) removing edge Edge(575->576,w:4.0)(A:W-1(V575_D-1)->G:W-1(V576_D-1)) removing edge Edge(549->575,w:4.0)(AGTCCACCACCAGCGTATCTAGACCCA:W4(V549_D-1)->A:W-1(V575_D-1)) Found potential edge: Edge(549->576,w:4.0) between AGTCCACCACCAGCGTATCTAGACCCA:W4(V549_D-1) and G:W-1(V576_D-1) removing vertex G:W-1(V576_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGACCCAG:W4(V549_D-1) Want to move edge Edge(576->577,w:4.0)(G:W-1(V576_D-1)->G:W-1(V577_D-1)) to (AGTCCACCACCAGCGTATCTAGACCCAG:W4(V549_D-1)->G:W-1(V577_D-1) adding edge: AGTCCACCACCAGCGTATCTAGACCCAG:W4(V549_D-1) to G:W-1(V577_D-1) removing edge Edge(576->577,w:4.0)(G:W-1(V576_D-1)->G:W-1(V577_D-1)) removing edge Edge(549->576,w:4.0)(AGTCCACCACCAGCGTATCTAGACCCAG:W4(V549_D-1)->G:W-1(V576_D-1)) Found potential edge: Edge(549->577,w:4.0) between AGTCCACCACCAGCGTATCTAGACCCAG:W4(V549_D-1) and G:W-1(V577_D-1) removing vertex G:W-1(V577_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGACCCAGG:W4(V549_D-1) Want to move edge Edge(577->578,w:4.0)(G:W-1(V577_D-1)->C:W-1(V578_D-1)) to (AGTCCACCACCAGCGTATCTAGACCCAGG:W4(V549_D-1)->C:W-1(V578_D-1) adding edge: AGTCCACCACCAGCGTATCTAGACCCAGG:W4(V549_D-1) to C:W-1(V578_D-1) removing edge Edge(577->578,w:4.0)(G:W-1(V577_D-1)->C:W-1(V578_D-1)) removing edge Edge(549->577,w:4.0)(AGTCCACCACCAGCGTATCTAGACCCAGG:W4(V549_D-1)->G:W-1(V577_D-1)) Found potential edge: Edge(549->578,w:4.0) between AGTCCACCACCAGCGTATCTAGACCCAGG:W4(V549_D-1) and C:W-1(V578_D-1) removing vertex C:W-1(V578_D-1) was concatenated into AGTCCACCACCAGCGTATCTAGACCCAGGC:W4(V549_D-1) Want to move edge Edge(578->579,w:4.0)(C:W-1(V578_D-1)->C:W-1(V579_D-1)) to (AGTCCACCACCAGCGTATCTAGACCCAGGC:W4(V549_D-1)->C:W-1(V579_D-1) adding edge: AGTCCACCACCAGCGTATCTAGACCCAGGC:W4(V549_D-1) to C:W-1(V579_D-1) removing edge Edge(578->579,w:4.0)(C:W-1(V578_D-1)->C:W-1(V579_D-1)) removing edge Edge(549->578,w:4.0)(AGTCCACCACCAGCGTATCTAGACCCAGGC:W4(V549_D-1)->C:W-1(V578_D-1)) Found potential edge: Edge(549->579,w:4.0) between AGTCCACCACCAGCGTATCTAGACCCAGGC:W4(V549_D-1) and C:W-1(V579_D-1) removing vertex C:W-1(V579_D-1) was concatenated into AGTCCACCAC...GACCCAGGCC:W4(V549_D-1) Want to move edge Edge(579->580,w:4.0)(C:W-1(V579_D-1)->A:W-1(V580_D-1)) to (AGTCCACCAC...GACCCAGGCC:W4(V549_D-1)->A:W-1(V580_D-1) adding edge: AGTCCACCAC...GACCCAGGCC:W4(V549_D-1) to A:W-1(V580_D-1) removing edge Edge(579->580,w:4.0)(C:W-1(V579_D-1)->A:W-1(V580_D-1)) removing edge Edge(549->579,w:4.0)(AGTCCACCAC...GACCCAGGCC:W4(V549_D-1)->C:W-1(V579_D-1)) Found potential edge: Edge(549->580,w:4.0) between AGTCCACCAC...GACCCAGGCC:W4(V549_D-1) and A:W-1(V580_D-1) removing vertex A:W-1(V580_D-1) was concatenated into AGTCCACCAC...ACCCAGGCCA:W4(V549_D-1) Want to move edge Edge(580->581,w:4.0)(A:W-1(V580_D-1)->T:W-1(V581_D-1)) to (AGTCCACCAC...ACCCAGGCCA:W4(V549_D-1)->T:W-1(V581_D-1) adding edge: AGTCCACCAC...ACCCAGGCCA:W4(V549_D-1) to T:W-1(V581_D-1) removing edge Edge(580->581,w:4.0)(A:W-1(V580_D-1)->T:W-1(V581_D-1)) removing edge Edge(549->580,w:4.0)(AGTCCACCAC...ACCCAGGCCA:W4(V549_D-1)->A:W-1(V580_D-1)) Found potential edge: Edge(549->581,w:4.0) between AGTCCACCAC...ACCCAGGCCA:W4(V549_D-1) and T:W-1(V581_D-1) removing vertex T:W-1(V581_D-1) was concatenated into AGTCCACCAC...CCCAGGCCAT:W4(V549_D-1) Want to move edge Edge(581->582,w:4.0)(T:W-1(V581_D-1)->C:W-1(V582_D-1)) to (AGTCCACCAC...CCCAGGCCAT:W4(V549_D-1)->C:W-1(V582_D-1) adding edge: AGTCCACCAC...CCCAGGCCAT:W4(V549_D-1) to C:W-1(V582_D-1) removing edge Edge(581->582,w:4.0)(T:W-1(V581_D-1)->C:W-1(V582_D-1)) removing edge Edge(549->581,w:4.0)(AGTCCACCAC...CCCAGGCCAT:W4(V549_D-1)->T:W-1(V581_D-1)) Found potential edge: Edge(549->582,w:4.0) between AGTCCACCAC...CCCAGGCCAT:W4(V549_D-1) and C:W-1(V582_D-1) removing vertex C:W-1(V582_D-1) was concatenated into AGTCCACCAC...CCAGGCCATC:W4(V549_D-1) Want to move edge Edge(582->583,w:4.0)(C:W-1(V582_D-1)->T:W-1(V583_D-1)) to (AGTCCACCAC...CCAGGCCATC:W4(V549_D-1)->T:W-1(V583_D-1) adding edge: AGTCCACCAC...CCAGGCCATC:W4(V549_D-1) to T:W-1(V583_D-1) removing edge Edge(582->583,w:4.0)(C:W-1(V582_D-1)->T:W-1(V583_D-1)) removing edge Edge(549->582,w:4.0)(AGTCCACCAC...CCAGGCCATC:W4(V549_D-1)->C:W-1(V582_D-1)) Found potential edge: Edge(549->583,w:4.0) between AGTCCACCAC...CCAGGCCATC:W4(V549_D-1) and T:W-1(V583_D-1) removing vertex T:W-1(V583_D-1) was concatenated into AGTCCACCAC...CAGGCCATCT:W4(V549_D-1) Want to move edge Edge(583->584,w:4.0)(T:W-1(V583_D-1)->A:W-1(V584_D-1)) to (AGTCCACCAC...CAGGCCATCT:W4(V549_D-1)->A:W-1(V584_D-1) adding edge: AGTCCACCAC...CAGGCCATCT:W4(V549_D-1) to A:W-1(V584_D-1) removing edge Edge(583->584,w:4.0)(T:W-1(V583_D-1)->A:W-1(V584_D-1)) removing edge Edge(549->583,w:4.0)(AGTCCACCAC...CAGGCCATCT:W4(V549_D-1)->T:W-1(V583_D-1)) Found potential edge: Edge(549->584,w:4.0) between AGTCCACCAC...CAGGCCATCT:W4(V549_D-1) and A:W-1(V584_D-1) removing vertex A:W-1(V584_D-1) was concatenated into AGTCCACCAC...AGGCCATCTA:W4(V549_D-1) Want to move edge Edge(584->585,w:4.0)(A:W-1(V584_D-1)->A:W-1(V585_D-1)) to (AGTCCACCAC...AGGCCATCTA:W4(V549_D-1)->A:W-1(V585_D-1) adding edge: AGTCCACCAC...AGGCCATCTA:W4(V549_D-1) to A:W-1(V585_D-1) removing edge Edge(584->585,w:4.0)(A:W-1(V584_D-1)->A:W-1(V585_D-1)) removing edge Edge(549->584,w:4.0)(AGTCCACCAC...AGGCCATCTA:W4(V549_D-1)->A:W-1(V584_D-1)) Found potential edge: Edge(549->585,w:4.0) between AGTCCACCAC...AGGCCATCTA:W4(V549_D-1) and A:W-1(V585_D-1) removing vertex A:W-1(V585_D-1) was concatenated into AGTCCACCAC...GGCCATCTAA:W4(V549_D-1) Want to move edge Edge(585->586,w:4.0)(A:W-1(V585_D-1)->T:W-1(V586_D-1)) to (AGTCCACCAC...GGCCATCTAA:W4(V549_D-1)->T:W-1(V586_D-1) adding edge: AGTCCACCAC...GGCCATCTAA:W4(V549_D-1) to T:W-1(V586_D-1) removing edge Edge(585->586,w:4.0)(A:W-1(V585_D-1)->T:W-1(V586_D-1)) removing edge Edge(549->585,w:4.0)(AGTCCACCAC...GGCCATCTAA:W4(V549_D-1)->A:W-1(V585_D-1)) Found potential edge: Edge(549->586,w:4.0) between AGTCCACCAC...GGCCATCTAA:W4(V549_D-1) and T:W-1(V586_D-1) removing vertex T:W-1(V586_D-1) was concatenated into AGTCCACCAC...GCCATCTAAT:W4(V549_D-1) Want to move edge Edge(586->587,w:4.0)(T:W-1(V586_D-1)->A:W-1(V587_D-1)) to (AGTCCACCAC...GCCATCTAAT:W4(V549_D-1)->A:W-1(V587_D-1) adding edge: AGTCCACCAC...GCCATCTAAT:W4(V549_D-1) to A:W-1(V587_D-1) removing edge Edge(586->587,w:4.0)(T:W-1(V586_D-1)->A:W-1(V587_D-1)) removing edge Edge(549->586,w:4.0)(AGTCCACCAC...GCCATCTAAT:W4(V549_D-1)->T:W-1(V586_D-1)) Found potential edge: Edge(549->587,w:4.0) between AGTCCACCAC...GCCATCTAAT:W4(V549_D-1) and A:W-1(V587_D-1) removing vertex A:W-1(V587_D-1) was concatenated into AGTCCACCAC...CCATCTAATA:W4(V549_D-1) Want to move edge Edge(587->588,w:4.0)(A:W-1(V587_D-1)->A:W-1(V588_D-1)) to (AGTCCACCAC...CCATCTAATA:W4(V549_D-1)->A:W-1(V588_D-1) adding edge: AGTCCACCAC...CCATCTAATA:W4(V549_D-1) to A:W-1(V588_D-1) removing edge Edge(587->588,w:4.0)(A:W-1(V587_D-1)->A:W-1(V588_D-1)) removing edge Edge(549->587,w:4.0)(AGTCCACCAC...CCATCTAATA:W4(V549_D-1)->A:W-1(V587_D-1)) Found potential edge: Edge(549->588,w:4.0) between AGTCCACCAC...CCATCTAATA:W4(V549_D-1) and A:W-1(V588_D-1) removing vertex A:W-1(V588_D-1) was concatenated into AGTCCACCAC...CATCTAATAA:W4(V549_D-1) Want to move edge Edge(588->589,w:4.0)(A:W-1(V588_D-1)->A:W-1(V589_D-1)) to (AGTCCACCAC...CATCTAATAA:W4(V549_D-1)->A:W-1(V589_D-1) adding edge: AGTCCACCAC...CATCTAATAA:W4(V549_D-1) to A:W-1(V589_D-1) removing edge Edge(588->589,w:4.0)(A:W-1(V588_D-1)->A:W-1(V589_D-1)) removing edge Edge(549->588,w:4.0)(AGTCCACCAC...CATCTAATAA:W4(V549_D-1)->A:W-1(V588_D-1)) Found potential edge: Edge(549->589,w:4.0) between AGTCCACCAC...CATCTAATAA:W4(V549_D-1) and A:W-1(V589_D-1) removing vertex A:W-1(V589_D-1) was concatenated into AGTCCACCAC...ATCTAATAAA:W4(V549_D-1) Want to move edge Edge(589->590,w:4.0)(A:W-1(V589_D-1)->G:W-1(V590_D-1)) to (AGTCCACCAC...ATCTAATAAA:W4(V549_D-1)->G:W-1(V590_D-1) adding edge: AGTCCACCAC...ATCTAATAAA:W4(V549_D-1) to G:W-1(V590_D-1) removing edge Edge(589->590,w:4.0)(A:W-1(V589_D-1)->G:W-1(V590_D-1)) removing edge Edge(549->589,w:4.0)(AGTCCACCAC...ATCTAATAAA:W4(V549_D-1)->A:W-1(V589_D-1)) Found potential edge: Edge(549->590,w:4.0) between AGTCCACCAC...ATCTAATAAA:W4(V549_D-1) and G:W-1(V590_D-1) removing vertex G:W-1(V590_D-1) was concatenated into AGTCCACCAC...TCTAATAAAG:W4(V549_D-1) Want to move edge Edge(590->591,w:2.0)(G:W-1(V590_D-1)->G:W-1(V591_D-1)) to (AGTCCACCAC...TCTAATAAAG:W4(V549_D-1)->G:W-1(V591_D-1) adding edge: AGTCCACCAC...TCTAATAAAG:W4(V549_D-1) to G:W-1(V591_D-1) removing edge Edge(590->591,w:2.0)(G:W-1(V590_D-1)->G:W-1(V591_D-1)) removing edge Edge(549->590,w:4.0)(AGTCCACCAC...TCTAATAAAG:W4(V549_D-1)->G:W-1(V590_D-1)) Found potential edge: Edge(549->591,w:2.0) between AGTCCACCAC...TCTAATAAAG:W4(V549_D-1) and G:W-1(V591_D-1) removing vertex G:W-1(V591_D-1) was concatenated into AGTCCACCAC...CTAATAAAGG:W4(V549_D-1) Want to move edge Edge(591->592,w:2.0)(G:W-1(V591_D-1)->A:W-1(V592_D-1)) to (AGTCCACCAC...CTAATAAAGG:W4(V549_D-1)->A:W-1(V592_D-1) adding edge: AGTCCACCAC...CTAATAAAGG:W4(V549_D-1) to A:W-1(V592_D-1) removing edge Edge(591->592,w:2.0)(G:W-1(V591_D-1)->A:W-1(V592_D-1)) removing edge Edge(549->591,w:2.0)(AGTCCACCAC...CTAATAAAGG:W4(V549_D-1)->G:W-1(V591_D-1)) Found potential edge: Edge(549->592,w:2.0) between AGTCCACCAC...CTAATAAAGG:W4(V549_D-1) and A:W-1(V592_D-1) removing vertex A:W-1(V592_D-1) was concatenated into AGTCCACCAC...TAATAAAGGA:W4(V549_D-1) Want to move edge Edge(592->593,w:2.0)(A:W-1(V592_D-1)->A:W-1(V593_D-1)) to (AGTCCACCAC...TAATAAAGGA:W4(V549_D-1)->A:W-1(V593_D-1) adding edge: AGTCCACCAC...TAATAAAGGA:W4(V549_D-1) to A:W-1(V593_D-1) removing edge Edge(592->593,w:2.0)(A:W-1(V592_D-1)->A:W-1(V593_D-1)) removing edge Edge(549->592,w:2.0)(AGTCCACCAC...TAATAAAGGA:W4(V549_D-1)->A:W-1(V592_D-1)) Found potential edge: Edge(549->593,w:2.0) between AGTCCACCAC...TAATAAAGGA:W4(V549_D-1) and A:W-1(V593_D-1) removing vertex A:W-1(V593_D-1) was concatenated into AGTCCACCAC...AATAAAGGAA:W4(V549_D-1) Want to move edge Edge(593->594,w:2.0)(A:W-1(V593_D-1)->A:W-1(V594_D-1)) to (AGTCCACCAC...AATAAAGGAA:W4(V549_D-1)->A:W-1(V594_D-1) adding edge: AGTCCACCAC...AATAAAGGAA:W4(V549_D-1) to A:W-1(V594_D-1) removing edge Edge(593->594,w:2.0)(A:W-1(V593_D-1)->A:W-1(V594_D-1)) removing edge Edge(549->593,w:2.0)(AGTCCACCAC...AATAAAGGAA:W4(V549_D-1)->A:W-1(V593_D-1)) Found potential edge: Edge(549->594,w:2.0) between AGTCCACCAC...AATAAAGGAA:W4(V549_D-1) and A:W-1(V594_D-1) removing vertex A:W-1(V594_D-1) was concatenated into AGTCCACCAC...ATAAAGGAAA:W4(V549_D-1) Want to move edge Edge(594->595,w:2.0)(A:W-1(V594_D-1)->A:W-1(V595_D-1)) to (AGTCCACCAC...ATAAAGGAAA:W4(V549_D-1)->A:W-1(V595_D-1) adding edge: AGTCCACCAC...ATAAAGGAAA:W4(V549_D-1) to A:W-1(V595_D-1) removing edge Edge(594->595,w:2.0)(A:W-1(V594_D-1)->A:W-1(V595_D-1)) removing edge Edge(549->594,w:2.0)(AGTCCACCAC...ATAAAGGAAA:W4(V549_D-1)->A:W-1(V594_D-1)) Found potential edge: Edge(549->595,w:2.0) between AGTCCACCAC...ATAAAGGAAA:W4(V549_D-1) and A:W-1(V595_D-1) removing vertex A:W-1(V595_D-1) was concatenated into AGTCCACCAC...TAAAGGAAAA:W4(V549_D-1) Want to move edge Edge(595->596,w:2.0)(A:W-1(V595_D-1)->C:W-1(V596_D-1)) to (AGTCCACCAC...TAAAGGAAAA:W4(V549_D-1)->C:W-1(V596_D-1) adding edge: AGTCCACCAC...TAAAGGAAAA:W4(V549_D-1) to C:W-1(V596_D-1) removing edge Edge(595->596,w:2.0)(A:W-1(V595_D-1)->C:W-1(V596_D-1)) removing edge Edge(549->595,w:2.0)(AGTCCACCAC...TAAAGGAAAA:W4(V549_D-1)->A:W-1(V595_D-1)) Found potential edge: Edge(549->596,w:2.0) between AGTCCACCAC...TAAAGGAAAA:W4(V549_D-1) and C:W-1(V596_D-1) removing vertex C:W-1(V596_D-1) was concatenated into AGTCCACCAC...AAAGGAAAAC:W4(V549_D-1) Want to move edge Edge(596->597,w:2.0)(C:W-1(V596_D-1)->T:W-1(V597_D-1)) to (AGTCCACCAC...AAAGGAAAAC:W4(V549_D-1)->T:W-1(V597_D-1) adding edge: AGTCCACCAC...AAAGGAAAAC:W4(V549_D-1) to T:W-1(V597_D-1) removing edge Edge(596->597,w:2.0)(C:W-1(V596_D-1)->T:W-1(V597_D-1)) removing edge Edge(549->596,w:2.0)(AGTCCACCAC...AAAGGAAAAC:W4(V549_D-1)->C:W-1(V596_D-1)) Found potential edge: Edge(549->597,w:2.0) between AGTCCACCAC...AAAGGAAAAC:W4(V549_D-1) and T:W-1(V597_D-1) removing vertex T:W-1(V597_D-1) was concatenated into AGTCCACCAC...AAGGAAAACT:W4(V549_D-1) Want to move edge Edge(597->598,w:2.0)(T:W-1(V597_D-1)->G:W-1(V598_D-1)) to (AGTCCACCAC...AAGGAAAACT:W4(V549_D-1)->G:W-1(V598_D-1) adding edge: AGTCCACCAC...AAGGAAAACT:W4(V549_D-1) to G:W-1(V598_D-1) removing edge Edge(597->598,w:2.0)(T:W-1(V597_D-1)->G:W-1(V598_D-1)) removing edge Edge(549->597,w:2.0)(AGTCCACCAC...AAGGAAAACT:W4(V549_D-1)->T:W-1(V597_D-1)) Found potential edge: Edge(549->598,w:2.0) between AGTCCACCAC...AAGGAAAACT:W4(V549_D-1) and G:W-1(V598_D-1) removing vertex G:W-1(V598_D-1) was concatenated into AGTCCACCAC...AGGAAAACTG:W4(V549_D-1) Want to move edge Edge(598->599,w:2.0)(G:W-1(V598_D-1)->C:W-1(V599_D-1)) to (AGTCCACCAC...AGGAAAACTG:W4(V549_D-1)->C:W-1(V599_D-1) adding edge: AGTCCACCAC...AGGAAAACTG:W4(V549_D-1) to C:W-1(V599_D-1) removing edge Edge(598->599,w:2.0)(G:W-1(V598_D-1)->C:W-1(V599_D-1)) removing edge Edge(549->598,w:2.0)(AGTCCACCAC...AGGAAAACTG:W4(V549_D-1)->G:W-1(V598_D-1)) Found potential edge: Edge(549->599,w:2.0) between AGTCCACCAC...AGGAAAACTG:W4(V549_D-1) and C:W-1(V599_D-1) removing vertex C:W-1(V599_D-1) was concatenated into AGTCCACCAC...GGAAAACTGC:W4(V549_D-1) Want to move edge Edge(599->600,w:2.0)(C:W-1(V599_D-1)->A:W-1(V600_D-1)) to (AGTCCACCAC...GGAAAACTGC:W4(V549_D-1)->A:W-1(V600_D-1) adding edge: AGTCCACCAC...GGAAAACTGC:W4(V549_D-1) to A:W-1(V600_D-1) removing edge Edge(599->600,w:2.0)(C:W-1(V599_D-1)->A:W-1(V600_D-1)) removing edge Edge(549->599,w:2.0)(AGTCCACCAC...GGAAAACTGC:W4(V549_D-1)->C:W-1(V599_D-1)) Found potential edge: Edge(549->600,w:2.0) between AGTCCACCAC...GGAAAACTGC:W4(V549_D-1) and A:W-1(V600_D-1) removing vertex A:W-1(V600_D-1) was concatenated into AGTCCACCAC...GAAAACTGCA:W4(V549_D-1) Want to move edge Edge(600->601,w:2.0)(A:W-1(V600_D-1)->T:W-1(V601_D-1)) to (AGTCCACCAC...GAAAACTGCA:W4(V549_D-1)->T:W-1(V601_D-1) adding edge: AGTCCACCAC...GAAAACTGCA:W4(V549_D-1) to T:W-1(V601_D-1) removing edge Edge(600->601,w:2.0)(A:W-1(V600_D-1)->T:W-1(V601_D-1)) removing edge Edge(549->600,w:2.0)(AGTCCACCAC...GAAAACTGCA:W4(V549_D-1)->A:W-1(V600_D-1)) Found potential edge: Edge(549->601,w:2.0) between AGTCCACCAC...GAAAACTGCA:W4(V549_D-1) and T:W-1(V601_D-1) removing vertex T:W-1(V601_D-1) was concatenated into AGTCCACCAC...AAAACTGCAT:W4(V549_D-1) Want to move edge Edge(601->602,w:2.0)(T:W-1(V601_D-1)->C:W-1(V602_D-1)) to (AGTCCACCAC...AAAACTGCAT:W4(V549_D-1)->C:W-1(V602_D-1) adding edge: AGTCCACCAC...AAAACTGCAT:W4(V549_D-1) to C:W-1(V602_D-1) removing edge Edge(601->602,w:2.0)(T:W-1(V601_D-1)->C:W-1(V602_D-1)) removing edge Edge(549->601,w:2.0)(AGTCCACCAC...AAAACTGCAT:W4(V549_D-1)->T:W-1(V601_D-1)) Found potential edge: Edge(549->602,w:2.0) between AGTCCACCAC...AAAACTGCAT:W4(V549_D-1) and C:W-1(V602_D-1) removing vertex C:W-1(V602_D-1) was concatenated into AGTCCACCAC...AAACTGCATC:W4(V549_D-1) Want to move edge Edge(602->603,w:2.0)(C:W-1(V602_D-1)->T:W-1(V603_D-1)) to (AGTCCACCAC...AAACTGCATC:W4(V549_D-1)->T:W-1(V603_D-1) adding edge: AGTCCACCAC...AAACTGCATC:W4(V549_D-1) to T:W-1(V603_D-1) removing edge Edge(602->603,w:2.0)(C:W-1(V602_D-1)->T:W-1(V603_D-1)) removing edge Edge(549->602,w:2.0)(AGTCCACCAC...AAACTGCATC:W4(V549_D-1)->C:W-1(V602_D-1)) Found potential edge: Edge(549->603,w:2.0) between AGTCCACCAC...AAACTGCATC:W4(V549_D-1) and T:W-1(V603_D-1) removing vertex T:W-1(V603_D-1) was concatenated into AGTCCACCAC...AACTGCATCT:W4(V549_D-1) Want to move edge Edge(603->604,w:2.0)(T:W-1(V603_D-1)->T:W-1(V604_D-1)) to (AGTCCACCAC...AACTGCATCT:W4(V549_D-1)->T:W-1(V604_D-1) adding edge: AGTCCACCAC...AACTGCATCT:W4(V549_D-1) to T:W-1(V604_D-1) removing edge Edge(603->604,w:2.0)(T:W-1(V603_D-1)->T:W-1(V604_D-1)) removing edge Edge(549->603,w:2.0)(AGTCCACCAC...AACTGCATCT:W4(V549_D-1)->T:W-1(V603_D-1)) Found potential edge: Edge(549->604,w:2.0) between AGTCCACCAC...AACTGCATCT:W4(V549_D-1) and T:W-1(V604_D-1) removing vertex T:W-1(V604_D-1) was concatenated into AGTCCACCAC...ACTGCATCTT:W4(V549_D-1) Want to move edge Edge(604->605,w:2.0)(T:W-1(V604_D-1)->T:W-1(V605_D-1)) to (AGTCCACCAC...ACTGCATCTT:W4(V549_D-1)->T:W-1(V605_D-1) adding edge: AGTCCACCAC...ACTGCATCTT:W4(V549_D-1) to T:W-1(V605_D-1) removing edge Edge(604->605,w:2.0)(T:W-1(V604_D-1)->T:W-1(V605_D-1)) removing edge Edge(549->604,w:2.0)(AGTCCACCAC...ACTGCATCTT:W4(V549_D-1)->T:W-1(V604_D-1)) Found potential edge: Edge(549->605,w:2.0) between AGTCCACCAC...ACTGCATCTT:W4(V549_D-1) and T:W-1(V605_D-1) removing vertex T:W-1(V605_D-1) was concatenated into AGTCCACCAC...CTGCATCTTT:W4(V549_D-1) Want to move edge Edge(605->606,w:2.0)(T:W-1(V605_D-1)->G:W-1(V606_D-1)) to (AGTCCACCAC...CTGCATCTTT:W4(V549_D-1)->G:W-1(V606_D-1) adding edge: AGTCCACCAC...CTGCATCTTT:W4(V549_D-1) to G:W-1(V606_D-1) removing edge Edge(605->606,w:2.0)(T:W-1(V605_D-1)->G:W-1(V606_D-1)) removing edge Edge(549->605,w:2.0)(AGTCCACCAC...CTGCATCTTT:W4(V549_D-1)->T:W-1(V605_D-1)) Found potential edge: Edge(549->606,w:2.0) between AGTCCACCAC...CTGCATCTTT:W4(V549_D-1) and G:W-1(V606_D-1) removing vertex G:W-1(V606_D-1) was concatenated into AGTCCACCAC...TGCATCTTTG:W4(V549_D-1) Want to move edge Edge(606->607,w:4.0)(G:W-1(V606_D-1)->C:W-1(V607_D-1)) to (AGTCCACCAC...TGCATCTTTG:W4(V549_D-1)->C:W-1(V607_D-1) adding edge: AGTCCACCAC...TGCATCTTTG:W4(V549_D-1) to C:W-1(V607_D-1) removing edge Edge(606->607,w:4.0)(G:W-1(V606_D-1)->C:W-1(V607_D-1)) removing edge Edge(549->606,w:2.0)(AGTCCACCAC...TGCATCTTTG:W4(V549_D-1)->G:W-1(V606_D-1)) Found potential edge: Edge(549->607,w:4.0) between AGTCCACCAC...TGCATCTTTG:W4(V549_D-1) and C:W-1(V607_D-1) removing vertex C:W-1(V607_D-1) was concatenated into AGTCCACCAC...GCATCTTTGC:W4(V549_D-1) Want to move edge Edge(607->608,w:4.0)(C:W-1(V607_D-1)->C:W-1(V608_D-1)) to (AGTCCACCAC...GCATCTTTGC:W4(V549_D-1)->C:W-1(V608_D-1) adding edge: AGTCCACCAC...GCATCTTTGC:W4(V549_D-1) to C:W-1(V608_D-1) removing edge Edge(607->608,w:4.0)(C:W-1(V607_D-1)->C:W-1(V608_D-1)) removing edge Edge(549->607,w:4.0)(AGTCCACCAC...GCATCTTTGC:W4(V549_D-1)->C:W-1(V607_D-1)) Found potential edge: Edge(549->608,w:4.0) between AGTCCACCAC...GCATCTTTGC:W4(V549_D-1) and C:W-1(V608_D-1) removing vertex C:W-1(V608_D-1) was concatenated into AGTCCACCAC...CATCTTTGCC:W4(V549_D-1) Want to move edge Edge(608->609,w:4.0)(C:W-1(V608_D-1)->C:W-1(V609_D-1)) to (AGTCCACCAC...CATCTTTGCC:W4(V549_D-1)->C:W-1(V609_D-1) adding edge: AGTCCACCAC...CATCTTTGCC:W4(V549_D-1) to C:W-1(V609_D-1) removing edge Edge(608->609,w:4.0)(C:W-1(V608_D-1)->C:W-1(V609_D-1)) removing edge Edge(549->608,w:4.0)(AGTCCACCAC...CATCTTTGCC:W4(V549_D-1)->C:W-1(V608_D-1)) Found potential edge: Edge(549->609,w:4.0) between AGTCCACCAC...CATCTTTGCC:W4(V549_D-1) and C:W-1(V609_D-1) removing vertex C:W-1(V609_D-1) was concatenated into AGTCCACCAC...ATCTTTGCCC:W4(V549_D-1) Want to move edge Edge(609->610,w:4.0)(C:W-1(V609_D-1)->A:W-1(V610_D-1)) to (AGTCCACCAC...ATCTTTGCCC:W4(V549_D-1)->A:W-1(V610_D-1) adding edge: AGTCCACCAC...ATCTTTGCCC:W4(V549_D-1) to A:W-1(V610_D-1) removing edge Edge(609->610,w:4.0)(C:W-1(V609_D-1)->A:W-1(V610_D-1)) removing edge Edge(549->609,w:4.0)(AGTCCACCAC...ATCTTTGCCC:W4(V549_D-1)->C:W-1(V609_D-1)) Found potential edge: Edge(549->610,w:4.0) between AGTCCACCAC...ATCTTTGCCC:W4(V549_D-1) and A:W-1(V610_D-1) removing vertex A:W-1(V610_D-1) was concatenated into AGTCCACCAC...TCTTTGCCCA:W4(V549_D-1) Want to move edge Edge(610->611,w:4.0)(A:W-1(V610_D-1)->C:W-1(V611_D-1)) to (AGTCCACCAC...TCTTTGCCCA:W4(V549_D-1)->C:W-1(V611_D-1) adding edge: AGTCCACCAC...TCTTTGCCCA:W4(V549_D-1) to C:W-1(V611_D-1) removing edge Edge(610->611,w:4.0)(A:W-1(V610_D-1)->C:W-1(V611_D-1)) removing edge Edge(549->610,w:4.0)(AGTCCACCAC...TCTTTGCCCA:W4(V549_D-1)->A:W-1(V610_D-1)) Found potential edge: Edge(549->611,w:4.0) between AGTCCACCAC...TCTTTGCCCA:W4(V549_D-1) and C:W-1(V611_D-1) removing vertex C:W-1(V611_D-1) was concatenated into AGTCCACCAC...CTTTGCCCAC:W4(V549_D-1) Want to move edge Edge(611->612,w:4.0)(C:W-1(V611_D-1)->A:W-1(V612_D-1)) to (AGTCCACCAC...CTTTGCCCAC:W4(V549_D-1)->A:W-1(V612_D-1) adding edge: AGTCCACCAC...CTTTGCCCAC:W4(V549_D-1) to A:W-1(V612_D-1) removing edge Edge(611->612,w:4.0)(C:W-1(V611_D-1)->A:W-1(V612_D-1)) removing edge Edge(549->611,w:4.0)(AGTCCACCAC...CTTTGCCCAC:W4(V549_D-1)->C:W-1(V611_D-1)) Found potential edge: Edge(549->612,w:4.0) between AGTCCACCAC...CTTTGCCCAC:W4(V549_D-1) and A:W-1(V612_D-1) removing vertex A:W-1(V612_D-1) was concatenated into AGTCCACCAC...TTTGCCCACA:W4(V549_D-1) Want to move edge Edge(612->613,w:6.0)(A:W-1(V612_D-1)->T:W-1(V613_D-1)) to (AGTCCACCAC...TTTGCCCACA:W4(V549_D-1)->T:W-1(V613_D-1) adding edge: AGTCCACCAC...TTTGCCCACA:W4(V549_D-1) to T:W-1(V613_D-1) removing edge Edge(612->613,w:6.0)(A:W-1(V612_D-1)->T:W-1(V613_D-1)) removing edge Edge(549->612,w:4.0)(AGTCCACCAC...TTTGCCCACA:W4(V549_D-1)->A:W-1(V612_D-1)) Found potential edge: Edge(549->613,w:6.0) between AGTCCACCAC...TTTGCCCACA:W4(V549_D-1) and T:W-1(V613_D-1) removing vertex T:W-1(V613_D-1) was concatenated into AGTCCACCAC...TTGCCCACAT:W4(V549_D-1) Want to move edge Edge(613->614,w:6.0)(T:W-1(V613_D-1)->G:W-1(V614_D-1)) to (AGTCCACCAC...TTGCCCACAT:W4(V549_D-1)->G:W-1(V614_D-1) adding edge: AGTCCACCAC...TTGCCCACAT:W4(V549_D-1) to G:W-1(V614_D-1) removing edge Edge(613->614,w:6.0)(T:W-1(V613_D-1)->G:W-1(V614_D-1)) removing edge Edge(549->613,w:6.0)(AGTCCACCAC...TTGCCCACAT:W4(V549_D-1)->T:W-1(V613_D-1)) Found potential edge: Edge(549->614,w:6.0) between AGTCCACCAC...TTGCCCACAT:W4(V549_D-1) and G:W-1(V614_D-1) removing vertex G:W-1(V614_D-1) was concatenated into AGTCCACCAC...TGCCCACATG:W4(V549_D-1) Want to move edge Edge(614->615,w:6.0)(G:W-1(V614_D-1)->A:W-1(V615_D-1)) to (AGTCCACCAC...TGCCCACATG:W4(V549_D-1)->A:W-1(V615_D-1) adding edge: AGTCCACCAC...TGCCCACATG:W4(V549_D-1) to A:W-1(V615_D-1) removing edge Edge(614->615,w:6.0)(G:W-1(V614_D-1)->A:W-1(V615_D-1)) removing edge Edge(549->614,w:6.0)(AGTCCACCAC...TGCCCACATG:W4(V549_D-1)->G:W-1(V614_D-1)) Found potential edge: Edge(549->615,w:6.0) between AGTCCACCAC...TGCCCACATG:W4(V549_D-1) and A:W-1(V615_D-1) removing vertex A:W-1(V615_D-1) was concatenated into AGTCCACCAC...GCCCACATGA:W4(V549_D-1) Want to move edge Edge(615->616,w:6.0)(A:W-1(V615_D-1)->T:W-1(V616_D-1)) to (AGTCCACCAC...GCCCACATGA:W4(V549_D-1)->T:W-1(V616_D-1) adding edge: AGTCCACCAC...GCCCACATGA:W4(V549_D-1) to T:W-1(V616_D-1) removing edge Edge(615->616,w:6.0)(A:W-1(V615_D-1)->T:W-1(V616_D-1)) removing edge Edge(549->615,w:6.0)(AGTCCACCAC...GCCCACATGA:W4(V549_D-1)->A:W-1(V615_D-1)) Found potential edge: Edge(549->616,w:6.0) between AGTCCACCAC...GCCCACATGA:W4(V549_D-1) and T:W-1(V616_D-1) removing vertex T:W-1(V616_D-1) was concatenated into AGTCCACCAC...CCCACATGAT:W4(V549_D-1) Want to move edge Edge(616->617,w:6.0)(T:W-1(V616_D-1)->G:W-1(V617_D-1)) to (AGTCCACCAC...CCCACATGAT:W4(V549_D-1)->G:W-1(V617_D-1) adding edge: AGTCCACCAC...CCCACATGAT:W4(V549_D-1) to G:W-1(V617_D-1) removing edge Edge(616->617,w:6.0)(T:W-1(V616_D-1)->G:W-1(V617_D-1)) removing edge Edge(549->616,w:6.0)(AGTCCACCAC...CCCACATGAT:W4(V549_D-1)->T:W-1(V616_D-1)) Found potential edge: Edge(549->617,w:6.0) between AGTCCACCAC...CCCACATGAT:W4(V549_D-1) and G:W-1(V617_D-1) removing vertex G:W-1(V617_D-1) was concatenated into AGTCCACCAC...CCACATGATG:W4(V549_D-1) Want to move edge Edge(617->618,w:6.0)(G:W-1(V617_D-1)->C:W-1(V618_D-1)) to (AGTCCACCAC...CCACATGATG:W4(V549_D-1)->C:W-1(V618_D-1) adding edge: AGTCCACCAC...CCACATGATG:W4(V549_D-1) to C:W-1(V618_D-1) removing edge Edge(617->618,w:6.0)(G:W-1(V617_D-1)->C:W-1(V618_D-1)) removing edge Edge(549->617,w:6.0)(AGTCCACCAC...CCACATGATG:W4(V549_D-1)->G:W-1(V617_D-1)) Found potential edge: Edge(549->618,w:6.0) between AGTCCACCAC...CCACATGATG:W4(V549_D-1) and C:W-1(V618_D-1) removing vertex C:W-1(V618_D-1) was concatenated into AGTCCACCAC...CACATGATGC:W4(V549_D-1) Want to move edge Edge(618->619,w:6.0)(C:W-1(V618_D-1)->T:W-1(V619_D-1)) to (AGTCCACCAC...CACATGATGC:W4(V549_D-1)->T:W-1(V619_D-1) adding edge: AGTCCACCAC...CACATGATGC:W4(V549_D-1) to T:W-1(V619_D-1) removing edge Edge(618->619,w:6.0)(C:W-1(V618_D-1)->T:W-1(V619_D-1)) removing edge Edge(549->618,w:6.0)(AGTCCACCAC...CACATGATGC:W4(V549_D-1)->C:W-1(V618_D-1)) Found potential edge: Edge(549->619,w:6.0) between AGTCCACCAC...CACATGATGC:W4(V549_D-1) and T:W-1(V619_D-1) removing vertex T:W-1(V619_D-1) was concatenated into AGTCCACCAC...ACATGATGCT:W4(V549_D-1) Want to move edge Edge(619->620,w:4.0)(T:W-1(V619_D-1)->T:W-1(V620_D-1)) to (AGTCCACCAC...ACATGATGCT:W4(V549_D-1)->T:W-1(V620_D-1) adding edge: AGTCCACCAC...ACATGATGCT:W4(V549_D-1) to T:W-1(V620_D-1) removing edge Edge(619->620,w:4.0)(T:W-1(V619_D-1)->T:W-1(V620_D-1)) removing edge Edge(549->619,w:6.0)(AGTCCACCAC...ACATGATGCT:W4(V549_D-1)->T:W-1(V619_D-1)) Found potential edge: Edge(549->620,w:4.0) between AGTCCACCAC...ACATGATGCT:W4(V549_D-1) and T:W-1(V620_D-1) removing vertex T:W-1(V620_D-1) was concatenated into AGTCCACCAC...CATGATGCTT:W4(V549_D-1) Want to move edge Edge(620->621,w:4.0)(T:W-1(V620_D-1)->G:W-1(V621_D-1)) to (AGTCCACCAC...CATGATGCTT:W4(V549_D-1)->G:W-1(V621_D-1) adding edge: AGTCCACCAC...CATGATGCTT:W4(V549_D-1) to G:W-1(V621_D-1) removing edge Edge(620->621,w:4.0)(T:W-1(V620_D-1)->G:W-1(V621_D-1)) removing edge Edge(549->620,w:4.0)(AGTCCACCAC...CATGATGCTT:W4(V549_D-1)->T:W-1(V620_D-1)) Found potential edge: Edge(549->621,w:4.0) between AGTCCACCAC...CATGATGCTT:W4(V549_D-1) and G:W-1(V621_D-1) removing vertex G:W-1(V621_D-1) was concatenated into AGTCCACCAC...ATGATGCTTG:W4(V549_D-1) Want to move edge Edge(621->622,w:4.0)(G:W-1(V621_D-1)->G:W-1(V622_D-1)) to (AGTCCACCAC...ATGATGCTTG:W4(V549_D-1)->G:W-1(V622_D-1) adding edge: AGTCCACCAC...ATGATGCTTG:W4(V549_D-1) to G:W-1(V622_D-1) removing edge Edge(621->622,w:4.0)(G:W-1(V621_D-1)->G:W-1(V622_D-1)) removing edge Edge(549->621,w:4.0)(AGTCCACCAC...ATGATGCTTG:W4(V549_D-1)->G:W-1(V621_D-1)) Found potential edge: Edge(549->622,w:4.0) between AGTCCACCAC...ATGATGCTTG:W4(V549_D-1) and G:W-1(V622_D-1) removing vertex G:W-1(V622_D-1) was concatenated into AGTCCACCAC...TGATGCTTGG:W4(V549_D-1) Want to move edge Edge(622->623,w:4.0)(G:W-1(V622_D-1)->T:W-1(V623_D-1)) to (AGTCCACCAC...TGATGCTTGG:W4(V549_D-1)->T:W-1(V623_D-1) adding edge: AGTCCACCAC...TGATGCTTGG:W4(V549_D-1) to T:W-1(V623_D-1) removing edge Edge(622->623,w:4.0)(G:W-1(V622_D-1)->T:W-1(V623_D-1)) removing edge Edge(549->622,w:4.0)(AGTCCACCAC...TGATGCTTGG:W4(V549_D-1)->G:W-1(V622_D-1)) Found potential edge: Edge(549->623,w:4.0) between AGTCCACCAC...TGATGCTTGG:W4(V549_D-1) and T:W-1(V623_D-1) removing vertex T:W-1(V623_D-1) was concatenated into AGTCCACCAC...GATGCTTGGT:W4(V549_D-1) Want to move edge Edge(623->624,w:4.0)(T:W-1(V623_D-1)->T:W-1(V624_D-1)) to (AGTCCACCAC...GATGCTTGGT:W4(V549_D-1)->T:W-1(V624_D-1) adding edge: AGTCCACCAC...GATGCTTGGT:W4(V549_D-1) to T:W-1(V624_D-1) removing edge Edge(623->624,w:4.0)(T:W-1(V623_D-1)->T:W-1(V624_D-1)) removing edge Edge(549->623,w:4.0)(AGTCCACCAC...GATGCTTGGT:W4(V549_D-1)->T:W-1(V623_D-1)) Found potential edge: Edge(549->624,w:4.0) between AGTCCACCAC...GATGCTTGGT:W4(V549_D-1) and T:W-1(V624_D-1) removing vertex T:W-1(V624_D-1) was concatenated into AGTCCACCAC...ATGCTTGGTT:W4(V549_D-1) Want to move edge Edge(624->625,w:4.0)(T:W-1(V624_D-1)->A:W-1(V625_D-1)) to (AGTCCACCAC...ATGCTTGGTT:W4(V549_D-1)->A:W-1(V625_D-1) adding edge: AGTCCACCAC...ATGCTTGGTT:W4(V549_D-1) to A:W-1(V625_D-1) removing edge Edge(624->625,w:4.0)(T:W-1(V624_D-1)->A:W-1(V625_D-1)) removing edge Edge(549->624,w:4.0)(AGTCCACCAC...ATGCTTGGTT:W4(V549_D-1)->T:W-1(V624_D-1)) Found potential edge: Edge(549->625,w:4.0) between AGTCCACCAC...ATGCTTGGTT:W4(V549_D-1) and A:W-1(V625_D-1) removing vertex A:W-1(V625_D-1) was concatenated into AGTCCACCAC...TGCTTGGTTA:W4(V549_D-1) Want to move edge Edge(625->626,w:4.0)(A:W-1(V625_D-1)->A:W-1(V626_D-1)) to (AGTCCACCAC...TGCTTGGTTA:W4(V549_D-1)->A:W-1(V626_D-1) adding edge: AGTCCACCAC...TGCTTGGTTA:W4(V549_D-1) to A:W-1(V626_D-1) removing edge Edge(625->626,w:4.0)(A:W-1(V625_D-1)->A:W-1(V626_D-1)) removing edge Edge(549->625,w:4.0)(AGTCCACCAC...TGCTTGGTTA:W4(V549_D-1)->A:W-1(V625_D-1)) Found potential edge: Edge(549->626,w:4.0) between AGTCCACCAC...TGCTTGGTTA:W4(V549_D-1) and A:W-1(V626_D-1) removing vertex A:W-1(V626_D-1) was concatenated into AGTCCACCAC...GCTTGGTTAA:W4(V549_D-1) Want to move edge Edge(626->627,w:4.0)(A:W-1(V626_D-1)->G:W-1(V627_D-1)) to (AGTCCACCAC...GCTTGGTTAA:W4(V549_D-1)->G:W-1(V627_D-1) adding edge: AGTCCACCAC...GCTTGGTTAA:W4(V549_D-1) to G:W-1(V627_D-1) removing edge Edge(626->627,w:4.0)(A:W-1(V626_D-1)->G:W-1(V627_D-1)) removing edge Edge(549->626,w:4.0)(AGTCCACCAC...GCTTGGTTAA:W4(V549_D-1)->A:W-1(V626_D-1)) Found potential edge: Edge(549->627,w:4.0) between AGTCCACCAC...GCTTGGTTAA:W4(V549_D-1) and G:W-1(V627_D-1) removing vertex G:W-1(V627_D-1) was concatenated into AGTCCACCAC...CTTGGTTAAG:W4(V549_D-1) Want to move edge Edge(627->628,w:4.0)(G:W-1(V627_D-1)->A:W-1(V628_D-1)) to (AGTCCACCAC...CTTGGTTAAG:W4(V549_D-1)->A:W-1(V628_D-1) adding edge: AGTCCACCAC...CTTGGTTAAG:W4(V549_D-1) to A:W-1(V628_D-1) removing edge Edge(627->628,w:4.0)(G:W-1(V627_D-1)->A:W-1(V628_D-1)) removing edge Edge(549->627,w:4.0)(AGTCCACCAC...CTTGGTTAAG:W4(V549_D-1)->G:W-1(V627_D-1)) Found potential edge: Edge(549->628,w:4.0) between AGTCCACCAC...CTTGGTTAAG:W4(V549_D-1) and A:W-1(V628_D-1) removing vertex A:W-1(V628_D-1) was concatenated into AGTCCACCAC...TTGGTTAAGA:W4(V549_D-1) Want to move edge Edge(628->629,w:4.0)(A:W-1(V628_D-1)->C:W-1(V629_D-1)) to (AGTCCACCAC...TTGGTTAAGA:W4(V549_D-1)->C:W-1(V629_D-1) adding edge: AGTCCACCAC...TTGGTTAAGA:W4(V549_D-1) to C:W-1(V629_D-1) removing edge Edge(628->629,w:4.0)(A:W-1(V628_D-1)->C:W-1(V629_D-1)) removing edge Edge(549->628,w:4.0)(AGTCCACCAC...TTGGTTAAGA:W4(V549_D-1)->A:W-1(V628_D-1)) Found potential edge: Edge(549->629,w:4.0) between AGTCCACCAC...TTGGTTAAGA:W4(V549_D-1) and C:W-1(V629_D-1) removing vertex C:W-1(V629_D-1) was concatenated into AGTCCACCAC...TGGTTAAGAC:W4(V549_D-1) Want to move edge Edge(629->630,w:4.0)(C:W-1(V629_D-1)->A:W-1(V630_D-1)) to (AGTCCACCAC...TGGTTAAGAC:W4(V549_D-1)->A:W-1(V630_D-1) adding edge: AGTCCACCAC...TGGTTAAGAC:W4(V549_D-1) to A:W-1(V630_D-1) removing edge Edge(629->630,w:4.0)(C:W-1(V629_D-1)->A:W-1(V630_D-1)) removing edge Edge(549->629,w:4.0)(AGTCCACCAC...TGGTTAAGAC:W4(V549_D-1)->C:W-1(V629_D-1)) Found potential edge: Edge(549->630,w:4.0) between AGTCCACCAC...TGGTTAAGAC:W4(V549_D-1) and A:W-1(V630_D-1) removing vertex A:W-1(V630_D-1) was concatenated into AGTCCACCAC...GGTTAAGACA:W4(V549_D-1) Want to move edge Edge(630->631,w:4.0)(A:W-1(V630_D-1)->A:W-1(V631_D-1)) to (AGTCCACCAC...GGTTAAGACA:W4(V549_D-1)->A:W-1(V631_D-1) adding edge: AGTCCACCAC...GGTTAAGACA:W4(V549_D-1) to A:W-1(V631_D-1) removing edge Edge(630->631,w:4.0)(A:W-1(V630_D-1)->A:W-1(V631_D-1)) removing edge Edge(549->630,w:4.0)(AGTCCACCAC...GGTTAAGACA:W4(V549_D-1)->A:W-1(V630_D-1)) Found potential edge: Edge(549->631,w:4.0) between AGTCCACCAC...GGTTAAGACA:W4(V549_D-1) and A:W-1(V631_D-1) removing vertex A:W-1(V631_D-1) was concatenated into AGTCCACCAC...GTTAAGACAA:W4(V549_D-1) Want to move edge Edge(631->632,w:6.0)(A:W-1(V631_D-1)->G:W-1(V632_D-1)) to (AGTCCACCAC...GTTAAGACAA:W4(V549_D-1)->G:W-1(V632_D-1) adding edge: AGTCCACCAC...GTTAAGACAA:W4(V549_D-1) to G:W-1(V632_D-1) removing edge Edge(631->632,w:6.0)(A:W-1(V631_D-1)->G:W-1(V632_D-1)) removing edge Edge(549->631,w:4.0)(AGTCCACCAC...GTTAAGACAA:W4(V549_D-1)->A:W-1(V631_D-1)) Found potential edge: Edge(549->632,w:6.0) between AGTCCACCAC...GTTAAGACAA:W4(V549_D-1) and G:W-1(V632_D-1) removing vertex G:W-1(V632_D-1) was concatenated into AGTCCACCAC...TTAAGACAAG:W4(V549_D-1) Want to move edge Edge(632->633,w:6.0)(G:W-1(V632_D-1)->G:W-1(V633_D-1)) to (AGTCCACCAC...TTAAGACAAG:W4(V549_D-1)->G:W-1(V633_D-1) adding edge: AGTCCACCAC...TTAAGACAAG:W4(V549_D-1) to G:W-1(V633_D-1) removing edge Edge(632->633,w:6.0)(G:W-1(V632_D-1)->G:W-1(V633_D-1)) removing edge Edge(549->632,w:6.0)(AGTCCACCAC...TTAAGACAAG:W4(V549_D-1)->G:W-1(V632_D-1)) Found potential edge: Edge(549->633,w:6.0) between AGTCCACCAC...TTAAGACAAG:W4(V549_D-1) and G:W-1(V633_D-1) removing vertex G:W-1(V633_D-1) was concatenated into AGTCCACCAC...TAAGACAAGG:W4(V549_D-1) Want to move edge Edge(633->634,w:6.0)(G:W-1(V633_D-1)->G:W-1(V634_D-1)) to (AGTCCACCAC...TAAGACAAGG:W4(V549_D-1)->G:W-1(V634_D-1) adding edge: AGTCCACCAC...TAAGACAAGG:W4(V549_D-1) to G:W-1(V634_D-1) removing edge Edge(633->634,w:6.0)(G:W-1(V633_D-1)->G:W-1(V634_D-1)) removing edge Edge(549->633,w:6.0)(AGTCCACCAC...TAAGACAAGG:W4(V549_D-1)->G:W-1(V633_D-1)) Found potential edge: Edge(549->634,w:6.0) between AGTCCACCAC...TAAGACAAGG:W4(V549_D-1) and G:W-1(V634_D-1) removing vertex G:W-1(V634_D-1) was concatenated into AGTCCACCAC...AAGACAAGGG:W4(V549_D-1) Want to move edge Edge(634->635,w:6.0)(G:W-1(V634_D-1)->G:W-1(V635_D-1)) to (AGTCCACCAC...AAGACAAGGG:W4(V549_D-1)->G:W-1(V635_D-1) adding edge: AGTCCACCAC...AAGACAAGGG:W4(V549_D-1) to G:W-1(V635_D-1) removing edge Edge(634->635,w:6.0)(G:W-1(V634_D-1)->G:W-1(V635_D-1)) removing edge Edge(549->634,w:6.0)(AGTCCACCAC...AAGACAAGGG:W4(V549_D-1)->G:W-1(V634_D-1)) Found potential edge: Edge(549->635,w:6.0) between AGTCCACCAC...AAGACAAGGG:W4(V549_D-1) and G:W-1(V635_D-1) removing vertex G:W-1(V635_D-1) was concatenated into AGTCCACCAC...AGACAAGGGG:W4(V549_D-1) Want to move edge Edge(635->636,w:6.0)(G:W-1(V635_D-1)->T:W-1(V636_D-1)) to (AGTCCACCAC...AGACAAGGGG:W4(V549_D-1)->T:W-1(V636_D-1) adding edge: AGTCCACCAC...AGACAAGGGG:W4(V549_D-1) to T:W-1(V636_D-1) removing edge Edge(635->636,w:6.0)(G:W-1(V635_D-1)->T:W-1(V636_D-1)) removing edge Edge(549->635,w:6.0)(AGTCCACCAC...AGACAAGGGG:W4(V549_D-1)->G:W-1(V635_D-1)) Found potential edge: Edge(549->636,w:6.0) between AGTCCACCAC...AGACAAGGGG:W4(V549_D-1) and T:W-1(V636_D-1) removing vertex T:W-1(V636_D-1) was concatenated into AGTCCACCAC...GACAAGGGGT:W4(V549_D-1) Want to move edge Edge(636->637,w:6.0)(T:W-1(V636_D-1)->T:W-1(V637_D-1)) to (AGTCCACCAC...GACAAGGGGT:W4(V549_D-1)->T:W-1(V637_D-1) adding edge: AGTCCACCAC...GACAAGGGGT:W4(V549_D-1) to T:W-1(V637_D-1) removing edge Edge(636->637,w:6.0)(T:W-1(V636_D-1)->T:W-1(V637_D-1)) removing edge Edge(549->636,w:6.0)(AGTCCACCAC...GACAAGGGGT:W4(V549_D-1)->T:W-1(V636_D-1)) Found potential edge: Edge(549->637,w:6.0) between AGTCCACCAC...GACAAGGGGT:W4(V549_D-1) and T:W-1(V637_D-1) removing vertex T:W-1(V637_D-1) was concatenated into AGTCCACCAC...ACAAGGGGTT:W4(V549_D-1) Want to move edge Edge(637->638,w:6.0)(T:W-1(V637_D-1)->A:W-1(V638_D-1)) to (AGTCCACCAC...ACAAGGGGTT:W4(V549_D-1)->A:W-1(V638_D-1) adding edge: AGTCCACCAC...ACAAGGGGTT:W4(V549_D-1) to A:W-1(V638_D-1) removing edge Edge(637->638,w:6.0)(T:W-1(V637_D-1)->A:W-1(V638_D-1)) removing edge Edge(549->637,w:6.0)(AGTCCACCAC...ACAAGGGGTT:W4(V549_D-1)->T:W-1(V637_D-1)) Found potential edge: Edge(549->638,w:6.0) between AGTCCACCAC...ACAAGGGGTT:W4(V549_D-1) and A:W-1(V638_D-1) removing vertex A:W-1(V638_D-1) was concatenated into AGTCCACCAC...CAAGGGGTTA:W4(V549_D-1) Want to move edge Edge(638->639,w:6.0)(A:W-1(V638_D-1)->G:W-1(V639_D-1)) to (AGTCCACCAC...CAAGGGGTTA:W4(V549_D-1)->G:W-1(V639_D-1) adding edge: AGTCCACCAC...CAAGGGGTTA:W4(V549_D-1) to G:W-1(V639_D-1) removing edge Edge(638->639,w:6.0)(A:W-1(V638_D-1)->G:W-1(V639_D-1)) removing edge Edge(549->638,w:6.0)(AGTCCACCAC...CAAGGGGTTA:W4(V549_D-1)->A:W-1(V638_D-1)) Found potential edge: Edge(549->639,w:6.0) between AGTCCACCAC...CAAGGGGTTA:W4(V549_D-1) and G:W-1(V639_D-1) removing vertex G:W-1(V639_D-1) was concatenated into AGTCCACCAC...AAGGGGTTAG:W4(V549_D-1) Want to move edge Edge(639->640,w:8.0)(G:W-1(V639_D-1)->T:W-1(V640_D-1)) to (AGTCCACCAC...AAGGGGTTAG:W4(V549_D-1)->T:W-1(V640_D-1) adding edge: AGTCCACCAC...AAGGGGTTAG:W4(V549_D-1) to T:W-1(V640_D-1) removing edge Edge(639->640,w:8.0)(G:W-1(V639_D-1)->T:W-1(V640_D-1)) removing edge Edge(549->639,w:6.0)(AGTCCACCAC...AAGGGGTTAG:W4(V549_D-1)->G:W-1(V639_D-1)) Found potential edge: Edge(549->640,w:8.0) between AGTCCACCAC...AAGGGGTTAG:W4(V549_D-1) and T:W-1(V640_D-1) removing vertex T:W-1(V640_D-1) was concatenated into AGTCCACCAC...AGGGGTTAGT:W4(V549_D-1) Want to move edge Edge(640->641,w:8.0)(T:W-1(V640_D-1)->G:W-1(V641_D-1)) to (AGTCCACCAC...AGGGGTTAGT:W4(V549_D-1)->G:W-1(V641_D-1) adding edge: AGTCCACCAC...AGGGGTTAGT:W4(V549_D-1) to G:W-1(V641_D-1) removing edge Edge(640->641,w:8.0)(T:W-1(V640_D-1)->G:W-1(V641_D-1)) removing edge Edge(549->640,w:8.0)(AGTCCACCAC...AGGGGTTAGT:W4(V549_D-1)->T:W-1(V640_D-1)) Found potential edge: Edge(549->641,w:8.0) between AGTCCACCAC...AGGGGTTAGT:W4(V549_D-1) and G:W-1(V641_D-1) removing vertex G:W-1(V641_D-1) was concatenated into AGTCCACCAC...GGGGTTAGTG:W4(V549_D-1) Want to move edge Edge(641->642,w:8.0)(G:W-1(V641_D-1)->A:W-1(V642_D-1)) to (AGTCCACCAC...GGGGTTAGTG:W4(V549_D-1)->A:W-1(V642_D-1) adding edge: AGTCCACCAC...GGGGTTAGTG:W4(V549_D-1) to A:W-1(V642_D-1) removing edge Edge(641->642,w:8.0)(G:W-1(V641_D-1)->A:W-1(V642_D-1)) removing edge Edge(549->641,w:8.0)(AGTCCACCAC...GGGGTTAGTG:W4(V549_D-1)->G:W-1(V641_D-1)) Found potential edge: Edge(549->642,w:8.0) between AGTCCACCAC...GGGGTTAGTG:W4(V549_D-1) and A:W-1(V642_D-1) removing vertex A:W-1(V642_D-1) was concatenated into AGTCCACCAC...GGGTTAGTGA:W4(V549_D-1) Want to move edge Edge(642->643,w:8.0)(A:W-1(V642_D-1)->C:W-1(V643_D-1)) to (AGTCCACCAC...GGGTTAGTGA:W4(V549_D-1)->C:W-1(V643_D-1) adding edge: AGTCCACCAC...GGGTTAGTGA:W4(V549_D-1) to C:W-1(V643_D-1) removing edge Edge(642->643,w:8.0)(A:W-1(V642_D-1)->C:W-1(V643_D-1)) removing edge Edge(549->642,w:8.0)(AGTCCACCAC...GGGTTAGTGA:W4(V549_D-1)->A:W-1(V642_D-1)) Found potential edge: Edge(549->643,w:8.0) between AGTCCACCAC...GGGTTAGTGA:W4(V549_D-1) and C:W-1(V643_D-1) removing vertex C:W-1(V643_D-1) was concatenated into AGTCCACCAC...GGTTAGTGAC:W4(V549_D-1) Want to move edge Edge(643->644,w:8.0)(C:W-1(V643_D-1)->A:W-1(V644_D-1)) to (AGTCCACCAC...GGTTAGTGAC:W4(V549_D-1)->A:W-1(V644_D-1) adding edge: AGTCCACCAC...GGTTAGTGAC:W4(V549_D-1) to A:W-1(V644_D-1) removing edge Edge(643->644,w:8.0)(C:W-1(V643_D-1)->A:W-1(V644_D-1)) removing edge Edge(549->643,w:8.0)(AGTCCACCAC...GGTTAGTGAC:W4(V549_D-1)->C:W-1(V643_D-1)) Found potential edge: Edge(549->644,w:8.0) between AGTCCACCAC...GGTTAGTGAC:W4(V549_D-1) and A:W-1(V644_D-1) removing vertex A:W-1(V644_D-1) was concatenated into AGTCCACCAC...GTTAGTGACA:W4(V549_D-1) Want to move edge Edge(644->645,w:8.0)(A:W-1(V644_D-1)->A:W-1(V645_D-1)) to (AGTCCACCAC...GTTAGTGACA:W4(V549_D-1)->A:W-1(V645_D-1) adding edge: AGTCCACCAC...GTTAGTGACA:W4(V549_D-1) to A:W-1(V645_D-1) removing edge Edge(644->645,w:8.0)(A:W-1(V644_D-1)->A:W-1(V645_D-1)) removing edge Edge(549->644,w:8.0)(AGTCCACCAC...GTTAGTGACA:W4(V549_D-1)->A:W-1(V644_D-1)) Found potential edge: Edge(549->645,w:8.0) between AGTCCACCAC...GTTAGTGACA:W4(V549_D-1) and A:W-1(V645_D-1) removing vertex A:W-1(V645_D-1) was concatenated into AGTCCACCAC...TTAGTGACAA:W4(V549_D-1) Want to move edge Edge(645->646,w:8.0)(A:W-1(V645_D-1)->A:W-1(V646_D-1)) to (AGTCCACCAC...TTAGTGACAA:W4(V549_D-1)->A:W-1(V646_D-1) adding edge: AGTCCACCAC...TTAGTGACAA:W4(V549_D-1) to A:W-1(V646_D-1) removing edge Edge(645->646,w:8.0)(A:W-1(V645_D-1)->A:W-1(V646_D-1)) removing edge Edge(549->645,w:8.0)(AGTCCACCAC...TTAGTGACAA:W4(V549_D-1)->A:W-1(V645_D-1)) Found potential edge: Edge(549->646,w:8.0) between AGTCCACCAC...TTAGTGACAA:W4(V549_D-1) and A:W-1(V646_D-1) removing vertex A:W-1(V646_D-1) was concatenated into AGTCCACCAC...TAGTGACAAA:W4(V549_D-1) Want to move edge Edge(646->647,w:8.0)(A:W-1(V646_D-1)->G:W-1(V647_D-1)) to (AGTCCACCAC...TAGTGACAAA:W4(V549_D-1)->G:W-1(V647_D-1) adding edge: AGTCCACCAC...TAGTGACAAA:W4(V549_D-1) to G:W-1(V647_D-1) removing edge Edge(646->647,w:8.0)(A:W-1(V646_D-1)->G:W-1(V647_D-1)) removing edge Edge(549->646,w:8.0)(AGTCCACCAC...TAGTGACAAA:W4(V549_D-1)->A:W-1(V646_D-1)) Found potential edge: Edge(549->647,w:8.0) between AGTCCACCAC...TAGTGACAAA:W4(V549_D-1) and G:W-1(V647_D-1) removing vertex G:W-1(V647_D-1) was concatenated into AGTCCACCAC...AGTGACAAAG:W4(V549_D-1) Want to move edge Edge(647->648,w:8.0)(G:W-1(V647_D-1)->T:W-1(V648_D-1)) to (AGTCCACCAC...AGTGACAAAG:W4(V549_D-1)->T:W-1(V648_D-1) adding edge: AGTCCACCAC...AGTGACAAAG:W4(V549_D-1) to T:W-1(V648_D-1) removing edge Edge(647->648,w:8.0)(G:W-1(V647_D-1)->T:W-1(V648_D-1)) removing edge Edge(549->647,w:8.0)(AGTCCACCAC...AGTGACAAAG:W4(V549_D-1)->G:W-1(V647_D-1)) Found potential edge: Edge(549->648,w:8.0) between AGTCCACCAC...AGTGACAAAG:W4(V549_D-1) and T:W-1(V648_D-1) removing vertex T:W-1(V648_D-1) was concatenated into AGTCCACCAC...GTGACAAAGT:W4(V549_D-1) Want to move edge Edge(648->649,w:8.0)(T:W-1(V648_D-1)->A:W-1(V649_D-1)) to (AGTCCACCAC...GTGACAAAGT:W4(V549_D-1)->A:W-1(V649_D-1) adding edge: AGTCCACCAC...GTGACAAAGT:W4(V549_D-1) to A:W-1(V649_D-1) removing edge Edge(648->649,w:8.0)(T:W-1(V648_D-1)->A:W-1(V649_D-1)) removing edge Edge(549->648,w:8.0)(AGTCCACCAC...GTGACAAAGT:W4(V549_D-1)->T:W-1(V648_D-1)) Found potential edge: Edge(549->649,w:8.0) between AGTCCACCAC...GTGACAAAGT:W4(V549_D-1) and A:W-1(V649_D-1) removing vertex A:W-1(V649_D-1) was concatenated into AGTCCACCAC...TGACAAAGTA:W4(V549_D-1) Want to move edge Edge(649->650,w:8.0)(A:W-1(V649_D-1)->A:W-1(V650_D-1)) to (AGTCCACCAC...TGACAAAGTA:W4(V549_D-1)->A:W-1(V650_D-1) adding edge: AGTCCACCAC...TGACAAAGTA:W4(V549_D-1) to A:W-1(V650_D-1) removing edge Edge(649->650,w:8.0)(A:W-1(V649_D-1)->A:W-1(V650_D-1)) removing edge Edge(549->649,w:8.0)(AGTCCACCAC...TGACAAAGTA:W4(V549_D-1)->A:W-1(V649_D-1)) Found potential edge: Edge(549->650,w:8.0) between AGTCCACCAC...TGACAAAGTA:W4(V549_D-1) and A:W-1(V650_D-1) removing vertex A:W-1(V650_D-1) was concatenated into AGTCCACCAC...GACAAAGTAA:W4(V549_D-1) Want to move edge Edge(650->651,w:8.0)(A:W-1(V650_D-1)->A:W-1(V651_D-1)) to (AGTCCACCAC...GACAAAGTAA:W4(V549_D-1)->A:W-1(V651_D-1) adding edge: AGTCCACCAC...GACAAAGTAA:W4(V549_D-1) to A:W-1(V651_D-1) removing edge Edge(650->651,w:8.0)(A:W-1(V650_D-1)->A:W-1(V651_D-1)) removing edge Edge(549->650,w:8.0)(AGTCCACCAC...GACAAAGTAA:W4(V549_D-1)->A:W-1(V650_D-1)) Found potential edge: Edge(549->651,w:8.0) between AGTCCACCAC...GACAAAGTAA:W4(V549_D-1) and A:W-1(V651_D-1) removing vertex A:W-1(V651_D-1) was concatenated into AGTCCACCAC...ACAAAGTAAA:W5(V549_D-1) Want to move edge Edge(651->652,w:8.0)(A:W-1(V651_D-1)->G:W-1(V652_D-1)) to (AGTCCACCAC...ACAAAGTAAA:W5(V549_D-1)->G:W-1(V652_D-1) adding edge: AGTCCACCAC...ACAAAGTAAA:W5(V549_D-1) to G:W-1(V652_D-1) removing edge Edge(651->652,w:8.0)(A:W-1(V651_D-1)->G:W-1(V652_D-1)) removing edge Edge(549->651,w:8.0)(AGTCCACCAC...ACAAAGTAAA:W5(V549_D-1)->A:W-1(V651_D-1)) Found potential edge: Edge(549->652,w:8.0) between AGTCCACCAC...ACAAAGTAAA:W5(V549_D-1) and G:W-1(V652_D-1) removing vertex G:W-1(V652_D-1) was concatenated into AGTCCACCAC...CAAAGTAAAG:W5(V549_D-1) Want to move edge Edge(652->653,w:8.0)(G:W-1(V652_D-1)->A:W-1(V653_D-1)) to (AGTCCACCAC...CAAAGTAAAG:W5(V549_D-1)->A:W-1(V653_D-1) adding edge: AGTCCACCAC...CAAAGTAAAG:W5(V549_D-1) to A:W-1(V653_D-1) removing edge Edge(652->653,w:8.0)(G:W-1(V652_D-1)->A:W-1(V653_D-1)) removing edge Edge(549->652,w:8.0)(AGTCCACCAC...CAAAGTAAAG:W5(V549_D-1)->G:W-1(V652_D-1)) Found potential edge: Edge(549->653,w:8.0) between AGTCCACCAC...CAAAGTAAAG:W5(V549_D-1) and A:W-1(V653_D-1) removing vertex A:W-1(V653_D-1) was concatenated into AGTCCACCAC...AAAGTAAAGA:W5(V549_D-1) Want to move edge Edge(653->654,w:8.0)(A:W-1(V653_D-1)->G:W-1(V654_D-1)) to (AGTCCACCAC...AAAGTAAAGA:W5(V549_D-1)->G:W-1(V654_D-1) adding edge: AGTCCACCAC...AAAGTAAAGA:W5(V549_D-1) to G:W-1(V654_D-1) removing edge Edge(653->654,w:8.0)(A:W-1(V653_D-1)->G:W-1(V654_D-1)) removing edge Edge(549->653,w:8.0)(AGTCCACCAC...AAAGTAAAGA:W5(V549_D-1)->A:W-1(V653_D-1)) Found potential edge: Edge(549->654,w:8.0) between AGTCCACCAC...AAAGTAAAGA:W5(V549_D-1) and G:W-1(V654_D-1) removing vertex G:W-1(V654_D-1) was concatenated into AGTCCACCAC...AAGTAAAGAG:W5(V549_D-1) Want to move edge Edge(654->655,w:10.0)(G:W-1(V654_D-1)->G:W-1(V655_D-1)) to (AGTCCACCAC...AAGTAAAGAG:W5(V549_D-1)->G:W-1(V655_D-1) adding edge: AGTCCACCAC...AAGTAAAGAG:W5(V549_D-1) to G:W-1(V655_D-1) removing edge Edge(654->655,w:10.0)(G:W-1(V654_D-1)->G:W-1(V655_D-1)) removing edge Edge(549->654,w:8.0)(AGTCCACCAC...AAGTAAAGAG:W5(V549_D-1)->G:W-1(V654_D-1)) Found potential edge: Edge(549->655,w:10.0) between AGTCCACCAC...AAGTAAAGAG:W5(V549_D-1) and G:W-1(V655_D-1) removing vertex G:W-1(V655_D-1) was concatenated into AGTCCACCAC...AGTAAAGAGG:W5(V549_D-1) Want to move edge Edge(655->656,w:10.0)(G:W-1(V655_D-1)->A:W-1(V656_D-1)) to (AGTCCACCAC...AGTAAAGAGG:W5(V549_D-1)->A:W-1(V656_D-1) adding edge: AGTCCACCAC...AGTAAAGAGG:W5(V549_D-1) to A:W-1(V656_D-1) removing edge Edge(655->656,w:10.0)(G:W-1(V655_D-1)->A:W-1(V656_D-1)) removing edge Edge(549->655,w:10.0)(AGTCCACCAC...AGTAAAGAGG:W5(V549_D-1)->G:W-1(V655_D-1)) Found potential edge: Edge(549->656,w:10.0) between AGTCCACCAC...AGTAAAGAGG:W5(V549_D-1) and A:W-1(V656_D-1) removing vertex A:W-1(V656_D-1) was concatenated into AGTCCACCAC...GTAAAGAGGA:W5(V549_D-1) Want to move edge Edge(656->657,w:10.0)(A:W-1(V656_D-1)->T:W-1(V657_D-1)) to (AGTCCACCAC...GTAAAGAGGA:W5(V549_D-1)->T:W-1(V657_D-1) adding edge: AGTCCACCAC...GTAAAGAGGA:W5(V549_D-1) to T:W-1(V657_D-1) removing edge Edge(656->657,w:10.0)(A:W-1(V656_D-1)->T:W-1(V657_D-1)) removing edge Edge(549->656,w:10.0)(AGTCCACCAC...GTAAAGAGGA:W5(V549_D-1)->A:W-1(V656_D-1)) Found potential edge: Edge(549->657,w:10.0) between AGTCCACCAC...GTAAAGAGGA:W5(V549_D-1) and T:W-1(V657_D-1) removing vertex T:W-1(V657_D-1) was concatenated into AGTCCACCAC...TAAAGAGGAT:W5(V549_D-1) Want to move edge Edge(657->658,w:12.0)(T:W-1(V657_D-1)->G:W-1(V658_D-1)) to (AGTCCACCAC...TAAAGAGGAT:W5(V549_D-1)->G:W-1(V658_D-1) adding edge: AGTCCACCAC...TAAAGAGGAT:W5(V549_D-1) to G:W-1(V658_D-1) removing edge Edge(657->658,w:12.0)(T:W-1(V657_D-1)->G:W-1(V658_D-1)) removing edge Edge(549->657,w:10.0)(AGTCCACCAC...TAAAGAGGAT:W5(V549_D-1)->T:W-1(V657_D-1)) Found potential edge: Edge(549->658,w:12.0) between AGTCCACCAC...TAAAGAGGAT:W5(V549_D-1) and G:W-1(V658_D-1) removing vertex G:W-1(V658_D-1) was concatenated into AGTCCACCAC...AAAGAGGATG:W5(V549_D-1) Want to move edge Edge(658->659,w:10.0)(G:W-1(V658_D-1)->A:W-1(V659_D-1)) to (AGTCCACCAC...AAAGAGGATG:W5(V549_D-1)->A:W-1(V659_D-1) adding edge: AGTCCACCAC...AAAGAGGATG:W5(V549_D-1) to A:W-1(V659_D-1) removing edge Edge(658->659,w:10.0)(G:W-1(V658_D-1)->A:W-1(V659_D-1)) removing edge Edge(549->658,w:12.0)(AGTCCACCAC...AAAGAGGATG:W5(V549_D-1)->G:W-1(V658_D-1)) Found potential edge: Edge(549->659,w:10.0) between AGTCCACCAC...AAAGAGGATG:W5(V549_D-1) and A:W-1(V659_D-1) removing vertex A:W-1(V659_D-1) was concatenated into AGTCCACCAC...AAGAGGATGA:W5(V549_D-1) Want to move edge Edge(659->660,w:10.0)(A:W-1(V659_D-1)->C:W-1(V660_D-1)) to (AGTCCACCAC...AAGAGGATGA:W5(V549_D-1)->C:W-1(V660_D-1) adding edge: AGTCCACCAC...AAGAGGATGA:W5(V549_D-1) to C:W-1(V660_D-1) removing edge Edge(659->660,w:10.0)(A:W-1(V659_D-1)->C:W-1(V660_D-1)) removing edge Edge(549->659,w:10.0)(AGTCCACCAC...AAGAGGATGA:W5(V549_D-1)->A:W-1(V659_D-1)) Found potential edge: Edge(549->660,w:10.0) between AGTCCACCAC...AAGAGGATGA:W5(V549_D-1) and C:W-1(V660_D-1) removing vertex C:W-1(V660_D-1) was concatenated into AGTCCACCAC...AGAGGATGAC:W5(V549_D-1) Want to move edge Edge(660->661,w:10.0)(C:W-1(V660_D-1)->A:W-1(V661_D-1)) to (AGTCCACCAC...AGAGGATGAC:W5(V549_D-1)->A:W-1(V661_D-1) adding edge: AGTCCACCAC...AGAGGATGAC:W5(V549_D-1) to A:W-1(V661_D-1) removing edge Edge(660->661,w:10.0)(C:W-1(V660_D-1)->A:W-1(V661_D-1)) removing edge Edge(549->660,w:10.0)(AGTCCACCAC...AGAGGATGAC:W5(V549_D-1)->C:W-1(V660_D-1)) Found potential edge: Edge(549->661,w:10.0) between AGTCCACCAC...AGAGGATGAC:W5(V549_D-1) and A:W-1(V661_D-1) removing vertex A:W-1(V661_D-1) was concatenated into AGTCCACCAC...GAGGATGACA:W5(V549_D-1) Want to move edge Edge(661->662,w:10.0)(A:W-1(V661_D-1)->G:W-1(V662_D-1)) to (AGTCCACCAC...GAGGATGACA:W5(V549_D-1)->G:W-1(V662_D-1) adding edge: AGTCCACCAC...GAGGATGACA:W5(V549_D-1) to G:W-1(V662_D-1) removing edge Edge(661->662,w:10.0)(A:W-1(V661_D-1)->G:W-1(V662_D-1)) removing edge Edge(549->661,w:10.0)(AGTCCACCAC...GAGGATGACA:W5(V549_D-1)->A:W-1(V661_D-1)) Found potential edge: Edge(549->662,w:10.0) between AGTCCACCAC...GAGGATGACA:W5(V549_D-1) and G:W-1(V662_D-1) removing vertex G:W-1(V662_D-1) was concatenated into AGTCCACCAC...AGGATGACAG:W5(V549_D-1) Want to move edge Edge(662->663,w:10.0)(G:W-1(V662_D-1)->A:W-1(V663_D-1)) to (AGTCCACCAC...AGGATGACAG:W5(V549_D-1)->A:W-1(V663_D-1) adding edge: AGTCCACCAC...AGGATGACAG:W5(V549_D-1) to A:W-1(V663_D-1) removing edge Edge(662->663,w:10.0)(G:W-1(V662_D-1)->A:W-1(V663_D-1)) removing edge Edge(549->662,w:10.0)(AGTCCACCAC...AGGATGACAG:W5(V549_D-1)->G:W-1(V662_D-1)) Found potential edge: Edge(549->663,w:10.0) between AGTCCACCAC...AGGATGACAG:W5(V549_D-1) and A:W-1(V663_D-1) removing vertex A:W-1(V663_D-1) was concatenated into AGTCCACCAC...GGATGACAGA:W5(V549_D-1) Want to move edge Edge(663->664,w:10.0)(A:W-1(V663_D-1)->C:W-1(V664_D-1)) to (AGTCCACCAC...GGATGACAGA:W5(V549_D-1)->C:W-1(V664_D-1) adding edge: AGTCCACCAC...GGATGACAGA:W5(V549_D-1) to C:W-1(V664_D-1) removing edge Edge(663->664,w:10.0)(A:W-1(V663_D-1)->C:W-1(V664_D-1)) removing edge Edge(549->663,w:10.0)(AGTCCACCAC...GGATGACAGA:W5(V549_D-1)->A:W-1(V663_D-1)) Found potential edge: Edge(549->664,w:10.0) between AGTCCACCAC...GGATGACAGA:W5(V549_D-1) and C:W-1(V664_D-1) removing vertex C:W-1(V664_D-1) was concatenated into AGTCCACCAC...GATGACAGAC:W5(V549_D-1) Want to move edge Edge(664->665,w:8.0)(C:W-1(V664_D-1)->T:W-1(V665_D-1)) to (AGTCCACCAC...GATGACAGAC:W5(V549_D-1)->T:W-1(V665_D-1) adding edge: AGTCCACCAC...GATGACAGAC:W5(V549_D-1) to T:W-1(V665_D-1) removing edge Edge(664->665,w:8.0)(C:W-1(V664_D-1)->T:W-1(V665_D-1)) removing edge Edge(549->664,w:10.0)(AGTCCACCAC...GATGACAGAC:W5(V549_D-1)->C:W-1(V664_D-1)) Found potential edge: Edge(549->665,w:8.0) between AGTCCACCAC...GATGACAGAC:W5(V549_D-1) and T:W-1(V665_D-1) removing vertex T:W-1(V665_D-1) was concatenated into AGTCCACCAC...ATGACAGACT:W5(V549_D-1) Want to move edge Edge(665->666,w:8.0)(T:W-1(V665_D-1)->C:W-1(V666_D-1)) to (AGTCCACCAC...ATGACAGACT:W5(V549_D-1)->C:W-1(V666_D-1) adding edge: AGTCCACCAC...ATGACAGACT:W5(V549_D-1) to C:W-1(V666_D-1) removing edge Edge(665->666,w:8.0)(T:W-1(V665_D-1)->C:W-1(V666_D-1)) removing edge Edge(549->665,w:8.0)(AGTCCACCAC...ATGACAGACT:W5(V549_D-1)->T:W-1(V665_D-1)) Found potential edge: Edge(549->666,w:8.0) between AGTCCACCAC...ATGACAGACT:W5(V549_D-1) and C:W-1(V666_D-1) removing vertex C:W-1(V666_D-1) was concatenated into AGTCCACCAC...TGACAGACTC:W5(V549_D-1) Want to move edge Edge(666->667,w:8.0)(C:W-1(V666_D-1)->T:W-1(V667_D-1)) to (AGTCCACCAC...TGACAGACTC:W5(V549_D-1)->T:W-1(V667_D-1) adding edge: AGTCCACCAC...TGACAGACTC:W5(V549_D-1) to T:W-1(V667_D-1) removing edge Edge(666->667,w:8.0)(C:W-1(V666_D-1)->T:W-1(V667_D-1)) removing edge Edge(549->666,w:8.0)(AGTCCACCAC...TGACAGACTC:W5(V549_D-1)->C:W-1(V666_D-1)) Found potential edge: Edge(549->667,w:8.0) between AGTCCACCAC...TGACAGACTC:W5(V549_D-1) and T:W-1(V667_D-1) removing vertex T:W-1(V667_D-1) was concatenated into AGTCCACCAC...GACAGACTCT:W5(V549_D-1) Want to move edge Edge(667->668,w:8.0)(T:W-1(V667_D-1)->C:W-1(V668_D-1)) to (AGTCCACCAC...GACAGACTCT:W5(V549_D-1)->C:W-1(V668_D-1) adding edge: AGTCCACCAC...GACAGACTCT:W5(V549_D-1) to C:W-1(V668_D-1) removing edge Edge(667->668,w:8.0)(T:W-1(V667_D-1)->C:W-1(V668_D-1)) removing edge Edge(549->667,w:8.0)(AGTCCACCAC...GACAGACTCT:W5(V549_D-1)->T:W-1(V667_D-1)) Found potential edge: Edge(549->668,w:8.0) between AGTCCACCAC...GACAGACTCT:W5(V549_D-1) and C:W-1(V668_D-1) removing vertex C:W-1(V668_D-1) was concatenated into AGTCCACCAC...ACAGACTCTC:W5(V549_D-1) Want to move edge Edge(668->669,w:8.0)(C:W-1(V668_D-1)->T:W-1(V669_D-1)) to (AGTCCACCAC...ACAGACTCTC:W5(V549_D-1)->T:W-1(V669_D-1) adding edge: AGTCCACCAC...ACAGACTCTC:W5(V549_D-1) to T:W-1(V669_D-1) removing edge Edge(668->669,w:8.0)(C:W-1(V668_D-1)->T:W-1(V669_D-1)) removing edge Edge(549->668,w:8.0)(AGTCCACCAC...ACAGACTCTC:W5(V549_D-1)->C:W-1(V668_D-1)) Found potential edge: Edge(549->669,w:8.0) between AGTCCACCAC...ACAGACTCTC:W5(V549_D-1) and T:W-1(V669_D-1) removing vertex T:W-1(V669_D-1) was concatenated into AGTCCACCAC...CAGACTCTCT:W5(V549_D-1) Want to move edge Edge(669->670,w:8.0)(T:W-1(V669_D-1)->A:W-1(V670_D-1)) to (AGTCCACCAC...CAGACTCTCT:W5(V549_D-1)->A:W-1(V670_D-1) adding edge: AGTCCACCAC...CAGACTCTCT:W5(V549_D-1) to A:W-1(V670_D-1) removing edge Edge(669->670,w:8.0)(T:W-1(V669_D-1)->A:W-1(V670_D-1)) removing edge Edge(549->669,w:8.0)(AGTCCACCAC...CAGACTCTCT:W5(V549_D-1)->T:W-1(V669_D-1)) Found potential edge: Edge(549->670,w:8.0) between AGTCCACCAC...CAGACTCTCT:W5(V549_D-1) and A:W-1(V670_D-1) removing vertex A:W-1(V670_D-1) was concatenated into AGTCCACCAC...AGACTCTCTA:W5(V549_D-1) Want to move edge Edge(670->671,w:8.0)(A:W-1(V670_D-1)->A:W-1(V671_D-1)) to (AGTCCACCAC...AGACTCTCTA:W5(V549_D-1)->A:W-1(V671_D-1) adding edge: AGTCCACCAC...AGACTCTCTA:W5(V549_D-1) to A:W-1(V671_D-1) removing edge Edge(670->671,w:8.0)(A:W-1(V670_D-1)->A:W-1(V671_D-1)) removing edge Edge(549->670,w:8.0)(AGTCCACCAC...AGACTCTCTA:W5(V549_D-1)->A:W-1(V670_D-1)) Found potential edge: Edge(549->671,w:8.0) between AGTCCACCAC...AGACTCTCTA:W5(V549_D-1) and A:W-1(V671_D-1) removing vertex A:W-1(V671_D-1) was concatenated into AGTCCACCAC...GACTCTCTAA:W5(V549_D-1) Want to move edge Edge(671->672,w:8.0)(A:W-1(V671_D-1)->G:W-1(V672_D-1)) to (AGTCCACCAC...GACTCTCTAA:W5(V549_D-1)->G:W-1(V672_D-1) adding edge: AGTCCACCAC...GACTCTCTAA:W5(V549_D-1) to G:W-1(V672_D-1) removing edge Edge(671->672,w:8.0)(A:W-1(V671_D-1)->G:W-1(V672_D-1)) removing edge Edge(549->671,w:8.0)(AGTCCACCAC...GACTCTCTAA:W5(V549_D-1)->A:W-1(V671_D-1)) Found potential edge: Edge(549->672,w:8.0) between AGTCCACCAC...GACTCTCTAA:W5(V549_D-1) and G:W-1(V672_D-1) removing vertex G:W-1(V672_D-1) was concatenated into AGTCCACCAC...ACTCTCTAAG:W5(V549_D-1) Want to move edge Edge(672->673,w:8.0)(G:W-1(V672_D-1)->G:W-1(V673_D-1)) to (AGTCCACCAC...ACTCTCTAAG:W5(V549_D-1)->G:W-1(V673_D-1) adding edge: AGTCCACCAC...ACTCTCTAAG:W5(V549_D-1) to G:W-1(V673_D-1) removing edge Edge(672->673,w:8.0)(G:W-1(V672_D-1)->G:W-1(V673_D-1)) removing edge Edge(549->672,w:8.0)(AGTCCACCAC...ACTCTCTAAG:W5(V549_D-1)->G:W-1(V672_D-1)) Found potential edge: Edge(549->673,w:8.0) between AGTCCACCAC...ACTCTCTAAG:W5(V549_D-1) and G:W-1(V673_D-1) removing vertex G:W-1(V673_D-1) was concatenated into AGTCCACCAC...CTCTCTAAGG:W5(V549_D-1) Want to move edge Edge(673->674,w:8.0)(G:W-1(V673_D-1)->G:W-1(V674_D-1)) to (AGTCCACCAC...CTCTCTAAGG:W5(V549_D-1)->G:W-1(V674_D-1) adding edge: AGTCCACCAC...CTCTCTAAGG:W5(V549_D-1) to G:W-1(V674_D-1) removing edge Edge(673->674,w:8.0)(G:W-1(V673_D-1)->G:W-1(V674_D-1)) removing edge Edge(549->673,w:8.0)(AGTCCACCAC...CTCTCTAAGG:W5(V549_D-1)->G:W-1(V673_D-1)) Found potential edge: Edge(549->674,w:8.0) between AGTCCACCAC...CTCTCTAAGG:W5(V549_D-1) and G:W-1(V674_D-1) removing vertex G:W-1(V674_D-1) was concatenated into AGTCCACCAC...TCTCTAAGGG:W5(V549_D-1) Want to move edge Edge(674->675,w:8.0)(G:W-1(V674_D-1)->A:W-1(V675_D-1)) to (AGTCCACCAC...TCTCTAAGGG:W5(V549_D-1)->A:W-1(V675_D-1) adding edge: AGTCCACCAC...TCTCTAAGGG:W5(V549_D-1) to A:W-1(V675_D-1) removing edge Edge(674->675,w:8.0)(G:W-1(V674_D-1)->A:W-1(V675_D-1)) removing edge Edge(549->674,w:8.0)(AGTCCACCAC...TCTCTAAGGG:W5(V549_D-1)->G:W-1(V674_D-1)) Found potential edge: Edge(549->675,w:8.0) between AGTCCACCAC...TCTCTAAGGG:W5(V549_D-1) and A:W-1(V675_D-1) removing vertex A:W-1(V675_D-1) was concatenated into AGTCCACCAC...CTCTAAGGGA:W5(V549_D-1) Want to move edge Edge(675->676,w:8.0)(A:W-1(V675_D-1)->C:W-1(V676_D-1)) to (AGTCCACCAC...CTCTAAGGGA:W5(V549_D-1)->C:W-1(V676_D-1) adding edge: AGTCCACCAC...CTCTAAGGGA:W5(V549_D-1) to C:W-1(V676_D-1) removing edge Edge(675->676,w:8.0)(A:W-1(V675_D-1)->C:W-1(V676_D-1)) removing edge Edge(549->675,w:8.0)(AGTCCACCAC...CTCTAAGGGA:W5(V549_D-1)->A:W-1(V675_D-1)) Found potential edge: Edge(549->676,w:8.0) between AGTCCACCAC...CTCTAAGGGA:W5(V549_D-1) and C:W-1(V676_D-1) removing vertex C:W-1(V676_D-1) was concatenated into AGTCCACCAC...TCTAAGGGAC:W5(V549_D-1) Want to move edge Edge(676->677,w:8.0)(C:W-1(V676_D-1)->A:W-1(V677_D-1)) to (AGTCCACCAC...TCTAAGGGAC:W5(V549_D-1)->A:W-1(V677_D-1) adding edge: AGTCCACCAC...TCTAAGGGAC:W5(V549_D-1) to A:W-1(V677_D-1) removing edge Edge(676->677,w:8.0)(C:W-1(V676_D-1)->A:W-1(V677_D-1)) removing edge Edge(549->676,w:8.0)(AGTCCACCAC...TCTAAGGGAC:W5(V549_D-1)->C:W-1(V676_D-1)) Found potential edge: Edge(549->677,w:8.0) between AGTCCACCAC...TCTAAGGGAC:W5(V549_D-1) and A:W-1(V677_D-1) removing vertex A:W-1(V677_D-1) was concatenated into AGTCCACCAC...CTAAGGGACA:W5(V549_D-1) Want to move edge Edge(677->678,w:8.0)(A:W-1(V677_D-1)->T:W-1(V678_D-1)) to (AGTCCACCAC...CTAAGGGACA:W5(V549_D-1)->T:W-1(V678_D-1) adding edge: AGTCCACCAC...CTAAGGGACA:W5(V549_D-1) to T:W-1(V678_D-1) removing edge Edge(677->678,w:8.0)(A:W-1(V677_D-1)->T:W-1(V678_D-1)) removing edge Edge(549->677,w:8.0)(AGTCCACCAC...CTAAGGGACA:W5(V549_D-1)->A:W-1(V677_D-1)) Found potential edge: Edge(549->678,w:8.0) between AGTCCACCAC...CTAAGGGACA:W5(V549_D-1) and T:W-1(V678_D-1) removing vertex T:W-1(V678_D-1) was concatenated into AGTCCACCAC...TAAGGGACAT:W5(V549_D-1) Want to move edge Edge(678->679,w:8.0)(T:W-1(V678_D-1)->A:W-1(V679_D-1)) to (AGTCCACCAC...TAAGGGACAT:W5(V549_D-1)->A:W-1(V679_D-1) adding edge: AGTCCACCAC...TAAGGGACAT:W5(V549_D-1) to A:W-1(V679_D-1) removing edge Edge(678->679,w:8.0)(T:W-1(V678_D-1)->A:W-1(V679_D-1)) removing edge Edge(549->678,w:8.0)(AGTCCACCAC...TAAGGGACAT:W5(V549_D-1)->T:W-1(V678_D-1)) Found potential edge: Edge(549->679,w:8.0) between AGTCCACCAC...TAAGGGACAT:W5(V549_D-1) and A:W-1(V679_D-1) removing vertex A:W-1(V679_D-1) was concatenated into AGTCCACCAC...AAGGGACATA:W5(V549_D-1) Want to move edge Edge(679->680,w:8.0)(A:W-1(V679_D-1)->T:W-1(V680_D-1)) to (AGTCCACCAC...AAGGGACATA:W5(V549_D-1)->T:W-1(V680_D-1) adding edge: AGTCCACCAC...AAGGGACATA:W5(V549_D-1) to T:W-1(V680_D-1) removing edge Edge(679->680,w:8.0)(A:W-1(V679_D-1)->T:W-1(V680_D-1)) removing edge Edge(549->679,w:8.0)(AGTCCACCAC...AAGGGACATA:W5(V549_D-1)->A:W-1(V679_D-1)) Found potential edge: Edge(549->680,w:8.0) between AGTCCACCAC...AAGGGACATA:W5(V549_D-1) and T:W-1(V680_D-1) removing vertex T:W-1(V680_D-1) was concatenated into AGTCCACCAC...AGGGACATAT:W5(V549_D-1) Want to move edge Edge(680->681,w:10.0)(T:W-1(V680_D-1)->G:W-1(V681_D-1)) to (AGTCCACCAC...AGGGACATAT:W5(V549_D-1)->G:W-1(V681_D-1) adding edge: AGTCCACCAC...AGGGACATAT:W5(V549_D-1) to G:W-1(V681_D-1) removing edge Edge(680->681,w:10.0)(T:W-1(V680_D-1)->G:W-1(V681_D-1)) removing edge Edge(549->680,w:8.0)(AGTCCACCAC...AGGGACATAT:W5(V549_D-1)->T:W-1(V680_D-1)) Found potential edge: Edge(549->681,w:10.0) between AGTCCACCAC...AGGGACATAT:W5(V549_D-1) and G:W-1(V681_D-1) removing vertex G:W-1(V681_D-1) was concatenated into AGTCCACCAC...GGGACATATG:W6(V549_D-1) Want to move edge Edge(681->682,w:10.0)(G:W-1(V681_D-1)->G:W-1(V682_D-1)) to (AGTCCACCAC...GGGACATATG:W6(V549_D-1)->G:W-1(V682_D-1) adding edge: AGTCCACCAC...GGGACATATG:W6(V549_D-1) to G:W-1(V682_D-1) removing edge Edge(681->682,w:10.0)(G:W-1(V681_D-1)->G:W-1(V682_D-1)) removing edge Edge(549->681,w:10.0)(AGTCCACCAC...GGGACATATG:W6(V549_D-1)->G:W-1(V681_D-1)) Found potential edge: Edge(549->682,w:10.0) between AGTCCACCAC...GGGACATATG:W6(V549_D-1) and G:W-1(V682_D-1) removing vertex G:W-1(V682_D-1) was concatenated into AGTCCACCAC...GGACATATGG:W6(V549_D-1) Want to move edge Edge(682->683,w:10.0)(G:W-1(V682_D-1)->G:W-1(V683_D-1)) to (AGTCCACCAC...GGACATATGG:W6(V549_D-1)->G:W-1(V683_D-1) adding edge: AGTCCACCAC...GGACATATGG:W6(V549_D-1) to G:W-1(V683_D-1) removing edge Edge(682->683,w:10.0)(G:W-1(V682_D-1)->G:W-1(V683_D-1)) removing edge Edge(549->682,w:10.0)(AGTCCACCAC...GGACATATGG:W6(V549_D-1)->G:W-1(V682_D-1)) Found potential edge: Edge(549->683,w:10.0) between AGTCCACCAC...GGACATATGG:W6(V549_D-1) and G:W-1(V683_D-1) removing vertex G:W-1(V683_D-1) was concatenated into AGTCCACCAC...GACATATGGG:W6(V549_D-1) Want to move edge Edge(683->684,w:8.0)(G:W-1(V683_D-1)->A:W-1(V684_D-1)) to (AGTCCACCAC...GACATATGGG:W6(V549_D-1)->A:W-1(V684_D-1) adding edge: AGTCCACCAC...GACATATGGG:W6(V549_D-1) to A:W-1(V684_D-1) removing edge Edge(683->684,w:8.0)(G:W-1(V683_D-1)->A:W-1(V684_D-1)) removing edge Edge(549->683,w:10.0)(AGTCCACCAC...GACATATGGG:W6(V549_D-1)->G:W-1(V683_D-1)) Found potential edge: Edge(549->684,w:8.0) between AGTCCACCAC...GACATATGGG:W6(V549_D-1) and A:W-1(V684_D-1) removing vertex A:W-1(V684_D-1) was concatenated into AGTCCACCAC...ACATATGGGA:W6(V549_D-1) Want to move edge Edge(684->685,w:8.0)(A:W-1(V684_D-1)->G:W-1(V685_D-1)) to (AGTCCACCAC...ACATATGGGA:W6(V549_D-1)->G:W-1(V685_D-1) adding edge: AGTCCACCAC...ACATATGGGA:W6(V549_D-1) to G:W-1(V685_D-1) removing edge Edge(684->685,w:8.0)(A:W-1(V684_D-1)->G:W-1(V685_D-1)) removing edge Edge(549->684,w:8.0)(AGTCCACCAC...ACATATGGGA:W6(V549_D-1)->A:W-1(V684_D-1)) Found potential edge: Edge(549->685,w:8.0) between AGTCCACCAC...ACATATGGGA:W6(V549_D-1) and G:W-1(V685_D-1) removing vertex G:W-1(V685_D-1) was concatenated into AGTCCACCAC...CATATGGGAG:W6(V549_D-1) Want to move edge Edge(685->686,w:8.0)(G:W-1(V685_D-1)->C:W-1(V686_D-1)) to (AGTCCACCAC...CATATGGGAG:W6(V549_D-1)->C:W-1(V686_D-1) adding edge: AGTCCACCAC...CATATGGGAG:W6(V549_D-1) to C:W-1(V686_D-1) removing edge Edge(685->686,w:8.0)(G:W-1(V685_D-1)->C:W-1(V686_D-1)) removing edge Edge(549->685,w:8.0)(AGTCCACCAC...CATATGGGAG:W6(V549_D-1)->G:W-1(V685_D-1)) Found potential edge: Edge(549->686,w:8.0) between AGTCCACCAC...CATATGGGAG:W6(V549_D-1) and C:W-1(V686_D-1) removing vertex C:W-1(V686_D-1) was concatenated into AGTCCACCAC...ATATGGGAGC:W6(V549_D-1) Want to move edge Edge(686->687,w:8.0)(C:W-1(V686_D-1)->T:W-1(V687_D-1)) to (AGTCCACCAC...ATATGGGAGC:W6(V549_D-1)->T:W-1(V687_D-1) adding edge: AGTCCACCAC...ATATGGGAGC:W6(V549_D-1) to T:W-1(V687_D-1) removing edge Edge(686->687,w:8.0)(C:W-1(V686_D-1)->T:W-1(V687_D-1)) removing edge Edge(549->686,w:8.0)(AGTCCACCAC...ATATGGGAGC:W6(V549_D-1)->C:W-1(V686_D-1)) Found potential edge: Edge(549->687,w:8.0) between AGTCCACCAC...ATATGGGAGC:W6(V549_D-1) and T:W-1(V687_D-1) removing vertex T:W-1(V687_D-1) was concatenated into AGTCCACCAC...TATGGGAGCT:W6(V549_D-1) Want to move edge Edge(687->688,w:8.0)(T:W-1(V687_D-1)->A:W-1(V688_D-1)) to (AGTCCACCAC...TATGGGAGCT:W6(V549_D-1)->A:W-1(V688_D-1) adding edge: AGTCCACCAC...TATGGGAGCT:W6(V549_D-1) to A:W-1(V688_D-1) removing edge Edge(687->688,w:8.0)(T:W-1(V687_D-1)->A:W-1(V688_D-1)) removing edge Edge(549->687,w:8.0)(AGTCCACCAC...TATGGGAGCT:W6(V549_D-1)->T:W-1(V687_D-1)) Found potential edge: Edge(549->688,w:8.0) between AGTCCACCAC...TATGGGAGCT:W6(V549_D-1) and A:W-1(V688_D-1) removing vertex A:W-1(V688_D-1) was concatenated into AGTCCACCAC...ATGGGAGCTA:W6(V549_D-1) Want to move edge Edge(688->689,w:6.0)(A:W-1(V688_D-1)->C:W-1(V689_D-1)) to (AGTCCACCAC...ATGGGAGCTA:W6(V549_D-1)->C:W-1(V689_D-1) adding edge: AGTCCACCAC...ATGGGAGCTA:W6(V549_D-1) to C:W-1(V689_D-1) removing edge Edge(688->689,w:6.0)(A:W-1(V688_D-1)->C:W-1(V689_D-1)) removing edge Edge(549->688,w:8.0)(AGTCCACCAC...ATGGGAGCTA:W6(V549_D-1)->A:W-1(V688_D-1)) Found potential edge: Edge(549->689,w:6.0) between AGTCCACCAC...ATGGGAGCTA:W6(V549_D-1) and C:W-1(V689_D-1) removing vertex C:W-1(V689_D-1) was concatenated into AGTCCACCAC...TGGGAGCTAC:W6(V549_D-1) Want to move edge Edge(689->690,w:6.0)(C:W-1(V689_D-1)->A:W-1(V690_D-1)) to (AGTCCACCAC...TGGGAGCTAC:W6(V549_D-1)->A:W-1(V690_D-1) adding edge: AGTCCACCAC...TGGGAGCTAC:W6(V549_D-1) to A:W-1(V690_D-1) removing edge Edge(689->690,w:6.0)(C:W-1(V689_D-1)->A:W-1(V690_D-1)) removing edge Edge(549->689,w:6.0)(AGTCCACCAC...TGGGAGCTAC:W6(V549_D-1)->C:W-1(V689_D-1)) Found potential edge: Edge(549->690,w:6.0) between AGTCCACCAC...TGGGAGCTAC:W6(V549_D-1) and A:W-1(V690_D-1) removing vertex A:W-1(V690_D-1) was concatenated into AGTCCACCAC...GGGAGCTACA:W6(V549_D-1) Want to move edge Edge(690->691,w:6.0)(A:W-1(V690_D-1)->T:W-1(V691_D-1)) to (AGTCCACCAC...GGGAGCTACA:W6(V549_D-1)->T:W-1(V691_D-1) adding edge: AGTCCACCAC...GGGAGCTACA:W6(V549_D-1) to T:W-1(V691_D-1) removing edge Edge(690->691,w:6.0)(A:W-1(V690_D-1)->T:W-1(V691_D-1)) removing edge Edge(549->690,w:6.0)(AGTCCACCAC...GGGAGCTACA:W6(V549_D-1)->A:W-1(V690_D-1)) Found potential edge: Edge(549->691,w:6.0) between AGTCCACCAC...GGGAGCTACA:W6(V549_D-1) and T:W-1(V691_D-1) removing vertex T:W-1(V691_D-1) was concatenated into AGTCCACCAC...GGAGCTACAT:W6(V549_D-1) Want to move edge Edge(691->692,w:4.0)(T:W-1(V691_D-1)->A:W-1(V692_D-1)) to (AGTCCACCAC...GGAGCTACAT:W6(V549_D-1)->A:W-1(V692_D-1) adding edge: AGTCCACCAC...GGAGCTACAT:W6(V549_D-1) to A:W-1(V692_D-1) removing edge Edge(691->692,w:4.0)(T:W-1(V691_D-1)->A:W-1(V692_D-1)) removing edge Edge(549->691,w:6.0)(AGTCCACCAC...GGAGCTACAT:W6(V549_D-1)->T:W-1(V691_D-1)) Found potential edge: Edge(549->692,w:4.0) between AGTCCACCAC...GGAGCTACAT:W6(V549_D-1) and A:W-1(V692_D-1) removing vertex A:W-1(V692_D-1) was concatenated into AGTCCACCAC...GAGCTACATA:W6(V549_D-1) Want to move edge Edge(692->693,w:4.0)(A:W-1(V692_D-1)->G:W-1(V693_D-1)) to (AGTCCACCAC...GAGCTACATA:W6(V549_D-1)->G:W-1(V693_D-1) adding edge: AGTCCACCAC...GAGCTACATA:W6(V549_D-1) to G:W-1(V693_D-1) removing edge Edge(692->693,w:4.0)(A:W-1(V692_D-1)->G:W-1(V693_D-1)) removing edge Edge(549->692,w:4.0)(AGTCCACCAC...GAGCTACATA:W6(V549_D-1)->A:W-1(V692_D-1)) Found potential edge: Edge(549->693,w:4.0) between AGTCCACCAC...GAGCTACATA:W6(V549_D-1) and G:W-1(V693_D-1) removing vertex G:W-1(V693_D-1) was concatenated into AGTCCACCAC...AGCTACATAG:W6(V549_D-1) Want to move edge Edge(693->694,w:4.0)(G:W-1(V693_D-1)->C:W-1(V694_D-1)) to (AGTCCACCAC...AGCTACATAG:W6(V549_D-1)->C:W-1(V694_D-1) adding edge: AGTCCACCAC...AGCTACATAG:W6(V549_D-1) to C:W-1(V694_D-1) removing edge Edge(693->694,w:4.0)(G:W-1(V693_D-1)->C:W-1(V694_D-1)) removing edge Edge(549->693,w:4.0)(AGTCCACCAC...AGCTACATAG:W6(V549_D-1)->G:W-1(V693_D-1)) Found potential edge: Edge(549->694,w:4.0) between AGTCCACCAC...AGCTACATAG:W6(V549_D-1) and C:W-1(V694_D-1) removing vertex C:W-1(V694_D-1) was concatenated into AGTCCACCAC...GCTACATAGC:W6(V549_D-1) Want to move edge Edge(694->695,w:4.0)(C:W-1(V694_D-1)->C:W-1(V695_D-1)) to (AGTCCACCAC...GCTACATAGC:W6(V549_D-1)->C:W-1(V695_D-1) adding edge: AGTCCACCAC...GCTACATAGC:W6(V549_D-1) to C:W-1(V695_D-1) removing edge Edge(694->695,w:4.0)(C:W-1(V694_D-1)->C:W-1(V695_D-1)) removing edge Edge(549->694,w:4.0)(AGTCCACCAC...GCTACATAGC:W6(V549_D-1)->C:W-1(V694_D-1)) Found potential edge: Edge(549->695,w:4.0) between AGTCCACCAC...GCTACATAGC:W6(V549_D-1) and C:W-1(V695_D-1) removing vertex C:W-1(V695_D-1) was concatenated into AGTCCACCAC...CTACATAGCC:W6(V549_D-1) Want to move edge Edge(695->696,w:4.0)(C:W-1(V695_D-1)->A:W-1(V696_D-1)) to (AGTCCACCAC...CTACATAGCC:W6(V549_D-1)->A:W-1(V696_D-1) adding edge: AGTCCACCAC...CTACATAGCC:W6(V549_D-1) to A:W-1(V696_D-1) removing edge Edge(695->696,w:4.0)(C:W-1(V695_D-1)->A:W-1(V696_D-1)) removing edge Edge(549->695,w:4.0)(AGTCCACCAC...CTACATAGCC:W6(V549_D-1)->C:W-1(V695_D-1)) Found potential edge: Edge(549->696,w:4.0) between AGTCCACCAC...CTACATAGCC:W6(V549_D-1) and A:W-1(V696_D-1) removing vertex A:W-1(V696_D-1) was concatenated into AGTCCACCAC...TACATAGCCA:W6(V549_D-1) Want to move edge Edge(696->697,w:6.0)(A:W-1(V696_D-1)->G:W-1(V697_D-1)) to (AGTCCACCAC...TACATAGCCA:W6(V549_D-1)->G:W-1(V697_D-1) adding edge: AGTCCACCAC...TACATAGCCA:W6(V549_D-1) to G:W-1(V697_D-1) removing edge Edge(696->697,w:6.0)(A:W-1(V696_D-1)->G:W-1(V697_D-1)) removing edge Edge(549->696,w:4.0)(AGTCCACCAC...TACATAGCCA:W6(V549_D-1)->A:W-1(V696_D-1)) Found potential edge: Edge(549->697,w:6.0) between AGTCCACCAC...TACATAGCCA:W6(V549_D-1) and G:W-1(V697_D-1) removing vertex G:W-1(V697_D-1) was concatenated into AGTCCACCAC...ACATAGCCAG:W6(V549_D-1) Want to move edge Edge(697->698,w:6.0)(G:W-1(V697_D-1)->C:W-1(V698_D-1)) to (AGTCCACCAC...ACATAGCCAG:W6(V549_D-1)->C:W-1(V698_D-1) adding edge: AGTCCACCAC...ACATAGCCAG:W6(V549_D-1) to C:W-1(V698_D-1) removing edge Edge(697->698,w:6.0)(G:W-1(V697_D-1)->C:W-1(V698_D-1)) removing edge Edge(549->697,w:6.0)(AGTCCACCAC...ACATAGCCAG:W6(V549_D-1)->G:W-1(V697_D-1)) Found potential edge: Edge(549->698,w:6.0) between AGTCCACCAC...ACATAGCCAG:W6(V549_D-1) and C:W-1(V698_D-1) removing vertex C:W-1(V698_D-1) was concatenated into AGTCCACCAC...CATAGCCAGC:W6(V549_D-1) Want to move edge Edge(698->699,w:6.0)(C:W-1(V698_D-1)->C:W-1(V699_D-1)) to (AGTCCACCAC...CATAGCCAGC:W6(V549_D-1)->C:W-1(V699_D-1) adding edge: AGTCCACCAC...CATAGCCAGC:W6(V549_D-1) to C:W-1(V699_D-1) removing edge Edge(698->699,w:6.0)(C:W-1(V698_D-1)->C:W-1(V699_D-1)) removing edge Edge(549->698,w:6.0)(AGTCCACCAC...CATAGCCAGC:W6(V549_D-1)->C:W-1(V698_D-1)) Found potential edge: Edge(549->699,w:6.0) between AGTCCACCAC...CATAGCCAGC:W6(V549_D-1) and C:W-1(V699_D-1) removing vertex C:W-1(V699_D-1) was concatenated into AGTCCACCAC...ATAGCCAGCC:W6(V549_D-1) Want to move edge Edge(699->700,w:6.0)(C:W-1(V699_D-1)->C:W-1(V700_D-1)) to (AGTCCACCAC...ATAGCCAGCC:W6(V549_D-1)->C:W-1(V700_D-1) adding edge: AGTCCACCAC...ATAGCCAGCC:W6(V549_D-1) to C:W-1(V700_D-1) removing edge Edge(699->700,w:6.0)(C:W-1(V699_D-1)->C:W-1(V700_D-1)) removing edge Edge(549->699,w:6.0)(AGTCCACCAC...ATAGCCAGCC:W6(V549_D-1)->C:W-1(V699_D-1)) Found potential edge: Edge(549->700,w:6.0) between AGTCCACCAC...ATAGCCAGCC:W6(V549_D-1) and C:W-1(V700_D-1) removing vertex C:W-1(V700_D-1) was concatenated into AGTCCACCAC...TAGCCAGCCC:W6(V549_D-1) Want to move edge Edge(700->701,w:6.0)(C:W-1(V700_D-1)->C:W-1(V701_D-1)) to (AGTCCACCAC...TAGCCAGCCC:W6(V549_D-1)->C:W-1(V701_D-1) adding edge: AGTCCACCAC...TAGCCAGCCC:W6(V549_D-1) to C:W-1(V701_D-1) removing edge Edge(700->701,w:6.0)(C:W-1(V700_D-1)->C:W-1(V701_D-1)) removing edge Edge(549->700,w:6.0)(AGTCCACCAC...TAGCCAGCCC:W6(V549_D-1)->C:W-1(V700_D-1)) Found potential edge: Edge(549->701,w:6.0) between AGTCCACCAC...TAGCCAGCCC:W6(V549_D-1) and C:W-1(V701_D-1) removing vertex C:W-1(V701_D-1) was concatenated into AGTCCACCAC...AGCCAGCCCC:W6(V549_D-1) Want to move edge Edge(701->702,w:6.0)(C:W-1(V701_D-1)->G:W-1(V702_D-1)) to (AGTCCACCAC...AGCCAGCCCC:W6(V549_D-1)->G:W-1(V702_D-1) adding edge: AGTCCACCAC...AGCCAGCCCC:W6(V549_D-1) to G:W-1(V702_D-1) removing edge Edge(701->702,w:6.0)(C:W-1(V701_D-1)->G:W-1(V702_D-1)) removing edge Edge(549->701,w:6.0)(AGTCCACCAC...AGCCAGCCCC:W6(V549_D-1)->C:W-1(V701_D-1)) Found potential edge: Edge(549->702,w:6.0) between AGTCCACCAC...AGCCAGCCCC:W6(V549_D-1) and G:W-1(V702_D-1) removing vertex G:W-1(V702_D-1) was concatenated into AGTCCACCAC...GCCAGCCCCG:W6(V549_D-1) Want to move edge Edge(702->703,w:6.0)(G:W-1(V702_D-1)->T:W-1(V703_D-1)) to (AGTCCACCAC...GCCAGCCCCG:W6(V549_D-1)->T:W-1(V703_D-1) adding edge: AGTCCACCAC...GCCAGCCCCG:W6(V549_D-1) to T:W-1(V703_D-1) removing edge Edge(702->703,w:6.0)(G:W-1(V702_D-1)->T:W-1(V703_D-1)) removing edge Edge(549->702,w:6.0)(AGTCCACCAC...GCCAGCCCCG:W6(V549_D-1)->G:W-1(V702_D-1)) Found potential edge: Edge(549->703,w:6.0) between AGTCCACCAC...GCCAGCCCCG:W6(V549_D-1) and T:W-1(V703_D-1) removing vertex T:W-1(V703_D-1) was concatenated into AGTCCACCAC...CCAGCCCCGT:W6(V549_D-1) Want to move edge Edge(703->704,w:6.0)(T:W-1(V703_D-1)->G:W-1(V704_D-1)) to (AGTCCACCAC...CCAGCCCCGT:W6(V549_D-1)->G:W-1(V704_D-1) adding edge: AGTCCACCAC...CCAGCCCCGT:W6(V549_D-1) to G:W-1(V704_D-1) removing edge Edge(703->704,w:6.0)(T:W-1(V703_D-1)->G:W-1(V704_D-1)) removing edge Edge(549->703,w:6.0)(AGTCCACCAC...CCAGCCCCGT:W6(V549_D-1)->T:W-1(V703_D-1)) Found potential edge: Edge(549->704,w:6.0) between AGTCCACCAC...CCAGCCCCGT:W6(V549_D-1) and G:W-1(V704_D-1) removing vertex G:W-1(V704_D-1) was concatenated into AGTCCACCAC...CAGCCCCGTG:W6(V549_D-1) Want to move edge Edge(704->705,w:6.0)(G:W-1(V704_D-1)->G:W-1(V705_D-1)) to (AGTCCACCAC...CAGCCCCGTG:W6(V549_D-1)->G:W-1(V705_D-1) adding edge: AGTCCACCAC...CAGCCCCGTG:W6(V549_D-1) to G:W-1(V705_D-1) removing edge Edge(704->705,w:6.0)(G:W-1(V704_D-1)->G:W-1(V705_D-1)) removing edge Edge(549->704,w:6.0)(AGTCCACCAC...CAGCCCCGTG:W6(V549_D-1)->G:W-1(V704_D-1)) Found potential edge: Edge(549->705,w:6.0) between AGTCCACCAC...CAGCCCCGTG:W6(V549_D-1) and G:W-1(V705_D-1) removing vertex G:W-1(V705_D-1) was concatenated into AGTCCACCAC...AGCCCCGTGG:W6(V549_D-1) Want to move edge Edge(705->706,w:6.0)(G:W-1(V705_D-1)->A:W-1(V706_D-1)) to (AGTCCACCAC...AGCCCCGTGG:W6(V549_D-1)->A:W-1(V706_D-1) adding edge: AGTCCACCAC...AGCCCCGTGG:W6(V549_D-1) to A:W-1(V706_D-1) removing edge Edge(705->706,w:6.0)(G:W-1(V705_D-1)->A:W-1(V706_D-1)) removing edge Edge(549->705,w:6.0)(AGTCCACCAC...AGCCCCGTGG:W6(V549_D-1)->G:W-1(V705_D-1)) Found potential edge: Edge(549->706,w:6.0) between AGTCCACCAC...AGCCCCGTGG:W6(V549_D-1) and A:W-1(V706_D-1) removing vertex A:W-1(V706_D-1) was concatenated into AGTCCACCAC...GCCCCGTGGA:W6(V549_D-1) Want to move edge Edge(706->707,w:6.0)(A:W-1(V706_D-1)->G:W-1(V707_D-1)) to (AGTCCACCAC...GCCCCGTGGA:W6(V549_D-1)->G:W-1(V707_D-1) adding edge: AGTCCACCAC...GCCCCGTGGA:W6(V549_D-1) to G:W-1(V707_D-1) removing edge Edge(706->707,w:6.0)(A:W-1(V706_D-1)->G:W-1(V707_D-1)) removing edge Edge(549->706,w:6.0)(AGTCCACCAC...GCCCCGTGGA:W6(V549_D-1)->A:W-1(V706_D-1)) Found potential edge: Edge(549->707,w:6.0) between AGTCCACCAC...GCCCCGTGGA:W6(V549_D-1) and G:W-1(V707_D-1) removing vertex G:W-1(V707_D-1) was concatenated into AGTCCACCAC...CCCCGTGGAG:W6(V549_D-1) Want to move edge Edge(707->708,w:6.0)(G:W-1(V707_D-1)->G:W-1(V708_D-1)) to (AGTCCACCAC...CCCCGTGGAG:W6(V549_D-1)->G:W-1(V708_D-1) adding edge: AGTCCACCAC...CCCCGTGGAG:W6(V549_D-1) to G:W-1(V708_D-1) removing edge Edge(707->708,w:6.0)(G:W-1(V707_D-1)->G:W-1(V708_D-1)) removing edge Edge(549->707,w:6.0)(AGTCCACCAC...CCCCGTGGAG:W6(V549_D-1)->G:W-1(V707_D-1)) Found potential edge: Edge(549->708,w:6.0) between AGTCCACCAC...CCCCGTGGAG:W6(V549_D-1) and G:W-1(V708_D-1) removing vertex G:W-1(V708_D-1) was concatenated into AGTCCACCAC...CCCGTGGAGG:W6(V549_D-1) Want to move edge Edge(708->709,w:6.0)(G:W-1(V708_D-1)->G:W-1(V709_D-1)) to (AGTCCACCAC...CCCGTGGAGG:W6(V549_D-1)->G:W-1(V709_D-1) adding edge: AGTCCACCAC...CCCGTGGAGG:W6(V549_D-1) to G:W-1(V709_D-1) removing edge Edge(708->709,w:6.0)(G:W-1(V708_D-1)->G:W-1(V709_D-1)) removing edge Edge(549->708,w:6.0)(AGTCCACCAC...CCCGTGGAGG:W6(V549_D-1)->G:W-1(V708_D-1)) Found potential edge: Edge(549->709,w:6.0) between AGTCCACCAC...CCCGTGGAGG:W6(V549_D-1) and G:W-1(V709_D-1) removing vertex G:W-1(V709_D-1) was concatenated into AGTCCACCAC...CCGTGGAGGG:W6(V549_D-1) Want to move edge Edge(709->710,w:4.0)(G:W-1(V709_D-1)->A:W-1(V710_D-1)) to (AGTCCACCAC...CCGTGGAGGG:W6(V549_D-1)->A:W-1(V710_D-1) adding edge: AGTCCACCAC...CCGTGGAGGG:W6(V549_D-1) to A:W-1(V710_D-1) removing edge Edge(709->710,w:4.0)(G:W-1(V709_D-1)->A:W-1(V710_D-1)) removing edge Edge(549->709,w:6.0)(AGTCCACCAC...CCGTGGAGGG:W6(V549_D-1)->G:W-1(V709_D-1)) Found potential edge: Edge(549->710,w:4.0) between AGTCCACCAC...CCGTGGAGGG:W6(V549_D-1) and A:W-1(V710_D-1) removing vertex A:W-1(V710_D-1) was concatenated into AGTCCACCAC...CGTGGAGGGA:W6(V549_D-1) Want to move edge Edge(710->711,w:4.0)(A:W-1(V710_D-1)->G:W-1(V711_D-1)) to (AGTCCACCAC...CGTGGAGGGA:W6(V549_D-1)->G:W-1(V711_D-1) adding edge: AGTCCACCAC...CGTGGAGGGA:W6(V549_D-1) to G:W-1(V711_D-1) removing edge Edge(710->711,w:4.0)(A:W-1(V710_D-1)->G:W-1(V711_D-1)) removing edge Edge(549->710,w:4.0)(AGTCCACCAC...CGTGGAGGGA:W6(V549_D-1)->A:W-1(V710_D-1)) Found potential edge: Edge(549->711,w:4.0) between AGTCCACCAC...CGTGGAGGGA:W6(V549_D-1) and G:W-1(V711_D-1) removing vertex G:W-1(V711_D-1) was concatenated into AGTCCACCAC...GTGGAGGGAG:W6(V549_D-1) Want to move edge Edge(711->712,w:4.0)(G:W-1(V711_D-1)->C:W-1(V712_D-1)) to (AGTCCACCAC...GTGGAGGGAG:W6(V549_D-1)->C:W-1(V712_D-1) adding edge: AGTCCACCAC...GTGGAGGGAG:W6(V549_D-1) to C:W-1(V712_D-1) removing edge Edge(711->712,w:4.0)(G:W-1(V711_D-1)->C:W-1(V712_D-1)) removing edge Edge(549->711,w:4.0)(AGTCCACCAC...GTGGAGGGAG:W6(V549_D-1)->G:W-1(V711_D-1)) Found potential edge: Edge(549->712,w:4.0) between AGTCCACCAC...GTGGAGGGAG:W6(V549_D-1) and C:W-1(V712_D-1) removing vertex C:W-1(V712_D-1) was concatenated into AGTCCACCAC...TGGAGGGAGC:W6(V549_D-1) Want to move edge Edge(712->713,w:4.0)(C:W-1(V712_D-1)->C:W-1(V713_D-1)) to (AGTCCACCAC...TGGAGGGAGC:W6(V549_D-1)->C:W-1(V713_D-1) adding edge: AGTCCACCAC...TGGAGGGAGC:W6(V549_D-1) to C:W-1(V713_D-1) removing edge Edge(712->713,w:4.0)(C:W-1(V712_D-1)->C:W-1(V713_D-1)) removing edge Edge(549->712,w:4.0)(AGTCCACCAC...TGGAGGGAGC:W6(V549_D-1)->C:W-1(V712_D-1)) Found potential edge: Edge(549->713,w:4.0) between AGTCCACCAC...TGGAGGGAGC:W6(V549_D-1) and C:W-1(V713_D-1) removing vertex C:W-1(V713_D-1) was concatenated into AGTCCACCAC...GGAGGGAGCC:W6(V549_D-1) Want to move edge Edge(713->714,w:4.0)(C:W-1(V713_D-1)->A:W-1(V714_D-1)) to (AGTCCACCAC...GGAGGGAGCC:W6(V549_D-1)->A:W-1(V714_D-1) adding edge: AGTCCACCAC...GGAGGGAGCC:W6(V549_D-1) to A:W-1(V714_D-1) removing edge Edge(713->714,w:4.0)(C:W-1(V713_D-1)->A:W-1(V714_D-1)) removing edge Edge(549->713,w:4.0)(AGTCCACCAC...GGAGGGAGCC:W6(V549_D-1)->C:W-1(V713_D-1)) Found potential edge: Edge(549->714,w:4.0) between AGTCCACCAC...GGAGGGAGCC:W6(V549_D-1) and A:W-1(V714_D-1) removing vertex A:W-1(V714_D-1) was concatenated into AGTCCACCAC...GAGGGAGCCA:W6(V549_D-1) Want to move edge Edge(714->715,w:4.0)(A:W-1(V714_D-1)->C:W-1(V715_D-1)) to (AGTCCACCAC...GAGGGAGCCA:W6(V549_D-1)->C:W-1(V715_D-1) adding edge: AGTCCACCAC...GAGGGAGCCA:W6(V549_D-1) to C:W-1(V715_D-1) removing edge Edge(714->715,w:4.0)(A:W-1(V714_D-1)->C:W-1(V715_D-1)) removing edge Edge(549->714,w:4.0)(AGTCCACCAC...GAGGGAGCCA:W6(V549_D-1)->A:W-1(V714_D-1)) Found potential edge: Edge(549->715,w:4.0) between AGTCCACCAC...GAGGGAGCCA:W6(V549_D-1) and C:W-1(V715_D-1) removing vertex C:W-1(V715_D-1) was concatenated into AGTCCACCAC...AGGGAGCCAC:W6(V549_D-1) Want to move edge Edge(715->716,w:4.0)(C:W-1(V715_D-1)->C:W-1(V716_D-1)) to (AGTCCACCAC...AGGGAGCCAC:W6(V549_D-1)->C:W-1(V716_D-1) adding edge: AGTCCACCAC...AGGGAGCCAC:W6(V549_D-1) to C:W-1(V716_D-1) removing edge Edge(715->716,w:4.0)(C:W-1(V715_D-1)->C:W-1(V716_D-1)) removing edge Edge(549->715,w:4.0)(AGTCCACCAC...AGGGAGCCAC:W6(V549_D-1)->C:W-1(V715_D-1)) Found potential edge: Edge(549->716,w:4.0) between AGTCCACCAC...AGGGAGCCAC:W6(V549_D-1) and C:W-1(V716_D-1) removing vertex C:W-1(V716_D-1) was concatenated into AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) Want to move edge Edge(716->717,w:4.0)(C:W-1(V716_D-1)->A:W-1(V717_D-1)) to (AGTCCACCAC...GGGAGCCACC:W6(V549_D-1)->A:W-1(V717_D-1) adding edge: AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) to A:W-1(V717_D-1) removing edge Edge(716->717,w:4.0)(C:W-1(V716_D-1)->A:W-1(V717_D-1)) removing edge Edge(549->716,w:4.0)(AGTCCACCAC...GGGAGCCACC:W6(V549_D-1)->C:W-1(V716_D-1)) Found potential edge: Edge(717->718,w:6.0) between A:W-1(V717_D-1) and G:W-1(V718_D-1) removing vertex G:W-1(V718_D-1) was concatenated into AG:W6(V717_D-1) Want to move edge Edge(718->719,w:6.0)(G:W-1(V718_D-1)->C:W-1(V719_D-1)) to (AG:W6(V717_D-1)->C:W-1(V719_D-1) adding edge: AG:W6(V717_D-1) to C:W-1(V719_D-1) removing edge Edge(718->719,w:6.0)(G:W-1(V718_D-1)->C:W-1(V719_D-1)) removing edge Edge(717->718,w:6.0)(AG:W6(V717_D-1)->G:W-1(V718_D-1)) Found potential edge: Edge(717->719,w:6.0) between AG:W6(V717_D-1) and C:W-1(V719_D-1) removing vertex C:W-1(V719_D-1) was concatenated into AGC:W6(V717_D-1) Want to move edge Edge(719->720,w:6.0)(C:W-1(V719_D-1)->C:W-1(V720_D-1)) to (AGC:W6(V717_D-1)->C:W-1(V720_D-1) adding edge: AGC:W6(V717_D-1) to C:W-1(V720_D-1) removing edge Edge(719->720,w:6.0)(C:W-1(V719_D-1)->C:W-1(V720_D-1)) removing edge Edge(717->719,w:6.0)(AGC:W6(V717_D-1)->C:W-1(V719_D-1)) Found potential edge: Edge(717->720,w:6.0) between AGC:W6(V717_D-1) and C:W-1(V720_D-1) removing vertex C:W-1(V720_D-1) was concatenated into AGCC:W6(V717_D-1) Want to move edge Edge(720->721,w:6.0)(C:W-1(V720_D-1)->A:W-1(V721_D-1)) to (AGCC:W6(V717_D-1)->A:W-1(V721_D-1) adding edge: AGCC:W6(V717_D-1) to A:W-1(V721_D-1) removing edge Edge(720->721,w:6.0)(C:W-1(V720_D-1)->A:W-1(V721_D-1)) removing edge Edge(717->720,w:6.0)(AGCC:W6(V717_D-1)->C:W-1(V720_D-1)) Found potential edge: Edge(717->721,w:6.0) between AGCC:W6(V717_D-1) and A:W-1(V721_D-1) removing vertex A:W-1(V721_D-1) was concatenated into AGCCA:W6(V717_D-1) Want to move edge Edge(721->722,w:6.0)(A:W-1(V721_D-1)->C:W-1(V722_D-1)) to (AGCCA:W6(V717_D-1)->C:W-1(V722_D-1) adding edge: AGCCA:W6(V717_D-1) to C:W-1(V722_D-1) removing edge Edge(721->722,w:6.0)(A:W-1(V721_D-1)->C:W-1(V722_D-1)) removing edge Edge(717->721,w:6.0)(AGCCA:W6(V717_D-1)->A:W-1(V721_D-1)) Found potential edge: Edge(717->722,w:6.0) between AGCCA:W6(V717_D-1) and C:W-1(V722_D-1) removing vertex C:W-1(V722_D-1) was concatenated into AGCCAC:W6(V717_D-1) Want to move edge Edge(722->723,w:6.0)(C:W-1(V722_D-1)->A:W-1(V723_D-1)) to (AGCCAC:W6(V717_D-1)->A:W-1(V723_D-1) adding edge: AGCCAC:W6(V717_D-1) to A:W-1(V723_D-1) removing edge Edge(722->723,w:6.0)(C:W-1(V722_D-1)->A:W-1(V723_D-1)) removing edge Edge(717->722,w:6.0)(AGCCAC:W6(V717_D-1)->C:W-1(V722_D-1)) Found potential edge: Edge(717->723,w:6.0) between AGCCAC:W6(V717_D-1) and A:W-1(V723_D-1) removing vertex A:W-1(V723_D-1) was concatenated into AGCCACA:W6(V717_D-1) Want to move edge Edge(723->724,w:6.0)(A:W-1(V723_D-1)->G:W-1(V724_D-1)) to (AGCCACA:W6(V717_D-1)->G:W-1(V724_D-1) adding edge: AGCCACA:W6(V717_D-1) to G:W-1(V724_D-1) removing edge Edge(723->724,w:6.0)(A:W-1(V723_D-1)->G:W-1(V724_D-1)) removing edge Edge(717->723,w:6.0)(AGCCACA:W6(V717_D-1)->A:W-1(V723_D-1)) Found potential edge: Edge(717->724,w:6.0) between AGCCACA:W6(V717_D-1) and G:W-1(V724_D-1) removing vertex G:W-1(V724_D-1) was concatenated into AGCCACAG:W6(V717_D-1) Want to move edge Edge(724->725,w:6.0)(G:W-1(V724_D-1)->G:W-1(V725_D-1)) to (AGCCACAG:W6(V717_D-1)->G:W-1(V725_D-1) adding edge: AGCCACAG:W6(V717_D-1) to G:W-1(V725_D-1) removing edge Edge(724->725,w:6.0)(G:W-1(V724_D-1)->G:W-1(V725_D-1)) removing edge Edge(717->724,w:6.0)(AGCCACAG:W6(V717_D-1)->G:W-1(V724_D-1)) Found potential edge: Edge(717->725,w:6.0) between AGCCACAG:W6(V717_D-1) and G:W-1(V725_D-1) removing vertex G:W-1(V725_D-1) was concatenated into AGCCACAGG:W6(V717_D-1) Want to move edge Edge(725->726,w:6.0)(G:W-1(V725_D-1)->T:W-1(V726_D-1)) to (AGCCACAGG:W6(V717_D-1)->T:W-1(V726_D-1) adding edge: AGCCACAGG:W6(V717_D-1) to T:W-1(V726_D-1) removing edge Edge(725->726,w:6.0)(G:W-1(V725_D-1)->T:W-1(V726_D-1)) removing edge Edge(717->725,w:6.0)(AGCCACAGG:W6(V717_D-1)->G:W-1(V725_D-1)) Found potential edge: Edge(717->726,w:6.0) between AGCCACAGG:W6(V717_D-1) and T:W-1(V726_D-1) removing vertex T:W-1(V726_D-1) was concatenated into AGCCACAGGT:W6(V717_D-1) Want to move edge Edge(726->727,w:6.0)(T:W-1(V726_D-1)->A:W-1(V727_D-1)) to (AGCCACAGGT:W6(V717_D-1)->A:W-1(V727_D-1) adding edge: AGCCACAGGT:W6(V717_D-1) to A:W-1(V727_D-1) removing edge Edge(726->727,w:6.0)(T:W-1(V726_D-1)->A:W-1(V727_D-1)) removing edge Edge(717->726,w:6.0)(AGCCACAGGT:W6(V717_D-1)->T:W-1(V726_D-1)) Found potential edge: Edge(717->727,w:6.0) between AGCCACAGGT:W6(V717_D-1) and A:W-1(V727_D-1) removing vertex A:W-1(V727_D-1) was concatenated into AGCCACAGGTA:W6(V717_D-1) Want to move edge Edge(727->728,w:6.0)(A:W-1(V727_D-1)->C:W-1(V728_D-1)) to (AGCCACAGGTA:W6(V717_D-1)->C:W-1(V728_D-1) adding edge: AGCCACAGGTA:W6(V717_D-1) to C:W-1(V728_D-1) removing edge Edge(727->728,w:6.0)(A:W-1(V727_D-1)->C:W-1(V728_D-1)) removing edge Edge(717->727,w:6.0)(AGCCACAGGTA:W6(V717_D-1)->A:W-1(V727_D-1)) Found potential edge: Edge(717->728,w:6.0) between AGCCACAGGTA:W6(V717_D-1) and C:W-1(V728_D-1) removing vertex C:W-1(V728_D-1) was concatenated into AGCCACAGGTAC:W6(V717_D-1) Want to move edge Edge(728->729,w:6.0)(C:W-1(V728_D-1)->C:W-1(V729_D-1)) to (AGCCACAGGTAC:W6(V717_D-1)->C:W-1(V729_D-1) adding edge: AGCCACAGGTAC:W6(V717_D-1) to C:W-1(V729_D-1) removing edge Edge(728->729,w:6.0)(C:W-1(V728_D-1)->C:W-1(V729_D-1)) removing edge Edge(717->728,w:6.0)(AGCCACAGGTAC:W6(V717_D-1)->C:W-1(V728_D-1)) Found potential edge: Edge(717->729,w:6.0) between AGCCACAGGTAC:W6(V717_D-1) and C:W-1(V729_D-1) removing vertex C:W-1(V729_D-1) was concatenated into AGCCACAGGTACC:W6(V717_D-1) Want to move edge Edge(729->730,w:6.0)(C:W-1(V729_D-1)->T:W-1(V730_D-1)) to (AGCCACAGGTACC:W6(V717_D-1)->T:W-1(V730_D-1) adding edge: AGCCACAGGTACC:W6(V717_D-1) to T:W-1(V730_D-1) removing edge Edge(729->730,w:6.0)(C:W-1(V729_D-1)->T:W-1(V730_D-1)) removing edge Edge(717->729,w:6.0)(AGCCACAGGTACC:W6(V717_D-1)->C:W-1(V729_D-1)) Found potential edge: Edge(717->730,w:6.0) between AGCCACAGGTACC:W6(V717_D-1) and T:W-1(V730_D-1) removing vertex T:W-1(V730_D-1) was concatenated into AGCCACAGGTACCT:W6(V717_D-1) Want to move edge Edge(730->731,w:6.0)(T:W-1(V730_D-1)->G:W-1(V731_D-1)) to (AGCCACAGGTACCT:W6(V717_D-1)->G:W-1(V731_D-1) adding edge: AGCCACAGGTACCT:W6(V717_D-1) to G:W-1(V731_D-1) removing edge Edge(730->731,w:6.0)(T:W-1(V730_D-1)->G:W-1(V731_D-1)) removing edge Edge(717->730,w:6.0)(AGCCACAGGTACCT:W6(V717_D-1)->T:W-1(V730_D-1)) Found potential edge: Edge(717->731,w:6.0) between AGCCACAGGTACCT:W6(V717_D-1) and G:W-1(V731_D-1) removing vertex G:W-1(V731_D-1) was concatenated into AGCCACAGGTACCTG:W6(V717_D-1) Want to move edge Edge(731->732,w:6.0)(G:W-1(V731_D-1)->A:W-1(V732_D-1)) to (AGCCACAGGTACCTG:W6(V717_D-1)->A:W-1(V732_D-1) adding edge: AGCCACAGGTACCTG:W6(V717_D-1) to A:W-1(V732_D-1) removing edge Edge(731->732,w:6.0)(G:W-1(V731_D-1)->A:W-1(V732_D-1)) removing edge Edge(717->731,w:6.0)(AGCCACAGGTACCTG:W6(V717_D-1)->G:W-1(V731_D-1)) Found potential edge: Edge(717->732,w:6.0) between AGCCACAGGTACCTG:W6(V717_D-1) and A:W-1(V732_D-1) removing vertex A:W-1(V732_D-1) was concatenated into AGCCACAGGTACCTGA:W6(V717_D-1) Want to move edge Edge(732->733,w:6.0)(A:W-1(V732_D-1)->T:W-1(V733_D-1)) to (AGCCACAGGTACCTGA:W6(V717_D-1)->T:W-1(V733_D-1) adding edge: AGCCACAGGTACCTGA:W6(V717_D-1) to T:W-1(V733_D-1) removing edge Edge(732->733,w:6.0)(A:W-1(V732_D-1)->T:W-1(V733_D-1)) removing edge Edge(717->732,w:6.0)(AGCCACAGGTACCTGA:W6(V717_D-1)->A:W-1(V732_D-1)) Found potential edge: Edge(717->733,w:6.0) between AGCCACAGGTACCTGA:W6(V717_D-1) and T:W-1(V733_D-1) removing vertex T:W-1(V733_D-1) was concatenated into AGCCACAGGTACCTGAT:W6(V717_D-1) Want to move edge Edge(733->734,w:6.0)(T:W-1(V733_D-1)->G:W-1(V734_D-1)) to (AGCCACAGGTACCTGAT:W6(V717_D-1)->G:W-1(V734_D-1) adding edge: AGCCACAGGTACCTGAT:W6(V717_D-1) to G:W-1(V734_D-1) removing edge Edge(733->734,w:6.0)(T:W-1(V733_D-1)->G:W-1(V734_D-1)) removing edge Edge(717->733,w:6.0)(AGCCACAGGTACCTGAT:W6(V717_D-1)->T:W-1(V733_D-1)) Found potential edge: Edge(717->734,w:6.0) between AGCCACAGGTACCTGAT:W6(V717_D-1) and G:W-1(V734_D-1) removing vertex G:W-1(V734_D-1) was concatenated into AGCCACAGGTACCTGATG:W6(V717_D-1) Want to move edge Edge(734->735,w:6.0)(G:W-1(V734_D-1)->G:W-1(V735_D-1)) to (AGCCACAGGTACCTGATG:W6(V717_D-1)->G:W-1(V735_D-1) adding edge: AGCCACAGGTACCTGATG:W6(V717_D-1) to G:W-1(V735_D-1) removing edge Edge(734->735,w:6.0)(G:W-1(V734_D-1)->G:W-1(V735_D-1)) removing edge Edge(717->734,w:6.0)(AGCCACAGGTACCTGATG:W6(V717_D-1)->G:W-1(V734_D-1)) Found potential edge: Edge(717->735,w:6.0) between AGCCACAGGTACCTGATG:W6(V717_D-1) and G:W-1(V735_D-1) removing vertex G:W-1(V735_D-1) was concatenated into AGCCACAGGTACCTGATGG:W6(V717_D-1) Want to move edge Edge(735->736,w:6.0)(G:W-1(V735_D-1)->A:W-1(V736_D-1)) to (AGCCACAGGTACCTGATGG:W6(V717_D-1)->A:W-1(V736_D-1) adding edge: AGCCACAGGTACCTGATGG:W6(V717_D-1) to A:W-1(V736_D-1) removing edge Edge(735->736,w:6.0)(G:W-1(V735_D-1)->A:W-1(V736_D-1)) removing edge Edge(717->735,w:6.0)(AGCCACAGGTACCTGATGG:W6(V717_D-1)->G:W-1(V735_D-1)) Found potential edge: Edge(717->736,w:6.0) between AGCCACAGGTACCTGATGG:W6(V717_D-1) and A:W-1(V736_D-1) removing vertex A:W-1(V736_D-1) was concatenated into AGCCACAGGTACCTGATGGA:W6(V717_D-1) Want to move edge Edge(736->737,w:6.0)(A:W-1(V736_D-1)->A:W-1(V737_D-1)) to (AGCCACAGGTACCTGATGGA:W6(V717_D-1)->A:W-1(V737_D-1) adding edge: AGCCACAGGTACCTGATGGA:W6(V717_D-1) to A:W-1(V737_D-1) removing edge Edge(736->737,w:6.0)(A:W-1(V736_D-1)->A:W-1(V737_D-1)) removing edge Edge(717->736,w:6.0)(AGCCACAGGTACCTGATGGA:W6(V717_D-1)->A:W-1(V736_D-1)) Found potential edge: Edge(717->737,w:6.0) between AGCCACAGGTACCTGATGGA:W6(V717_D-1) and A:W-1(V737_D-1) removing vertex A:W-1(V737_D-1) was concatenated into AGCCACAGGTACCTGATGGAA:W6(V717_D-1) Want to move edge Edge(737->738,w:6.0)(A:W-1(V737_D-1)->A:W-1(V738_D-1)) to (AGCCACAGGTACCTGATGGAA:W6(V717_D-1)->A:W-1(V738_D-1) adding edge: AGCCACAGGTACCTGATGGAA:W6(V717_D-1) to A:W-1(V738_D-1) removing edge Edge(737->738,w:6.0)(A:W-1(V737_D-1)->A:W-1(V738_D-1)) removing edge Edge(717->737,w:6.0)(AGCCACAGGTACCTGATGGAA:W6(V717_D-1)->A:W-1(V737_D-1)) Found potential edge: Edge(717->738,w:6.0) between AGCCACAGGTACCTGATGGAA:W6(V717_D-1) and A:W-1(V738_D-1) removing vertex A:W-1(V738_D-1) was concatenated into AGCCACAGGTACCTGATGGAAA:W6(V717_D-1) Want to move edge Edge(738->739,w:6.0)(A:W-1(V738_D-1)->T:W-1(V739_D-1)) to (AGCCACAGGTACCTGATGGAAA:W6(V717_D-1)->T:W-1(V739_D-1) adding edge: AGCCACAGGTACCTGATGGAAA:W6(V717_D-1) to T:W-1(V739_D-1) removing edge Edge(738->739,w:6.0)(A:W-1(V738_D-1)->T:W-1(V739_D-1)) removing edge Edge(717->738,w:6.0)(AGCCACAGGTACCTGATGGAAA:W6(V717_D-1)->A:W-1(V738_D-1)) Found potential edge: Edge(717->739,w:6.0) between AGCCACAGGTACCTGATGGAAA:W6(V717_D-1) and T:W-1(V739_D-1) removing vertex T:W-1(V739_D-1) was concatenated into AGCCACAGGTACCTGATGGAAAT:W6(V717_D-1) Want to move edge Edge(739->740,w:6.0)(T:W-1(V739_D-1)->G:W-1(V740_D-1)) to (AGCCACAGGTACCTGATGGAAAT:W6(V717_D-1)->G:W-1(V740_D-1) adding edge: AGCCACAGGTACCTGATGGAAAT:W6(V717_D-1) to G:W-1(V740_D-1) removing edge Edge(739->740,w:6.0)(T:W-1(V739_D-1)->G:W-1(V740_D-1)) removing edge Edge(717->739,w:6.0)(AGCCACAGGTACCTGATGGAAAT:W6(V717_D-1)->T:W-1(V739_D-1)) Found potential edge: Edge(717->740,w:6.0) between AGCCACAGGTACCTGATGGAAAT:W6(V717_D-1) and G:W-1(V740_D-1) removing vertex G:W-1(V740_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATG:W6(V717_D-1) Want to move edge Edge(740->741,w:6.0)(G:W-1(V740_D-1)->C:W-1(V741_D-1)) to (AGCCACAGGTACCTGATGGAAATG:W6(V717_D-1)->C:W-1(V741_D-1) adding edge: AGCCACAGGTACCTGATGGAAATG:W6(V717_D-1) to C:W-1(V741_D-1) removing edge Edge(740->741,w:6.0)(G:W-1(V740_D-1)->C:W-1(V741_D-1)) removing edge Edge(717->740,w:6.0)(AGCCACAGGTACCTGATGGAAATG:W6(V717_D-1)->G:W-1(V740_D-1)) Found potential edge: Edge(717->741,w:6.0) between AGCCACAGGTACCTGATGGAAATG:W6(V717_D-1) and C:W-1(V741_D-1) removing vertex C:W-1(V741_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATGC:W6(V717_D-1) Want to move edge Edge(741->742,w:6.0)(C:W-1(V741_D-1)->C:W-1(V742_D-1)) to (AGCCACAGGTACCTGATGGAAATGC:W6(V717_D-1)->C:W-1(V742_D-1) adding edge: AGCCACAGGTACCTGATGGAAATGC:W6(V717_D-1) to C:W-1(V742_D-1) removing edge Edge(741->742,w:6.0)(C:W-1(V741_D-1)->C:W-1(V742_D-1)) removing edge Edge(717->741,w:6.0)(AGCCACAGGTACCTGATGGAAATGC:W6(V717_D-1)->C:W-1(V741_D-1)) Found potential edge: Edge(717->742,w:6.0) between AGCCACAGGTACCTGATGGAAATGC:W6(V717_D-1) and C:W-1(V742_D-1) removing vertex C:W-1(V742_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATGCC:W6(V717_D-1) Want to move edge Edge(742->743,w:4.0)(C:W-1(V742_D-1)->G:W-1(V743_D-1)) to (AGCCACAGGTACCTGATGGAAATGCC:W6(V717_D-1)->G:W-1(V743_D-1) adding edge: AGCCACAGGTACCTGATGGAAATGCC:W6(V717_D-1) to G:W-1(V743_D-1) removing edge Edge(742->743,w:4.0)(C:W-1(V742_D-1)->G:W-1(V743_D-1)) removing edge Edge(717->742,w:6.0)(AGCCACAGGTACCTGATGGAAATGCC:W6(V717_D-1)->C:W-1(V742_D-1)) Found potential edge: Edge(717->743,w:4.0) between AGCCACAGGTACCTGATGGAAATGCC:W6(V717_D-1) and G:W-1(V743_D-1) removing vertex G:W-1(V743_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATGCCG:W6(V717_D-1) Want to move edge Edge(743->744,w:4.0)(G:W-1(V743_D-1)->G:W-1(V744_D-1)) to (AGCCACAGGTACCTGATGGAAATGCCG:W6(V717_D-1)->G:W-1(V744_D-1) adding edge: AGCCACAGGTACCTGATGGAAATGCCG:W6(V717_D-1) to G:W-1(V744_D-1) removing edge Edge(743->744,w:4.0)(G:W-1(V743_D-1)->G:W-1(V744_D-1)) removing edge Edge(717->743,w:4.0)(AGCCACAGGTACCTGATGGAAATGCCG:W6(V717_D-1)->G:W-1(V743_D-1)) Found potential edge: Edge(717->744,w:4.0) between AGCCACAGGTACCTGATGGAAATGCCG:W6(V717_D-1) and G:W-1(V744_D-1) removing vertex G:W-1(V744_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATGCCGG:W6(V717_D-1) Want to move edge Edge(744->745,w:4.0)(G:W-1(V744_D-1)->C:W-1(V745_D-1)) to (AGCCACAGGTACCTGATGGAAATGCCGG:W6(V717_D-1)->C:W-1(V745_D-1) adding edge: AGCCACAGGTACCTGATGGAAATGCCGG:W6(V717_D-1) to C:W-1(V745_D-1) removing edge Edge(744->745,w:4.0)(G:W-1(V744_D-1)->C:W-1(V745_D-1)) removing edge Edge(717->744,w:4.0)(AGCCACAGGTACCTGATGGAAATGCCGG:W6(V717_D-1)->G:W-1(V744_D-1)) Found potential edge: Edge(717->745,w:4.0) between AGCCACAGGTACCTGATGGAAATGCCGG:W6(V717_D-1) and C:W-1(V745_D-1) removing vertex C:W-1(V745_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATGCCGGC:W6(V717_D-1) Want to move edge Edge(745->746,w:4.0)(C:W-1(V745_D-1)->T:W-1(V746_D-1)) to (AGCCACAGGTACCTGATGGAAATGCCGGC:W6(V717_D-1)->T:W-1(V746_D-1) adding edge: AGCCACAGGTACCTGATGGAAATGCCGGC:W6(V717_D-1) to T:W-1(V746_D-1) removing edge Edge(745->746,w:4.0)(C:W-1(V745_D-1)->T:W-1(V746_D-1)) removing edge Edge(717->745,w:4.0)(AGCCACAGGTACCTGATGGAAATGCCGGC:W6(V717_D-1)->C:W-1(V745_D-1)) Found potential edge: Edge(717->746,w:4.0) between AGCCACAGGTACCTGATGGAAATGCCGGC:W6(V717_D-1) and T:W-1(V746_D-1) removing vertex T:W-1(V746_D-1) was concatenated into AGCCACAGGTACCTGATGGAAATGCCGGCT:W6(V717_D-1) Want to move edge Edge(746->747,w:4.0)(T:W-1(V746_D-1)->C:W-1(V747_D-1)) to (AGCCACAGGTACCTGATGGAAATGCCGGCT:W6(V717_D-1)->C:W-1(V747_D-1) adding edge: AGCCACAGGTACCTGATGGAAATGCCGGCT:W6(V717_D-1) to C:W-1(V747_D-1) removing edge Edge(746->747,w:4.0)(T:W-1(V746_D-1)->C:W-1(V747_D-1)) removing edge Edge(717->746,w:4.0)(AGCCACAGGTACCTGATGGAAATGCCGGCT:W6(V717_D-1)->T:W-1(V746_D-1)) Found potential edge: Edge(717->747,w:4.0) between AGCCACAGGTACCTGATGGAAATGCCGGCT:W6(V717_D-1) and C:W-1(V747_D-1) removing vertex C:W-1(V747_D-1) was concatenated into AGCCACAGGT...ATGCCGGCTC:W6(V717_D-1) Want to move edge Edge(747->748,w:4.0)(C:W-1(V747_D-1)->A:W-1(V748_D-1)) to (AGCCACAGGT...ATGCCGGCTC:W6(V717_D-1)->A:W-1(V748_D-1) adding edge: AGCCACAGGT...ATGCCGGCTC:W6(V717_D-1) to A:W-1(V748_D-1) removing edge Edge(747->748,w:4.0)(C:W-1(V747_D-1)->A:W-1(V748_D-1)) removing edge Edge(717->747,w:4.0)(AGCCACAGGT...ATGCCGGCTC:W6(V717_D-1)->C:W-1(V747_D-1)) Found potential edge: Edge(717->748,w:4.0) between AGCCACAGGT...ATGCCGGCTC:W6(V717_D-1) and A:W-1(V748_D-1) removing vertex A:W-1(V748_D-1) was concatenated into AGCCACAGGT...TGCCGGCTCA:W6(V717_D-1) Want to move edge Edge(748->749,w:2.0)(A:W-1(V748_D-1)->C:W-1(V749_D-1)) to (AGCCACAGGT...TGCCGGCTCA:W6(V717_D-1)->C:W-1(V749_D-1) adding edge: AGCCACAGGT...TGCCGGCTCA:W6(V717_D-1) to C:W-1(V749_D-1) removing edge Edge(748->749,w:2.0)(A:W-1(V748_D-1)->C:W-1(V749_D-1)) removing edge Edge(717->748,w:4.0)(AGCCACAGGT...TGCCGGCTCA:W6(V717_D-1)->A:W-1(V748_D-1)) Found potential edge: Edge(717->749,w:2.0) between AGCCACAGGT...TGCCGGCTCA:W6(V717_D-1) and C:W-1(V749_D-1) removing vertex C:W-1(V749_D-1) was concatenated into AGCCACAGGT...GCCGGCTCAC:W6(V717_D-1) Want to move edge Edge(749->750,w:2.0)(C:W-1(V749_D-1)->T:W-1(V750_D-1)) to (AGCCACAGGT...GCCGGCTCAC:W6(V717_D-1)->T:W-1(V750_D-1) adding edge: AGCCACAGGT...GCCGGCTCAC:W6(V717_D-1) to T:W-1(V750_D-1) removing edge Edge(749->750,w:2.0)(C:W-1(V749_D-1)->T:W-1(V750_D-1)) removing edge Edge(717->749,w:2.0)(AGCCACAGGT...GCCGGCTCAC:W6(V717_D-1)->C:W-1(V749_D-1)) Found potential edge: Edge(717->750,w:2.0) between AGCCACAGGT...GCCGGCTCAC:W6(V717_D-1) and T:W-1(V750_D-1) removing vertex T:W-1(V750_D-1) was concatenated into AGCCACAGGT...CCGGCTCACT:W5(V717_D-1) Want to move edge Edge(750->751,w:2.0)(T:W-1(V750_D-1)->T:W-1(V751_D-1)) to (AGCCACAGGT...CCGGCTCACT:W5(V717_D-1)->T:W-1(V751_D-1) adding edge: AGCCACAGGT...CCGGCTCACT:W5(V717_D-1) to T:W-1(V751_D-1) removing edge Edge(750->751,w:2.0)(T:W-1(V750_D-1)->T:W-1(V751_D-1)) removing edge Edge(717->750,w:2.0)(AGCCACAGGT...CCGGCTCACT:W5(V717_D-1)->T:W-1(V750_D-1)) Found potential edge: Edge(717->751,w:2.0) between AGCCACAGGT...CCGGCTCACT:W5(V717_D-1) and T:W-1(V751_D-1) removing vertex T:W-1(V751_D-1) was concatenated into AGCCACAGGT...CGGCTCACTT:W5(V717_D-1) Want to move edge Edge(751->752,w:2.0)(T:W-1(V751_D-1)->C:W-1(V752_D-1)) to (AGCCACAGGT...CGGCTCACTT:W5(V717_D-1)->C:W-1(V752_D-1) adding edge: AGCCACAGGT...CGGCTCACTT:W5(V717_D-1) to C:W-1(V752_D-1) removing edge Edge(751->752,w:2.0)(T:W-1(V751_D-1)->C:W-1(V752_D-1)) removing edge Edge(717->751,w:2.0)(AGCCACAGGT...CGGCTCACTT:W5(V717_D-1)->T:W-1(V751_D-1)) Found potential edge: Edge(717->752,w:2.0) between AGCCACAGGT...CGGCTCACTT:W5(V717_D-1) and C:W-1(V752_D-1) removing vertex C:W-1(V752_D-1) was concatenated into AGCCACAGGT...GGCTCACTTC:W5(V717_D-1) Want to move edge Edge(752->753,w:2.0)(C:W-1(V752_D-1)->C:W-1(V753_D-1)) to (AGCCACAGGT...GGCTCACTTC:W5(V717_D-1)->C:W-1(V753_D-1) adding edge: AGCCACAGGT...GGCTCACTTC:W5(V717_D-1) to C:W-1(V753_D-1) removing edge Edge(752->753,w:2.0)(C:W-1(V752_D-1)->C:W-1(V753_D-1)) removing edge Edge(717->752,w:2.0)(AGCCACAGGT...GGCTCACTTC:W5(V717_D-1)->C:W-1(V752_D-1)) Found potential edge: Edge(717->753,w:2.0) between AGCCACAGGT...GGCTCACTTC:W5(V717_D-1) and C:W-1(V753_D-1) removing vertex C:W-1(V753_D-1) was concatenated into AGCCACAGGT...GCTCACTTCC:W5(V717_D-1) Want to move edge Edge(753->754,w:2.0)(C:W-1(V753_D-1)->T:W-1(V754_D-1)) to (AGCCACAGGT...GCTCACTTCC:W5(V717_D-1)->T:W-1(V754_D-1) adding edge: AGCCACAGGT...GCTCACTTCC:W5(V717_D-1) to T:W-1(V754_D-1) removing edge Edge(753->754,w:2.0)(C:W-1(V753_D-1)->T:W-1(V754_D-1)) removing edge Edge(717->753,w:2.0)(AGCCACAGGT...GCTCACTTCC:W5(V717_D-1)->C:W-1(V753_D-1)) Found potential edge: Edge(717->754,w:2.0) between AGCCACAGGT...GCTCACTTCC:W5(V717_D-1) and T:W-1(V754_D-1) removing vertex T:W-1(V754_D-1) was concatenated into AGCCACAGGT...CTCACTTCCT:W5(V717_D-1) Want to move edge Edge(754->755,w:2.0)(T:W-1(V754_D-1)->G:W-1(V755_D-1)) to (AGCCACAGGT...CTCACTTCCT:W5(V717_D-1)->G:W-1(V755_D-1) adding edge: AGCCACAGGT...CTCACTTCCT:W5(V717_D-1) to G:W-1(V755_D-1) removing edge Edge(754->755,w:2.0)(T:W-1(V754_D-1)->G:W-1(V755_D-1)) removing edge Edge(717->754,w:2.0)(AGCCACAGGT...CTCACTTCCT:W5(V717_D-1)->T:W-1(V754_D-1)) Found potential edge: Edge(717->755,w:2.0) between AGCCACAGGT...CTCACTTCCT:W5(V717_D-1) and G:W-1(V755_D-1) removing vertex G:W-1(V755_D-1) was concatenated into AGCCACAGGT...TCACTTCCTG:W5(V717_D-1) Want to move edge Edge(755->756,w:2.0)(G:W-1(V755_D-1)->T:W-1(V756_D-1)) to (AGCCACAGGT...TCACTTCCTG:W5(V717_D-1)->T:W-1(V756_D-1) adding edge: AGCCACAGGT...TCACTTCCTG:W5(V717_D-1) to T:W-1(V756_D-1) removing edge Edge(755->756,w:2.0)(G:W-1(V755_D-1)->T:W-1(V756_D-1)) removing edge Edge(717->755,w:2.0)(AGCCACAGGT...TCACTTCCTG:W5(V717_D-1)->G:W-1(V755_D-1)) Found potential edge: Edge(717->756,w:2.0) between AGCCACAGGT...TCACTTCCTG:W5(V717_D-1) and T:W-1(V756_D-1) removing vertex T:W-1(V756_D-1) was concatenated into AGCCACAGGT...CACTTCCTGT:W5(V717_D-1) Want to move edge Edge(756->757,w:2.0)(T:W-1(V756_D-1)->G:W-1(V757_D-1)) to (AGCCACAGGT...CACTTCCTGT:W5(V717_D-1)->G:W-1(V757_D-1) adding edge: AGCCACAGGT...CACTTCCTGT:W5(V717_D-1) to G:W-1(V757_D-1) removing edge Edge(756->757,w:2.0)(T:W-1(V756_D-1)->G:W-1(V757_D-1)) removing edge Edge(717->756,w:2.0)(AGCCACAGGT...CACTTCCTGT:W5(V717_D-1)->T:W-1(V756_D-1)) Found potential edge: Edge(717->757,w:2.0) between AGCCACAGGT...CACTTCCTGT:W5(V717_D-1) and G:W-1(V757_D-1) removing vertex G:W-1(V757_D-1) was concatenated into AGCCACAGGT...ACTTCCTGTG:W5(V717_D-1) Want to move edge Edge(757->758,w:2.0)(G:W-1(V757_D-1)->A:W-1(V758_D-1)) to (AGCCACAGGT...ACTTCCTGTG:W5(V717_D-1)->A:W-1(V758_D-1) adding edge: AGCCACAGGT...ACTTCCTGTG:W5(V717_D-1) to A:W-1(V758_D-1) removing edge Edge(757->758,w:2.0)(G:W-1(V757_D-1)->A:W-1(V758_D-1)) removing edge Edge(717->757,w:2.0)(AGCCACAGGT...ACTTCCTGTG:W5(V717_D-1)->G:W-1(V757_D-1)) Found potential edge: Edge(717->758,w:2.0) between AGCCACAGGT...ACTTCCTGTG:W5(V717_D-1) and A:W-1(V758_D-1) removing vertex A:W-1(V758_D-1) was concatenated into AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1) removing edge Edge(717->758,w:2.0)(AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1)->A:W-1(V758_D-1)) Found potential edge: Edge(786->787,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCA:W0(V786_D-1) and A:W-1(V787_D-1) removing vertex A:W-1(V787_D-1) was concatenated into GCTAGGGGAAATAGGGGAGCTCCAA:W0(V786_D-1) Want to move edge Edge(787->788,w:2.0)(A:W-1(V787_D-1)->A:W-1(V788_D-1)) to (GCTAGGGGAAATAGGGGAGCTCCAA:W0(V786_D-1)->A:W-1(V788_D-1) adding edge: GCTAGGGGAAATAGGGGAGCTCCAA:W0(V786_D-1) to A:W-1(V788_D-1) removing edge Edge(787->788,w:2.0)(A:W-1(V787_D-1)->A:W-1(V788_D-1)) removing edge Edge(786->787,w:2.0)(GCTAGGGGAAATAGGGGAGCTCCAA:W0(V786_D-1)->A:W-1(V787_D-1)) Found potential edge: Edge(786->788,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCAA:W0(V786_D-1) and A:W-1(V788_D-1) removing vertex A:W-1(V788_D-1) was concatenated into GCTAGGGGAAATAGGGGAGCTCCAAA:W0(V786_D-1) Want to move edge Edge(788->789,w:2.0)(A:W-1(V788_D-1)->C:W-1(V789_D-1)) to (GCTAGGGGAAATAGGGGAGCTCCAAA:W0(V786_D-1)->C:W-1(V789_D-1) adding edge: GCTAGGGGAAATAGGGGAGCTCCAAA:W0(V786_D-1) to C:W-1(V789_D-1) removing edge Edge(788->789,w:2.0)(A:W-1(V788_D-1)->C:W-1(V789_D-1)) removing edge Edge(786->788,w:2.0)(GCTAGGGGAAATAGGGGAGCTCCAAA:W0(V786_D-1)->A:W-1(V788_D-1)) Found potential edge: Edge(786->789,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCAAA:W0(V786_D-1) and C:W-1(V789_D-1) removing vertex C:W-1(V789_D-1) was concatenated into GCTAGGGGAAATAGGGGAGCTCCAAAC:W0(V786_D-1) Want to move edge Edge(789->790,w:2.0)(C:W-1(V789_D-1)->C:W-1(V790_D-1)) to (GCTAGGGGAAATAGGGGAGCTCCAAAC:W0(V786_D-1)->C:W-1(V790_D-1) adding edge: GCTAGGGGAAATAGGGGAGCTCCAAAC:W0(V786_D-1) to C:W-1(V790_D-1) removing edge Edge(789->790,w:2.0)(C:W-1(V789_D-1)->C:W-1(V790_D-1)) removing edge Edge(786->789,w:2.0)(GCTAGGGGAAATAGGGGAGCTCCAAAC:W0(V786_D-1)->C:W-1(V789_D-1)) Found potential edge: Edge(786->790,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCAAAC:W0(V786_D-1) and C:W-1(V790_D-1) removing vertex C:W-1(V790_D-1) was concatenated into GCTAGGGGAAATAGGGGAGCTCCAAACC:W0(V786_D-1) Want to move edge Edge(790->791,w:2.0)(C:W-1(V790_D-1)->C:W-1(V791_D-1)) to (GCTAGGGGAAATAGGGGAGCTCCAAACC:W0(V786_D-1)->C:W-1(V791_D-1) adding edge: GCTAGGGGAAATAGGGGAGCTCCAAACC:W0(V786_D-1) to C:W-1(V791_D-1) removing edge Edge(790->791,w:2.0)(C:W-1(V790_D-1)->C:W-1(V791_D-1)) removing edge Edge(786->790,w:2.0)(GCTAGGGGAAATAGGGGAGCTCCAAACC:W0(V786_D-1)->C:W-1(V790_D-1)) Found potential edge: Edge(786->791,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCAAACC:W0(V786_D-1) and C:W-1(V791_D-1) removing vertex C:W-1(V791_D-1) was concatenated into GCTAGGGGAAATAGGGGAGCTCCAAACCC:W0(V786_D-1) Want to move edge Edge(791->792,w:2.0)(C:W-1(V791_D-1)->A:W-1(V792_D-1)) to (GCTAGGGGAAATAGGGGAGCTCCAAACCC:W0(V786_D-1)->A:W-1(V792_D-1) adding edge: GCTAGGGGAAATAGGGGAGCTCCAAACCC:W0(V786_D-1) to A:W-1(V792_D-1) removing edge Edge(791->792,w:2.0)(C:W-1(V791_D-1)->A:W-1(V792_D-1)) removing edge Edge(786->791,w:2.0)(GCTAGGGGAAATAGGGGAGCTCCAAACCC:W0(V786_D-1)->C:W-1(V791_D-1)) Found potential edge: Edge(786->792,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCAAACCC:W0(V786_D-1) and A:W-1(V792_D-1) removing vertex A:W-1(V792_D-1) was concatenated into GCTAGGGGAAATAGGGGAGCTCCAAACCCA:W0(V786_D-1) Want to move edge Edge(792->793,w:2.0)(A:W-1(V792_D-1)->G:W-1(V793_D-1)) to (GCTAGGGGAAATAGGGGAGCTCCAAACCCA:W0(V786_D-1)->G:W-1(V793_D-1) adding edge: GCTAGGGGAAATAGGGGAGCTCCAAACCCA:W0(V786_D-1) to G:W-1(V793_D-1) removing edge Edge(792->793,w:2.0)(A:W-1(V792_D-1)->G:W-1(V793_D-1)) removing edge Edge(786->792,w:2.0)(GCTAGGGGAAATAGGGGAGCTCCAAACCCA:W0(V786_D-1)->A:W-1(V792_D-1)) Found potential edge: Edge(786->793,w:2.0) between GCTAGGGGAAATAGGGGAGCTCCAAACCCA:W0(V786_D-1) and G:W-1(V793_D-1) removing vertex G:W-1(V793_D-1) was concatenated into GCTAGGGGAA...CCAAACCCAG:W0(V786_D-1) Want to move edge Edge(793->794,w:2.0)(G:W-1(V793_D-1)->C:W-1(V794_D-1)) to (GCTAGGGGAA...CCAAACCCAG:W0(V786_D-1)->C:W-1(V794_D-1) adding edge: GCTAGGGGAA...CCAAACCCAG:W0(V786_D-1) to C:W-1(V794_D-1) removing edge Edge(793->794,w:2.0)(G:W-1(V793_D-1)->C:W-1(V794_D-1)) removing edge Edge(786->793,w:2.0)(GCTAGGGGAA...CCAAACCCAG:W0(V786_D-1)->G:W-1(V793_D-1)) Found potential edge: Edge(786->794,w:2.0) between GCTAGGGGAA...CCAAACCCAG:W0(V786_D-1) and C:W-1(V794_D-1) removing vertex C:W-1(V794_D-1) was concatenated into GCTAGGGGAA...CAAACCCAGC:W1(V786_D-1) Want to move edge Edge(794->795,w:2.0)(C:W-1(V794_D-1)->C:W-1(V795_D-1)) to (GCTAGGGGAA...CAAACCCAGC:W1(V786_D-1)->C:W-1(V795_D-1) adding edge: GCTAGGGGAA...CAAACCCAGC:W1(V786_D-1) to C:W-1(V795_D-1) removing edge Edge(794->795,w:2.0)(C:W-1(V794_D-1)->C:W-1(V795_D-1)) removing edge Edge(786->794,w:2.0)(GCTAGGGGAA...CAAACCCAGC:W1(V786_D-1)->C:W-1(V794_D-1)) Found potential edge: Edge(786->795,w:2.0) between GCTAGGGGAA...CAAACCCAGC:W1(V786_D-1) and C:W-1(V795_D-1) removing vertex C:W-1(V795_D-1) was concatenated into GCTAGGGGAA...AAACCCAGCC:W1(V786_D-1) Want to move edge Edge(795->796,w:2.0)(C:W-1(V795_D-1)->C:W-1(V796_D-1)) to (GCTAGGGGAA...AAACCCAGCC:W1(V786_D-1)->C:W-1(V796_D-1) adding edge: GCTAGGGGAA...AAACCCAGCC:W1(V786_D-1) to C:W-1(V796_D-1) removing edge Edge(795->796,w:2.0)(C:W-1(V795_D-1)->C:W-1(V796_D-1)) removing edge Edge(786->795,w:2.0)(GCTAGGGGAA...AAACCCAGCC:W1(V786_D-1)->C:W-1(V795_D-1)) Found potential edge: Edge(786->796,w:2.0) between GCTAGGGGAA...AAACCCAGCC:W1(V786_D-1) and C:W-1(V796_D-1) removing vertex C:W-1(V796_D-1) was concatenated into GCTAGGGGAA...AACCCAGCCC:W1(V786_D-1) Want to move edge Edge(796->797,w:2.0)(C:W-1(V796_D-1)->C:W-1(V797_D-1)) to (GCTAGGGGAA...AACCCAGCCC:W1(V786_D-1)->C:W-1(V797_D-1) adding edge: GCTAGGGGAA...AACCCAGCCC:W1(V786_D-1) to C:W-1(V797_D-1) removing edge Edge(796->797,w:2.0)(C:W-1(V796_D-1)->C:W-1(V797_D-1)) removing edge Edge(786->796,w:2.0)(GCTAGGGGAA...AACCCAGCCC:W1(V786_D-1)->C:W-1(V796_D-1)) Found potential edge: Edge(786->797,w:2.0) between GCTAGGGGAA...AACCCAGCCC:W1(V786_D-1) and C:W-1(V797_D-1) removing vertex C:W-1(V797_D-1) was concatenated into GCTAGGGGAA...ACCCAGCCCC:W1(V786_D-1) Want to move edge Edge(797->798,w:2.0)(C:W-1(V797_D-1)->G:W-1(V798_D-1)) to (GCTAGGGGAA...ACCCAGCCCC:W1(V786_D-1)->G:W-1(V798_D-1) adding edge: GCTAGGGGAA...ACCCAGCCCC:W1(V786_D-1) to G:W-1(V798_D-1) removing edge Edge(797->798,w:2.0)(C:W-1(V797_D-1)->G:W-1(V798_D-1)) removing edge Edge(786->797,w:2.0)(GCTAGGGGAA...ACCCAGCCCC:W1(V786_D-1)->C:W-1(V797_D-1)) Found potential edge: Edge(786->798,w:2.0) between GCTAGGGGAA...ACCCAGCCCC:W1(V786_D-1) and G:W-1(V798_D-1) removing vertex G:W-1(V798_D-1) was concatenated into GCTAGGGGAA...CCCAGCCCCG:W1(V786_D-1) Want to move edge Edge(798->799,w:2.0)(G:W-1(V798_D-1)->T:W-1(V799_D-1)) to (GCTAGGGGAA...CCCAGCCCCG:W1(V786_D-1)->T:W-1(V799_D-1) adding edge: GCTAGGGGAA...CCCAGCCCCG:W1(V786_D-1) to T:W-1(V799_D-1) removing edge Edge(798->799,w:2.0)(G:W-1(V798_D-1)->T:W-1(V799_D-1)) removing edge Edge(786->798,w:2.0)(GCTAGGGGAA...CCCAGCCCCG:W1(V786_D-1)->G:W-1(V798_D-1)) Found potential edge: Edge(786->799,w:2.0) between GCTAGGGGAA...CCCAGCCCCG:W1(V786_D-1) and T:W-1(V799_D-1) removing vertex T:W-1(V799_D-1) was concatenated into GCTAGGGGAA...CCAGCCCCGT:W1(V786_D-1) Want to move edge Edge(799->800,w:2.0)(T:W-1(V799_D-1)->G:W-1(V800_D-1)) to (GCTAGGGGAA...CCAGCCCCGT:W1(V786_D-1)->G:W-1(V800_D-1) adding edge: GCTAGGGGAA...CCAGCCCCGT:W1(V786_D-1) to G:W-1(V800_D-1) removing edge Edge(799->800,w:2.0)(T:W-1(V799_D-1)->G:W-1(V800_D-1)) removing edge Edge(786->799,w:2.0)(GCTAGGGGAA...CCAGCCCCGT:W1(V786_D-1)->T:W-1(V799_D-1)) Found potential edge: Edge(786->800,w:2.0) between GCTAGGGGAA...CCAGCCCCGT:W1(V786_D-1) and G:W-1(V800_D-1) removing vertex G:W-1(V800_D-1) was concatenated into GCTAGGGGAA...CAGCCCCGTG:W1(V786_D-1) Want to move edge Edge(800->801,w:2.0)(G:W-1(V800_D-1)->G:W-1(V801_D-1)) to (GCTAGGGGAA...CAGCCCCGTG:W1(V786_D-1)->G:W-1(V801_D-1) adding edge: GCTAGGGGAA...CAGCCCCGTG:W1(V786_D-1) to G:W-1(V801_D-1) removing edge Edge(800->801,w:2.0)(G:W-1(V800_D-1)->G:W-1(V801_D-1)) removing edge Edge(786->800,w:2.0)(GCTAGGGGAA...CAGCCCCGTG:W1(V786_D-1)->G:W-1(V800_D-1)) Found potential edge: Edge(786->801,w:2.0) between GCTAGGGGAA...CAGCCCCGTG:W1(V786_D-1) and G:W-1(V801_D-1) removing vertex G:W-1(V801_D-1) was concatenated into GCTAGGGGAA...AGCCCCGTGG:W1(V786_D-1) Want to move edge Edge(801->802,w:2.0)(G:W-1(V801_D-1)->A:W-1(V802_D-1)) to (GCTAGGGGAA...AGCCCCGTGG:W1(V786_D-1)->A:W-1(V802_D-1) adding edge: GCTAGGGGAA...AGCCCCGTGG:W1(V786_D-1) to A:W-1(V802_D-1) removing edge Edge(801->802,w:2.0)(G:W-1(V801_D-1)->A:W-1(V802_D-1)) removing edge Edge(786->801,w:2.0)(GCTAGGGGAA...AGCCCCGTGG:W1(V786_D-1)->G:W-1(V801_D-1)) Found potential edge: Edge(786->802,w:2.0) between GCTAGGGGAA...AGCCCCGTGG:W1(V786_D-1) and A:W-1(V802_D-1) removing vertex A:W-1(V802_D-1) was concatenated into GCTAGGGGAA...GCCCCGTGGA:W1(V786_D-1) Want to move edge Edge(802->803,w:2.0)(A:W-1(V802_D-1)->G:W-1(V803_D-1)) to (GCTAGGGGAA...GCCCCGTGGA:W1(V786_D-1)->G:W-1(V803_D-1) adding edge: GCTAGGGGAA...GCCCCGTGGA:W1(V786_D-1) to G:W-1(V803_D-1) removing edge Edge(802->803,w:2.0)(A:W-1(V802_D-1)->G:W-1(V803_D-1)) removing edge Edge(786->802,w:2.0)(GCTAGGGGAA...GCCCCGTGGA:W1(V786_D-1)->A:W-1(V802_D-1)) Found potential edge: Edge(786->803,w:2.0) between GCTAGGGGAA...GCCCCGTGGA:W1(V786_D-1) and G:W-1(V803_D-1) removing vertex G:W-1(V803_D-1) was concatenated into GCTAGGGGAA...CCCCGTGGAG:W1(V786_D-1) Want to move edge Edge(803->804,w:2.0)(G:W-1(V803_D-1)->G:W-1(V804_D-1)) to (GCTAGGGGAA...CCCCGTGGAG:W1(V786_D-1)->G:W-1(V804_D-1) adding edge: GCTAGGGGAA...CCCCGTGGAG:W1(V786_D-1) to G:W-1(V804_D-1) removing edge Edge(803->804,w:2.0)(G:W-1(V803_D-1)->G:W-1(V804_D-1)) removing edge Edge(786->803,w:2.0)(GCTAGGGGAA...CCCCGTGGAG:W1(V786_D-1)->G:W-1(V803_D-1)) Found potential edge: Edge(786->804,w:2.0) between GCTAGGGGAA...CCCCGTGGAG:W1(V786_D-1) and G:W-1(V804_D-1) removing vertex G:W-1(V804_D-1) was concatenated into GCTAGGGGAA...CCCGTGGAGG:W1(V786_D-1) Want to move edge Edge(804->805,w:2.0)(G:W-1(V804_D-1)->G:W-1(V805_D-1)) to (GCTAGGGGAA...CCCGTGGAGG:W1(V786_D-1)->G:W-1(V805_D-1) adding edge: GCTAGGGGAA...CCCGTGGAGG:W1(V786_D-1) to G:W-1(V805_D-1) removing edge Edge(804->805,w:2.0)(G:W-1(V804_D-1)->G:W-1(V805_D-1)) removing edge Edge(786->804,w:2.0)(GCTAGGGGAA...CCCGTGGAGG:W1(V786_D-1)->G:W-1(V804_D-1)) Found potential edge: Edge(786->805,w:2.0) between GCTAGGGGAA...CCCGTGGAGG:W1(V786_D-1) and G:W-1(V805_D-1) removing vertex G:W-1(V805_D-1) was concatenated into GCTAGGGGAA...CCGTGGAGGG:W1(V786_D-1) Want to move edge Edge(805->806,w:2.0)(G:W-1(V805_D-1)->A:W-1(V806_D-1)) to (GCTAGGGGAA...CCGTGGAGGG:W1(V786_D-1)->A:W-1(V806_D-1) adding edge: GCTAGGGGAA...CCGTGGAGGG:W1(V786_D-1) to A:W-1(V806_D-1) removing edge Edge(805->806,w:2.0)(G:W-1(V805_D-1)->A:W-1(V806_D-1)) removing edge Edge(786->805,w:2.0)(GCTAGGGGAA...CCGTGGAGGG:W1(V786_D-1)->G:W-1(V805_D-1)) Found potential edge: Edge(786->806,w:2.0) between GCTAGGGGAA...CCGTGGAGGG:W1(V786_D-1) and A:W-1(V806_D-1) removing vertex A:W-1(V806_D-1) was concatenated into GCTAGGGGAA...CGTGGAGGGA:W1(V786_D-1) Want to move edge Edge(806->807,w:2.0)(A:W-1(V806_D-1)->G:W-1(V807_D-1)) to (GCTAGGGGAA...CGTGGAGGGA:W1(V786_D-1)->G:W-1(V807_D-1) adding edge: GCTAGGGGAA...CGTGGAGGGA:W1(V786_D-1) to G:W-1(V807_D-1) removing edge Edge(806->807,w:2.0)(A:W-1(V806_D-1)->G:W-1(V807_D-1)) removing edge Edge(786->806,w:2.0)(GCTAGGGGAA...CGTGGAGGGA:W1(V786_D-1)->A:W-1(V806_D-1)) Found potential edge: Edge(786->807,w:2.0) between GCTAGGGGAA...CGTGGAGGGA:W1(V786_D-1) and G:W-1(V807_D-1) removing vertex G:W-1(V807_D-1) was concatenated into GCTAGGGGAA...GTGGAGGGAG:W1(V786_D-1) Want to move edge Edge(807->808,w:2.0)(G:W-1(V807_D-1)->C:W-1(V808_D-1)) to (GCTAGGGGAA...GTGGAGGGAG:W1(V786_D-1)->C:W-1(V808_D-1) adding edge: GCTAGGGGAA...GTGGAGGGAG:W1(V786_D-1) to C:W-1(V808_D-1) removing edge Edge(807->808,w:2.0)(G:W-1(V807_D-1)->C:W-1(V808_D-1)) removing edge Edge(786->807,w:2.0)(GCTAGGGGAA...GTGGAGGGAG:W1(V786_D-1)->G:W-1(V807_D-1)) Found potential edge: Edge(786->808,w:2.0) between GCTAGGGGAA...GTGGAGGGAG:W1(V786_D-1) and C:W-1(V808_D-1) removing vertex C:W-1(V808_D-1) was concatenated into GCTAGGGGAA...TGGAGGGAGC:W1(V786_D-1) Want to move edge Edge(808->809,w:2.0)(C:W-1(V808_D-1)->C:W-1(V809_D-1)) to (GCTAGGGGAA...TGGAGGGAGC:W1(V786_D-1)->C:W-1(V809_D-1) adding edge: GCTAGGGGAA...TGGAGGGAGC:W1(V786_D-1) to C:W-1(V809_D-1) removing edge Edge(808->809,w:2.0)(C:W-1(V808_D-1)->C:W-1(V809_D-1)) removing edge Edge(786->808,w:2.0)(GCTAGGGGAA...TGGAGGGAGC:W1(V786_D-1)->C:W-1(V808_D-1)) Found potential edge: Edge(786->809,w:2.0) between GCTAGGGGAA...TGGAGGGAGC:W1(V786_D-1) and C:W-1(V809_D-1) removing vertex C:W-1(V809_D-1) was concatenated into GCTAGGGGAA...GGAGGGAGCC:W1(V786_D-1) Want to move edge Edge(809->810,w:2.0)(C:W-1(V809_D-1)->A:W-1(V810_D-1)) to (GCTAGGGGAA...GGAGGGAGCC:W1(V786_D-1)->A:W-1(V810_D-1) adding edge: GCTAGGGGAA...GGAGGGAGCC:W1(V786_D-1) to A:W-1(V810_D-1) removing edge Edge(809->810,w:2.0)(C:W-1(V809_D-1)->A:W-1(V810_D-1)) removing edge Edge(786->809,w:2.0)(GCTAGGGGAA...GGAGGGAGCC:W1(V786_D-1)->C:W-1(V809_D-1)) Found potential edge: Edge(786->810,w:2.0) between GCTAGGGGAA...GGAGGGAGCC:W1(V786_D-1) and A:W-1(V810_D-1) removing vertex A:W-1(V810_D-1) was concatenated into GCTAGGGGAA...GAGGGAGCCA:W1(V786_D-1) Want to move edge Edge(810->811,w:2.0)(A:W-1(V810_D-1)->C:W-1(V811_D-1)) to (GCTAGGGGAA...GAGGGAGCCA:W1(V786_D-1)->C:W-1(V811_D-1) adding edge: GCTAGGGGAA...GAGGGAGCCA:W1(V786_D-1) to C:W-1(V811_D-1) removing edge Edge(810->811,w:2.0)(A:W-1(V810_D-1)->C:W-1(V811_D-1)) removing edge Edge(786->810,w:2.0)(GCTAGGGGAA...GAGGGAGCCA:W1(V786_D-1)->A:W-1(V810_D-1)) Found potential edge: Edge(786->811,w:2.0) between GCTAGGGGAA...GAGGGAGCCA:W1(V786_D-1) and C:W-1(V811_D-1) removing vertex C:W-1(V811_D-1) was concatenated into GCTAGGGGAA...AGGGAGCCAC:W1(V786_D-1) Want to move edge Edge(811->812,w:2.0)(C:W-1(V811_D-1)->C:W-1(V812_D-1)) to (GCTAGGGGAA...AGGGAGCCAC:W1(V786_D-1)->C:W-1(V812_D-1) adding edge: GCTAGGGGAA...AGGGAGCCAC:W1(V786_D-1) to C:W-1(V812_D-1) removing edge Edge(811->812,w:2.0)(C:W-1(V811_D-1)->C:W-1(V812_D-1)) removing edge Edge(786->811,w:2.0)(GCTAGGGGAA...AGGGAGCCAC:W1(V786_D-1)->C:W-1(V811_D-1)) Found potential edge: Edge(786->812,w:2.0) between GCTAGGGGAA...AGGGAGCCAC:W1(V786_D-1) and C:W-1(V812_D-1) removing vertex C:W-1(V812_D-1) was concatenated into GCTAGGGGAA...GGGAGCCACC:W1(V786_D-1) Want to move edge Edge(812->717,w:2.0)(C:W-1(V812_D-1)->AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1)) to (GCTAGGGGAA...GGGAGCCACC:W1(V786_D-1)->AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1) adding edge: GCTAGGGGAA...GGGAGCCACC:W1(V786_D-1) to AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1) removing edge Edge(812->717,w:2.0)(C:W-1(V812_D-1)->AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1)) removing edge Edge(786->812,w:2.0)(GCTAGGGGAA...GGGAGCCACC:W1(V786_D-1)->C:W-1(V812_D-1)) Found potential edge: Edge(813->814,w:2.0) between C:W-1(V813_D-1) and A:W-1(V814_D-1) removing vertex A:W-1(V814_D-1) was concatenated into CA:W2(V813_D-1) Want to move edge Edge(814->815,w:2.0)(A:W-1(V814_D-1)->G:W-1(V815_D-1)) to (CA:W2(V813_D-1)->G:W-1(V815_D-1) adding edge: CA:W2(V813_D-1) to G:W-1(V815_D-1) removing edge Edge(814->815,w:2.0)(A:W-1(V814_D-1)->G:W-1(V815_D-1)) removing edge Edge(813->814,w:2.0)(CA:W2(V813_D-1)->A:W-1(V814_D-1)) Found potential edge: Edge(813->815,w:2.0) between CA:W2(V813_D-1) and G:W-1(V815_D-1) removing vertex G:W-1(V815_D-1) was concatenated into CAG:W2(V813_D-1) Want to move edge Edge(815->816,w:2.0)(G:W-1(V815_D-1)->C:W-1(V816_D-1)) to (CAG:W2(V813_D-1)->C:W-1(V816_D-1) adding edge: CAG:W2(V813_D-1) to C:W-1(V816_D-1) removing edge Edge(815->816,w:2.0)(G:W-1(V815_D-1)->C:W-1(V816_D-1)) removing edge Edge(813->815,w:2.0)(CAG:W2(V813_D-1)->G:W-1(V815_D-1)) Found potential edge: Edge(813->816,w:2.0) between CAG:W2(V813_D-1) and C:W-1(V816_D-1) removing vertex C:W-1(V816_D-1) was concatenated into CAGC:W2(V813_D-1) Want to move edge Edge(816->817,w:2.0)(C:W-1(V816_D-1)->A:W-1(V817_D-1)) to (CAGC:W2(V813_D-1)->A:W-1(V817_D-1) adding edge: CAGC:W2(V813_D-1) to A:W-1(V817_D-1) removing edge Edge(816->817,w:2.0)(C:W-1(V816_D-1)->A:W-1(V817_D-1)) removing edge Edge(813->816,w:2.0)(CAGC:W2(V813_D-1)->C:W-1(V816_D-1)) Found potential edge: Edge(813->817,w:2.0) between CAGC:W2(V813_D-1) and A:W-1(V817_D-1) removing vertex A:W-1(V817_D-1) was concatenated into CAGCA:W2(V813_D-1) Want to move edge Edge(817->818,w:2.0)(A:W-1(V817_D-1)->C:W-1(V818_D-1)) to (CAGCA:W2(V813_D-1)->C:W-1(V818_D-1) adding edge: CAGCA:W2(V813_D-1) to C:W-1(V818_D-1) removing edge Edge(817->818,w:2.0)(A:W-1(V817_D-1)->C:W-1(V818_D-1)) removing edge Edge(813->817,w:2.0)(CAGCA:W2(V813_D-1)->A:W-1(V817_D-1)) Found potential edge: Edge(813->818,w:2.0) between CAGCA:W2(V813_D-1) and C:W-1(V818_D-1) removing vertex C:W-1(V818_D-1) was concatenated into CAGCAC:W2(V813_D-1) Want to move edge Edge(818->819,w:2.0)(C:W-1(V818_D-1)->T:W-1(V819_D-1)) to (CAGCAC:W2(V813_D-1)->T:W-1(V819_D-1) adding edge: CAGCAC:W2(V813_D-1) to T:W-1(V819_D-1) removing edge Edge(818->819,w:2.0)(C:W-1(V818_D-1)->T:W-1(V819_D-1)) removing edge Edge(813->818,w:2.0)(CAGCAC:W2(V813_D-1)->C:W-1(V818_D-1)) Found potential edge: Edge(813->819,w:2.0) between CAGCAC:W2(V813_D-1) and T:W-1(V819_D-1) removing vertex T:W-1(V819_D-1) was concatenated into CAGCACT:W2(V813_D-1) Want to move edge Edge(819->820,w:2.0)(T:W-1(V819_D-1)->C:W-1(V820_D-1)) to (CAGCACT:W2(V813_D-1)->C:W-1(V820_D-1) adding edge: CAGCACT:W2(V813_D-1) to C:W-1(V820_D-1) removing edge Edge(819->820,w:2.0)(T:W-1(V819_D-1)->C:W-1(V820_D-1)) removing edge Edge(813->819,w:2.0)(CAGCACT:W2(V813_D-1)->T:W-1(V819_D-1)) Found potential edge: Edge(813->820,w:2.0) between CAGCACT:W2(V813_D-1) and C:W-1(V820_D-1) removing vertex C:W-1(V820_D-1) was concatenated into CAGCACTC:W2(V813_D-1) Want to move edge Edge(820->821,w:2.0)(C:W-1(V820_D-1)->T:W-1(V821_D-1)) to (CAGCACTC:W2(V813_D-1)->T:W-1(V821_D-1) adding edge: CAGCACTC:W2(V813_D-1) to T:W-1(V821_D-1) removing edge Edge(820->821,w:2.0)(C:W-1(V820_D-1)->T:W-1(V821_D-1)) removing edge Edge(813->820,w:2.0)(CAGCACTC:W2(V813_D-1)->C:W-1(V820_D-1)) Found potential edge: Edge(813->821,w:2.0) between CAGCACTC:W2(V813_D-1) and T:W-1(V821_D-1) removing vertex T:W-1(V821_D-1) was concatenated into CAGCACTCT:W2(V813_D-1) Want to move edge Edge(821->822,w:2.0)(T:W-1(V821_D-1)->G:W-1(V822_D-1)) to (CAGCACTCT:W2(V813_D-1)->G:W-1(V822_D-1) adding edge: CAGCACTCT:W2(V813_D-1) to G:W-1(V822_D-1) removing edge Edge(821->822,w:2.0)(T:W-1(V821_D-1)->G:W-1(V822_D-1)) removing edge Edge(813->821,w:2.0)(CAGCACTCT:W2(V813_D-1)->T:W-1(V821_D-1)) Found potential edge: Edge(813->822,w:2.0) between CAGCACTCT:W2(V813_D-1) and G:W-1(V822_D-1) removing vertex G:W-1(V822_D-1) was concatenated into CAGCACTCTG:W2(V813_D-1) Want to move edge Edge(822->823,w:2.0)(G:W-1(V822_D-1)->A:W-1(V823_D-1)) to (CAGCACTCTG:W2(V813_D-1)->A:W-1(V823_D-1) adding edge: CAGCACTCTG:W2(V813_D-1) to A:W-1(V823_D-1) removing edge Edge(822->823,w:2.0)(G:W-1(V822_D-1)->A:W-1(V823_D-1)) removing edge Edge(813->822,w:2.0)(CAGCACTCTG:W2(V813_D-1)->G:W-1(V822_D-1)) Found potential edge: Edge(813->823,w:2.0) between CAGCACTCTG:W2(V813_D-1) and A:W-1(V823_D-1) removing vertex A:W-1(V823_D-1) was concatenated into CAGCACTCTGA:W2(V813_D-1) Want to move edge Edge(823->824,w:2.0)(A:W-1(V823_D-1)->A:W-1(V824_D-1)) to (CAGCACTCTGA:W2(V813_D-1)->A:W-1(V824_D-1) adding edge: CAGCACTCTGA:W2(V813_D-1) to A:W-1(V824_D-1) removing edge Edge(823->824,w:2.0)(A:W-1(V823_D-1)->A:W-1(V824_D-1)) removing edge Edge(813->823,w:2.0)(CAGCACTCTGA:W2(V813_D-1)->A:W-1(V823_D-1)) Found potential edge: Edge(813->824,w:2.0) between CAGCACTCTGA:W2(V813_D-1) and A:W-1(V824_D-1) removing vertex A:W-1(V824_D-1) was concatenated into CAGCACTCTGAA:W2(V813_D-1) Want to move edge Edge(824->825,w:2.0)(A:W-1(V824_D-1)->C:W-1(V825_D-1)) to (CAGCACTCTGAA:W2(V813_D-1)->C:W-1(V825_D-1) adding edge: CAGCACTCTGAA:W2(V813_D-1) to C:W-1(V825_D-1) removing edge Edge(824->825,w:2.0)(A:W-1(V824_D-1)->C:W-1(V825_D-1)) removing edge Edge(813->824,w:2.0)(CAGCACTCTGAA:W2(V813_D-1)->A:W-1(V824_D-1)) Found potential edge: Edge(813->825,w:2.0) between CAGCACTCTGAA:W2(V813_D-1) and C:W-1(V825_D-1) removing vertex C:W-1(V825_D-1) was concatenated into CAGCACTCTGAAC:W2(V813_D-1) Want to move edge Edge(825->826,w:2.0)(C:W-1(V825_D-1)->C:W-1(V826_D-1)) to (CAGCACTCTGAAC:W2(V813_D-1)->C:W-1(V826_D-1) adding edge: CAGCACTCTGAAC:W2(V813_D-1) to C:W-1(V826_D-1) removing edge Edge(825->826,w:2.0)(C:W-1(V825_D-1)->C:W-1(V826_D-1)) removing edge Edge(813->825,w:2.0)(CAGCACTCTGAAC:W2(V813_D-1)->C:W-1(V825_D-1)) Found potential edge: Edge(813->826,w:2.0) between CAGCACTCTGAAC:W2(V813_D-1) and C:W-1(V826_D-1) removing vertex C:W-1(V826_D-1) was concatenated into CAGCACTCTGAACC:W2(V813_D-1) Want to move edge Edge(826->827,w:2.0)(C:W-1(V826_D-1)->C:W-1(V827_D-1)) to (CAGCACTCTGAACC:W2(V813_D-1)->C:W-1(V827_D-1) adding edge: CAGCACTCTGAACC:W2(V813_D-1) to C:W-1(V827_D-1) removing edge Edge(826->827,w:2.0)(C:W-1(V826_D-1)->C:W-1(V827_D-1)) removing edge Edge(813->826,w:2.0)(CAGCACTCTGAACC:W2(V813_D-1)->C:W-1(V826_D-1)) Found potential edge: Edge(813->827,w:2.0) between CAGCACTCTGAACC:W2(V813_D-1) and C:W-1(V827_D-1) removing vertex C:W-1(V827_D-1) was concatenated into CAGCACTCTGAACCC:W2(V813_D-1) Want to move edge Edge(827->828,w:2.0)(C:W-1(V827_D-1)->T:W-1(V828_D-1)) to (CAGCACTCTGAACCC:W2(V813_D-1)->T:W-1(V828_D-1) adding edge: CAGCACTCTGAACCC:W2(V813_D-1) to T:W-1(V828_D-1) removing edge Edge(827->828,w:2.0)(C:W-1(V827_D-1)->T:W-1(V828_D-1)) removing edge Edge(813->827,w:2.0)(CAGCACTCTGAACCC:W2(V813_D-1)->C:W-1(V827_D-1)) Found potential edge: Edge(813->828,w:2.0) between CAGCACTCTGAACCC:W2(V813_D-1) and T:W-1(V828_D-1) removing vertex T:W-1(V828_D-1) was concatenated into CAGCACTCTGAACCCT:W2(V813_D-1) Want to move edge Edge(828->829,w:2.0)(T:W-1(V828_D-1)->G:W-1(V829_D-1)) to (CAGCACTCTGAACCCT:W2(V813_D-1)->G:W-1(V829_D-1) adding edge: CAGCACTCTGAACCCT:W2(V813_D-1) to G:W-1(V829_D-1) removing edge Edge(828->829,w:2.0)(T:W-1(V828_D-1)->G:W-1(V829_D-1)) removing edge Edge(813->828,w:2.0)(CAGCACTCTGAACCCT:W2(V813_D-1)->T:W-1(V828_D-1)) Found potential edge: Edge(813->829,w:2.0) between CAGCACTCTGAACCCT:W2(V813_D-1) and G:W-1(V829_D-1) removing vertex G:W-1(V829_D-1) was concatenated into CAGCACTCTGAACCCTG:W2(V813_D-1) Want to move edge Edge(829->830,w:2.0)(G:W-1(V829_D-1)->T:W-1(V830_D-1)) to (CAGCACTCTGAACCCTG:W2(V813_D-1)->T:W-1(V830_D-1) adding edge: CAGCACTCTGAACCCTG:W2(V813_D-1) to T:W-1(V830_D-1) removing edge Edge(829->830,w:2.0)(G:W-1(V829_D-1)->T:W-1(V830_D-1)) removing edge Edge(813->829,w:2.0)(CAGCACTCTGAACCCTG:W2(V813_D-1)->G:W-1(V829_D-1)) Found potential edge: Edge(813->830,w:2.0) between CAGCACTCTGAACCCTG:W2(V813_D-1) and T:W-1(V830_D-1) removing vertex T:W-1(V830_D-1) was concatenated into CAGCACTCTGAACCCTGT:W2(V813_D-1) Want to move edge Edge(830->831,w:2.0)(T:W-1(V830_D-1)->G:W-1(V831_D-1)) to (CAGCACTCTGAACCCTGT:W2(V813_D-1)->G:W-1(V831_D-1) adding edge: CAGCACTCTGAACCCTGT:W2(V813_D-1) to G:W-1(V831_D-1) removing edge Edge(830->831,w:2.0)(T:W-1(V830_D-1)->G:W-1(V831_D-1)) removing edge Edge(813->830,w:2.0)(CAGCACTCTGAACCCTGT:W2(V813_D-1)->T:W-1(V830_D-1)) Found potential edge: Edge(813->831,w:2.0) between CAGCACTCTGAACCCTGT:W2(V813_D-1) and G:W-1(V831_D-1) removing vertex G:W-1(V831_D-1) was concatenated into CAGCACTCTGAACCCTGTG:W2(V813_D-1) Want to move edge Edge(831->832,w:2.0)(G:W-1(V831_D-1)->A:W-1(V832_D-1)) to (CAGCACTCTGAACCCTGTG:W2(V813_D-1)->A:W-1(V832_D-1) adding edge: CAGCACTCTGAACCCTGTG:W2(V813_D-1) to A:W-1(V832_D-1) removing edge Edge(831->832,w:2.0)(G:W-1(V831_D-1)->A:W-1(V832_D-1)) removing edge Edge(813->831,w:2.0)(CAGCACTCTGAACCCTGTG:W2(V813_D-1)->G:W-1(V831_D-1)) Found potential edge: Edge(813->832,w:2.0) between CAGCACTCTGAACCCTGTG:W2(V813_D-1) and A:W-1(V832_D-1) removing vertex A:W-1(V832_D-1) was concatenated into CAGCACTCTGAACCCTGTGA:W2(V813_D-1) Want to move edge Edge(832->833,w:2.0)(A:W-1(V832_D-1)->G:W-1(V833_D-1)) to (CAGCACTCTGAACCCTGTGA:W2(V813_D-1)->G:W-1(V833_D-1) adding edge: CAGCACTCTGAACCCTGTGA:W2(V813_D-1) to G:W-1(V833_D-1) removing edge Edge(832->833,w:2.0)(A:W-1(V832_D-1)->G:W-1(V833_D-1)) removing edge Edge(813->832,w:2.0)(CAGCACTCTGAACCCTGTGA:W2(V813_D-1)->A:W-1(V832_D-1)) Found potential edge: Edge(813->833,w:2.0) between CAGCACTCTGAACCCTGTGA:W2(V813_D-1) and G:W-1(V833_D-1) removing vertex G:W-1(V833_D-1) was concatenated into CAGCACTCTGAACCCTGTGAG:W2(V813_D-1) Want to move edge Edge(833->834,w:2.0)(G:W-1(V833_D-1)->G:W-1(V834_D-1)) to (CAGCACTCTGAACCCTGTGAG:W2(V813_D-1)->G:W-1(V834_D-1) adding edge: CAGCACTCTGAACCCTGTGAG:W2(V813_D-1) to G:W-1(V834_D-1) removing edge Edge(833->834,w:2.0)(G:W-1(V833_D-1)->G:W-1(V834_D-1)) removing edge Edge(813->833,w:2.0)(CAGCACTCTGAACCCTGTGAG:W2(V813_D-1)->G:W-1(V833_D-1)) Found potential edge: Edge(813->834,w:2.0) between CAGCACTCTGAACCCTGTGAG:W2(V813_D-1) and G:W-1(V834_D-1) removing vertex G:W-1(V834_D-1) was concatenated into CAGCACTCTGAACCCTGTGAGG:W2(V813_D-1) Want to move edge Edge(834->835,w:2.0)(G:W-1(V834_D-1)->C:W-1(V835_D-1)) to (CAGCACTCTGAACCCTGTGAGG:W2(V813_D-1)->C:W-1(V835_D-1) adding edge: CAGCACTCTGAACCCTGTGAGG:W2(V813_D-1) to C:W-1(V835_D-1) removing edge Edge(834->835,w:2.0)(G:W-1(V834_D-1)->C:W-1(V835_D-1)) removing edge Edge(813->834,w:2.0)(CAGCACTCTGAACCCTGTGAGG:W2(V813_D-1)->G:W-1(V834_D-1)) Found potential edge: Edge(813->835,w:2.0) between CAGCACTCTGAACCCTGTGAGG:W2(V813_D-1) and C:W-1(V835_D-1) removing vertex C:W-1(V835_D-1) was concatenated into CAGCACTCTGAACCCTGTGAGGC:W2(V813_D-1) Want to move edge Edge(835->836,w:2.0)(C:W-1(V835_D-1)->A:W-1(V836_D-1)) to (CAGCACTCTGAACCCTGTGAGGC:W2(V813_D-1)->A:W-1(V836_D-1) adding edge: CAGCACTCTGAACCCTGTGAGGC:W2(V813_D-1) to A:W-1(V836_D-1) removing edge Edge(835->836,w:2.0)(C:W-1(V835_D-1)->A:W-1(V836_D-1)) removing edge Edge(813->835,w:2.0)(CAGCACTCTGAACCCTGTGAGGC:W2(V813_D-1)->C:W-1(V835_D-1)) Found potential edge: Edge(813->836,w:2.0) between CAGCACTCTGAACCCTGTGAGGC:W2(V813_D-1) and A:W-1(V836_D-1) removing vertex A:W-1(V836_D-1) was concatenated into CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1) Want to move edge Edge(836->549,w:2.0)(A:W-1(V836_D-1)->AGTCCACCAC...GGGAGCCACC:W6(V549_D-1)) to (CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1)->AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) adding edge: CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1) to AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) removing edge Edge(836->549,w:2.0)(A:W-1(V836_D-1)->AGTCCACCAC...GGGAGCCACC:W6(V549_D-1)) removing edge Edge(813->836,w:2.0)(CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1)->A:W-1(V836_D-1)) Found potential edge: Edge(885->886,w:2.0) between G:W-1(V885_D-1) and C:W-1(V886_D-1) removing vertex C:W-1(V886_D-1) was concatenated into GC:W2(V885_D-1) Want to move edge Edge(886->887,w:2.0)(C:W-1(V886_D-1)->T:W-1(V887_D-1)) to (GC:W2(V885_D-1)->T:W-1(V887_D-1) adding edge: GC:W2(V885_D-1) to T:W-1(V887_D-1) removing edge Edge(886->887,w:2.0)(C:W-1(V886_D-1)->T:W-1(V887_D-1)) removing edge Edge(885->886,w:2.0)(GC:W2(V885_D-1)->C:W-1(V886_D-1)) Found potential edge: Edge(885->887,w:2.0) between GC:W2(V885_D-1) and T:W-1(V887_D-1) removing vertex T:W-1(V887_D-1) was concatenated into GCT:W2(V885_D-1) Want to move edge Edge(887->888,w:2.0)(T:W-1(V887_D-1)->C:W-1(V888_D-1)) to (GCT:W2(V885_D-1)->C:W-1(V888_D-1) adding edge: GCT:W2(V885_D-1) to C:W-1(V888_D-1) removing edge Edge(887->888,w:2.0)(T:W-1(V887_D-1)->C:W-1(V888_D-1)) removing edge Edge(885->887,w:2.0)(GCT:W2(V885_D-1)->T:W-1(V887_D-1)) Found potential edge: Edge(885->888,w:2.0) between GCT:W2(V885_D-1) and C:W-1(V888_D-1) removing vertex C:W-1(V888_D-1) was concatenated into GCTC:W2(V885_D-1) Want to move edge Edge(888->889,w:2.0)(C:W-1(V888_D-1)->A:W-1(V889_D-1)) to (GCTC:W2(V885_D-1)->A:W-1(V889_D-1) adding edge: GCTC:W2(V885_D-1) to A:W-1(V889_D-1) removing edge Edge(888->889,w:2.0)(C:W-1(V888_D-1)->A:W-1(V889_D-1)) removing edge Edge(885->888,w:2.0)(GCTC:W2(V885_D-1)->C:W-1(V888_D-1)) Found potential edge: Edge(885->889,w:2.0) between GCTC:W2(V885_D-1) and A:W-1(V889_D-1) removing vertex A:W-1(V889_D-1) was concatenated into GCTCA:W2(V885_D-1) Want to move edge Edge(889->890,w:2.0)(A:W-1(V889_D-1)->T:W-1(V890_D-1)) to (GCTCA:W2(V885_D-1)->T:W-1(V890_D-1) adding edge: GCTCA:W2(V885_D-1) to T:W-1(V890_D-1) removing edge Edge(889->890,w:2.0)(A:W-1(V889_D-1)->T:W-1(V890_D-1)) removing edge Edge(885->889,w:2.0)(GCTCA:W2(V885_D-1)->A:W-1(V889_D-1)) Found potential edge: Edge(885->890,w:2.0) between GCTCA:W2(V885_D-1) and T:W-1(V890_D-1) removing vertex T:W-1(V890_D-1) was concatenated into GCTCAT:W2(V885_D-1) Want to move edge Edge(890->891,w:2.0)(T:W-1(V890_D-1)->C:W-1(V891_D-1)) to (GCTCAT:W2(V885_D-1)->C:W-1(V891_D-1) adding edge: GCTCAT:W2(V885_D-1) to C:W-1(V891_D-1) removing edge Edge(890->891,w:2.0)(T:W-1(V890_D-1)->C:W-1(V891_D-1)) removing edge Edge(885->890,w:2.0)(GCTCAT:W2(V885_D-1)->T:W-1(V890_D-1)) Found potential edge: Edge(885->891,w:2.0) between GCTCAT:W2(V885_D-1) and C:W-1(V891_D-1) removing vertex C:W-1(V891_D-1) was concatenated into GCTCATC:W2(V885_D-1) Want to move edge Edge(891->892,w:2.0)(C:W-1(V891_D-1)->A:W-1(V892_D-1)) to (GCTCATC:W2(V885_D-1)->A:W-1(V892_D-1) adding edge: GCTCATC:W2(V885_D-1) to A:W-1(V892_D-1) removing edge Edge(891->892,w:2.0)(C:W-1(V891_D-1)->A:W-1(V892_D-1)) removing edge Edge(885->891,w:2.0)(GCTCATC:W2(V885_D-1)->C:W-1(V891_D-1)) Found potential edge: Edge(885->892,w:2.0) between GCTCATC:W2(V885_D-1) and A:W-1(V892_D-1) removing vertex A:W-1(V892_D-1) was concatenated into GCTCATCA:W2(V885_D-1) Want to move edge Edge(892->893,w:2.0)(A:W-1(V892_D-1)->G:W-1(V893_D-1)) to (GCTCATCA:W2(V885_D-1)->G:W-1(V893_D-1) adding edge: GCTCATCA:W2(V885_D-1) to G:W-1(V893_D-1) removing edge Edge(892->893,w:2.0)(A:W-1(V892_D-1)->G:W-1(V893_D-1)) removing edge Edge(885->892,w:2.0)(GCTCATCA:W2(V885_D-1)->A:W-1(V892_D-1)) Found potential edge: Edge(885->893,w:2.0) between GCTCATCA:W2(V885_D-1) and G:W-1(V893_D-1) removing vertex G:W-1(V893_D-1) was concatenated into GCTCATCAG:W2(V885_D-1) Want to move edge Edge(893->894,w:2.0)(G:W-1(V893_D-1)->C:W-1(V894_D-1)) to (GCTCATCAG:W2(V885_D-1)->C:W-1(V894_D-1) adding edge: GCTCATCAG:W2(V885_D-1) to C:W-1(V894_D-1) removing edge Edge(893->894,w:2.0)(G:W-1(V893_D-1)->C:W-1(V894_D-1)) removing edge Edge(885->893,w:2.0)(GCTCATCAG:W2(V885_D-1)->G:W-1(V893_D-1)) Found potential edge: Edge(885->894,w:2.0) between GCTCATCAG:W2(V885_D-1) and C:W-1(V894_D-1) removing vertex C:W-1(V894_D-1) was concatenated into GCTCATCAGC:W2(V885_D-1) Want to move edge Edge(894->895,w:2.0)(C:W-1(V894_D-1)->A:W-1(V895_D-1)) to (GCTCATCAGC:W2(V885_D-1)->A:W-1(V895_D-1) adding edge: GCTCATCAGC:W2(V885_D-1) to A:W-1(V895_D-1) removing edge Edge(894->895,w:2.0)(C:W-1(V894_D-1)->A:W-1(V895_D-1)) removing edge Edge(885->894,w:2.0)(GCTCATCAGC:W2(V885_D-1)->C:W-1(V894_D-1)) Found potential edge: Edge(885->895,w:2.0) between GCTCATCAGC:W2(V885_D-1) and A:W-1(V895_D-1) removing vertex A:W-1(V895_D-1) was concatenated into GCTCATCAGCA:W2(V885_D-1) Want to move edge Edge(895->896,w:2.0)(A:W-1(V895_D-1)->A:W-1(V896_D-1)) to (GCTCATCAGCA:W2(V885_D-1)->A:W-1(V896_D-1) adding edge: GCTCATCAGCA:W2(V885_D-1) to A:W-1(V896_D-1) removing edge Edge(895->896,w:2.0)(A:W-1(V895_D-1)->A:W-1(V896_D-1)) removing edge Edge(885->895,w:2.0)(GCTCATCAGCA:W2(V885_D-1)->A:W-1(V895_D-1)) Found potential edge: Edge(885->896,w:2.0) between GCTCATCAGCA:W2(V885_D-1) and A:W-1(V896_D-1) removing vertex A:W-1(V896_D-1) was concatenated into GCTCATCAGCAA:W2(V885_D-1) Want to move edge Edge(896->897,w:2.0)(A:W-1(V896_D-1)->G:W-1(V897_D-1)) to (GCTCATCAGCAA:W2(V885_D-1)->G:W-1(V897_D-1) adding edge: GCTCATCAGCAA:W2(V885_D-1) to G:W-1(V897_D-1) removing edge Edge(896->897,w:2.0)(A:W-1(V896_D-1)->G:W-1(V897_D-1)) removing edge Edge(885->896,w:2.0)(GCTCATCAGCAA:W2(V885_D-1)->A:W-1(V896_D-1)) Found potential edge: Edge(885->897,w:2.0) between GCTCATCAGCAA:W2(V885_D-1) and G:W-1(V897_D-1) removing vertex G:W-1(V897_D-1) was concatenated into GCTCATCAGCAAG:W2(V885_D-1) Want to move edge Edge(897->898,w:2.0)(G:W-1(V897_D-1)->A:W-1(V898_D-1)) to (GCTCATCAGCAAG:W2(V885_D-1)->A:W-1(V898_D-1) adding edge: GCTCATCAGCAAG:W2(V885_D-1) to A:W-1(V898_D-1) removing edge Edge(897->898,w:2.0)(G:W-1(V897_D-1)->A:W-1(V898_D-1)) removing edge Edge(885->897,w:2.0)(GCTCATCAGCAAG:W2(V885_D-1)->G:W-1(V897_D-1)) Found potential edge: Edge(885->898,w:2.0) between GCTCATCAGCAAG:W2(V885_D-1) and A:W-1(V898_D-1) removing vertex A:W-1(V898_D-1) was concatenated into GCTCATCAGCAAGA:W2(V885_D-1) Want to move edge Edge(898->899,w:2.0)(A:W-1(V898_D-1)->A:W-1(V899_D-1)) to (GCTCATCAGCAAGA:W2(V885_D-1)->A:W-1(V899_D-1) adding edge: GCTCATCAGCAAGA:W2(V885_D-1) to A:W-1(V899_D-1) removing edge Edge(898->899,w:2.0)(A:W-1(V898_D-1)->A:W-1(V899_D-1)) removing edge Edge(885->898,w:2.0)(GCTCATCAGCAAGA:W2(V885_D-1)->A:W-1(V898_D-1)) Found potential edge: Edge(885->899,w:2.0) between GCTCATCAGCAAGA:W2(V885_D-1) and A:W-1(V899_D-1) removing vertex A:W-1(V899_D-1) was concatenated into GCTCATCAGCAAGAA:W2(V885_D-1) Want to move edge Edge(899->900,w:2.0)(A:W-1(V899_D-1)->G:W-1(V900_D-1)) to (GCTCATCAGCAAGAA:W2(V885_D-1)->G:W-1(V900_D-1) adding edge: GCTCATCAGCAAGAA:W2(V885_D-1) to G:W-1(V900_D-1) removing edge Edge(899->900,w:2.0)(A:W-1(V899_D-1)->G:W-1(V900_D-1)) removing edge Edge(885->899,w:2.0)(GCTCATCAGCAAGAA:W2(V885_D-1)->A:W-1(V899_D-1)) Found potential edge: Edge(885->900,w:2.0) between GCTCATCAGCAAGAA:W2(V885_D-1) and G:W-1(V900_D-1) removing vertex G:W-1(V900_D-1) was concatenated into GCTCATCAGCAAGAAG:W2(V885_D-1) Want to move edge Edge(900->901,w:2.0)(G:W-1(V900_D-1)->A:W-1(V901_D-1)) to (GCTCATCAGCAAGAAG:W2(V885_D-1)->A:W-1(V901_D-1) adding edge: GCTCATCAGCAAGAAG:W2(V885_D-1) to A:W-1(V901_D-1) removing edge Edge(900->901,w:2.0)(G:W-1(V900_D-1)->A:W-1(V901_D-1)) removing edge Edge(885->900,w:2.0)(GCTCATCAGCAAGAAG:W2(V885_D-1)->G:W-1(V900_D-1)) Found potential edge: Edge(885->901,w:2.0) between GCTCATCAGCAAGAAG:W2(V885_D-1) and A:W-1(V901_D-1) removing vertex A:W-1(V901_D-1) was concatenated into GCTCATCAGCAAGAAGA:W2(V885_D-1) Want to move edge Edge(901->902,w:2.0)(A:W-1(V901_D-1)->A:W-1(V902_D-1)) to (GCTCATCAGCAAGAAGA:W2(V885_D-1)->A:W-1(V902_D-1) adding edge: GCTCATCAGCAAGAAGA:W2(V885_D-1) to A:W-1(V902_D-1) removing edge Edge(901->902,w:2.0)(A:W-1(V901_D-1)->A:W-1(V902_D-1)) removing edge Edge(885->901,w:2.0)(GCTCATCAGCAAGAAGA:W2(V885_D-1)->A:W-1(V901_D-1)) Found potential edge: Edge(885->902,w:2.0) between GCTCATCAGCAAGAAGA:W2(V885_D-1) and A:W-1(V902_D-1) removing vertex A:W-1(V902_D-1) was concatenated into GCTCATCAGCAAGAAGAA:W2(V885_D-1) Want to move edge Edge(902->903,w:2.0)(A:W-1(V902_D-1)->A:W-1(V903_D-1)) to (GCTCATCAGCAAGAAGAA:W2(V885_D-1)->A:W-1(V903_D-1) adding edge: GCTCATCAGCAAGAAGAA:W2(V885_D-1) to A:W-1(V903_D-1) removing edge Edge(902->903,w:2.0)(A:W-1(V902_D-1)->A:W-1(V903_D-1)) removing edge Edge(885->902,w:2.0)(GCTCATCAGCAAGAAGAA:W2(V885_D-1)->A:W-1(V902_D-1)) Found potential edge: Edge(885->903,w:2.0) between GCTCATCAGCAAGAAGAA:W2(V885_D-1) and A:W-1(V903_D-1) removing vertex A:W-1(V903_D-1) was concatenated into GCTCATCAGCAAGAAGAAA:W2(V885_D-1) Want to move edge Edge(903->904,w:2.0)(A:W-1(V903_D-1)->T:W-1(V904_D-1)) to (GCTCATCAGCAAGAAGAAA:W2(V885_D-1)->T:W-1(V904_D-1) adding edge: GCTCATCAGCAAGAAGAAA:W2(V885_D-1) to T:W-1(V904_D-1) removing edge Edge(903->904,w:2.0)(A:W-1(V903_D-1)->T:W-1(V904_D-1)) removing edge Edge(885->903,w:2.0)(GCTCATCAGCAAGAAGAAA:W2(V885_D-1)->A:W-1(V903_D-1)) Found potential edge: Edge(885->904,w:2.0) between GCTCATCAGCAAGAAGAAA:W2(V885_D-1) and T:W-1(V904_D-1) removing vertex T:W-1(V904_D-1) was concatenated into GCTCATCAGCAAGAAGAAAT:W2(V885_D-1) Want to move edge Edge(904->905,w:2.0)(T:W-1(V904_D-1)->C:W-1(V905_D-1)) to (GCTCATCAGCAAGAAGAAAT:W2(V885_D-1)->C:W-1(V905_D-1) adding edge: GCTCATCAGCAAGAAGAAAT:W2(V885_D-1) to C:W-1(V905_D-1) removing edge Edge(904->905,w:2.0)(T:W-1(V904_D-1)->C:W-1(V905_D-1)) removing edge Edge(885->904,w:2.0)(GCTCATCAGCAAGAAGAAAT:W2(V885_D-1)->T:W-1(V904_D-1)) Found potential edge: Edge(885->905,w:2.0) between GCTCATCAGCAAGAAGAAAT:W2(V885_D-1) and C:W-1(V905_D-1) removing vertex C:W-1(V905_D-1) was concatenated into GCTCATCAGCAAGAAGAAATC:W2(V885_D-1) Want to move edge Edge(905->906,w:2.0)(C:W-1(V905_D-1)->T:W-1(V906_D-1)) to (GCTCATCAGCAAGAAGAAATC:W2(V885_D-1)->T:W-1(V906_D-1) adding edge: GCTCATCAGCAAGAAGAAATC:W2(V885_D-1) to T:W-1(V906_D-1) removing edge Edge(905->906,w:2.0)(C:W-1(V905_D-1)->T:W-1(V906_D-1)) removing edge Edge(885->905,w:2.0)(GCTCATCAGCAAGAAGAAATC:W2(V885_D-1)->C:W-1(V905_D-1)) Found potential edge: Edge(885->906,w:2.0) between GCTCATCAGCAAGAAGAAATC:W2(V885_D-1) and T:W-1(V906_D-1) removing vertex T:W-1(V906_D-1) was concatenated into GCTCATCAGCAAGAAGAAATCT:W2(V885_D-1) Want to move edge Edge(906->907,w:2.0)(T:W-1(V906_D-1)->T:W-1(V907_D-1)) to (GCTCATCAGCAAGAAGAAATCT:W2(V885_D-1)->T:W-1(V907_D-1) adding edge: GCTCATCAGCAAGAAGAAATCT:W2(V885_D-1) to T:W-1(V907_D-1) removing edge Edge(906->907,w:2.0)(T:W-1(V906_D-1)->T:W-1(V907_D-1)) removing edge Edge(885->906,w:2.0)(GCTCATCAGCAAGAAGAAATCT:W2(V885_D-1)->T:W-1(V906_D-1)) Found potential edge: Edge(885->907,w:2.0) between GCTCATCAGCAAGAAGAAATCT:W2(V885_D-1) and T:W-1(V907_D-1) removing vertex T:W-1(V907_D-1) was concatenated into GCTCATCAGCAAGAAGAAATCTT:W2(V885_D-1) Want to move edge Edge(907->908,w:2.0)(T:W-1(V907_D-1)->T:W-1(V908_D-1)) to (GCTCATCAGCAAGAAGAAATCTT:W2(V885_D-1)->T:W-1(V908_D-1) adding edge: GCTCATCAGCAAGAAGAAATCTT:W2(V885_D-1) to T:W-1(V908_D-1) removing edge Edge(907->908,w:2.0)(T:W-1(V907_D-1)->T:W-1(V908_D-1)) removing edge Edge(885->907,w:2.0)(GCTCATCAGCAAGAAGAAATCTT:W2(V885_D-1)->T:W-1(V907_D-1)) Found potential edge: Edge(885->908,w:2.0) between GCTCATCAGCAAGAAGAAATCTT:W2(V885_D-1) and T:W-1(V908_D-1) removing vertex T:W-1(V908_D-1) was concatenated into GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1) Want to move edge Edge(908->440,w:2.0)(T:W-1(V908_D-1)->CTTTCCAAGTA:W8(V440_D-1)) to (GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1)->CTTTCCAAGTA:W8(V440_D-1) adding edge: GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1) to CTTTCCAAGTA:W8(V440_D-1) removing edge Edge(908->440,w:2.0)(T:W-1(V908_D-1)->CTTTCCAAGTA:W8(V440_D-1)) removing edge Edge(885->908,w:2.0)(GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1)->T:W-1(V908_D-1)) Found potential edge: Edge(945->946,w:2.0) between AGAATACAAAATGCCTTCCTCCAG:W0(V945_D-1) and C:W-1(V946_D-1) removing vertex C:W-1(V946_D-1) was concatenated into AGAATACAAAATGCCTTCCTCCAGC:W0(V945_D-1) Want to move edge Edge(946->947,w:2.0)(C:W-1(V946_D-1)->C:W-1(V947_D-1)) to (AGAATACAAAATGCCTTCCTCCAGC:W0(V945_D-1)->C:W-1(V947_D-1) adding edge: AGAATACAAAATGCCTTCCTCCAGC:W0(V945_D-1) to C:W-1(V947_D-1) removing edge Edge(946->947,w:2.0)(C:W-1(V946_D-1)->C:W-1(V947_D-1)) removing edge Edge(945->946,w:2.0)(AGAATACAAAATGCCTTCCTCCAGC:W0(V945_D-1)->C:W-1(V946_D-1)) Found potential edge: Edge(945->947,w:2.0) between AGAATACAAAATGCCTTCCTCCAGC:W0(V945_D-1) and C:W-1(V947_D-1) removing vertex C:W-1(V947_D-1) was concatenated into AGAATACAAAATGCCTTCCTCCAGCC:W0(V945_D-1) Want to move edge Edge(947->948,w:2.0)(C:W-1(V947_D-1)->T:W-1(V948_D-1)) to (AGAATACAAAATGCCTTCCTCCAGCC:W0(V945_D-1)->T:W-1(V948_D-1) adding edge: AGAATACAAAATGCCTTCCTCCAGCC:W0(V945_D-1) to T:W-1(V948_D-1) removing edge Edge(947->948,w:2.0)(C:W-1(V947_D-1)->T:W-1(V948_D-1)) removing edge Edge(945->947,w:2.0)(AGAATACAAAATGCCTTCCTCCAGCC:W0(V945_D-1)->C:W-1(V947_D-1)) Found potential edge: Edge(945->948,w:2.0) between AGAATACAAAATGCCTTCCTCCAGCC:W0(V945_D-1) and T:W-1(V948_D-1) removing vertex T:W-1(V948_D-1) was concatenated into AGAATACAAAATGCCTTCCTCCAGCCT:W0(V945_D-1) Want to move edge Edge(948->949,w:2.0)(T:W-1(V948_D-1)->C:W-1(V949_D-1)) to (AGAATACAAAATGCCTTCCTCCAGCCT:W0(V945_D-1)->C:W-1(V949_D-1) adding edge: AGAATACAAAATGCCTTCCTCCAGCCT:W0(V945_D-1) to C:W-1(V949_D-1) removing edge Edge(948->949,w:2.0)(T:W-1(V948_D-1)->C:W-1(V949_D-1)) removing edge Edge(945->948,w:2.0)(AGAATACAAAATGCCTTCCTCCAGCCT:W0(V945_D-1)->T:W-1(V948_D-1)) Found potential edge: Edge(945->949,w:2.0) between AGAATACAAAATGCCTTCCTCCAGCCT:W0(V945_D-1) and C:W-1(V949_D-1) removing vertex C:W-1(V949_D-1) was concatenated into AGAATACAAAATGCCTTCCTCCAGCCTC:W0(V945_D-1) Want to move edge Edge(949->950,w:2.0)(C:W-1(V949_D-1)->A:W-1(V950_D-1)) to (AGAATACAAAATGCCTTCCTCCAGCCTC:W0(V945_D-1)->A:W-1(V950_D-1) adding edge: AGAATACAAAATGCCTTCCTCCAGCCTC:W0(V945_D-1) to A:W-1(V950_D-1) removing edge Edge(949->950,w:2.0)(C:W-1(V949_D-1)->A:W-1(V950_D-1)) removing edge Edge(945->949,w:2.0)(AGAATACAAAATGCCTTCCTCCAGCCTC:W0(V945_D-1)->C:W-1(V949_D-1)) Found potential edge: Edge(945->950,w:2.0) between AGAATACAAAATGCCTTCCTCCAGCCTC:W0(V945_D-1) and A:W-1(V950_D-1) removing vertex A:W-1(V950_D-1) was concatenated into AGAATACAAAATGCCTTCCTCCAGCCTCA:W0(V945_D-1) Want to move edge Edge(950->951,w:2.0)(A:W-1(V950_D-1)->T:W-1(V951_D-1)) to (AGAATACAAAATGCCTTCCTCCAGCCTCA:W0(V945_D-1)->T:W-1(V951_D-1) adding edge: AGAATACAAAATGCCTTCCTCCAGCCTCA:W0(V945_D-1) to T:W-1(V951_D-1) removing edge Edge(950->951,w:2.0)(A:W-1(V950_D-1)->T:W-1(V951_D-1)) removing edge Edge(945->950,w:2.0)(AGAATACAAAATGCCTTCCTCCAGCCTCA:W0(V945_D-1)->A:W-1(V950_D-1)) Found potential edge: Edge(945->951,w:2.0) between AGAATACAAAATGCCTTCCTCCAGCCTCA:W0(V945_D-1) and T:W-1(V951_D-1) removing vertex T:W-1(V951_D-1) was concatenated into AGAATACAAAATGCCTTCCTCCAGCCTCAT:W0(V945_D-1) Want to move edge Edge(951->952,w:2.0)(T:W-1(V951_D-1)->C:W-1(V952_D-1)) to (AGAATACAAAATGCCTTCCTCCAGCCTCAT:W0(V945_D-1)->C:W-1(V952_D-1) adding edge: AGAATACAAAATGCCTTCCTCCAGCCTCAT:W0(V945_D-1) to C:W-1(V952_D-1) removing edge Edge(951->952,w:2.0)(T:W-1(V951_D-1)->C:W-1(V952_D-1)) removing edge Edge(945->951,w:2.0)(AGAATACAAAATGCCTTCCTCCAGCCTCAT:W0(V945_D-1)->T:W-1(V951_D-1)) Found potential edge: Edge(945->952,w:2.0) between AGAATACAAAATGCCTTCCTCCAGCCTCAT:W0(V945_D-1) and C:W-1(V952_D-1) removing vertex C:W-1(V952_D-1) was concatenated into AGAATACAAA...CAGCCTCATC:W0(V945_D-1) Want to move edge Edge(952->953,w:2.0)(C:W-1(V952_D-1)->A:W-1(V953_D-1)) to (AGAATACAAA...CAGCCTCATC:W0(V945_D-1)->A:W-1(V953_D-1) adding edge: AGAATACAAA...CAGCCTCATC:W0(V945_D-1) to A:W-1(V953_D-1) removing edge Edge(952->953,w:2.0)(C:W-1(V952_D-1)->A:W-1(V953_D-1)) removing edge Edge(945->952,w:2.0)(AGAATACAAA...CAGCCTCATC:W0(V945_D-1)->C:W-1(V952_D-1)) Found potential edge: Edge(945->953,w:2.0) between AGAATACAAA...CAGCCTCATC:W0(V945_D-1) and A:W-1(V953_D-1) removing vertex A:W-1(V953_D-1) was concatenated into AGAATACAAA...AGCCTCATCA:W1(V945_D-1) Want to move edge Edge(953->954,w:2.0)(A:W-1(V953_D-1)->G:W-1(V954_D-1)) to (AGAATACAAA...AGCCTCATCA:W1(V945_D-1)->G:W-1(V954_D-1) adding edge: AGAATACAAA...AGCCTCATCA:W1(V945_D-1) to G:W-1(V954_D-1) removing edge Edge(953->954,w:2.0)(A:W-1(V953_D-1)->G:W-1(V954_D-1)) removing edge Edge(945->953,w:2.0)(AGAATACAAA...AGCCTCATCA:W1(V945_D-1)->A:W-1(V953_D-1)) Found potential edge: Edge(945->954,w:2.0) between AGAATACAAA...AGCCTCATCA:W1(V945_D-1) and G:W-1(V954_D-1) removing vertex G:W-1(V954_D-1) was concatenated into AGAATACAAA...GCCTCATCAG:W1(V945_D-1) Want to move edge Edge(954->955,w:2.0)(G:W-1(V954_D-1)->C:W-1(V955_D-1)) to (AGAATACAAA...GCCTCATCAG:W1(V945_D-1)->C:W-1(V955_D-1) adding edge: AGAATACAAA...GCCTCATCAG:W1(V945_D-1) to C:W-1(V955_D-1) removing edge Edge(954->955,w:2.0)(G:W-1(V954_D-1)->C:W-1(V955_D-1)) removing edge Edge(945->954,w:2.0)(AGAATACAAA...GCCTCATCAG:W1(V945_D-1)->G:W-1(V954_D-1)) Found potential edge: Edge(945->955,w:2.0) between AGAATACAAA...GCCTCATCAG:W1(V945_D-1) and C:W-1(V955_D-1) removing vertex C:W-1(V955_D-1) was concatenated into AGAATACAAA...CCTCATCAGC:W1(V945_D-1) Want to move edge Edge(955->956,w:2.0)(C:W-1(V955_D-1)->A:W-1(V956_D-1)) to (AGAATACAAA...CCTCATCAGC:W1(V945_D-1)->A:W-1(V956_D-1) adding edge: AGAATACAAA...CCTCATCAGC:W1(V945_D-1) to A:W-1(V956_D-1) removing edge Edge(955->956,w:2.0)(C:W-1(V955_D-1)->A:W-1(V956_D-1)) removing edge Edge(945->955,w:2.0)(AGAATACAAA...CCTCATCAGC:W1(V945_D-1)->C:W-1(V955_D-1)) Found potential edge: Edge(945->956,w:2.0) between AGAATACAAA...CCTCATCAGC:W1(V945_D-1) and A:W-1(V956_D-1) removing vertex A:W-1(V956_D-1) was concatenated into AGAATACAAA...CTCATCAGCA:W1(V945_D-1) Want to move edge Edge(956->957,w:2.0)(A:W-1(V956_D-1)->G:W-1(V957_D-1)) to (AGAATACAAA...CTCATCAGCA:W1(V945_D-1)->G:W-1(V957_D-1) adding edge: AGAATACAAA...CTCATCAGCA:W1(V945_D-1) to G:W-1(V957_D-1) removing edge Edge(956->957,w:2.0)(A:W-1(V956_D-1)->G:W-1(V957_D-1)) removing edge Edge(945->956,w:2.0)(AGAATACAAA...CTCATCAGCA:W1(V945_D-1)->A:W-1(V956_D-1)) Found potential edge: Edge(945->957,w:2.0) between AGAATACAAA...CTCATCAGCA:W1(V945_D-1) and G:W-1(V957_D-1) removing vertex G:W-1(V957_D-1) was concatenated into AGAATACAAA...TCATCAGCAG:W1(V945_D-1) Want to move edge Edge(957->958,w:2.0)(G:W-1(V957_D-1)->G:W-1(V958_D-1)) to (AGAATACAAA...TCATCAGCAG:W1(V945_D-1)->G:W-1(V958_D-1) adding edge: AGAATACAAA...TCATCAGCAG:W1(V945_D-1) to G:W-1(V958_D-1) removing edge Edge(957->958,w:2.0)(G:W-1(V957_D-1)->G:W-1(V958_D-1)) removing edge Edge(945->957,w:2.0)(AGAATACAAA...TCATCAGCAG:W1(V945_D-1)->G:W-1(V957_D-1)) Found potential edge: Edge(945->958,w:2.0) between AGAATACAAA...TCATCAGCAG:W1(V945_D-1) and G:W-1(V958_D-1) removing vertex G:W-1(V958_D-1) was concatenated into AGAATACAAA...CATCAGCAGG:W1(V945_D-1) Want to move edge Edge(958->959,w:2.0)(G:W-1(V958_D-1)->A:W-1(V959_D-1)) to (AGAATACAAA...CATCAGCAGG:W1(V945_D-1)->A:W-1(V959_D-1) adding edge: AGAATACAAA...CATCAGCAGG:W1(V945_D-1) to A:W-1(V959_D-1) removing edge Edge(958->959,w:2.0)(G:W-1(V958_D-1)->A:W-1(V959_D-1)) removing edge Edge(945->958,w:2.0)(AGAATACAAA...CATCAGCAGG:W1(V945_D-1)->G:W-1(V958_D-1)) Found potential edge: Edge(945->959,w:2.0) between AGAATACAAA...CATCAGCAGG:W1(V945_D-1) and A:W-1(V959_D-1) removing vertex A:W-1(V959_D-1) was concatenated into AGAATACAAA...ATCAGCAGGA:W1(V945_D-1) Want to move edge Edge(959->960,w:2.0)(A:W-1(V959_D-1)->A:W-1(V960_D-1)) to (AGAATACAAA...ATCAGCAGGA:W1(V945_D-1)->A:W-1(V960_D-1) adding edge: AGAATACAAA...ATCAGCAGGA:W1(V945_D-1) to A:W-1(V960_D-1) removing edge Edge(959->960,w:2.0)(A:W-1(V959_D-1)->A:W-1(V960_D-1)) removing edge Edge(945->959,w:2.0)(AGAATACAAA...ATCAGCAGGA:W1(V945_D-1)->A:W-1(V959_D-1)) Found potential edge: Edge(945->960,w:2.0) between AGAATACAAA...ATCAGCAGGA:W1(V945_D-1) and A:W-1(V960_D-1) removing vertex A:W-1(V960_D-1) was concatenated into AGAATACAAA...TCAGCAGGAA:W1(V945_D-1) Want to move edge Edge(960->961,w:2.0)(A:W-1(V960_D-1)->G:W-1(V961_D-1)) to (AGAATACAAA...TCAGCAGGAA:W1(V945_D-1)->G:W-1(V961_D-1) adding edge: AGAATACAAA...TCAGCAGGAA:W1(V945_D-1) to G:W-1(V961_D-1) removing edge Edge(960->961,w:2.0)(A:W-1(V960_D-1)->G:W-1(V961_D-1)) removing edge Edge(945->960,w:2.0)(AGAATACAAA...TCAGCAGGAA:W1(V945_D-1)->A:W-1(V960_D-1)) Found potential edge: Edge(945->961,w:2.0) between AGAATACAAA...TCAGCAGGAA:W1(V945_D-1) and G:W-1(V961_D-1) removing vertex G:W-1(V961_D-1) was concatenated into AGAATACAAA...CAGCAGGAAG:W1(V945_D-1) Want to move edge Edge(961->962,w:2.0)(G:W-1(V961_D-1)->A:W-1(V962_D-1)) to (AGAATACAAA...CAGCAGGAAG:W1(V945_D-1)->A:W-1(V962_D-1) adding edge: AGAATACAAA...CAGCAGGAAG:W1(V945_D-1) to A:W-1(V962_D-1) removing edge Edge(961->962,w:2.0)(G:W-1(V961_D-1)->A:W-1(V962_D-1)) removing edge Edge(945->961,w:2.0)(AGAATACAAA...CAGCAGGAAG:W1(V945_D-1)->G:W-1(V961_D-1)) Found potential edge: Edge(945->962,w:2.0) between AGAATACAAA...CAGCAGGAAG:W1(V945_D-1) and A:W-1(V962_D-1) removing vertex A:W-1(V962_D-1) was concatenated into AGAATACAAA...AGCAGGAAGA:W1(V945_D-1) Want to move edge Edge(962->963,w:2.0)(A:W-1(V962_D-1)->A:W-1(V963_D-1)) to (AGAATACAAA...AGCAGGAAGA:W1(V945_D-1)->A:W-1(V963_D-1) adding edge: AGAATACAAA...AGCAGGAAGA:W1(V945_D-1) to A:W-1(V963_D-1) removing edge Edge(962->963,w:2.0)(A:W-1(V962_D-1)->A:W-1(V963_D-1)) removing edge Edge(945->962,w:2.0)(AGAATACAAA...AGCAGGAAGA:W1(V945_D-1)->A:W-1(V962_D-1)) Found potential edge: Edge(945->963,w:2.0) between AGAATACAAA...AGCAGGAAGA:W1(V945_D-1) and A:W-1(V963_D-1) removing vertex A:W-1(V963_D-1) was concatenated into AGAATACAAA...GCAGGAAGAA:W1(V945_D-1) Want to move edge Edge(963->964,w:2.0)(A:W-1(V963_D-1)->A:W-1(V964_D-1)) to (AGAATACAAA...GCAGGAAGAA:W1(V945_D-1)->A:W-1(V964_D-1) adding edge: AGAATACAAA...GCAGGAAGAA:W1(V945_D-1) to A:W-1(V964_D-1) removing edge Edge(963->964,w:2.0)(A:W-1(V963_D-1)->A:W-1(V964_D-1)) removing edge Edge(945->963,w:2.0)(AGAATACAAA...GCAGGAAGAA:W1(V945_D-1)->A:W-1(V963_D-1)) Found potential edge: Edge(945->964,w:2.0) between AGAATACAAA...GCAGGAAGAA:W1(V945_D-1) and A:W-1(V964_D-1) removing vertex A:W-1(V964_D-1) was concatenated into AGAATACAAA...CAGGAAGAAA:W1(V945_D-1) Want to move edge Edge(964->965,w:2.0)(A:W-1(V964_D-1)->T:W-1(V965_D-1)) to (AGAATACAAA...CAGGAAGAAA:W1(V945_D-1)->T:W-1(V965_D-1) adding edge: AGAATACAAA...CAGGAAGAAA:W1(V945_D-1) to T:W-1(V965_D-1) removing edge Edge(964->965,w:2.0)(A:W-1(V964_D-1)->T:W-1(V965_D-1)) removing edge Edge(945->964,w:2.0)(AGAATACAAA...CAGGAAGAAA:W1(V945_D-1)->A:W-1(V964_D-1)) Found potential edge: Edge(945->965,w:2.0) between AGAATACAAA...CAGGAAGAAA:W1(V945_D-1) and T:W-1(V965_D-1) removing vertex T:W-1(V965_D-1) was concatenated into AGAATACAAA...AGGAAGAAAT:W1(V945_D-1) Want to move edge Edge(965->966,w:2.0)(T:W-1(V965_D-1)->C:W-1(V966_D-1)) to (AGAATACAAA...AGGAAGAAAT:W1(V945_D-1)->C:W-1(V966_D-1) adding edge: AGAATACAAA...AGGAAGAAAT:W1(V945_D-1) to C:W-1(V966_D-1) removing edge Edge(965->966,w:2.0)(T:W-1(V965_D-1)->C:W-1(V966_D-1)) removing edge Edge(945->965,w:2.0)(AGAATACAAA...AGGAAGAAAT:W1(V945_D-1)->T:W-1(V965_D-1)) Found potential edge: Edge(945->966,w:2.0) between AGAATACAAA...AGGAAGAAAT:W1(V945_D-1) and C:W-1(V966_D-1) removing vertex C:W-1(V966_D-1) was concatenated into AGAATACAAA...GGAAGAAATC:W1(V945_D-1) Want to move edge Edge(966->967,w:2.0)(C:W-1(V966_D-1)->T:W-1(V967_D-1)) to (AGAATACAAA...GGAAGAAATC:W1(V945_D-1)->T:W-1(V967_D-1) adding edge: AGAATACAAA...GGAAGAAATC:W1(V945_D-1) to T:W-1(V967_D-1) removing edge Edge(966->967,w:2.0)(C:W-1(V966_D-1)->T:W-1(V967_D-1)) removing edge Edge(945->966,w:2.0)(AGAATACAAA...GGAAGAAATC:W1(V945_D-1)->C:W-1(V966_D-1)) Found potential edge: Edge(945->967,w:2.0) between AGAATACAAA...GGAAGAAATC:W1(V945_D-1) and T:W-1(V967_D-1) removing vertex T:W-1(V967_D-1) was concatenated into AGAATACAAA...GAAGAAATCT:W1(V945_D-1) Want to move edge Edge(967->968,w:2.0)(T:W-1(V967_D-1)->T:W-1(V968_D-1)) to (AGAATACAAA...GAAGAAATCT:W1(V945_D-1)->T:W-1(V968_D-1) adding edge: AGAATACAAA...GAAGAAATCT:W1(V945_D-1) to T:W-1(V968_D-1) removing edge Edge(967->968,w:2.0)(T:W-1(V967_D-1)->T:W-1(V968_D-1)) removing edge Edge(945->967,w:2.0)(AGAATACAAA...GAAGAAATCT:W1(V945_D-1)->T:W-1(V967_D-1)) Found potential edge: Edge(945->968,w:2.0) between AGAATACAAA...GAAGAAATCT:W1(V945_D-1) and T:W-1(V968_D-1) removing vertex T:W-1(V968_D-1) was concatenated into AGAATACAAA...AAGAAATCTT:W1(V945_D-1) Want to move edge Edge(968->969,w:2.0)(T:W-1(V968_D-1)->T:W-1(V969_D-1)) to (AGAATACAAA...AAGAAATCTT:W1(V945_D-1)->T:W-1(V969_D-1) adding edge: AGAATACAAA...AAGAAATCTT:W1(V945_D-1) to T:W-1(V969_D-1) removing edge Edge(968->969,w:2.0)(T:W-1(V968_D-1)->T:W-1(V969_D-1)) removing edge Edge(945->968,w:2.0)(AGAATACAAA...AAGAAATCTT:W1(V945_D-1)->T:W-1(V968_D-1)) Found potential edge: Edge(945->969,w:2.0) between AGAATACAAA...AAGAAATCTT:W1(V945_D-1) and T:W-1(V969_D-1) removing vertex T:W-1(V969_D-1) was concatenated into AGAATACAAA...AGAAATCTTT:W1(V945_D-1) Want to move edge Edge(969->970,w:2.0)(T:W-1(V969_D-1)->C:W-1(V970_D-1)) to (AGAATACAAA...AGAAATCTTT:W1(V945_D-1)->C:W-1(V970_D-1) adding edge: AGAATACAAA...AGAAATCTTT:W1(V945_D-1) to C:W-1(V970_D-1) removing edge Edge(969->970,w:2.0)(T:W-1(V969_D-1)->C:W-1(V970_D-1)) removing edge Edge(945->969,w:2.0)(AGAATACAAA...AGAAATCTTT:W1(V945_D-1)->T:W-1(V969_D-1)) Found potential edge: Edge(945->970,w:2.0) between AGAATACAAA...AGAAATCTTT:W1(V945_D-1) and C:W-1(V970_D-1) removing vertex C:W-1(V970_D-1) was concatenated into AGAATACAAA...GAAATCTTTC:W1(V945_D-1) Want to move edge Edge(970->971,w:2.0)(C:W-1(V970_D-1)->T:W-1(V971_D-1)) to (AGAATACAAA...GAAATCTTTC:W1(V945_D-1)->T:W-1(V971_D-1) adding edge: AGAATACAAA...GAAATCTTTC:W1(V945_D-1) to T:W-1(V971_D-1) removing edge Edge(970->971,w:2.0)(C:W-1(V970_D-1)->T:W-1(V971_D-1)) removing edge Edge(945->970,w:2.0)(AGAATACAAA...GAAATCTTTC:W1(V945_D-1)->C:W-1(V970_D-1)) Found potential edge: Edge(945->971,w:2.0) between AGAATACAAA...GAAATCTTTC:W1(V945_D-1) and T:W-1(V971_D-1) removing vertex T:W-1(V971_D-1) was concatenated into AGAATACAAA...AAATCTTTCT:W1(V945_D-1) Want to move edge Edge(971->972,w:2.0)(T:W-1(V971_D-1)->T:W-1(V972_D-1)) to (AGAATACAAA...AAATCTTTCT:W1(V945_D-1)->T:W-1(V972_D-1) adding edge: AGAATACAAA...AAATCTTTCT:W1(V945_D-1) to T:W-1(V972_D-1) removing edge Edge(971->972,w:2.0)(T:W-1(V971_D-1)->T:W-1(V972_D-1)) removing edge Edge(945->971,w:2.0)(AGAATACAAA...AAATCTTTCT:W1(V945_D-1)->T:W-1(V971_D-1)) Found potential edge: Edge(945->972,w:2.0) between AGAATACAAA...AAATCTTTCT:W1(V945_D-1) and T:W-1(V972_D-1) removing vertex T:W-1(V972_D-1) was concatenated into AGAATACAAA...AATCTTTCTT:W1(V945_D-1) Want to move edge Edge(972->973,w:2.0)(T:W-1(V972_D-1)->T:W-1(V973_D-1)) to (AGAATACAAA...AATCTTTCTT:W1(V945_D-1)->T:W-1(V973_D-1) adding edge: AGAATACAAA...AATCTTTCTT:W1(V945_D-1) to T:W-1(V973_D-1) removing edge Edge(972->973,w:2.0)(T:W-1(V972_D-1)->T:W-1(V973_D-1)) removing edge Edge(945->972,w:2.0)(AGAATACAAA...AATCTTTCTT:W1(V945_D-1)->T:W-1(V972_D-1)) Found potential edge: Edge(945->973,w:2.0) between AGAATACAAA...AATCTTTCTT:W1(V945_D-1) and T:W-1(V973_D-1) removing vertex T:W-1(V973_D-1) was concatenated into AGAATACAAA...ATCTTTCTTT:W1(V945_D-1) Want to move edge Edge(973->974,w:2.0)(T:W-1(V973_D-1)->C:W-1(V974_D-1)) to (AGAATACAAA...ATCTTTCTTT:W1(V945_D-1)->C:W-1(V974_D-1) adding edge: AGAATACAAA...ATCTTTCTTT:W1(V945_D-1) to C:W-1(V974_D-1) removing edge Edge(973->974,w:2.0)(T:W-1(V973_D-1)->C:W-1(V974_D-1)) removing edge Edge(945->973,w:2.0)(AGAATACAAA...ATCTTTCTTT:W1(V945_D-1)->T:W-1(V973_D-1)) Found potential edge: Edge(945->974,w:2.0) between AGAATACAAA...ATCTTTCTTT:W1(V945_D-1) and C:W-1(V974_D-1) removing vertex C:W-1(V974_D-1) was concatenated into AGAATACAAA...TCTTTCTTTC:W1(V945_D-1) Want to move edge Edge(974->975,w:2.0)(C:W-1(V974_D-1)->C:W-1(V975_D-1)) to (AGAATACAAA...TCTTTCTTTC:W1(V945_D-1)->C:W-1(V975_D-1) adding edge: AGAATACAAA...TCTTTCTTTC:W1(V945_D-1) to C:W-1(V975_D-1) removing edge Edge(974->975,w:2.0)(C:W-1(V974_D-1)->C:W-1(V975_D-1)) removing edge Edge(945->974,w:2.0)(AGAATACAAA...TCTTTCTTTC:W1(V945_D-1)->C:W-1(V974_D-1)) Found potential edge: Edge(945->975,w:2.0) between AGAATACAAA...TCTTTCTTTC:W1(V945_D-1) and C:W-1(V975_D-1) removing vertex C:W-1(V975_D-1) was concatenated into AGAATACAAA...CTTTCTTTCC:W1(V945_D-1) Want to move edge Edge(975->976,w:2.0)(C:W-1(V975_D-1)->A:W-1(V976_D-1)) to (AGAATACAAA...CTTTCTTTCC:W1(V945_D-1)->A:W-1(V976_D-1) adding edge: AGAATACAAA...CTTTCTTTCC:W1(V945_D-1) to A:W-1(V976_D-1) removing edge Edge(975->976,w:2.0)(C:W-1(V975_D-1)->A:W-1(V976_D-1)) removing edge Edge(945->975,w:2.0)(AGAATACAAA...CTTTCTTTCC:W1(V945_D-1)->C:W-1(V975_D-1)) Found potential edge: Edge(945->976,w:2.0) between AGAATACAAA...CTTTCTTTCC:W1(V945_D-1) and A:W-1(V976_D-1) removing vertex A:W-1(V976_D-1) was concatenated into AGAATACAAA...TTTCTTTCCA:W1(V945_D-1) Want to move edge Edge(976->977,w:2.0)(A:W-1(V976_D-1)->A:W-1(V977_D-1)) to (AGAATACAAA...TTTCTTTCCA:W1(V945_D-1)->A:W-1(V977_D-1) adding edge: AGAATACAAA...TTTCTTTCCA:W1(V945_D-1) to A:W-1(V977_D-1) removing edge Edge(976->977,w:2.0)(A:W-1(V976_D-1)->A:W-1(V977_D-1)) removing edge Edge(945->976,w:2.0)(AGAATACAAA...TTTCTTTCCA:W1(V945_D-1)->A:W-1(V976_D-1)) Found potential edge: Edge(945->977,w:2.0) between AGAATACAAA...TTTCTTTCCA:W1(V945_D-1) and A:W-1(V977_D-1) removing vertex A:W-1(V977_D-1) was concatenated into AGAATACAAA...TTCTTTCCAA:W1(V945_D-1) Want to move edge Edge(977->978,w:2.0)(A:W-1(V977_D-1)->G:W-1(V978_D-1)) to (AGAATACAAA...TTCTTTCCAA:W1(V945_D-1)->G:W-1(V978_D-1) adding edge: AGAATACAAA...TTCTTTCCAA:W1(V945_D-1) to G:W-1(V978_D-1) removing edge Edge(977->978,w:2.0)(A:W-1(V977_D-1)->G:W-1(V978_D-1)) removing edge Edge(945->977,w:2.0)(AGAATACAAA...TTCTTTCCAA:W1(V945_D-1)->A:W-1(V977_D-1)) Found potential edge: Edge(945->978,w:2.0) between AGAATACAAA...TTCTTTCCAA:W1(V945_D-1) and G:W-1(V978_D-1) removing vertex G:W-1(V978_D-1) was concatenated into AGAATACAAA...TCTTTCCAAG:W1(V945_D-1) Want to move edge Edge(978->979,w:2.0)(G:W-1(V978_D-1)->T:W-1(V979_D-1)) to (AGAATACAAA...TCTTTCCAAG:W1(V945_D-1)->T:W-1(V979_D-1) adding edge: AGAATACAAA...TCTTTCCAAG:W1(V945_D-1) to T:W-1(V979_D-1) removing edge Edge(978->979,w:2.0)(G:W-1(V978_D-1)->T:W-1(V979_D-1)) removing edge Edge(945->978,w:2.0)(AGAATACAAA...TCTTTCCAAG:W1(V945_D-1)->G:W-1(V978_D-1)) Found potential edge: Edge(945->979,w:2.0) between AGAATACAAA...TCTTTCCAAG:W1(V945_D-1) and T:W-1(V979_D-1) removing vertex T:W-1(V979_D-1) was concatenated into AGAATACAAA...CTTTCCAAGT:W1(V945_D-1) Want to move edge Edge(979->980,w:2.0)(T:W-1(V979_D-1)->A:W-1(V980_D-1)) to (AGAATACAAA...CTTTCCAAGT:W1(V945_D-1)->A:W-1(V980_D-1) adding edge: AGAATACAAA...CTTTCCAAGT:W1(V945_D-1) to A:W-1(V980_D-1) removing edge Edge(979->980,w:2.0)(T:W-1(V979_D-1)->A:W-1(V980_D-1)) removing edge Edge(945->979,w:2.0)(AGAATACAAA...CTTTCCAAGT:W1(V945_D-1)->T:W-1(V979_D-1)) Found potential edge: Edge(945->980,w:2.0) between AGAATACAAA...CTTTCCAAGT:W1(V945_D-1) and A:W-1(V980_D-1) removing vertex A:W-1(V980_D-1) was concatenated into AGAATACAAA...TTTCCAAGTA:W1(V945_D-1) Want to move edge Edge(980->451,w:2.0)(A:W-1(V980_D-1)->GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1)) to (AGAATACAAA...TTTCCAAGTA:W1(V945_D-1)->GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) adding edge: AGAATACAAA...TTTCCAAGTA:W1(V945_D-1) to GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) removing edge Edge(980->451,w:2.0)(A:W-1(V980_D-1)->GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1)) removing edge Edge(945->980,w:2.0)(AGAATACAAA...TTTCCAAGTA:W1(V945_D-1)->A:W-1(V980_D-1)) ## Node descriptions after linear compaction: ## Node descriptions: GGCCACACGA...CTTCCTCAAG:W2(V380_D-1) Preds: [] Succ: [CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1) GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1) ] CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1) Preds: [GGCCACACGA...CTTCCTCAAG:W2(V380_D-1) ] Succ: [CTTTCCAAGTA:W8(V440_D-1) ] CTTTCCAAGTA:W8(V440_D-1) Preds: [CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D-1) GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1) ] Succ: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) ] GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) Preds: [AGAATACAAA...TTTCCAAGTA:W1(V945_D-1) CTTTCCAAGTA:W8(V440_D-1) ] Succ: [GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1) CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1) ] GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1) Preds: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) ] Succ: [AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) ] AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) Preds: [GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D-1) CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1) ] Succ: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1) ] AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1) Preds: [GCTAGGGGAA...GGGAGCCACC:W1(V786_D-1) AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) ] Succ: [] GCTAGGGGAA...GGGAGCCACC:W1(V786_D-1) Preds: [] Succ: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D-1) ] CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D-1) Preds: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) ] Succ: [AGTCCACCAC...GGGAGCCACC:W6(V549_D-1) ] GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D-1) Preds: [GGCCACACGA...CTTCCTCAAG:W2(V380_D-1) ] Succ: [CTTTCCAAGTA:W8(V440_D-1) ] AGAATACAAA...TTTCCAAGTA:W1(V945_D-1) Preds: [] Succ: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D-1) ] SNP_collapse candidates: GAGCACTCTGAACCCTGTGAGGCA:W6(V525_D2) len: 24 and CAGCACTCTGAACCCTGTGAGGCA:W2(V813_D2) len: 24 SNP_collapse: merging the node 813 to the node 525 SNP_collapse candidates: CCTCATCAGCAAGAAGAAATCTTT:W7(V416_D1) len: 24 and GCTCATCAGCAAGAAGAAATCTTT:W2(V885_D1) len: 24 SNP_collapse: merging the node 885 to the node 416 removing the single nt variation vertex 813 removing the single nt variation vertex 525 removing the single nt variation vertex 885 removing the single nt variation vertex 416 SECTION ==================== Removing small components. ==================== ComponentDivision: 0 contains the following vertices: node_id: 945 node_id: 786 node_id: 451 node_id: 981 node_id: 549 node_id: 982 node_id: 440 node_id: 380 node_id: 717 SubComp: 945 has 9 nodes; total coverage: 2212 average: 4.3118906 number of good components: 1 adding to 380: Location of original node 380 in index 0 adding to 381: Location of original node 380 in index 1 adding to 382: Location of original node 380 in index 2 adding to 383: Location of original node 380 in index 3 adding to 384: Location of original node 380 in index 4 adding to 385: Location of original node 380 in index 5 adding to 386: Location of original node 380 in index 6 adding to 387: Location of original node 380 in index 7 adding to 388: Location of original node 380 in index 8 adding to 389: Location of original node 380 in index 9 adding to 390: Location of original node 380 in index 10 adding to 391: Location of original node 380 in index 11 adding to 392: Location of original node 380 in index 12 adding to 393: Location of original node 380 in index 13 adding to 394: Location of original node 380 in index 14 adding to 395: Location of original node 380 in index 15 adding to 396: Location of original node 380 in index 16 adding to 397: Location of original node 380 in index 17 adding to 398: Location of original node 380 in index 18 adding to 399: Location of original node 380 in index 19 adding to 400: Location of original node 380 in index 20 adding to 401: Location of original node 380 in index 21 adding to 402: Location of original node 380 in index 22 adding to 403: Location of original node 380 in index 23 adding to 404: Location of original node 380 in index 24 adding to 405: Location of original node 380 in index 25 adding to 406: Location of original node 380 in index 26 adding to 407: Location of original node 380 in index 27 adding to 408: Location of original node 380 in index 28 adding to 409: Location of original node 380 in index 29 adding to 410: Location of original node 380 in index 30 adding to 411: Location of original node 380 in index 31 adding to 412: Location of original node 380 in index 32 adding to 413: Location of original node 380 in index 33 adding to 414: Location of original node 380 in index 34 adding to 415: Location of original node 380 in index 35 adding to 440: Location of original node 440 in index 0 adding to 441: Location of original node 440 in index 1 adding to 442: Location of original node 440 in index 2 adding to 443: Location of original node 440 in index 3 adding to 444: Location of original node 440 in index 4 adding to 445: Location of original node 440 in index 5 adding to 446: Location of original node 440 in index 6 adding to 447: Location of original node 440 in index 7 adding to 448: Location of original node 440 in index 8 adding to 449: Location of original node 440 in index 9 adding to 450: Location of original node 440 in index 10 adding to 451: Location of original node 451 in index 0 adding to 452: Location of original node 451 in index 1 adding to 453: Location of original node 451 in index 2 adding to 454: Location of original node 451 in index 3 adding to 455: Location of original node 451 in index 4 adding to 456: Location of original node 451 in index 5 adding to 457: Location of original node 451 in index 6 adding to 458: Location of original node 451 in index 7 adding to 459: Location of original node 451 in index 8 adding to 460: Location of original node 451 in index 9 adding to 461: Location of original node 451 in index 10 adding to 462: Location of original node 451 in index 11 adding to 463: Location of original node 451 in index 12 adding to 464: Location of original node 451 in index 13 adding to 465: Location of original node 451 in index 14 adding to 466: Location of original node 451 in index 15 adding to 467: Location of original node 451 in index 16 adding to 468: Location of original node 451 in index 17 adding to 469: Location of original node 451 in index 18 adding to 470: Location of original node 451 in index 19 adding to 471: Location of original node 451 in index 20 adding to 472: Location of original node 451 in index 21 adding to 473: Location of original node 451 in index 22 adding to 474: Location of original node 451 in index 23 adding to 475: Location of original node 451 in index 24 adding to 476: Location of original node 451 in index 25 adding to 477: Location of original node 451 in index 26 adding to 478: Location of original node 451 in index 27 adding to 479: Location of original node 451 in index 28 adding to 480: Location of original node 451 in index 29 adding to 481: Location of original node 451 in index 30 adding to 482: Location of original node 451 in index 31 adding to 483: Location of original node 451 in index 32 adding to 484: Location of original node 451 in index 33 adding to 485: Location of original node 451 in index 34 adding to 486: Location of original node 451 in index 35 adding to 487: Location of original node 451 in index 36 adding to 488: Location of original node 451 in index 37 adding to 489: Location of original node 451 in index 38 adding to 490: Location of original node 451 in index 39 adding to 491: Location of original node 451 in index 40 adding to 492: Location of original node 451 in index 41 adding to 493: Location of original node 451 in index 42 adding to 494: Location of original node 451 in index 43 adding to 495: Location of original node 451 in index 44 adding to 496: Location of original node 451 in index 45 adding to 497: Location of original node 451 in index 46 adding to 498: Location of original node 451 in index 47 adding to 499: Location of original node 451 in index 48 adding to 500: Location of original node 451 in index 49 adding to 501: Location of original node 451 in index 50 adding to 502: Location of original node 451 in index 51 adding to 503: Location of original node 451 in index 52 adding to 504: Location of original node 451 in index 53 adding to 505: Location of original node 451 in index 54 adding to 506: Location of original node 451 in index 55 adding to 507: Location of original node 451 in index 56 adding to 508: Location of original node 451 in index 57 adding to 509: Location of original node 451 in index 58 adding to 510: Location of original node 451 in index 59 adding to 511: Location of original node 451 in index 60 adding to 512: Location of original node 451 in index 61 adding to 513: Location of original node 451 in index 62 adding to 514: Location of original node 451 in index 63 adding to 515: Location of original node 451 in index 64 adding to 516: Location of original node 451 in index 65 adding to 517: Location of original node 451 in index 66 adding to 518: Location of original node 451 in index 67 adding to 519: Location of original node 451 in index 68 adding to 520: Location of original node 451 in index 69 adding to 521: Location of original node 451 in index 70 adding to 522: Location of original node 451 in index 71 adding to 523: Location of original node 451 in index 72 adding to 524: Location of original node 451 in index 73 adding to 549: Location of original node 549 in index 0 adding to 550: Location of original node 549 in index 1 adding to 551: Location of original node 549 in index 2 adding to 552: Location of original node 549 in index 3 adding to 553: Location of original node 549 in index 4 adding to 554: Location of original node 549 in index 5 adding to 555: Location of original node 549 in index 6 adding to 556: Location of original node 549 in index 7 adding to 557: Location of original node 549 in index 8 adding to 558: Location of original node 549 in index 9 adding to 559: Location of original node 549 in index 10 adding to 560: Location of original node 549 in index 11 adding to 561: Location of original node 549 in index 12 adding to 562: Location of original node 549 in index 13 adding to 563: Location of original node 549 in index 14 adding to 564: Location of original node 549 in index 15 adding to 565: Location of original node 549 in index 16 adding to 566: Location of original node 549 in index 17 adding to 567: Location of original node 549 in index 18 adding to 568: Location of original node 549 in index 19 adding to 569: Location of original node 549 in index 20 adding to 570: Location of original node 549 in index 21 adding to 571: Location of original node 549 in index 22 adding to 572: Location of original node 549 in index 23 adding to 573: Location of original node 549 in index 24 adding to 574: Location of original node 549 in index 25 adding to 575: Location of original node 549 in index 26 adding to 576: Location of original node 549 in index 27 adding to 577: Location of original node 549 in index 28 adding to 578: Location of original node 549 in index 29 adding to 579: Location of original node 549 in index 30 adding to 580: Location of original node 549 in index 31 adding to 581: Location of original node 549 in index 32 adding to 582: Location of original node 549 in index 33 adding to 583: Location of original node 549 in index 34 adding to 584: Location of original node 549 in index 35 adding to 585: Location of original node 549 in index 36 adding to 586: Location of original node 549 in index 37 adding to 587: Location of original node 549 in index 38 adding to 588: Location of original node 549 in index 39 adding to 589: Location of original node 549 in index 40 adding to 590: Location of original node 549 in index 41 adding to 591: Location of original node 549 in index 42 adding to 592: Location of original node 549 in index 43 adding to 593: Location of original node 549 in index 44 adding to 594: Location of original node 549 in index 45 adding to 595: Location of original node 549 in index 46 adding to 596: Location of original node 549 in index 47 adding to 597: Location of original node 549 in index 48 adding to 598: Location of original node 549 in index 49 adding to 599: Location of original node 549 in index 50 adding to 600: Location of original node 549 in index 51 adding to 601: Location of original node 549 in index 52 adding to 602: Location of original node 549 in index 53 adding to 603: Location of original node 549 in index 54 adding to 604: Location of original node 549 in index 55 adding to 605: Location of original node 549 in index 56 adding to 606: Location of original node 549 in index 57 adding to 607: Location of original node 549 in index 58 adding to 608: Location of original node 549 in index 59 adding to 609: Location of original node 549 in index 60 adding to 610: Location of original node 549 in index 61 adding to 611: Location of original node 549 in index 62 adding to 612: Location of original node 549 in index 63 adding to 613: Location of original node 549 in index 64 adding to 614: Location of original node 549 in index 65 adding to 615: Location of original node 549 in index 66 adding to 616: Location of original node 549 in index 67 adding to 617: Location of original node 549 in index 68 adding to 618: Location of original node 549 in index 69 adding to 619: Location of original node 549 in index 70 adding to 620: Location of original node 549 in index 71 adding to 621: Location of original node 549 in index 72 adding to 622: Location of original node 549 in index 73 adding to 623: Location of original node 549 in index 74 adding to 624: Location of original node 549 in index 75 adding to 625: Location of original node 549 in index 76 adding to 626: Location of original node 549 in index 77 adding to 627: Location of original node 549 in index 78 adding to 628: Location of original node 549 in index 79 adding to 629: Location of original node 549 in index 80 adding to 630: Location of original node 549 in index 81 adding to 631: Location of original node 549 in index 82 adding to 632: Location of original node 549 in index 83 adding to 633: Location of original node 549 in index 84 adding to 634: Location of original node 549 in index 85 adding to 635: Location of original node 549 in index 86 adding to 636: Location of original node 549 in index 87 adding to 637: Location of original node 549 in index 88 adding to 638: Location of original node 549 in index 89 adding to 639: Location of original node 549 in index 90 adding to 640: Location of original node 549 in index 91 adding to 641: Location of original node 549 in index 92 adding to 642: Location of original node 549 in index 93 adding to 643: Location of original node 549 in index 94 adding to 644: Location of original node 549 in index 95 adding to 645: Location of original node 549 in index 96 adding to 646: Location of original node 549 in index 97 adding to 647: Location of original node 549 in index 98 adding to 648: Location of original node 549 in index 99 adding to 649: Location of original node 549 in index 100 adding to 650: Location of original node 549 in index 101 adding to 651: Location of original node 549 in index 102 adding to 652: Location of original node 549 in index 103 adding to 653: Location of original node 549 in index 104 adding to 654: Location of original node 549 in index 105 adding to 655: Location of original node 549 in index 106 adding to 656: Location of original node 549 in index 107 adding to 657: Location of original node 549 in index 108 adding to 658: Location of original node 549 in index 109 adding to 659: Location of original node 549 in index 110 adding to 660: Location of original node 549 in index 111 adding to 661: Location of original node 549 in index 112 adding to 662: Location of original node 549 in index 113 adding to 663: Location of original node 549 in index 114 adding to 664: Location of original node 549 in index 115 adding to 665: Location of original node 549 in index 116 adding to 666: Location of original node 549 in index 117 adding to 667: Location of original node 549 in index 118 adding to 668: Location of original node 549 in index 119 adding to 669: Location of original node 549 in index 120 adding to 670: Location of original node 549 in index 121 adding to 671: Location of original node 549 in index 122 adding to 672: Location of original node 549 in index 123 adding to 673: Location of original node 549 in index 124 adding to 674: Location of original node 549 in index 125 adding to 675: Location of original node 549 in index 126 adding to 676: Location of original node 549 in index 127 adding to 677: Location of original node 549 in index 128 adding to 678: Location of original node 549 in index 129 adding to 679: Location of original node 549 in index 130 adding to 680: Location of original node 549 in index 131 adding to 681: Location of original node 549 in index 132 adding to 682: Location of original node 549 in index 133 adding to 683: Location of original node 549 in index 134 adding to 684: Location of original node 549 in index 135 adding to 685: Location of original node 549 in index 136 adding to 686: Location of original node 549 in index 137 adding to 687: Location of original node 549 in index 138 adding to 688: Location of original node 549 in index 139 adding to 689: Location of original node 549 in index 140 adding to 690: Location of original node 549 in index 141 adding to 691: Location of original node 549 in index 142 adding to 692: Location of original node 549 in index 143 adding to 693: Location of original node 549 in index 144 adding to 694: Location of original node 549 in index 145 adding to 695: Location of original node 549 in index 146 adding to 696: Location of original node 549 in index 147 adding to 697: Location of original node 549 in index 148 adding to 698: Location of original node 549 in index 149 adding to 699: Location of original node 549 in index 150 adding to 700: Location of original node 549 in index 151 adding to 701: Location of original node 549 in index 152 adding to 702: Location of original node 549 in index 153 adding to 703: Location of original node 549 in index 154 adding to 704: Location of original node 549 in index 155 adding to 705: Location of original node 549 in index 156 adding to 706: Location of original node 549 in index 157 adding to 707: Location of original node 549 in index 158 adding to 708: Location of original node 549 in index 159 adding to 709: Location of original node 549 in index 160 adding to 710: Location of original node 549 in index 161 adding to 711: Location of original node 549 in index 162 adding to 712: Location of original node 549 in index 163 adding to 713: Location of original node 549 in index 164 adding to 714: Location of original node 549 in index 165 adding to 715: Location of original node 549 in index 166 adding to 716: Location of original node 549 in index 167 adding to 717: Location of original node 717 in index 0 adding to 718: Location of original node 717 in index 1 adding to 719: Location of original node 717 in index 2 adding to 720: Location of original node 717 in index 3 adding to 721: Location of original node 717 in index 4 adding to 722: Location of original node 717 in index 5 adding to 723: Location of original node 717 in index 6 adding to 724: Location of original node 717 in index 7 adding to 725: Location of original node 717 in index 8 adding to 726: Location of original node 717 in index 9 adding to 727: Location of original node 717 in index 10 adding to 728: Location of original node 717 in index 11 adding to 729: Location of original node 717 in index 12 adding to 730: Location of original node 717 in index 13 adding to 731: Location of original node 717 in index 14 adding to 732: Location of original node 717 in index 15 adding to 733: Location of original node 717 in index 16 adding to 734: Location of original node 717 in index 17 adding to 735: Location of original node 717 in index 18 adding to 736: Location of original node 717 in index 19 adding to 737: Location of original node 717 in index 20 adding to 738: Location of original node 717 in index 21 adding to 739: Location of original node 717 in index 22 adding to 740: Location of original node 717 in index 23 adding to 741: Location of original node 717 in index 24 adding to 742: Location of original node 717 in index 25 adding to 743: Location of original node 717 in index 26 adding to 744: Location of original node 717 in index 27 adding to 745: Location of original node 717 in index 28 adding to 746: Location of original node 717 in index 29 adding to 747: Location of original node 717 in index 30 adding to 748: Location of original node 717 in index 31 adding to 749: Location of original node 717 in index 32 adding to 750: Location of original node 717 in index 33 adding to 751: Location of original node 717 in index 34 adding to 752: Location of original node 717 in index 35 adding to 753: Location of original node 717 in index 36 adding to 754: Location of original node 717 in index 37 adding to 755: Location of original node 717 in index 38 adding to 756: Location of original node 717 in index 39 adding to 757: Location of original node 717 in index 40 adding to 758: Location of original node 717 in index 41 adding to 786: Location of original node 786 in index 0 adding to 787: Location of original node 786 in index 1 adding to 788: Location of original node 786 in index 2 adding to 789: Location of original node 786 in index 3 adding to 790: Location of original node 786 in index 4 adding to 791: Location of original node 786 in index 5 adding to 792: Location of original node 786 in index 6 adding to 793: Location of original node 786 in index 7 adding to 794: Location of original node 786 in index 8 adding to 795: Location of original node 786 in index 9 adding to 796: Location of original node 786 in index 10 adding to 797: Location of original node 786 in index 11 adding to 798: Location of original node 786 in index 12 adding to 799: Location of original node 786 in index 13 adding to 800: Location of original node 786 in index 14 adding to 801: Location of original node 786 in index 15 adding to 802: Location of original node 786 in index 16 adding to 803: Location of original node 786 in index 17 adding to 804: Location of original node 786 in index 18 adding to 805: Location of original node 786 in index 19 adding to 806: Location of original node 786 in index 20 adding to 807: Location of original node 786 in index 21 adding to 808: Location of original node 786 in index 22 adding to 809: Location of original node 786 in index 23 adding to 810: Location of original node 786 in index 24 adding to 811: Location of original node 786 in index 25 adding to 812: Location of original node 786 in index 26 adding to 945: Location of original node 945 in index 0 adding to 946: Location of original node 945 in index 1 adding to 947: Location of original node 945 in index 2 adding to 948: Location of original node 945 in index 3 adding to 949: Location of original node 945 in index 4 adding to 950: Location of original node 945 in index 5 adding to 951: Location of original node 945 in index 6 adding to 952: Location of original node 945 in index 7 adding to 953: Location of original node 945 in index 8 adding to 954: Location of original node 945 in index 9 adding to 955: Location of original node 945 in index 10 adding to 956: Location of original node 945 in index 11 adding to 957: Location of original node 945 in index 12 adding to 958: Location of original node 945 in index 13 adding to 959: Location of original node 945 in index 14 adding to 960: Location of original node 945 in index 15 adding to 961: Location of original node 945 in index 16 adding to 962: Location of original node 945 in index 17 adding to 963: Location of original node 945 in index 18 adding to 964: Location of original node 945 in index 19 adding to 965: Location of original node 945 in index 20 adding to 966: Location of original node 945 in index 21 adding to 967: Location of original node 945 in index 22 adding to 968: Location of original node 945 in index 23 adding to 969: Location of original node 945 in index 24 adding to 970: Location of original node 945 in index 25 adding to 971: Location of original node 945 in index 26 adding to 972: Location of original node 945 in index 27 adding to 973: Location of original node 945 in index 28 adding to 974: Location of original node 945 in index 29 adding to 975: Location of original node 945 in index 30 adding to 976: Location of original node 945 in index 31 adding to 977: Location of original node 945 in index 32 adding to 978: Location of original node 945 in index 33 adding to 979: Location of original node 945 in index 34 adding to 980: Location of original node 945 in index 35 adding to 526: Location of original node 981 in index 0 adding to 527: Location of original node 981 in index 1 adding to 528: Location of original node 981 in index 2 adding to 529: Location of original node 981 in index 3 adding to 530: Location of original node 981 in index 4 adding to 531: Location of original node 981 in index 5 adding to 532: Location of original node 981 in index 6 adding to 533: Location of original node 981 in index 7 adding to 534: Location of original node 981 in index 8 adding to 535: Location of original node 981 in index 9 adding to 536: Location of original node 981 in index 10 adding to 537: Location of original node 981 in index 11 adding to 538: Location of original node 981 in index 12 adding to 539: Location of original node 981 in index 13 adding to 540: Location of original node 981 in index 14 adding to 541: Location of original node 981 in index 15 adding to 542: Location of original node 981 in index 16 adding to 543: Location of original node 981 in index 17 adding to 544: Location of original node 981 in index 18 adding to 545: Location of original node 981 in index 19 adding to 546: Location of original node 981 in index 20 adding to 547: Location of original node 981 in index 21 adding to 548: Location of original node 981 in index 22 adding to 417: Location of original node 982 in index 0 adding to 418: Location of original node 982 in index 1 adding to 419: Location of original node 982 in index 2 adding to 420: Location of original node 982 in index 3 adding to 421: Location of original node 982 in index 4 adding to 422: Location of original node 982 in index 5 adding to 423: Location of original node 982 in index 6 adding to 424: Location of original node 982 in index 7 adding to 425: Location of original node 982 in index 8 adding to 426: Location of original node 982 in index 9 adding to 427: Location of original node 982 in index 10 adding to 428: Location of original node 982 in index 11 adding to 429: Location of original node 982 in index 12 adding to 430: Location of original node 982 in index 13 adding to 431: Location of original node 982 in index 14 adding to 432: Location of original node 982 in index 15 adding to 433: Location of original node 982 in index 16 adding to 434: Location of original node 982 in index 17 adding to 435: Location of original node 982 in index 18 adding to 436: Location of original node 982 in index 19 adding to 437: Location of original node 982 in index 20 adding to 438: Location of original node 982 in index 21 adding to 439: Location of original node 982 in index 22 SECTION ================= Node descriptions before threading. =================== NODE_DESCR: GGCCACACGA...CTTCCTCAAG:W2(V380_D0) Preds: [] Succ: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) ] NODE_DESCR: CTTTCCAAGTA:W8(V440_D2) Preds: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) ] Succ: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) ] NODE_DESCR: GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) Preds: [AGAATACAAA...TTTCCAAGTA:W1(V945_D0) CTTTCCAAGTA:W8(V440_D2) ] Succ: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) ] NODE_DESCR: AGTCCACCAC...GGGAGCCACC:W6(V549_D3) Preds: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) ] Succ: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) ] NODE_DESCR: AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) Preds: [GCTAGGGGAA...GGGAGCCACC:W1(V786_D0) AGTCCACCAC...GGGAGCCACC:W6(V549_D3) ] Succ: [] NODE_DESCR: GCTAGGGGAA...GGGAGCCACC:W1(V786_D0) Preds: [] Succ: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) ] NODE_DESCR: AGAATACAAA...TTTCCAAGTA:W1(V945_D0) Preds: [] Succ: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) ] NODE_DESCR: GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) Preds: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) ] Succ: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3) ] NODE_DESCR: CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) Preds: [GGCCACACGA...CTTCCTCAAG:W2(V380_D0) ] Succ: [CTTTCCAAGTA:W8(V440_D2) ] SECTION ==================== Threading reads through the graph ========================= mapped read [1]Read: >61DFRAAXX100204:1:112:16960:13532/1 0 654 51 705 AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA - Read: 61DFRAAXX100204:1:112:16960:13532 has start: 0, end: 75 and sequence: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA after extracting substring: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 105 Threading read: 61DFRAAXX100204:1:112:16960:13532, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:112:16960:13532 sequence is: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA updatePathRecursively(readName=61DFRAAXX100204:1:112:16960:13532, locInSeq: 0 / 75, locInNode: 105 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:1:112:16960:13532) AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA 105 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 181 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:112:16960:13532 with length: 76 and base [76] ends at position [181] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:1:112:16960:13532 is [549] with total mm: 0 Read 61DFRAAXX100204:1:112:16960:13532 seq AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:181,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:1:112:16960:13532 : [549] ReadPath@Init: 61DFRAAXX100204:1:112:16960:13532 : [549] mapped read [2]Read: >61DFRAAXX100204:1:113:7690:4285/2 0 538 51 589 GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG - Read: 61DFRAAXX100204:1:113:7690:4285 has start: 0, end: 75 and sequence: GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG after extracting substring: GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG findPathInGraph: V:981, with seq: GGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCA trying to start the mapping to node 981 at position: 12 Threading read: 61DFRAAXX100204:1:113:7690:4285, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:113:7690:4285 sequence is: GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG updatePathRecursively(readName=61DFRAAXX100204:1:113:7690:4285, locInSeq: 0 / 75, locInNode: 12 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:1:113:7690:4285) GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAA 0 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCA 12 shortcircuiting the zipper test, too many MM or execeeding local seq divergence *Trying again using full DP alignment: -running Needleman-Wunsch alignment of vertex to read Read 1 -GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCG 49 |||||||||||||||||||||||||||||||||| Vertex 1 GGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCA--------------- 35 vertex end gaps: 15 read end gaps: 0 mismatches encountered: 1 alignment divergence up to seq pos 34 = mm: 1, div:0.029411765 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Read61DFRAAXX100204:1:113:7690:4285 base [34] ends at position [47] within node: 981 totaling 1 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=61DFRAAXX100204:1:113:7690:4285, locInSeq: 34 / 75, locInNode: 23 / 190, totalNumMm: 1 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:1:113:7690:4285) AGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG 34 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 65 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:113:7690:4285 with length: 76 and base [76] ends at position [65] within node: 549 totaling 0 mismatches. 61DFRAAXX100204:1:113:7690:4285 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:1:113:7690:4285 is [981, 549] with total mm: 1 Read 61DFRAAXX100204:1:113:7690:4285 seq GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [981, 549] positions: [981,nodeEnd:47,readEnd:34] [549,nodeEnd:65,readEnd:76] , trimmed to: [981, 549] Threaded Read as: 61DFRAAXX100204:1:113:7690:4285 : [981, 549] ReadPath@Init: 61DFRAAXX100204:1:113:7690:4285 : [981, 549] mapped read [3]Read: >61DFRAAXX100204:1:115:8211:5116/2 0 473 51 524 AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG - Read: 61DFRAAXX100204:1:115:8211:5116 has start: 0, end: 75 and sequence: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG after extracting substring: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 22 Threading read: 61DFRAAXX100204:1:115:8211:5116, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:115:8211:5116 sequence is: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG updatePathRecursively(readName=61DFRAAXX100204:1:115:8211:5116, locInSeq: 0 / 75, locInNode: 22 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:1:115:8211:5116) AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 22 zipper alignment mm: 0 alignment divergence up to seq pos 75 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:1:115:8211:5116 base [75] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=61DFRAAXX100204:1:115:8211:5116, locInSeq: 75 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:1:115:8211:5116) G 75 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: G 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 24 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:115:8211:5116 with length: 76 and base [76] ends at position [24] within node: 981 totaling 0 mismatches. 61DFRAAXX100204:1:115:8211:5116 best path so far from vertex: 451 to : 981 = [981], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981] w/ mm: 0 AND best selected was: [981] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:1:115:8211:5116 is [451, 981] with total mm: 0 Read 61DFRAAXX100204:1:115:8211:5116 seq AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981] positions: [451,nodeEnd:97,readEnd:75] [981,nodeEnd:24,readEnd:76] , trimmed to: [451, 981] Threaded Read as: 61DFRAAXX100204:1:115:8211:5116 : [451, 981] ReadPath@Init: 61DFRAAXX100204:1:115:8211:5116 : [451, 981] mapped read [4]Read: >61DFRAAXX100204:1:20:5538:6890/2 0 567 51 618 AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT - Read: 61DFRAAXX100204:1:20:5538:6890 has start: 0, end: 75 and sequence: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT after extracting substring: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 18 Threading read: 61DFRAAXX100204:1:20:5538:6890, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:20:5538:6890 sequence is: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT updatePathRecursively(readName=61DFRAAXX100204:1:20:5538:6890, locInSeq: 0 / 75, locInNode: 18 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:1:20:5538:6890) AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT 18 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 94 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:20:5538:6890 with length: 76 and base [76] ends at position [94] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:1:20:5538:6890 is [549] with total mm: 0 Read 61DFRAAXX100204:1:20:5538:6890 seq AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:94,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:1:20:5538:6890 : [549] ReadPath@Init: 61DFRAAXX100204:1:20:5538:6890 : [549] mapped read [5]Read: >61DFRAAXX100204:1:39:8793:18196/1 0 380 51 431 GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA - Read: 61DFRAAXX100204:1:39:8793:18196 has start: 0, end: 75 and sequence: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA after extracting substring: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 0 Threading read: 61DFRAAXX100204:1:39:8793:18196, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:39:8793:18196 sequence is: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA updatePathRecursively(readName=61DFRAAXX100204:1:39:8793:18196, locInSeq: 0 / 75, locInNode: 0 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (61DFRAAXX100204:1:39:8793:18196) GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 0 zipper alignment mm: 0 alignment divergence up to seq pos 59 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:1:39:8793:18196 base [59] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=61DFRAAXX100204:1:39:8793:18196, locInSeq: 59 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:1:39:8793:18196) CCTCATCAGCAAGAAGA 59 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 40 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:39:8793:18196 with length: 76 and base [76] ends at position [40] within node: 982 totaling 0 mismatches. 61DFRAAXX100204:1:39:8793:18196 best path so far from vertex: 380 to : 982 = [982], with total mm: 0 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982] w/ mm: 0 AND best selected was: [982] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:1:39:8793:18196 is [380, 982] with total mm: 0 Read 61DFRAAXX100204:1:39:8793:18196 seq GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [380, 982] positions: [380,nodeEnd:59,readEnd:59] [982,nodeEnd:40,readEnd:76] , trimmed to: [380, 982] Threaded Read as: 61DFRAAXX100204:1:39:8793:18196 : [380, 982] ReadPath@Init: 61DFRAAXX100204:1:39:8793:18196 : [380, 982] mapped read [6]Read: >61DFRAAXX100204:1:39:8793:18196/2 0 502 51 553 GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA - Read: 61DFRAAXX100204:1:39:8793:18196 has start: 0, end: 75 and sequence: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA after extracting substring: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 51 Threading read: 61DFRAAXX100204:1:39:8793:18196, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:39:8793:18196 sequence is: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA updatePathRecursively(readName=61DFRAAXX100204:1:39:8793:18196, locInSeq: 0 / 75, locInNode: 51 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:1:39:8793:18196) GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 51 zipper alignment mm: 0 alignment divergence up to seq pos 46 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:1:39:8793:18196 base [46] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=61DFRAAXX100204:1:39:8793:18196, locInSeq: 46 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:1:39:8793:18196) CAGCACTCTGAACCCTGTGAGGCA 46 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAACCCTGTGAGGCA 23 zipper alignment mm: 1 alignment divergence up to seq pos 70 = mm: 1, div:0.014285714 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Read61DFRAAXX100204:1:39:8793:18196 base [70] ends at position [47] within node: 981 totaling 1 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=61DFRAAXX100204:1:39:8793:18196, locInSeq: 70 / 75, locInNode: 23 / 190, totalNumMm: 1 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:1:39:8793:18196) AGTCCA 70 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 29 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:39:8793:18196 with length: 76 and base [76] ends at position [29] within node: 549 totaling 0 mismatches. 61DFRAAXX100204:1:39:8793:18196 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 61DFRAAXX100204:1:39:8793:18196 best path so far from vertex: 451 to : 981 = [981, 549], with total mm: 1 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981, 549] w/ mm: 1 AND best selected was: [981, 549] w/ mm: 1 FINAL BEST PATH for 61DFRAAXX100204:1:39:8793:18196 is [451, 981, 549] with total mm: 1 Read 61DFRAAXX100204:1:39:8793:18196 seq GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA threaded as: PATH_N_MM_COUNT: mismatches=1, path= [451, 981, 549] positions: [451,nodeEnd:97,readEnd:46] [981,nodeEnd:47,readEnd:70] [549,nodeEnd:29,readEnd:76] , trimmed to: [451, 981, 549] Threaded Read as: 61DFRAAXX100204:1:39:8793:18196 : [451, 981, 549] ReadPath@Init: 61DFRAAXX100204:1:39:8793:18196 : [451, 981, 549] mapped read [7]Read: >61DFRAAXX100204:1:67:9991:2232/1 0 401 51 452 GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG - Read: 61DFRAAXX100204:1:67:9991:2232 has start: 0, end: 75 and sequence: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG after extracting substring: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 21 Threading read: 61DFRAAXX100204:1:67:9991:2232, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:67:9991:2232 sequence is: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG updatePathRecursively(readName=61DFRAAXX100204:1:67:9991:2232, locInSeq: 0 / 75, locInNode: 21 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (61DFRAAXX100204:1:67:9991:2232) GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 21 zipper alignment mm: 0 alignment divergence up to seq pos 38 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:1:67:9991:2232 base [38] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=61DFRAAXX100204:1:67:9991:2232, locInSeq: 38 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:1:67:9991:2232) CCTCATCAGCAAGAAGAAATCTTT 38 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGAAATCTTT 23 zipper alignment mm: 0 alignment divergence up to seq pos 62 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:1:67:9991:2232 base [62] ends at position [47] within node: 982 totaling 0 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=61DFRAAXX100204:1:67:9991:2232, locInSeq: 62 / 75, locInNode: 23 / 33, totalNumMm: 0 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (61DFRAAXX100204:1:67:9991:2232) CTTTCCAAGTA 62 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 73 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:1:67:9991:2232 base [73] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=61DFRAAXX100204:1:67:9991:2232, locInSeq: 73 / 75, locInNode: 23 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:1:67:9991:2232) GTG 73 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 26 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:67:9991:2232 with length: 76 and base [76] ends at position [26] within node: 451 totaling 0 mismatches. 61DFRAAXX100204:1:67:9991:2232 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 61DFRAAXX100204:1:67:9991:2232 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 61DFRAAXX100204:1:67:9991:2232 best path so far from vertex: 380 to : 982 = [982, 440, 451], with total mm: 0 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982, 440, 451] w/ mm: 0 AND best selected was: [982, 440, 451] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:1:67:9991:2232 is [380, 982, 440, 451] with total mm: 0 Read 61DFRAAXX100204:1:67:9991:2232 seq GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [380, 982, 440, 451] positions: [380,nodeEnd:59,readEnd:38] [982,nodeEnd:47,readEnd:62] [440,nodeEnd:34,readEnd:73] [451,nodeEnd:26,readEnd:76] , trimmed to: [380, 982, 440, 451] Threaded Read as: 61DFRAAXX100204:1:67:9991:2232 : [380, 982, 440, 451] ReadPath@Init: 61DFRAAXX100204:1:67:9991:2232 : [380, 982, 440, 451] mapped read [8]Read: >61DFRAAXX100204:1:70:1041:1268/1 18 680 25 687 GTGACAAAGAAAAGAGGTTGACAGACTCTCTAAGGGACATATGGGAGCTAGATAGAAAGCCCCGAGGAGGTAGCCG - Read: 61DFRAAXX100204:1:70:1041:1268 has start: 18, end: 49 and sequence: GTGACAAAGAAAAGAGGTTGACAGACTCTCTAAGGGACATATGGGAGCTAGATAGAAAGCCCCGAGGAGGTAGCCG after extracting substring: TGACAGACTCTCTAAGGGACATATGGGAGCTA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 131 Threading read: 61DFRAAXX100204:1:70:1041:1268, length: 32, allowing for 2 max mismatches. Read: 61DFRAAXX100204:1:70:1041:1268 sequence is: TGACAGACTCTCTAAGGGACATATGGGAGCTA updatePathRecursively(readName=61DFRAAXX100204:1:70:1041:1268, locInSeq: 0 / 31, locInNode: 131 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:1:70:1041:1268) TGACAGACTCTCTAAGGGACATATGGGAGCTA 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: TGACAGACTCTCTAAGGGACATATGGGAGCTA 131 zipper alignment mm: 0 alignment divergence up to seq pos 32 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 163 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:70:1041:1268 with length: 32 and base [32] ends at position [163] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:1:70:1041:1268 is [549] with total mm: 0 Read 61DFRAAXX100204:1:70:1041:1268 seq TGACAGACTCTCTAAGGGACATATGGGAGCTA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:163,readEnd:32] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:1:70:1041:1268 : [549] ReadPath@Init: 61DFRAAXX100204:1:70:1041:1268 : [549] mapped read [9]Read: >61DFRAAXX100204:1:85:13720:15251/1 0 639 51 690 TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT - Read: 61DFRAAXX100204:1:85:13720:15251 has start: 0, end: 75 and sequence: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT after extracting substring: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 90 Threading read: 61DFRAAXX100204:1:85:13720:15251, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:1:85:13720:15251 sequence is: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT updatePathRecursively(readName=61DFRAAXX100204:1:85:13720:15251, locInSeq: 0 / 75, locInNode: 90 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:1:85:13720:15251) TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT 90 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 166 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:1:85:13720:15251 with length: 76 and base [76] ends at position [166] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:1:85:13720:15251 is [549] with total mm: 0 Read 61DFRAAXX100204:1:85:13720:15251 seq TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:166,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:1:85:13720:15251 : [549] ReadPath@Init: 61DFRAAXX100204:1:85:13720:15251 : [549] mapped read [10]Read: >61DFRAAXX100204:2:13:7749:17373/2 0 413 51 464 ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG - Read: 61DFRAAXX100204:2:13:7749:17373 has start: 0, end: 75 and sequence: ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG after extracting substring: ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 33 Threading read: 61DFRAAXX100204:2:13:7749:17373, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:13:7749:17373 sequence is: ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG updatePathRecursively(readName=61DFRAAXX100204:2:13:7749:17373, locInSeq: 0 / 75, locInNode: 33 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (61DFRAAXX100204:2:13:7749:17373) ACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: ACTGGCTACAAACAGACTTCCTCAAG 33 zipper alignment mm: 0 alignment divergence up to seq pos 26 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:13:7749:17373 base [26] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=61DFRAAXX100204:2:13:7749:17373, locInSeq: 26 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:2:13:7749:17373) CCTCATCAGCAAGAAGAAATCTTT 26 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGAAATCTTT 23 zipper alignment mm: 0 alignment divergence up to seq pos 50 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:13:7749:17373 base [50] ends at position [47] within node: 982 totaling 0 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=61DFRAAXX100204:2:13:7749:17373, locInSeq: 50 / 75, locInNode: 23 / 33, totalNumMm: 0 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (61DFRAAXX100204:2:13:7749:17373) CTTTCCAAGTA 50 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 61 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:13:7749:17373 base [61] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=61DFRAAXX100204:2:13:7749:17373, locInSeq: 61 / 75, locInNode: 23 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:13:7749:17373) GTGTCTTAACTCAGG 61 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCAGG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 38 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:13:7749:17373 with length: 76 and base [76] ends at position [38] within node: 451 totaling 0 mismatches. 61DFRAAXX100204:2:13:7749:17373 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 61DFRAAXX100204:2:13:7749:17373 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 61DFRAAXX100204:2:13:7749:17373 best path so far from vertex: 380 to : 982 = [982, 440, 451], with total mm: 0 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982, 440, 451] w/ mm: 0 AND best selected was: [982, 440, 451] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:13:7749:17373 is [380, 982, 440, 451] with total mm: 0 Read 61DFRAAXX100204:2:13:7749:17373 seq ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [380, 982, 440, 451] positions: [380,nodeEnd:59,readEnd:26] [982,nodeEnd:47,readEnd:50] [440,nodeEnd:34,readEnd:61] [451,nodeEnd:38,readEnd:76] , trimmed to: [380, 982, 440, 451] Threaded Read as: 61DFRAAXX100204:2:13:7749:17373 : [380, 982, 440, 451] ReadPath@Init: 61DFRAAXX100204:2:13:7749:17373 : [380, 982, 440, 451] mapped read [11]Read: >61DFRAAXX100204:2:18:10392:2962/1 0 411 51 462 CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA - Read: 61DFRAAXX100204:2:18:10392:2962 has start: 0, end: 75 and sequence: CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA after extracting substring: CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 31 Threading read: 61DFRAAXX100204:2:18:10392:2962, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:18:10392:2962 sequence is: CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA updatePathRecursively(readName=61DFRAAXX100204:2:18:10392:2962, locInSeq: 0 / 75, locInNode: 31 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (61DFRAAXX100204:2:18:10392:2962) CTACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: CTACTGGCTACAAACAGACTTCCTCAAG 31 zipper alignment mm: 0 alignment divergence up to seq pos 28 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:18:10392:2962 base [28] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=61DFRAAXX100204:2:18:10392:2962, locInSeq: 28 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:2:18:10392:2962) GCTCATCAGCAAGAAGAAATCTTT 28 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGAAATCTTT 23 zipper alignment mm: 1 alignment divergence up to seq pos 52 = mm: 1, div:0.01923077 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Read61DFRAAXX100204:2:18:10392:2962 base [52] ends at position [47] within node: 982 totaling 1 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=61DFRAAXX100204:2:18:10392:2962, locInSeq: 52 / 75, locInNode: 23 / 33, totalNumMm: 1 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (61DFRAAXX100204:2:18:10392:2962) CTTTCCAAGTA 52 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 63 = mm: 1, div:0.015873017 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:18:10392:2962 base [63] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=61DFRAAXX100204:2:18:10392:2962, locInSeq: 63 / 75, locInNode: 23 / 96, totalNumMm: 1 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:18:10392:2962) GTGTCTTAACTCA 63 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 36 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:18:10392:2962 with length: 76 and base [76] ends at position [36] within node: 451 totaling 0 mismatches. 61DFRAAXX100204:2:18:10392:2962 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 61DFRAAXX100204:2:18:10392:2962 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 61DFRAAXX100204:2:18:10392:2962 best path so far from vertex: 380 to : 982 = [982, 440, 451], with total mm: 1 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982, 440, 451] w/ mm: 1 AND best selected was: [982, 440, 451] w/ mm: 1 FINAL BEST PATH for 61DFRAAXX100204:2:18:10392:2962 is [380, 982, 440, 451] with total mm: 1 Read 61DFRAAXX100204:2:18:10392:2962 seq CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA threaded as: PATH_N_MM_COUNT: mismatches=1, path= [380, 982, 440, 451] positions: [380,nodeEnd:59,readEnd:28] [982,nodeEnd:47,readEnd:52] [440,nodeEnd:34,readEnd:63] [451,nodeEnd:36,readEnd:76] , trimmed to: [380, 982, 440, 451] Threaded Read as: 61DFRAAXX100204:2:18:10392:2962 : [380, 982, 440, 451] ReadPath@Init: 61DFRAAXX100204:2:18:10392:2962 : [380, 982, 440, 451] mapped read [12]Read: >61DFRAAXX100204:2:27:5714:7307/1 0 657 51 708 GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG - Read: 61DFRAAXX100204:2:27:5714:7307 has start: 0, end: 75 and sequence: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG after extracting substring: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 108 Threading read: 61DFRAAXX100204:2:27:5714:7307, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:27:5714:7307 sequence is: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG updatePathRecursively(readName=61DFRAAXX100204:2:27:5714:7307, locInSeq: 0 / 75, locInNode: 108 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:27:5714:7307) GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG 108 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 184 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:27:5714:7307 with length: 76 and base [76] ends at position [184] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:2:27:5714:7307 is [549] with total mm: 0 Read 61DFRAAXX100204:2:27:5714:7307 seq GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:184,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:2:27:5714:7307 : [549] ReadPath@Init: 61DFRAAXX100204:2:27:5714:7307 : [549] mapped read [13]Read: >61DFRAAXX100204:2:33:12784:13782/1 0 606 51 657 TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG - Read: 61DFRAAXX100204:2:33:12784:13782 has start: 0, end: 75 and sequence: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG after extracting substring: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 57 Threading read: 61DFRAAXX100204:2:33:12784:13782, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:33:12784:13782 sequence is: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG updatePathRecursively(readName=61DFRAAXX100204:2:33:12784:13782, locInSeq: 0 / 75, locInNode: 57 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:33:12784:13782) TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG 57 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 133 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:33:12784:13782 with length: 76 and base [76] ends at position [133] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:2:33:12784:13782 is [549] with total mm: 0 Read 61DFRAAXX100204:2:33:12784:13782 seq TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:133,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:2:33:12784:13782 : [549] ReadPath@Init: 61DFRAAXX100204:2:33:12784:13782 : [549] mapped read [14]Read: >61DFRAAXX100204:2:34:11574:10433/2 0 422 51 473 AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG - Read: 61DFRAAXX100204:2:34:11574:10433 has start: 0, end: 75 and sequence: AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG after extracting substring: AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG findPathInGraph: V:982, with seq: GGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTT trying to start the mapping to node 982 at position: 5 Threading read: 61DFRAAXX100204:2:34:11574:10433, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:34:11574:10433 sequence is: AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG updatePathRecursively(readName=61DFRAAXX100204:2:34:11574:10433, locInSeq: 0 / 75, locInNode: 5 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:2:34:11574:10433) AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTC 0 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTT 5 shortcircuiting the zipper test, too many MM or execeeding local seq divergence *Trying again using full DP alignment: -running Needleman-Wunsch alignment of vertex to read Read 1 -AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAA 49 ||||||||||||||||||||||||||||||||||||||||| Vertex 1 CAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTT-------- 42 vertex end gaps: 8 read end gaps: 0 mismatches encountered: 1 alignment divergence up to seq pos 41 = mm: 1, div:0.024390243 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Read61DFRAAXX100204:2:34:11574:10433 base [41] ends at position [47] within node: 982 totaling 1 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=61DFRAAXX100204:2:34:11574:10433, locInSeq: 41 / 75, locInNode: 23 / 33, totalNumMm: 1 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (61DFRAAXX100204:2:34:11574:10433) CTTTCCAAGTA 41 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 52 = mm: 1, div:0.01923077 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:34:11574:10433 base [52] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=61DFRAAXX100204:2:34:11574:10433, locInSeq: 52 / 75, locInNode: 23 / 96, totalNumMm: 1 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:34:11574:10433) GTGTCTTAACTCAGGAGATCATGG 52 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCAGGAGATCATGG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:34:11574:10433 with length: 76 and base [76] ends at position [47] within node: 451 totaling 0 mismatches. 61DFRAAXX100204:2:34:11574:10433 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 61DFRAAXX100204:2:34:11574:10433 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:34:11574:10433 is [982, 440, 451] with total mm: 1 Read 61DFRAAXX100204:2:34:11574:10433 seq AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [982, 440, 451] positions: [982,nodeEnd:47,readEnd:41] [440,nodeEnd:34,readEnd:52] [451,nodeEnd:47,readEnd:76] , trimmed to: [982, 440, 451] Threaded Read as: 61DFRAAXX100204:2:34:11574:10433 : [982, 440, 451] ReadPath@Init: 61DFRAAXX100204:2:34:11574:10433 : [982, 440, 451] mapped read [15]Read: >61DFRAAXX100204:2:43:2649:2845/2 0 945 51 466 AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG - Read: 61DFRAAXX100204:2:43:2649:2845 has start: 0, end: 75 and sequence: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG after extracting substring: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG findPathInGraph: V:945, with seq: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA trying to start the mapping to node 945 at position: 0 Threading read: 61DFRAAXX100204:2:43:2649:2845, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:43:2649:2845 sequence is: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG updatePathRecursively(readName=61DFRAAXX100204:2:43:2649:2845, locInSeq: 0 / 75, locInNode: 0 / 58, totalNumMm: 0 trying to continue the mapping to node AGAATACAAA...TTTCCAAGTA:W1(V945_D0) -ALIGNING READ SEQ (61DFRAAXX100204:2:43:2649:2845) AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA 0 To VERTEX (AGAATACAAA...TTTCCAAGTA:W1(V945_D0)) SEQ: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA 0 zipper alignment mm: 0 alignment divergence up to seq pos 59 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:43:2649:2845 base [59] ends at position [59] within node: 945 totaling 0 mismatches. -reached end of vertex: 945, exploring next vertices for continued path extension: [451] Pursuing extension from : AGAATACAAA...TTTCCAAGTA:W1(V945_D0) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 945 to node: 451 updatePathRecursively(readName=61DFRAAXX100204:2:43:2649:2845, locInSeq: 59 / 75, locInNode: 23 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:43:2649:2845) GTGTCTTAACTCAGGAG 59 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCAGGAG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 40 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:43:2649:2845 with length: 76 and base [76] ends at position [40] within node: 451 totaling 0 mismatches. 61DFRAAXX100204:2:43:2649:2845 best path so far from vertex: 945 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 945 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:43:2649:2845 is [945, 451] with total mm: 0 Read 61DFRAAXX100204:2:43:2649:2845 seq AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [945, 451] positions: [945,nodeEnd:59,readEnd:59] [451,nodeEnd:40,readEnd:76] , trimmed to: [945, 451] Threaded Read as: 61DFRAAXX100204:2:43:2649:2845 : [945, 451] ReadPath@Init: 61DFRAAXX100204:2:43:2649:2845 : [945, 451] mapped read [16]Read: >61DFRAAXX100204:2:47:12270:6103/1 0 631 51 682 CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG - Read: 61DFRAAXX100204:2:47:12270:6103 has start: 0, end: 75 and sequence: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG after extracting substring: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 82 Threading read: 61DFRAAXX100204:2:47:12270:6103, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:47:12270:6103 sequence is: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG updatePathRecursively(readName=61DFRAAXX100204:2:47:12270:6103, locInSeq: 0 / 75, locInNode: 82 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:47:12270:6103) CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG 82 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 158 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:47:12270:6103 with length: 76 and base [76] ends at position [158] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:2:47:12270:6103 is [549] with total mm: 0 Read 61DFRAAXX100204:2:47:12270:6103 seq CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:158,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:2:47:12270:6103 : [549] ReadPath@Init: 61DFRAAXX100204:2:47:12270:6103 : [549] mapped read [17]Read: >61DFRAAXX100204:2:47:8841:7694/2 0 504 51 555 AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC - Read: 61DFRAAXX100204:2:47:8841:7694 has start: 0, end: 75 and sequence: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC after extracting substring: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 53 Threading read: 61DFRAAXX100204:2:47:8841:7694, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:47:8841:7694 sequence is: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC updatePathRecursively(readName=61DFRAAXX100204:2:47:8841:7694, locInSeq: 0 / 75, locInNode: 53 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:47:8841:7694) AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 53 zipper alignment mm: 0 alignment divergence up to seq pos 44 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:47:8841:7694 base [44] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=61DFRAAXX100204:2:47:8841:7694, locInSeq: 44 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:2:47:8841:7694) GAGCACTCTGAACCCTGTGAGGCA 44 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAACCCTGTGAGGCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 68 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:47:8841:7694 base [68] ends at position [47] within node: 981 totaling 0 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=61DFRAAXX100204:2:47:8841:7694, locInSeq: 68 / 75, locInNode: 23 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:47:8841:7694) AGTCCACC 68 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCACC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 31 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:47:8841:7694 with length: 76 and base [76] ends at position [31] within node: 549 totaling 0 mismatches. 61DFRAAXX100204:2:47:8841:7694 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 61DFRAAXX100204:2:47:8841:7694 best path so far from vertex: 451 to : 981 = [981, 549], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981, 549] w/ mm: 0 AND best selected was: [981, 549] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:47:8841:7694 is [451, 981, 549] with total mm: 0 Read 61DFRAAXX100204:2:47:8841:7694 seq AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981, 549] positions: [451,nodeEnd:97,readEnd:44] [981,nodeEnd:47,readEnd:68] [549,nodeEnd:31,readEnd:76] , trimmed to: [451, 981, 549] Threaded Read as: 61DFRAAXX100204:2:47:8841:7694 : [451, 981, 549] ReadPath@Init: 61DFRAAXX100204:2:47:8841:7694 : [451, 981, 549] mapped read [18]Read: >61DFRAAXX100204:2:59:18912:18239/1 0 485 51 536 CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC - Read: 61DFRAAXX100204:2:59:18912:18239 has start: 0, end: 75 and sequence: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC after extracting substring: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 34 Threading read: 61DFRAAXX100204:2:59:18912:18239, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:59:18912:18239 sequence is: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC updatePathRecursively(readName=61DFRAAXX100204:2:59:18912:18239, locInSeq: 0 / 75, locInNode: 34 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:59:18912:18239) CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 34 zipper alignment mm: 0 alignment divergence up to seq pos 63 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:59:18912:18239 base [63] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=61DFRAAXX100204:2:59:18912:18239, locInSeq: 63 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:2:59:18912:18239) GAGCACTCTGAAC 63 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAAC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 36 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:59:18912:18239 with length: 76 and base [76] ends at position [36] within node: 981 totaling 0 mismatches. 61DFRAAXX100204:2:59:18912:18239 best path so far from vertex: 451 to : 981 = [981], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981] w/ mm: 0 AND best selected was: [981] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:59:18912:18239 is [451, 981] with total mm: 0 Read 61DFRAAXX100204:2:59:18912:18239 seq CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981] positions: [451,nodeEnd:97,readEnd:63] [981,nodeEnd:36,readEnd:76] , trimmed to: [451, 981] Threaded Read as: 61DFRAAXX100204:2:59:18912:18239 : [451, 981] ReadPath@Init: 61DFRAAXX100204:2:59:18912:18239 : [451, 981] mapped read [19]Read: >61DFRAAXX100204:2:59:18912:18239/2 0 612 51 663 AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC - Read: 61DFRAAXX100204:2:59:18912:18239 has start: 0, end: 75 and sequence: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC after extracting substring: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 63 Threading read: 61DFRAAXX100204:2:59:18912:18239, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:59:18912:18239 sequence is: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC updatePathRecursively(readName=61DFRAAXX100204:2:59:18912:18239, locInSeq: 0 / 75, locInNode: 63 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:59:18912:18239) AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC 63 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 139 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:59:18912:18239 with length: 76 and base [76] ends at position [139] within node: 549 totaling 0 mismatches. FINAL BEST PATH for 61DFRAAXX100204:2:59:18912:18239 is [549] with total mm: 0 Read 61DFRAAXX100204:2:59:18912:18239 seq AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:139,readEnd:76] , trimmed to: [549] Threaded Read as: 61DFRAAXX100204:2:59:18912:18239 : [549] ReadPath@Init: 61DFRAAXX100204:2:59:18912:18239 : [549] mapped read [20]Read: >61DFRAAXX100204:2:61:13619:6070/2 0 786 51 741 GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC - Read: 61DFRAAXX100204:2:61:13619:6070 has start: 0, end: 75 and sequence: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC after extracting substring: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC findPathInGraph: V:786, with seq: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 786 at position: 0 Threading read: 61DFRAAXX100204:2:61:13619:6070, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:61:13619:6070 sequence is: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC updatePathRecursively(readName=61DFRAAXX100204:2:61:13619:6070, locInSeq: 0 / 75, locInNode: 0 / 49, totalNumMm: 0 trying to continue the mapping to node GCTAGGGGAA...GGGAGCCACC:W1(V786_D0) -ALIGNING READ SEQ (61DFRAAXX100204:2:61:13619:6070) GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACC 0 To VERTEX (GCTAGGGGAA...GGGAGCCACC:W1(V786_D0)) SEQ: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACC 0 zipper alignment mm: 0 alignment divergence up to seq pos 50 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 50 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:61:13619:6070 base [50] ends at position [50] within node: 786 totaling 0 mismatches. -reached end of vertex: 786, exploring next vertices for continued path extension: [717] Pursuing extension from : GCTAGGGGAA...GGGAGCCACC:W1(V786_D0) to successors: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)] Exploring extension from node: 786 to node: 717 updatePathRecursively(readName=61DFRAAXX100204:2:61:13619:6070, locInSeq: 50 / 75, locInNode: 23 / 64, totalNumMm: 0 trying to continue the mapping to node AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:61:13619:6070) AGCCACAGGTACCTGATGGAAATGCC 50 To VERTEX (AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)) SEQ: AGCCACAGGTACCTGATGGAAATGCC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 49 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:61:13619:6070 with length: 76 and base [76] ends at position [49] within node: 717 totaling 0 mismatches. 61DFRAAXX100204:2:61:13619:6070 best path so far from vertex: 786 to : 717 = [717], with total mm: 0 Done with exploring paths from vertex: 786 Paths and scores found are: explored path: [717] w/ mm: 0 AND best selected was: [717] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:61:13619:6070 is [786, 717] with total mm: 0 Read 61DFRAAXX100204:2:61:13619:6070 seq GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [786, 717] positions: [786,nodeEnd:50,readEnd:50] [717,nodeEnd:49,readEnd:76] , trimmed to: [786, 717] Threaded Read as: 61DFRAAXX100204:2:61:13619:6070 : [786, 717] ReadPath@Init: 61DFRAAXX100204:2:61:13619:6070 : [786, 717] mapped read [21]Read: >61DFRAAXX100204:2:64:15138:21125/1 0 706 51 757 GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA - Read: 61DFRAAXX100204:2:64:15138:21125 has start: 0, end: 75 and sequence: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA after extracting substring: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 157 Threading read: 61DFRAAXX100204:2:64:15138:21125, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:64:15138:21125 sequence is: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA updatePathRecursively(readName=61DFRAAXX100204:2:64:15138:21125, locInSeq: 0 / 75, locInNode: 157 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:64:15138:21125) GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 157 zipper alignment mm: 0 alignment divergence up to seq pos 34 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 191 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:64:15138:21125 base [34] ends at position [191] within node: 549 totaling 0 mismatches. -reached end of vertex: 549, exploring next vertices for continued path extension: [717] Pursuing extension from : AGTCCACCAC...GGGAGCCACC:W6(V549_D3) to successors: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)] Exploring extension from node: 549 to node: 717 updatePathRecursively(readName=61DFRAAXX100204:2:64:15138:21125, locInSeq: 34 / 75, locInNode: 23 / 64, totalNumMm: 0 trying to continue the mapping to node AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:64:15138:21125) AGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA 34 To VERTEX (AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)) SEQ: AGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 65 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:64:15138:21125 with length: 76 and base [76] ends at position [65] within node: 717 totaling 0 mismatches. 61DFRAAXX100204:2:64:15138:21125 best path so far from vertex: 549 to : 717 = [717], with total mm: 0 Done with exploring paths from vertex: 549 Paths and scores found are: explored path: [717] w/ mm: 0 AND best selected was: [717] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:64:15138:21125 is [549, 717] with total mm: 0 Read 61DFRAAXX100204:2:64:15138:21125 seq GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549, 717] positions: [549,nodeEnd:191,readEnd:34] [717,nodeEnd:65,readEnd:76] , trimmed to: [549, 717] Threaded Read as: 61DFRAAXX100204:2:64:15138:21125 : [549, 717] ReadPath@Init: 61DFRAAXX100204:2:64:15138:21125 : [549, 717] mapped read [22]Read: >61DFRAAXX100204:2:75:16853:12097/1 0 507 51 558 GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC - Read: 61DFRAAXX100204:2:75:16853:12097 has start: 0, end: 75 and sequence: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC after extracting substring: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 56 Threading read: 61DFRAAXX100204:2:75:16853:12097, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:75:16853:12097 sequence is: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC updatePathRecursively(readName=61DFRAAXX100204:2:75:16853:12097, locInSeq: 0 / 75, locInNode: 56 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:75:16853:12097) GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 56 zipper alignment mm: 0 alignment divergence up to seq pos 41 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:75:16853:12097 base [41] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=61DFRAAXX100204:2:75:16853:12097, locInSeq: 41 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (61DFRAAXX100204:2:75:16853:12097) GAGCACTCTGAACCCTGTGAGGCA 41 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAACCCTGTGAGGCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 65 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:75:16853:12097 base [65] ends at position [47] within node: 981 totaling 0 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=61DFRAAXX100204:2:75:16853:12097, locInSeq: 65 / 75, locInNode: 23 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:75:16853:12097) AGTCCACCACC 65 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCACCACC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:75:16853:12097 with length: 76 and base [76] ends at position [34] within node: 549 totaling 0 mismatches. 61DFRAAXX100204:2:75:16853:12097 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 61DFRAAXX100204:2:75:16853:12097 best path so far from vertex: 451 to : 981 = [981, 549], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981, 549] w/ mm: 0 AND best selected was: [981, 549] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:75:16853:12097 is [451, 981, 549] with total mm: 0 Read 61DFRAAXX100204:2:75:16853:12097 seq GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981, 549] positions: [451,nodeEnd:97,readEnd:41] [981,nodeEnd:47,readEnd:65] [549,nodeEnd:34,readEnd:76] , trimmed to: [451, 981, 549] Threaded Read as: 61DFRAAXX100204:2:75:16853:12097 : [451, 981, 549] ReadPath@Init: 61DFRAAXX100204:2:75:16853:12097 : [451, 981, 549] mapped read [23]Read: >61DFRAAXX100204:2:90:12533:11254/1 0 696 51 747 GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA - Read: 61DFRAAXX100204:2:90:12533:11254 has start: 0, end: 75 and sequence: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA after extracting substring: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 147 Threading read: 61DFRAAXX100204:2:90:12533:11254, length: 76, allowing for 4 max mismatches. Read: 61DFRAAXX100204:2:90:12533:11254 sequence is: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA updatePathRecursively(readName=61DFRAAXX100204:2:90:12533:11254, locInSeq: 0 / 75, locInNode: 147 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (61DFRAAXX100204:2:90:12533:11254) GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 147 zipper alignment mm: 0 alignment divergence up to seq pos 44 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 191 = 0.0 Reached end of node sequence. Read61DFRAAXX100204:2:90:12533:11254 base [44] ends at position [191] within node: 549 totaling 0 mismatches. -reached end of vertex: 549, exploring next vertices for continued path extension: [717] Pursuing extension from : AGTCCACCAC...GGGAGCCACC:W6(V549_D3) to successors: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)] Exploring extension from node: 549 to node: 717 updatePathRecursively(readName=61DFRAAXX100204:2:90:12533:11254, locInSeq: 44 / 75, locInNode: 23 / 64, totalNumMm: 0 trying to continue the mapping to node AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) -ALIGNING READ SEQ (61DFRAAXX100204:2:90:12533:11254) AGCCACAGGTACCTGATGGAAATGCCGGCTCA 44 To VERTEX (AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)) SEQ: AGCCACAGGTACCTGATGGAAATGCCGGCTCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 55 = 0.0 Reached end of read sequence. Read61DFRAAXX100204:2:90:12533:11254 with length: 76 and base [76] ends at position [55] within node: 717 totaling 0 mismatches. 61DFRAAXX100204:2:90:12533:11254 best path so far from vertex: 549 to : 717 = [717], with total mm: 0 Done with exploring paths from vertex: 549 Paths and scores found are: explored path: [717] w/ mm: 0 AND best selected was: [717] w/ mm: 0 FINAL BEST PATH for 61DFRAAXX100204:2:90:12533:11254 is [549, 717] with total mm: 0 Read 61DFRAAXX100204:2:90:12533:11254 seq GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549, 717] positions: [549,nodeEnd:191,readEnd:44] [717,nodeEnd:55,readEnd:76] , trimmed to: [549, 717] Threaded Read as: 61DFRAAXX100204:2:90:12533:11254 : [549, 717] ReadPath@Init: 61DFRAAXX100204:2:90:12533:11254 : [549, 717] mapped read [24]Read: >r261DFRAAXX100204:1:112:16960:13532/1 0 654 51 705 AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA - Read: r261DFRAAXX100204:1:112:16960:13532 has start: 0, end: 75 and sequence: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA after extracting substring: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 105 Threading read: r261DFRAAXX100204:1:112:16960:13532, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:112:16960:13532 sequence is: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA updatePathRecursively(readName=r261DFRAAXX100204:1:112:16960:13532, locInSeq: 0 / 75, locInNode: 105 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:1:112:16960:13532) AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA 105 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 181 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:112:16960:13532 with length: 76 and base [76] ends at position [181] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:1:112:16960:13532 is [549] with total mm: 0 Read r261DFRAAXX100204:1:112:16960:13532 seq AGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:181,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:1:112:16960:13532 : [549] ReadPath@Init: r261DFRAAXX100204:1:112:16960:13532 : [549] mapped read [25]Read: >r261DFRAAXX100204:1:113:7690:4285/2 0 538 51 589 GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG - Read: r261DFRAAXX100204:1:113:7690:4285 has start: 0, end: 75 and sequence: GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG after extracting substring: GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG findPathInGraph: V:981, with seq: GGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCA trying to start the mapping to node 981 at position: 12 Threading read: r261DFRAAXX100204:1:113:7690:4285, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:113:7690:4285 sequence is: GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG updatePathRecursively(readName=r261DFRAAXX100204:1:113:7690:4285, locInSeq: 0 / 75, locInNode: 12 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:113:7690:4285) GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAA 0 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCA 12 shortcircuiting the zipper test, too many MM or execeeding local seq divergence *Trying again using full DP alignment: -running Needleman-Wunsch alignment of vertex to read Read 1 -GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCG 49 |||||||||||||||||||||||||||||||||| Vertex 1 GGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCA--------------- 35 vertex end gaps: 15 read end gaps: 0 mismatches encountered: 1 alignment divergence up to seq pos 34 = mm: 1, div:0.029411765 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Readr261DFRAAXX100204:1:113:7690:4285 base [34] ends at position [47] within node: 981 totaling 1 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=r261DFRAAXX100204:1:113:7690:4285, locInSeq: 34 / 75, locInNode: 23 / 190, totalNumMm: 1 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:1:113:7690:4285) AGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG 34 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 65 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:113:7690:4285 with length: 76 and base [76] ends at position [65] within node: 549 totaling 0 mismatches. r261DFRAAXX100204:1:113:7690:4285 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:1:113:7690:4285 is [981, 549] with total mm: 1 Read r261DFRAAXX100204:1:113:7690:4285 seq GAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [981, 549] positions: [981,nodeEnd:47,readEnd:34] [549,nodeEnd:65,readEnd:76] , trimmed to: [981, 549] Threaded Read as: r261DFRAAXX100204:1:113:7690:4285 : [981, 549] ReadPath@Init: r261DFRAAXX100204:1:113:7690:4285 : [981, 549] mapped read [26]Read: >r261DFRAAXX100204:1:115:8211:5116/2 0 473 51 524 AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG - Read: r261DFRAAXX100204:1:115:8211:5116 has start: 0, end: 75 and sequence: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG after extracting substring: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 22 Threading read: r261DFRAAXX100204:1:115:8211:5116, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:115:8211:5116 sequence is: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG updatePathRecursively(readName=r261DFRAAXX100204:1:115:8211:5116, locInSeq: 0 / 75, locInNode: 22 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:115:8211:5116) AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 22 zipper alignment mm: 0 alignment divergence up to seq pos 75 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:1:115:8211:5116 base [75] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=r261DFRAAXX100204:1:115:8211:5116, locInSeq: 75 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:115:8211:5116) G 75 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: G 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 24 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:115:8211:5116 with length: 76 and base [76] ends at position [24] within node: 981 totaling 0 mismatches. r261DFRAAXX100204:1:115:8211:5116 best path so far from vertex: 451 to : 981 = [981], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981] w/ mm: 0 AND best selected was: [981] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:1:115:8211:5116 is [451, 981] with total mm: 0 Read r261DFRAAXX100204:1:115:8211:5116 seq AGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981] positions: [451,nodeEnd:97,readEnd:75] [981,nodeEnd:24,readEnd:76] , trimmed to: [451, 981] Threaded Read as: r261DFRAAXX100204:1:115:8211:5116 : [451, 981] ReadPath@Init: r261DFRAAXX100204:1:115:8211:5116 : [451, 981] mapped read [27]Read: >r261DFRAAXX100204:1:20:5538:6890/2 0 567 51 618 AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT - Read: r261DFRAAXX100204:1:20:5538:6890 has start: 0, end: 75 and sequence: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT after extracting substring: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 18 Threading read: r261DFRAAXX100204:1:20:5538:6890, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:20:5538:6890 sequence is: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT updatePathRecursively(readName=r261DFRAAXX100204:1:20:5538:6890, locInSeq: 0 / 75, locInNode: 18 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:1:20:5538:6890) AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT 18 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 94 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:20:5538:6890 with length: 76 and base [76] ends at position [94] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:1:20:5538:6890 is [549] with total mm: 0 Read r261DFRAAXX100204:1:20:5538:6890 seq AGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:94,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:1:20:5538:6890 : [549] ReadPath@Init: r261DFRAAXX100204:1:20:5538:6890 : [549] mapped read [28]Read: >r261DFRAAXX100204:1:39:8793:18196/1 0 380 51 431 GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA - Read: r261DFRAAXX100204:1:39:8793:18196 has start: 0, end: 75 and sequence: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA after extracting substring: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 0 Threading read: r261DFRAAXX100204:1:39:8793:18196, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:39:8793:18196 sequence is: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA updatePathRecursively(readName=r261DFRAAXX100204:1:39:8793:18196, locInSeq: 0 / 75, locInNode: 0 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (r261DFRAAXX100204:1:39:8793:18196) GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 0 zipper alignment mm: 0 alignment divergence up to seq pos 59 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:1:39:8793:18196 base [59] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=r261DFRAAXX100204:1:39:8793:18196, locInSeq: 59 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:39:8793:18196) CCTCATCAGCAAGAAGA 59 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 40 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:39:8793:18196 with length: 76 and base [76] ends at position [40] within node: 982 totaling 0 mismatches. r261DFRAAXX100204:1:39:8793:18196 best path so far from vertex: 380 to : 982 = [982], with total mm: 0 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982] w/ mm: 0 AND best selected was: [982] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:1:39:8793:18196 is [380, 982] with total mm: 0 Read r261DFRAAXX100204:1:39:8793:18196 seq GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [380, 982] positions: [380,nodeEnd:59,readEnd:59] [982,nodeEnd:40,readEnd:76] , trimmed to: [380, 982] Threaded Read as: r261DFRAAXX100204:1:39:8793:18196 : [380, 982] ReadPath@Init: r261DFRAAXX100204:1:39:8793:18196 : [380, 982] mapped read [29]Read: >r261DFRAAXX100204:1:39:8793:18196/2 0 502 51 553 GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA - Read: r261DFRAAXX100204:1:39:8793:18196 has start: 0, end: 75 and sequence: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA after extracting substring: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 51 Threading read: r261DFRAAXX100204:1:39:8793:18196, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:39:8793:18196 sequence is: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA updatePathRecursively(readName=r261DFRAAXX100204:1:39:8793:18196, locInSeq: 0 / 75, locInNode: 51 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:39:8793:18196) GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 51 zipper alignment mm: 0 alignment divergence up to seq pos 46 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:1:39:8793:18196 base [46] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=r261DFRAAXX100204:1:39:8793:18196, locInSeq: 46 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:39:8793:18196) CAGCACTCTGAACCCTGTGAGGCA 46 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAACCCTGTGAGGCA 23 zipper alignment mm: 1 alignment divergence up to seq pos 70 = mm: 1, div:0.014285714 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Readr261DFRAAXX100204:1:39:8793:18196 base [70] ends at position [47] within node: 981 totaling 1 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=r261DFRAAXX100204:1:39:8793:18196, locInSeq: 70 / 75, locInNode: 23 / 190, totalNumMm: 1 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:1:39:8793:18196) AGTCCA 70 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 29 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:39:8793:18196 with length: 76 and base [76] ends at position [29] within node: 549 totaling 0 mismatches. r261DFRAAXX100204:1:39:8793:18196 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 r261DFRAAXX100204:1:39:8793:18196 best path so far from vertex: 451 to : 981 = [981, 549], with total mm: 1 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981, 549] w/ mm: 1 AND best selected was: [981, 549] w/ mm: 1 FINAL BEST PATH for r261DFRAAXX100204:1:39:8793:18196 is [451, 981, 549] with total mm: 1 Read r261DFRAAXX100204:1:39:8793:18196 seq GAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTCAGCACTCTGAACCCTGTGAGGCAAGTCCA threaded as: PATH_N_MM_COUNT: mismatches=1, path= [451, 981, 549] positions: [451,nodeEnd:97,readEnd:46] [981,nodeEnd:47,readEnd:70] [549,nodeEnd:29,readEnd:76] , trimmed to: [451, 981, 549] Threaded Read as: r261DFRAAXX100204:1:39:8793:18196 : [451, 981, 549] ReadPath@Init: r261DFRAAXX100204:1:39:8793:18196 : [451, 981, 549] mapped read [30]Read: >r261DFRAAXX100204:1:67:9991:2232/1 0 401 51 452 GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG - Read: r261DFRAAXX100204:1:67:9991:2232 has start: 0, end: 75 and sequence: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG after extracting substring: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 21 Threading read: r261DFRAAXX100204:1:67:9991:2232, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:67:9991:2232 sequence is: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG updatePathRecursively(readName=r261DFRAAXX100204:1:67:9991:2232, locInSeq: 0 / 75, locInNode: 21 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (r261DFRAAXX100204:1:67:9991:2232) GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG 21 zipper alignment mm: 0 alignment divergence up to seq pos 38 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:1:67:9991:2232 base [38] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=r261DFRAAXX100204:1:67:9991:2232, locInSeq: 38 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:67:9991:2232) CCTCATCAGCAAGAAGAAATCTTT 38 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGAAATCTTT 23 zipper alignment mm: 0 alignment divergence up to seq pos 62 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:1:67:9991:2232 base [62] ends at position [47] within node: 982 totaling 0 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=r261DFRAAXX100204:1:67:9991:2232, locInSeq: 62 / 75, locInNode: 23 / 33, totalNumMm: 0 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (r261DFRAAXX100204:1:67:9991:2232) CTTTCCAAGTA 62 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 73 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:1:67:9991:2232 base [73] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=r261DFRAAXX100204:1:67:9991:2232, locInSeq: 73 / 75, locInNode: 23 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:1:67:9991:2232) GTG 73 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 26 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:67:9991:2232 with length: 76 and base [76] ends at position [26] within node: 451 totaling 0 mismatches. r261DFRAAXX100204:1:67:9991:2232 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 r261DFRAAXX100204:1:67:9991:2232 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 r261DFRAAXX100204:1:67:9991:2232 best path so far from vertex: 380 to : 982 = [982, 440, 451], with total mm: 0 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982, 440, 451] w/ mm: 0 AND best selected was: [982, 440, 451] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:1:67:9991:2232 is [380, 982, 440, 451] with total mm: 0 Read r261DFRAAXX100204:1:67:9991:2232 seq GTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [380, 982, 440, 451] positions: [380,nodeEnd:59,readEnd:38] [982,nodeEnd:47,readEnd:62] [440,nodeEnd:34,readEnd:73] [451,nodeEnd:26,readEnd:76] , trimmed to: [380, 982, 440, 451] Threaded Read as: r261DFRAAXX100204:1:67:9991:2232 : [380, 982, 440, 451] ReadPath@Init: r261DFRAAXX100204:1:67:9991:2232 : [380, 982, 440, 451] mapped read [31]Read: >r261DFRAAXX100204:1:70:1041:1268/1 18 680 25 687 GTGACAAAGAAAAGAGGTTGACAGACTCTCTAAGGGACATATGGGAGCTAGATAGAAAGCCCCGAGGAGGTAGCCG - Read: r261DFRAAXX100204:1:70:1041:1268 has start: 18, end: 49 and sequence: GTGACAAAGAAAAGAGGTTGACAGACTCTCTAAGGGACATATGGGAGCTAGATAGAAAGCCCCGAGGAGGTAGCCG after extracting substring: TGACAGACTCTCTAAGGGACATATGGGAGCTA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 131 Threading read: r261DFRAAXX100204:1:70:1041:1268, length: 32, allowing for 2 max mismatches. Read: r261DFRAAXX100204:1:70:1041:1268 sequence is: TGACAGACTCTCTAAGGGACATATGGGAGCTA updatePathRecursively(readName=r261DFRAAXX100204:1:70:1041:1268, locInSeq: 0 / 31, locInNode: 131 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:1:70:1041:1268) TGACAGACTCTCTAAGGGACATATGGGAGCTA 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: TGACAGACTCTCTAAGGGACATATGGGAGCTA 131 zipper alignment mm: 0 alignment divergence up to seq pos 32 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 163 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:70:1041:1268 with length: 32 and base [32] ends at position [163] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:1:70:1041:1268 is [549] with total mm: 0 Read r261DFRAAXX100204:1:70:1041:1268 seq TGACAGACTCTCTAAGGGACATATGGGAGCTA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:163,readEnd:32] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:1:70:1041:1268 : [549] ReadPath@Init: r261DFRAAXX100204:1:70:1041:1268 : [549] mapped read [32]Read: >r261DFRAAXX100204:1:85:13720:15251/1 0 639 51 690 TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT - Read: r261DFRAAXX100204:1:85:13720:15251 has start: 0, end: 75 and sequence: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT after extracting substring: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 90 Threading read: r261DFRAAXX100204:1:85:13720:15251, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:1:85:13720:15251 sequence is: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT updatePathRecursively(readName=r261DFRAAXX100204:1:85:13720:15251, locInSeq: 0 / 75, locInNode: 90 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:1:85:13720:15251) TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT 90 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 166 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:1:85:13720:15251 with length: 76 and base [76] ends at position [166] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:1:85:13720:15251 is [549] with total mm: 0 Read r261DFRAAXX100204:1:85:13720:15251 seq TGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:166,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:1:85:13720:15251 : [549] ReadPath@Init: r261DFRAAXX100204:1:85:13720:15251 : [549] mapped read [33]Read: >r261DFRAAXX100204:2:13:7749:17373/2 0 413 51 464 ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG - Read: r261DFRAAXX100204:2:13:7749:17373 has start: 0, end: 75 and sequence: ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG after extracting substring: ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 33 Threading read: r261DFRAAXX100204:2:13:7749:17373, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:13:7749:17373 sequence is: ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG updatePathRecursively(readName=r261DFRAAXX100204:2:13:7749:17373, locInSeq: 0 / 75, locInNode: 33 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (r261DFRAAXX100204:2:13:7749:17373) ACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: ACTGGCTACAAACAGACTTCCTCAAG 33 zipper alignment mm: 0 alignment divergence up to seq pos 26 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:13:7749:17373 base [26] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=r261DFRAAXX100204:2:13:7749:17373, locInSeq: 26 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:13:7749:17373) CCTCATCAGCAAGAAGAAATCTTT 26 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGAAATCTTT 23 zipper alignment mm: 0 alignment divergence up to seq pos 50 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:13:7749:17373 base [50] ends at position [47] within node: 982 totaling 0 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=r261DFRAAXX100204:2:13:7749:17373, locInSeq: 50 / 75, locInNode: 23 / 33, totalNumMm: 0 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (r261DFRAAXX100204:2:13:7749:17373) CTTTCCAAGTA 50 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 61 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:13:7749:17373 base [61] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=r261DFRAAXX100204:2:13:7749:17373, locInSeq: 61 / 75, locInNode: 23 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:13:7749:17373) GTGTCTTAACTCAGG 61 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCAGG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 38 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:13:7749:17373 with length: 76 and base [76] ends at position [38] within node: 451 totaling 0 mismatches. r261DFRAAXX100204:2:13:7749:17373 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 r261DFRAAXX100204:2:13:7749:17373 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 r261DFRAAXX100204:2:13:7749:17373 best path so far from vertex: 380 to : 982 = [982, 440, 451], with total mm: 0 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982, 440, 451] w/ mm: 0 AND best selected was: [982, 440, 451] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:13:7749:17373 is [380, 982, 440, 451] with total mm: 0 Read r261DFRAAXX100204:2:13:7749:17373 seq ACTGGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [380, 982, 440, 451] positions: [380,nodeEnd:59,readEnd:26] [982,nodeEnd:47,readEnd:50] [440,nodeEnd:34,readEnd:61] [451,nodeEnd:38,readEnd:76] , trimmed to: [380, 982, 440, 451] Threaded Read as: r261DFRAAXX100204:2:13:7749:17373 : [380, 982, 440, 451] ReadPath@Init: r261DFRAAXX100204:2:13:7749:17373 : [380, 982, 440, 451] mapped read [34]Read: >r261DFRAAXX100204:2:18:10392:2962/1 0 411 51 462 CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA - Read: r261DFRAAXX100204:2:18:10392:2962 has start: 0, end: 75 and sequence: CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA after extracting substring: CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA findPathInGraph: V:380, with seq: GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGACTTCCTCAAG trying to start the mapping to node 380 at position: 31 Threading read: r261DFRAAXX100204:2:18:10392:2962, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:18:10392:2962 sequence is: CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA updatePathRecursively(readName=r261DFRAAXX100204:2:18:10392:2962, locInSeq: 0 / 75, locInNode: 31 / 58, totalNumMm: 0 trying to continue the mapping to node GGCCACACGA...CTTCCTCAAG:W2(V380_D0) -ALIGNING READ SEQ (r261DFRAAXX100204:2:18:10392:2962) CTACTGGCTACAAACAGACTTCCTCAAG 0 To VERTEX (GGCCACACGA...CTTCCTCAAG:W2(V380_D0)) SEQ: CTACTGGCTACAAACAGACTTCCTCAAG 31 zipper alignment mm: 0 alignment divergence up to seq pos 28 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:18:10392:2962 base [28] ends at position [59] within node: 380 totaling 0 mismatches. -reached end of vertex: 380, exploring next vertices for continued path extension: [982] Pursuing extension from : GGCCACACGA...CTTCCTCAAG:W2(V380_D0) to successors: [CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)] Exploring extension from node: 380 to node: 982 updatePathRecursively(readName=r261DFRAAXX100204:2:18:10392:2962, locInSeq: 28 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:18:10392:2962) GCTCATCAGCAAGAAGAAATCTTT 28 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CCTCATCAGCAAGAAGAAATCTTT 23 zipper alignment mm: 1 alignment divergence up to seq pos 52 = mm: 1, div:0.01923077 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Readr261DFRAAXX100204:2:18:10392:2962 base [52] ends at position [47] within node: 982 totaling 1 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=r261DFRAAXX100204:2:18:10392:2962, locInSeq: 52 / 75, locInNode: 23 / 33, totalNumMm: 1 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (r261DFRAAXX100204:2:18:10392:2962) CTTTCCAAGTA 52 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 63 = mm: 1, div:0.015873017 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:18:10392:2962 base [63] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=r261DFRAAXX100204:2:18:10392:2962, locInSeq: 63 / 75, locInNode: 23 / 96, totalNumMm: 1 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:18:10392:2962) GTGTCTTAACTCA 63 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 36 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:18:10392:2962 with length: 76 and base [76] ends at position [36] within node: 451 totaling 0 mismatches. r261DFRAAXX100204:2:18:10392:2962 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 r261DFRAAXX100204:2:18:10392:2962 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 r261DFRAAXX100204:2:18:10392:2962 best path so far from vertex: 380 to : 982 = [982, 440, 451], with total mm: 1 Done with exploring paths from vertex: 380 Paths and scores found are: explored path: [982, 440, 451] w/ mm: 1 AND best selected was: [982, 440, 451] w/ mm: 1 FINAL BEST PATH for r261DFRAAXX100204:2:18:10392:2962 is [380, 982, 440, 451] with total mm: 1 Read r261DFRAAXX100204:2:18:10392:2962 seq CTACTGGCTACAAACAGACTTCCTCAAGGCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCA threaded as: PATH_N_MM_COUNT: mismatches=1, path= [380, 982, 440, 451] positions: [380,nodeEnd:59,readEnd:28] [982,nodeEnd:47,readEnd:52] [440,nodeEnd:34,readEnd:63] [451,nodeEnd:36,readEnd:76] , trimmed to: [380, 982, 440, 451] Threaded Read as: r261DFRAAXX100204:2:18:10392:2962 : [380, 982, 440, 451] ReadPath@Init: r261DFRAAXX100204:2:18:10392:2962 : [380, 982, 440, 451] mapped read [35]Read: >r261DFRAAXX100204:2:27:5714:7307/1 0 657 51 708 GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG - Read: r261DFRAAXX100204:2:27:5714:7307 has start: 0, end: 75 and sequence: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG after extracting substring: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 108 Threading read: r261DFRAAXX100204:2:27:5714:7307, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:27:5714:7307 sequence is: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG updatePathRecursively(readName=r261DFRAAXX100204:2:27:5714:7307, locInSeq: 0 / 75, locInNode: 108 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:27:5714:7307) GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG 108 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 184 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:27:5714:7307 with length: 76 and base [76] ends at position [184] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:2:27:5714:7307 is [549] with total mm: 0 Read r261DFRAAXX100204:2:27:5714:7307 seq GGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:184,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:2:27:5714:7307 : [549] ReadPath@Init: r261DFRAAXX100204:2:27:5714:7307 : [549] mapped read [36]Read: >r261DFRAAXX100204:2:33:12784:13782/1 0 606 51 657 TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG - Read: r261DFRAAXX100204:2:33:12784:13782 has start: 0, end: 75 and sequence: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG after extracting substring: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 57 Threading read: r261DFRAAXX100204:2:33:12784:13782, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:33:12784:13782 sequence is: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG updatePathRecursively(readName=r261DFRAAXX100204:2:33:12784:13782, locInSeq: 0 / 75, locInNode: 57 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:33:12784:13782) TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG 57 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 133 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:33:12784:13782 with length: 76 and base [76] ends at position [133] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:2:33:12784:13782 is [549] with total mm: 0 Read r261DFRAAXX100204:2:33:12784:13782 seq TAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:133,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:2:33:12784:13782 : [549] ReadPath@Init: r261DFRAAXX100204:2:33:12784:13782 : [549] mapped read [37]Read: >r261DFRAAXX100204:2:34:11574:10433/2 0 422 51 473 AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG - Read: r261DFRAAXX100204:2:34:11574:10433 has start: 0, end: 75 and sequence: AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG after extracting substring: AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG findPathInGraph: V:982, with seq: GGCTACAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTT trying to start the mapping to node 982 at position: 5 Threading read: r261DFRAAXX100204:2:34:11574:10433, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:34:11574:10433 sequence is: AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG updatePathRecursively(readName=r261DFRAAXX100204:2:34:11574:10433, locInSeq: 0 / 75, locInNode: 5 / 46, totalNumMm: 0 trying to continue the mapping to node CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:34:11574:10433) AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTC 0 To VERTEX (CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1)) SEQ: CAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTT 5 shortcircuiting the zipper test, too many MM or execeeding local seq divergence *Trying again using full DP alignment: -running Needleman-Wunsch alignment of vertex to read Read 1 -AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAA 49 ||||||||||||||||||||||||||||||||||||||||| Vertex 1 CAAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTT-------- 42 vertex end gaps: 8 read end gaps: 0 mismatches encountered: 1 alignment divergence up to seq pos 41 = mm: 1, div:0.024390243 local vertex alignment divergence = 1 / 47 = 0.021276595 Reached end of node sequence. Readr261DFRAAXX100204:2:34:11574:10433 base [41] ends at position [47] within node: 982 totaling 1 mismatches. -reached end of vertex: 982, exploring next vertices for continued path extension: [440] Pursuing extension from : CCTCATCAGCAAGAAGAAATCTTT:W7(V982_D-1) to successors: [CTTTCCAAGTA:W8(V440_D2)] Exploring extension from node: 982 to node: 440 updatePathRecursively(readName=r261DFRAAXX100204:2:34:11574:10433, locInSeq: 41 / 75, locInNode: 23 / 33, totalNumMm: 1 trying to continue the mapping to node CTTTCCAAGTA:W8(V440_D2) -ALIGNING READ SEQ (r261DFRAAXX100204:2:34:11574:10433) CTTTCCAAGTA 41 To VERTEX (CTTTCCAAGTA:W8(V440_D2)) SEQ: CTTTCCAAGTA 23 zipper alignment mm: 0 alignment divergence up to seq pos 52 = mm: 1, div:0.01923077 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:34:11574:10433 base [52] ends at position [34] within node: 440 totaling 0 mismatches. -reached end of vertex: 440, exploring next vertices for continued path extension: [451] Pursuing extension from : CTTTCCAAGTA:W8(V440_D2) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 440 to node: 451 updatePathRecursively(readName=r261DFRAAXX100204:2:34:11574:10433, locInSeq: 52 / 75, locInNode: 23 / 96, totalNumMm: 1 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:34:11574:10433) GTGTCTTAACTCAGGAGATCATGG 52 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCAGGAGATCATGG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 1, div:0.013157895 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:34:11574:10433 with length: 76 and base [76] ends at position [47] within node: 451 totaling 0 mismatches. r261DFRAAXX100204:2:34:11574:10433 best path so far from vertex: 440 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 440 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 r261DFRAAXX100204:2:34:11574:10433 best path so far from vertex: 982 to : 440 = [440, 451], with total mm: 0 Done with exploring paths from vertex: 982 Paths and scores found are: explored path: [440, 451] w/ mm: 0 AND best selected was: [440, 451] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:34:11574:10433 is [982, 440, 451] with total mm: 1 Read r261DFRAAXX100204:2:34:11574:10433 seq AAACAGACTTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [982, 440, 451] positions: [982,nodeEnd:47,readEnd:41] [440,nodeEnd:34,readEnd:52] [451,nodeEnd:47,readEnd:76] , trimmed to: [982, 440, 451] Threaded Read as: r261DFRAAXX100204:2:34:11574:10433 : [982, 440, 451] ReadPath@Init: r261DFRAAXX100204:2:34:11574:10433 : [982, 440, 451] mapped read [38]Read: >r261DFRAAXX100204:2:43:2649:2845/2 0 945 51 466 AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG - Read: r261DFRAAXX100204:2:43:2649:2845 has start: 0, end: 75 and sequence: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG after extracting substring: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG findPathInGraph: V:945, with seq: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA trying to start the mapping to node 945 at position: 0 Threading read: r261DFRAAXX100204:2:43:2649:2845, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:43:2649:2845 sequence is: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG updatePathRecursively(readName=r261DFRAAXX100204:2:43:2649:2845, locInSeq: 0 / 75, locInNode: 0 / 58, totalNumMm: 0 trying to continue the mapping to node AGAATACAAA...TTTCCAAGTA:W1(V945_D0) -ALIGNING READ SEQ (r261DFRAAXX100204:2:43:2649:2845) AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA 0 To VERTEX (AGAATACAAA...TTTCCAAGTA:W1(V945_D0)) SEQ: AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA 0 zipper alignment mm: 0 alignment divergence up to seq pos 59 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 59 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:43:2649:2845 base [59] ends at position [59] within node: 945 totaling 0 mismatches. -reached end of vertex: 945, exploring next vertices for continued path extension: [451] Pursuing extension from : AGAATACAAA...TTTCCAAGTA:W1(V945_D0) to successors: [GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)] Exploring extension from node: 945 to node: 451 updatePathRecursively(readName=r261DFRAAXX100204:2:43:2649:2845, locInSeq: 59 / 75, locInNode: 23 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:43:2649:2845) GTGTCTTAACTCAGGAG 59 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GTGTCTTAACTCAGGAG 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 40 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:43:2649:2845 with length: 76 and base [76] ends at position [40] within node: 451 totaling 0 mismatches. r261DFRAAXX100204:2:43:2649:2845 best path so far from vertex: 945 to : 451 = [451], with total mm: 0 Done with exploring paths from vertex: 945 Paths and scores found are: explored path: [451] w/ mm: 0 AND best selected was: [451] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:43:2649:2845 is [945, 451] with total mm: 0 Read r261DFRAAXX100204:2:43:2649:2845 seq AGAATACAAAATGCCTTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [945, 451] positions: [945,nodeEnd:59,readEnd:59] [451,nodeEnd:40,readEnd:76] , trimmed to: [945, 451] Threaded Read as: r261DFRAAXX100204:2:43:2649:2845 : [945, 451] ReadPath@Init: r261DFRAAXX100204:2:43:2649:2845 : [945, 451] mapped read [39]Read: >r261DFRAAXX100204:2:47:12270:6103/1 0 631 51 682 CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG - Read: r261DFRAAXX100204:2:47:12270:6103 has start: 0, end: 75 and sequence: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG after extracting substring: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 82 Threading read: r261DFRAAXX100204:2:47:12270:6103, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:47:12270:6103 sequence is: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG updatePathRecursively(readName=r261DFRAAXX100204:2:47:12270:6103, locInSeq: 0 / 75, locInNode: 82 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:47:12270:6103) CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG 82 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 158 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:47:12270:6103 with length: 76 and base [76] ends at position [158] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:2:47:12270:6103 is [549] with total mm: 0 Read r261DFRAAXX100204:2:47:12270:6103 seq CCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:158,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:2:47:12270:6103 : [549] ReadPath@Init: r261DFRAAXX100204:2:47:12270:6103 : [549] mapped read [40]Read: >r261DFRAAXX100204:2:47:8841:7694/2 0 504 51 555 AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC - Read: r261DFRAAXX100204:2:47:8841:7694 has start: 0, end: 75 and sequence: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC after extracting substring: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 53 Threading read: r261DFRAAXX100204:2:47:8841:7694, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:47:8841:7694 sequence is: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC updatePathRecursively(readName=r261DFRAAXX100204:2:47:8841:7694, locInSeq: 0 / 75, locInNode: 53 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:47:8841:7694) AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 53 zipper alignment mm: 0 alignment divergence up to seq pos 44 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:47:8841:7694 base [44] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=r261DFRAAXX100204:2:47:8841:7694, locInSeq: 44 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:47:8841:7694) GAGCACTCTGAACCCTGTGAGGCA 44 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAACCCTGTGAGGCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 68 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:47:8841:7694 base [68] ends at position [47] within node: 981 totaling 0 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=r261DFRAAXX100204:2:47:8841:7694, locInSeq: 68 / 75, locInNode: 23 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:47:8841:7694) AGTCCACC 68 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCACC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 31 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:47:8841:7694 with length: 76 and base [76] ends at position [31] within node: 549 totaling 0 mismatches. r261DFRAAXX100204:2:47:8841:7694 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 r261DFRAAXX100204:2:47:8841:7694 best path so far from vertex: 451 to : 981 = [981, 549], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981, 549] w/ mm: 0 AND best selected was: [981, 549] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:47:8841:7694 is [451, 981, 549] with total mm: 0 Read r261DFRAAXX100204:2:47:8841:7694 seq AGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981, 549] positions: [451,nodeEnd:97,readEnd:44] [981,nodeEnd:47,readEnd:68] [549,nodeEnd:31,readEnd:76] , trimmed to: [451, 981, 549] Threaded Read as: r261DFRAAXX100204:2:47:8841:7694 : [451, 981, 549] ReadPath@Init: r261DFRAAXX100204:2:47:8841:7694 : [451, 981, 549] mapped read [41]Read: >r261DFRAAXX100204:2:59:18912:18239/1 0 485 51 536 CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC - Read: r261DFRAAXX100204:2:59:18912:18239 has start: 0, end: 75 and sequence: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC after extracting substring: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 34 Threading read: r261DFRAAXX100204:2:59:18912:18239, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:59:18912:18239 sequence is: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC updatePathRecursively(readName=r261DFRAAXX100204:2:59:18912:18239, locInSeq: 0 / 75, locInNode: 34 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:59:18912:18239) CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 34 zipper alignment mm: 0 alignment divergence up to seq pos 63 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:59:18912:18239 base [63] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=r261DFRAAXX100204:2:59:18912:18239, locInSeq: 63 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:59:18912:18239) GAGCACTCTGAAC 63 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAAC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 36 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:59:18912:18239 with length: 76 and base [76] ends at position [36] within node: 981 totaling 0 mismatches. r261DFRAAXX100204:2:59:18912:18239 best path so far from vertex: 451 to : 981 = [981], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981] w/ mm: 0 AND best selected was: [981] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:59:18912:18239 is [451, 981] with total mm: 0 Read r261DFRAAXX100204:2:59:18912:18239 seq CAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981] positions: [451,nodeEnd:97,readEnd:63] [981,nodeEnd:36,readEnd:76] , trimmed to: [451, 981] Threaded Read as: r261DFRAAXX100204:2:59:18912:18239 : [451, 981] ReadPath@Init: r261DFRAAXX100204:2:59:18912:18239 : [451, 981] mapped read [42]Read: >r261DFRAAXX100204:2:59:18912:18239/2 0 612 51 663 AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC - Read: r261DFRAAXX100204:2:59:18912:18239 has start: 0, end: 75 and sequence: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC after extracting substring: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 63 Threading read: r261DFRAAXX100204:2:59:18912:18239, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:59:18912:18239 sequence is: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC updatePathRecursively(readName=r261DFRAAXX100204:2:59:18912:18239, locInSeq: 0 / 75, locInNode: 63 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:59:18912:18239) AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC 63 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 139 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:59:18912:18239 with length: 76 and base [76] ends at position [139] within node: 549 totaling 0 mismatches. FINAL BEST PATH for r261DFRAAXX100204:2:59:18912:18239 is [549] with total mm: 0 Read r261DFRAAXX100204:2:59:18912:18239 seq AGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549] positions: [549,nodeEnd:139,readEnd:76] , trimmed to: [549] Threaded Read as: r261DFRAAXX100204:2:59:18912:18239 : [549] ReadPath@Init: r261DFRAAXX100204:2:59:18912:18239 : [549] mapped read [43]Read: >r261DFRAAXX100204:2:61:13619:6070/2 0 786 51 741 GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC - Read: r261DFRAAXX100204:2:61:13619:6070 has start: 0, end: 75 and sequence: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC after extracting substring: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC findPathInGraph: V:786, with seq: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 786 at position: 0 Threading read: r261DFRAAXX100204:2:61:13619:6070, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:61:13619:6070 sequence is: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC updatePathRecursively(readName=r261DFRAAXX100204:2:61:13619:6070, locInSeq: 0 / 75, locInNode: 0 / 49, totalNumMm: 0 trying to continue the mapping to node GCTAGGGGAA...GGGAGCCACC:W1(V786_D0) -ALIGNING READ SEQ (r261DFRAAXX100204:2:61:13619:6070) GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACC 0 To VERTEX (GCTAGGGGAA...GGGAGCCACC:W1(V786_D0)) SEQ: GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACC 0 zipper alignment mm: 0 alignment divergence up to seq pos 50 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 50 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:61:13619:6070 base [50] ends at position [50] within node: 786 totaling 0 mismatches. -reached end of vertex: 786, exploring next vertices for continued path extension: [717] Pursuing extension from : GCTAGGGGAA...GGGAGCCACC:W1(V786_D0) to successors: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)] Exploring extension from node: 786 to node: 717 updatePathRecursively(readName=r261DFRAAXX100204:2:61:13619:6070, locInSeq: 50 / 75, locInNode: 23 / 64, totalNumMm: 0 trying to continue the mapping to node AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:61:13619:6070) AGCCACAGGTACCTGATGGAAATGCC 50 To VERTEX (AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)) SEQ: AGCCACAGGTACCTGATGGAAATGCC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 49 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:61:13619:6070 with length: 76 and base [76] ends at position [49] within node: 717 totaling 0 mismatches. r261DFRAAXX100204:2:61:13619:6070 best path so far from vertex: 786 to : 717 = [717], with total mm: 0 Done with exploring paths from vertex: 786 Paths and scores found are: explored path: [717] w/ mm: 0 AND best selected was: [717] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:61:13619:6070 is [786, 717] with total mm: 0 Read r261DFRAAXX100204:2:61:13619:6070 seq GCTAGGGGAAATAGGGGAGCTCCAAACCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [786, 717] positions: [786,nodeEnd:50,readEnd:50] [717,nodeEnd:49,readEnd:76] , trimmed to: [786, 717] Threaded Read as: r261DFRAAXX100204:2:61:13619:6070 : [786, 717] ReadPath@Init: r261DFRAAXX100204:2:61:13619:6070 : [786, 717] mapped read [44]Read: >r261DFRAAXX100204:2:64:15138:21125/1 0 706 51 757 GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA - Read: r261DFRAAXX100204:2:64:15138:21125 has start: 0, end: 75 and sequence: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA after extracting substring: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 157 Threading read: r261DFRAAXX100204:2:64:15138:21125, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:64:15138:21125 sequence is: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA updatePathRecursively(readName=r261DFRAAXX100204:2:64:15138:21125, locInSeq: 0 / 75, locInNode: 157 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:64:15138:21125) GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 157 zipper alignment mm: 0 alignment divergence up to seq pos 34 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 191 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:64:15138:21125 base [34] ends at position [191] within node: 549 totaling 0 mismatches. -reached end of vertex: 549, exploring next vertices for continued path extension: [717] Pursuing extension from : AGTCCACCAC...GGGAGCCACC:W6(V549_D3) to successors: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)] Exploring extension from node: 549 to node: 717 updatePathRecursively(readName=r261DFRAAXX100204:2:64:15138:21125, locInSeq: 34 / 75, locInNode: 23 / 64, totalNumMm: 0 trying to continue the mapping to node AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:64:15138:21125) AGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA 34 To VERTEX (AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)) SEQ: AGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 65 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:64:15138:21125 with length: 76 and base [76] ends at position [65] within node: 717 totaling 0 mismatches. r261DFRAAXX100204:2:64:15138:21125 best path so far from vertex: 549 to : 717 = [717], with total mm: 0 Done with exploring paths from vertex: 549 Paths and scores found are: explored path: [717] w/ mm: 0 AND best selected was: [717] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:64:15138:21125 is [549, 717] with total mm: 0 Read r261DFRAAXX100204:2:64:15138:21125 seq GAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCACTTCCTGTGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549, 717] positions: [549,nodeEnd:191,readEnd:34] [717,nodeEnd:65,readEnd:76] , trimmed to: [549, 717] Threaded Read as: r261DFRAAXX100204:2:64:15138:21125 : [549, 717] ReadPath@Init: r261DFRAAXX100204:2:64:15138:21125 : [549, 717] mapped read [45]Read: >r261DFRAAXX100204:2:75:16853:12097/1 0 507 51 558 GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC - Read: r261DFRAAXX100204:2:75:16853:12097 has start: 0, end: 75 and sequence: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC after extracting substring: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC findPathInGraph: V:451, with seq: GAAGAAATCTTTCTTTCCAAGTAGTGTCTTAACTCAGGAGATCATGGTAGGGAAGGGGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT trying to start the mapping to node 451 at position: 56 Threading read: r261DFRAAXX100204:2:75:16853:12097, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:75:16853:12097 sequence is: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC updatePathRecursively(readName=r261DFRAAXX100204:2:75:16853:12097, locInSeq: 0 / 75, locInNode: 56 / 96, totalNumMm: 0 trying to continue the mapping to node GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:75:16853:12097) GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 0 To VERTEX (GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1)) SEQ: GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCT 56 zipper alignment mm: 0 alignment divergence up to seq pos 41 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 97 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:75:16853:12097 base [41] ends at position [97] within node: 451 totaling 0 mismatches. -reached end of vertex: 451, exploring next vertices for continued path extension: [981] Pursuing extension from : GTGTCTTAAC...GAAGCTCCCT:W6(V451_D1) to successors: [GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)] Exploring extension from node: 451 to node: 981 updatePathRecursively(readName=r261DFRAAXX100204:2:75:16853:12097, locInSeq: 41 / 75, locInNode: 23 / 46, totalNumMm: 0 trying to continue the mapping to node GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:75:16853:12097) GAGCACTCTGAACCCTGTGAGGCA 41 To VERTEX (GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1)) SEQ: GAGCACTCTGAACCCTGTGAGGCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 65 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 47 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:75:16853:12097 base [65] ends at position [47] within node: 981 totaling 0 mismatches. -reached end of vertex: 981, exploring next vertices for continued path extension: [549] Pursuing extension from : GAGCACTCTGAACCCTGTGAGGCA:W6(V981_D-1) to successors: [AGTCCACCAC...GGGAGCCACC:W6(V549_D3)] Exploring extension from node: 981 to node: 549 updatePathRecursively(readName=r261DFRAAXX100204:2:75:16853:12097, locInSeq: 65 / 75, locInNode: 23 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:75:16853:12097) AGTCCACCACC 65 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: AGTCCACCACC 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 34 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:75:16853:12097 with length: 76 and base [76] ends at position [34] within node: 549 totaling 0 mismatches. r261DFRAAXX100204:2:75:16853:12097 best path so far from vertex: 981 to : 549 = [549], with total mm: 0 Done with exploring paths from vertex: 981 Paths and scores found are: explored path: [549] w/ mm: 0 AND best selected was: [549] w/ mm: 0 r261DFRAAXX100204:2:75:16853:12097 best path so far from vertex: 451 to : 981 = [981, 549], with total mm: 0 Done with exploring paths from vertex: 451 Paths and scores found are: explored path: [981, 549] w/ mm: 0 AND best selected was: [981, 549] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:75:16853:12097 is [451, 981, 549] with total mm: 0 Read r261DFRAAXX100204:2:75:16853:12097 seq GGTCAGGCCACTTCACAAGGAGCAGAGTTAGGAAGCTCCCTGAGCACTCTGAACCCTGTGAGGCAAGTCCACCACC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [451, 981, 549] positions: [451,nodeEnd:97,readEnd:41] [981,nodeEnd:47,readEnd:65] [549,nodeEnd:34,readEnd:76] , trimmed to: [451, 981, 549] Threaded Read as: r261DFRAAXX100204:2:75:16853:12097 : [451, 981, 549] ReadPath@Init: r261DFRAAXX100204:2:75:16853:12097 : [451, 981, 549] mapped read [46]Read: >r261DFRAAXX100204:2:90:12533:11254/1 0 696 51 747 GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA - Read: r261DFRAAXX100204:2:90:12533:11254 has start: 0, end: 75 and sequence: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA after extracting substring: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA findPathInGraph: V:549, with seq: AGCACTCTGAACCCTGTGAGGCAAGTCCACCACCAGCGTATCTAGACCCAGGCCATCTAATAAAGGAAAACTGCATCTTTGCCCACATGATGCTTGGTTAAGACAAGGGGTTAGTGACAAAGTAAAGAGGATGACAGACTCTCTAAGGGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC trying to start the mapping to node 549 at position: 147 Threading read: r261DFRAAXX100204:2:90:12533:11254, length: 76, allowing for 4 max mismatches. Read: r261DFRAAXX100204:2:90:12533:11254 sequence is: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA updatePathRecursively(readName=r261DFRAAXX100204:2:90:12533:11254, locInSeq: 0 / 75, locInNode: 147 / 190, totalNumMm: 0 trying to continue the mapping to node AGTCCACCAC...GGGAGCCACC:W6(V549_D3) -ALIGNING READ SEQ (r261DFRAAXX100204:2:90:12533:11254) GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 0 To VERTEX (AGTCCACCAC...GGGAGCCACC:W6(V549_D3)) SEQ: GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACC 147 zipper alignment mm: 0 alignment divergence up to seq pos 44 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 191 = 0.0 Reached end of node sequence. Readr261DFRAAXX100204:2:90:12533:11254 base [44] ends at position [191] within node: 549 totaling 0 mismatches. -reached end of vertex: 549, exploring next vertices for continued path extension: [717] Pursuing extension from : AGTCCACCAC...GGGAGCCACC:W6(V549_D3) to successors: [AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)] Exploring extension from node: 549 to node: 717 updatePathRecursively(readName=r261DFRAAXX100204:2:90:12533:11254, locInSeq: 44 / 75, locInNode: 23 / 64, totalNumMm: 0 trying to continue the mapping to node AGCCACAGGT...CTTCCTGTGA:W5(V717_D1) -ALIGNING READ SEQ (r261DFRAAXX100204:2:90:12533:11254) AGCCACAGGTACCTGATGGAAATGCCGGCTCA 44 To VERTEX (AGCCACAGGT...CTTCCTGTGA:W5(V717_D1)) SEQ: AGCCACAGGTACCTGATGGAAATGCCGGCTCA 23 zipper alignment mm: 0 alignment divergence up to seq pos 76 = mm: 0, div:0.0 local vertex alignment divergence = 0 / 55 = 0.0 Reached end of read sequence. Readr261DFRAAXX100204:2:90:12533:11254 with length: 76 and base [76] ends at position [55] within node: 717 totaling 0 mismatches. r261DFRAAXX100204:2:90:12533:11254 best path so far from vertex: 549 to : 717 = [717], with total mm: 0 Done with exploring paths from vertex: 549 Paths and scores found are: explored path: [717] w/ mm: 0 AND best selected was: [717] w/ mm: 0 FINAL BEST PATH for r261DFRAAXX100204:2:90:12533:11254 is [549, 717] with total mm: 0 Read r261DFRAAXX100204:2:90:12533:11254 seq GGACATATGGGAGCTACATAGCCAGCCCCGTGGAGGGAGCCACCAGCCACAGGTACCTGATGGAAATGCCGGCTCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [549, 717] positions: [549,nodeEnd:191,readEnd:44] [717,nodeEnd:55,readEnd:76] , trimmed to: [549, 717] Threaded Read as: r261DFRAAXX100204:2:90:12533:11254 : [549, 717] ReadPath@Init: r261DFRAAXX100204:2:90:12533:11254 : [549, 717] number of reads threaded = 46 (from total of 46) which came from 42 pairs Read name to pairing info: r261DFRAAXX100204:2:47:8841:7694 => [451, 981, 549] Read name to pairing info: r261DFRAAXX100204:1:67:9991:2232 => [380, 982, 440, 451] Read name to pairing info: 61DFRAAXX100204:2:27:5714:7307 => [549] Read name to pairing info: r261DFRAAXX100204:2:27:5714:7307 => [549] Read name to pairing info: 61DFRAAXX100204:1:70:1041:1268 => [549] Read name to pairing info: 61DFRAAXX100204:1:113:7690:4285 => [981, 549] Read name to pairing info: 61DFRAAXX100204:1:67:9991:2232 => [380, 982, 440, 451] Read name to pairing info: r261DFRAAXX100204:1:113:7690:4285 => [981, 549] Read name to pairing info: 61DFRAAXX100204:2:43:2649:2845 => [945, 451] Read name to pairing info: r261DFRAAXX100204:1:112:16960:13532 => [549] Read name to pairing info: r261DFRAAXX100204:2:13:7749:17373 => [380, 982, 440, 451] Read name to pairing info: 61DFRAAXX100204:2:90:12533:11254 => [549, 717] Read name to pairing info: 61DFRAAXX100204:1:20:5538:6890 => [549] Read name to pairing info: r261DFRAAXX100204:2:61:13619:6070 => [786, 717] Read name to pairing info: r261DFRAAXX100204:1:20:5538:6890 => [549] Read name to pairing info: 61DFRAAXX100204:1:112:16960:13532 => [549] Read name to pairing info: 61DFRAAXX100204:2:61:13619:6070 => [786, 717] Read name to pairing info: r261DFRAAXX100204:2:34:11574:10433 => [982, 440, 451] Read name to pairing info: 61DFRAAXX100204:2:13:7749:17373 => [380, 982, 440, 451] Read name to pairing info: r261DFRAAXX100204:2:90:12533:11254 => [549, 717] Read name to pairing info: 61DFRAAXX100204:2:47:8841:7694 => [451, 981, 549] Read name to pairing info: 61DFRAAXX100204:1:115:8211:5116 => [451, 981] Read name to pairing info: 61DFRAAXX100204:2:34:11574:10433 => [982, 440, 451] Read name to pairing info: r261DFRAAXX100204:1:85:13720:15251 => [549] Read name to pairing info: r261DFRAAXX100204:1:39:8793:18196 => [380, 982][451, 981, 549] Read name to pairing info: 61DFRAAXX100204:2:33:12784:13782 => [549] Read name to pairing info: 61DFRAAXX100204:2:47:12270:6103 => [549] Read name to pairing info: 61DFRAAXX100204:1:39:8793:18196 => [380, 982][451, 981, 549] Read name to pairing info: r261DFRAAXX100204:2:75:16853:12097 => [451, 981, 549] Read name to pairing info: r261DFRAAXX100204:2:59:18912:18239 => [451, 981][549] Read name to pairing info: 61DFRAAXX100204:1:85:13720:15251 => [549] Read name to pairing info: r261DFRAAXX100204:2:47:12270:6103 => [549] Read name to pairing info: r261DFRAAXX100204:2:33:12784:13782 => [549] Read name to pairing info: r261DFRAAXX100204:2:64:15138:21125 => [549, 717] Read name to pairing info: r261DFRAAXX100204:2:18:10392:2962 => [380, 982, 440, 451] Read name to pairing info: 61DFRAAXX100204:2:59:18912:18239 => [451, 981][549] Read name to pairing info: 61DFRAAXX100204:2:18:10392:2962 => [380, 982, 440, 451] Read name to pairing info: 61DFRAAXX100204:2:64:15138:21125 => [549, 717] Read name to pairing info: r261DFRAAXX100204:2:43:2649:2845 => [945, 451] Read name to pairing info: r261DFRAAXX100204:1:115:8211:5116 => [451, 981] Read name to pairing info: 61DFRAAXX100204:2:75:16853:12097 => [451, 981, 549] Read name to pairing info: r261DFRAAXX100204:1:70:1041:1268 => [549] SECTION ================== Pairing up the reads into PairPaths =========================== we have 1 reads supporting the path: PairPath [_paths=[[451, 981, 549], []]] we have 1 reads supporting the path: PairPath [_paths=[[380, 982, 440, 451], []]] we have 1 reads supporting the path: PairPath [_paths=[[549], []]] we have 2 reads supporting the path: PairPath [_paths=[[549], []]] we have 3 reads supporting the path: PairPath [_paths=[[549], []]] we have 1 reads supporting the path: PairPath [_paths=[[981, 549], []]] we have 2 reads supporting the path: PairPath [_paths=[[380, 982, 440, 451], []]] we have 2 reads supporting the path: PairPath [_paths=[[981, 549], []]] we have 1 reads supporting the path: PairPath [_paths=[[945, 451], []]] we have 4 reads supporting the path: PairPath [_paths=[[549], []]] we have 3 reads supporting the path: PairPath [_paths=[[380, 982, 440, 451], []]] we have 1 reads supporting the path: PairPath [_paths=[[549, 717], []]] we have 5 reads supporting the path: PairPath [_paths=[[549], []]] we have 1 reads supporting the path: PairPath [_paths=[[786, 717], []]] we have 6 reads supporting the path: PairPath [_paths=[[549], []]] we have 7 reads supporting the path: PairPath [_paths=[[549], []]] we have 2 reads supporting the path: PairPath [_paths=[[786, 717], []]] we have 1 reads supporting the path: PairPath [_paths=[[982, 440, 451], []]] we have 4 reads supporting the path: PairPath [_paths=[[380, 982, 440, 451], []]] we have 2 reads supporting the path: PairPath [_paths=[[549, 717], []]] we have 2 reads supporting the path: PairPath [_paths=[[451, 981, 549], []]] we have 1 reads supporting the path: PairPath [_paths=[[451, 981], []]] we have 2 reads supporting the path: PairPath [_paths=[[982, 440, 451], []]] we have 8 reads supporting the path: PairPath [_paths=[[549], []]] we have 1 reads supporting the path: PairPath [_paths=[[380, 982], [451, 981, 549]]] we have 9 reads supporting the path: PairPath [_paths=[[549], []]] we have 10 reads supporting the path: PairPath [_paths=[[549], []]] we have 2 reads supporting the path: PairPath [_paths=[[380, 982], [451, 981, 549]]] we have 3 reads supporting the path: PairPath [_paths=[[451, 981, 549], []]] we have 1 reads supporting the path: PairPath [_paths=[[451, 981], [549]]] we have 11 reads supporting the path: PairPath [_paths=[[549], []]] we have 12 reads supporting the path: PairPath [_paths=[[549], []]] we have 13 reads supporting the path: PairPath [_paths=[[549], []]] we have 3 reads supporting the path: PairPath [_paths=[[549, 717], []]] we have 5 reads supporting the path: PairPath [_paths=[[380, 982, 440, 451], []]] we have 2 reads supporting the path: PairPath [_paths=[[451, 981], [549]]] we have 6 reads supporting the path: PairPath [_paths=[[380, 982, 440, 451], []]] we have 4 reads supporting the path: PairPath [_paths=[[549, 717], []]] we have 2 reads supporting the path: PairPath [_paths=[[945, 451], []]] we have 2 reads supporting the path: PairPath [_paths=[[451, 981], []]] we have 4 reads supporting the path: PairPath [_paths=[[451, 981, 549], []]] we have 14 reads supporting the path: PairPath [_paths=[[549], []]] number of reads used = 42 ## Read PathPair results: 38 singletons, num pairs: 4, num pairs discarded: 0 Printing Pair Paths Before DAG Overlap Layout ------------------ Start Vertex:945 PairPaths@Init: PairPath [_paths=[[945, 451], []]]=2 Start Vertex:786 PairPaths@Init: PairPath [_paths=[[786, 717], []]]=2 Start Vertex:451 PairPaths@Init: PairPath [_paths=[[451, 981, 549], []]]=4 PairPaths@Init: PairPath [_paths=[[451, 981], [549]]]=2 PairPaths@Init: PairPath [_paths=[[451, 981], []]]=2 Start Vertex:549 PairPaths@Init: PairPath [_paths=[[549, 717], []]]=4 PairPaths@Init: PairPath [_paths=[[549], []]]=14 Start Vertex:981 PairPaths@Init: PairPath [_paths=[[981, 549], []]]=2 Start Vertex:982 PairPaths@Init: PairPath [_paths=[[982, 440, 451], []]]=2 Start Vertex:380 PairPaths@Init: PairPath [_paths=[[380, 982], [451, 981, 549]]]=2 PairPaths@Init: PairPath [_paths=[[380, 982, 440, 451], []]]=6 SECTION ======== Create DAG from Overlap Layout ============ Noncontained paths: [[380, 982, 440, 451], [451, 981, 549], [786, 717], [549, 717], [945, 451]] Node[451] has repeat count: 3 Node[549] has repeat count: 2 Node[717] has repeat count: 2 Node[945] has repeat count: 1 Node[786] has repeat count: 1 Node[981] has repeat count: 1 Node[982] has repeat count: 1 Node[440] has repeat count: 1 Node[380] has repeat count: 1 path PN1::[380, 982, 440, 451] extends no path PathNode Overlap Detected: [overlap: 1] PN1::[380, 982, 440, 451] extended by PN2::[451, 981, 549] PathNode Overlap Detected: [overlap: 1] PN5::[945, 451] extended by PN2::[451, 981, 549] extension of: PN1::[380, 982, 440, 451] by PN2::[451, 981, 549] has 1 terminal matches. extension of: PN5::[945, 451] by PN2::[451, 981, 549] has 1 terminal matches. path PN3::[786, 717] extends no path PathNode Overlap Detected: [overlap: 1] PN2::[451, 981, 549] extended by PN4::[549, 717] extension of: PN2::[451, 981, 549] by PN4::[549, 717] has 1 terminal matches. path PN5::[945, 451] extends no path PathNodeDescription: PN3::[786, 717] PathNodeDescription: PN4::[549, 717] PathNodeDescription: PN5::[945, 451] PathNodeDescription: PN1::[380, 982, 440, 451] PathNodeDescription: PN2::[451, 981, 549] // Breaking cycles in Path Overlap Graph (POG), Round: 1 SECTION ======== Convert Path-DAG to SeqVertex-DAG ============ prep_for_DAG_collapse: PN3 CurrVert:[983, 984], OrigVert:[786, 717] prep_for_DAG_collapse: PN4 CurrVert:[985, 986], OrigVert:[549, 717] prep_for_DAG_collapse: PN5 CurrVert:[987, 988], OrigVert:[945, 451] prep_for_DAG_collapse: PN1 CurrVert:[989, 990, 991, 992], OrigVert:[380, 982, 440, 451] prep_for_DAG_collapse: PN2 CurrVert:[993, 994, 995], OrigVert:[451, 981, 549] DFS_path_to_graph: targeting: PN3::[786, 717] DFS_path_to_graph: targeting: PN5::[945, 451] DFS_path_to_graph: targeting: PN2::[451, 981, 549] DFS_path_to_graph: targeting: PN4::[549, 717] DFS_path_to_graph: targeting: PN1::[380, 982, 440, 451] ## Round: 1 Zipping up. ## zip_up() attempt_zip_merge_SeqVertices([AGTCCACCAC...GGGAGCCACC:W6(V995_549_D11), AGCACTCTGA...GGGAGCCACC:W6(V985_549_D2)]) parent_depths[10], child_depths: [12, 12] UpZipMerging nodes: [AGCACTCTGA...GGGAGCCACC:W6(V995_549_D11), AGCACTCTGA...GGGAGCCACC:W6(V985_549_D2)] to AGTCCACCAC...GGGAGCCACC:W6(V996_549_D2) Zip up merged: 2 nodes. ## Round: 2 Zipping up. ## zip_up() attempt_zip_merge_SeqVertices([GTGTCTTAAC...GAAGCTCCCT:W6(V992_451_D8), GAAGAAATCT...GAAGCTCCCT:W6(V993_451_D0), GTGTCTTAAC...GAAGCTCCCT:W6(V988_451_D5)]) parent_depths[7, 2], child_depths: [9, 9, 9] UpZipMerging nodes: [GAAGAAATCT...GAAGCTCCCT:W6(V992_451_D8), GAAGAAATCT...GAAGCTCCCT:W6(V993_451_D0), GAAGAAATCT...GAAGCTCCCT:W6(V988_451_D5)] to GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D0) Zip up merged: 3 nodes. ## Round: 3 Zipping up. ## zip_up() Zip up merged: 0 nodes. ## Round: 4 Zipping down. Zip down merged: 0 nodes. ## Round: 5 Zipping up. ## zip_up() Zip up merged: 0 nodes. ## Round: 6 Zipping down. Zip down merged: 0 nodes. destroy_unzipped_duplicates_above() Old_to_new_vertex_id_mapping: 983 => 983 (stays same) Old_to_new_vertex_id_mapping: 987 => 987 (stays same) Old_to_new_vertex_id_mapping: 989 => 989 (stays same) Old_to_new_vertex_id_mapping: 984 => 984 (stays same) Old_to_new_vertex_id_mapping: 990 => 990 (stays same) Old_to_new_vertex_id_mapping: 991 => 991 (stays same) Old_to_new_vertex_id_mapping: 992 => 997 Old_to_new_vertex_id_mapping: 993 => 997 Old_to_new_vertex_id_mapping: 988 => 997 Old_to_new_vertex_id_mapping: 994 => 994 (stays same) Old_to_new_vertex_id_mapping: 995 => 996 Old_to_new_vertex_id_mapping: 985 => 996 Old_to_new_vertex_id_mapping: 986 => 986 (stays same) Old-to-new-path mappings: {[945, 451]=[987, 997], [451, 981, 549]=[997, 994, 996], [549, 717]=[996, 986], [786, 717]=[983, 984], [380, 982, 440, 451]=[989, 990, 991, 997]} update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[945, 451], []]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[549, 717], []]] has support: 4 update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[982, 440, 451], []]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths, p1: [982, 440, 451] mapped to: [[990, 991, 997]] update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[451, 981, 549], []]] has support: 4 update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[451, 981], [549]]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths, p1: [451, 981] mapped to: [[997, 994]] update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[786, 717], []]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[451, 981], []]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths, p1: [451, 981] mapped to: [[997, 994]] update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[380, 982], [451, 981, 549]]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths, p1: [380, 982] mapped to: [[989, 990]] update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[549], []]] has support: 14 update_PairPaths_using_overlapDAG_refined_paths, p1: [549] mapped to: [[996]] update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[981, 549], []]] has support: 2 update_PairPaths_using_overlapDAG_refined_paths, p1: [981, 549] mapped to: [[994, 996]] update_PairPaths_using_overlapDAG_refined_paths: orig_pp: PairPath [_paths=[[380, 982, 440, 451], []]] has support: 6 Printing Pair Paths ------------------ Start Vertex:994 PairPaths@PostOverlapLayout: PairPath [_paths=[[994, 996], []]]=2 Start Vertex:996 PairPaths@PostOverlapLayout: PairPath [_paths=[[996, 986], []]]=4 PairPaths@PostOverlapLayout: PairPath [_paths=[[996], []]]=14 Start Vertex:997 PairPaths@PostOverlapLayout: PairPath [_paths=[[997, 994, 996], []]]=4 PairPaths@PostOverlapLayout: PairPath [_paths=[[997, 994], [996]]]=2 PairPaths@PostOverlapLayout: PairPath [_paths=[[997, 994], []]]=2 Start Vertex:983 PairPaths@PostOverlapLayout: PairPath [_paths=[[983, 984], []]]=2 Start Vertex:987 PairPaths@PostOverlapLayout: PairPath [_paths=[[987, 997], []]]=2 Start Vertex:989 PairPaths@PostOverlapLayout: PairPath [_paths=[[989, 990], [997, 994, 996]]]=2 PairPaths@PostOverlapLayout: PairPath [_paths=[[989, 990, 991, 997], []]]=6 Start Vertex:990 PairPaths@PostOverlapLayout: PairPath [_paths=[[990, 991, 997], []]]=2 SECTION ======= Reorganize Read Pairings ========= NODE_DESCR: GAGCACTCTGAACCCTGTGAGGCA:W6(V994_981_D2) Preds: [GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1) ] Succ: [AGTCCACCAC...GGGAGCCACC:W6(V996_549_D3) ] NODE_DESCR: AGTCCACCAC...GGGAGCCACC:W6(V996_549_D3) Preds: [GAGCACTCTGAACCCTGTGAGGCA:W6(V994_981_D2) ] Succ: [AGCCACAGGT...CTTCCTGTGA:W5(V986_717_D4) ] NODE_DESCR: GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1) Preds: [AGAATACAAA...TTTCCAAGTA:W1(V987_945_D0) CTTTCCAAGTA:W8(V991_440_D2) ] Succ: [GAGCACTCTGAACCCTGTGAGGCA:W6(V994_981_D2) ] NODE_DESCR: GCTAGGGGAA...GGGAGCCACC:W1(V983_786_D0) Preds: [] Succ: [AGCCACAGGT...CTTCCTGTGA:W5(V984_717_D1) ] NODE_DESCR: AGCCACAGGT...CTTCCTGTGA:W5(V984_717_D1) Preds: [GCTAGGGGAA...GGGAGCCACC:W1(V983_786_D0) ] Succ: [] NODE_DESCR: AGCCACAGGT...CTTCCTGTGA:W5(V986_717_D4) Preds: [AGTCCACCAC...GGGAGCCACC:W6(V996_549_D3) ] Succ: [] NODE_DESCR: AGAATACAAA...TTTCCAAGTA:W1(V987_945_D0) Preds: [] Succ: [GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1) ] NODE_DESCR: GGCCACACGA...CTTCCTCAAG:W2(V989_380_D0) Preds: [] Succ: [CCTCATCAGCAAGAAGAAATCTTT:W7(V990_982_D1) ] NODE_DESCR: CCTCATCAGCAAGAAGAAATCTTT:W7(V990_982_D1) Preds: [GGCCACACGA...CTTCCTCAAG:W2(V989_380_D0) ] Succ: [CTTTCCAAGTA:W8(V991_440_D2) ] NODE_DESCR: CTTTCCAAGTA:W8(V991_440_D2) Preds: [CCTCATCAGCAAGAAGAAATCTTT:W7(V990_982_D1) ] Succ: [GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1) ] we have 2 reads supporting the path: PairPath [_paths=[[994, 996], []]] we have 4 reads supporting the path: PairPath [_paths=[[996, 986], []]] we have 14 reads supporting the path: PairPath [_paths=[[996], []]] we have 4 reads supporting the path: PairPath [_paths=[[997, 994, 996], []]] combinePaths: [997, 994], [996] Examining imputation of path connecting pairpath: PairPath [_paths=[[997, 994], [996]]] nodes 994 to 996 Could Impute path connectingPairPath [_paths=[[997, 994], [996]]] containing intervening nodes: [] we have 6 reads supporting the path: PairPath [_paths=[[997, 994, 996], []]] OK pp update to new DAG: PairPath [_paths=[[997, 994], [996]]] => PairPath [_paths=[[997, 994, 996], []]] we have 2 reads supporting the path: PairPath [_paths=[[997, 994], []]] we have 2 reads supporting the path: PairPath [_paths=[[983, 984], []]] we have 2 reads supporting the path: PairPath [_paths=[[987, 997], []]] combinePaths: [989, 990], [997, 994, 996] Examining imputation of path connecting pairpath: PairPath [_paths=[[989, 990], [997, 994, 996]]] nodes 990 to 997 Could Impute path connectingPairPath [_paths=[[989, 990], [997, 994, 996]]] containing intervening nodes: [991] we have 2 reads supporting the path: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] OK pp update to new DAG: PairPath [_paths=[[989, 990], [997, 994, 996]]] => PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] we have 6 reads supporting the path: PairPath [_paths=[[989, 990, 991, 997], []]] we have 2 reads supporting the path: PairPath [_paths=[[990, 991, 997], []]] Start Vertex:994 PairPaths@AfterPairReorganization: PairPath [_paths=[[994, 996], []]]=2 Start Vertex:996 PairPaths@AfterPairReorganization: PairPath [_paths=[[996, 986], []]]=4 PairPaths@AfterPairReorganization: PairPath [_paths=[[996], []]]=14 Start Vertex:997 PairPaths@AfterPairReorganization: PairPath [_paths=[[997, 994, 996], []]]=6 PairPaths@AfterPairReorganization: PairPath [_paths=[[997, 994], []]]=2 Start Vertex:983 PairPaths@AfterPairReorganization: PairPath [_paths=[[983, 984], []]]=2 Start Vertex:987 PairPaths@AfterPairReorganization: PairPath [_paths=[[987, 997], []]]=2 Start Vertex:989 PairPaths@AfterPairReorganization: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]]=2 PairPaths@AfterPairReorganization: PairPath [_paths=[[989, 990, 991, 997], []]]=6 Start Vertex:990 PairPaths@AfterPairReorganization: PairPath [_paths=[[990, 991, 997], []]]=2 ComponentDivision: 0 contains the following vertices: node_id: 994 node_id: 996 node_id: 997 node_id: 986 node_id: 987 node_id: 989 node_id: 990 node_id: 991 ComponentDivision: 1 contains the following vertices: node_id: 983 node_id: 984 total number of components = 2 Searching for kmer set: CCCAGCCCCGTGGAGGGAGCCACC -> CCAGCCCCGTGGAGGGAGCCACCA Searching for kmer set: TGGCTACAAACAGACTTCCTCAAG -> GGCTACAAACAGACTTCCTCAAGC Searching for kmer set: CCTCATCAGCAAGAAGAAATCTTT -> CTCATCAGCAAGAAGAAATCTTTC Searching for kmer set: GAGCACTCTGAACCCTGTGAGGCA -> AGCACTCTGAACCCTGTGAGGCAA Searching for kmer set: GGAAGAAATCTTTCTTTCCAAGTA -> GAAGAAATCTTTCTTTCCAAGTAG Searching for kmer set: GCCAGCCCCGTGGAGGGAGCCACC -> CCAGCCCCGTGGAGGGAGCCACCA Searching for kmer set: AGGAGCAGAGTTAGGAAGCTCCCT -> GGAGCAGAGTTAGGAAGCTCCCTG Searching for kmer set: AGAAGAAATCTTTCTTTCCAAGTA -> GAAGAAATCTTTCTTTCCAAGTAG SECTION ============= Begin Assembly =============== Assembling subcomponent 0 Subcomponent: 0, adding pairpath: PairPath [_paths=[[994, 996], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[996, 986], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[996], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[997, 994, 996], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[997, 994], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[987, 997], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[989, 990, 991, 997], []]] Subcomponent: 0, adding pairpath: PairPath [_paths=[[990, 991, 997], []]] #### Component Read Summary BEFORE PairPath-per-node Reduction ***** PairPath Counts ***** componentReadHash, start node: 994 has size: 1 Node: 994 has 1 pairpaths stored: PairPath [_paths=[[994, 996], []]] has read support: 2 componentReadHash, start node: 996 has size: 2 Node: 996 has 2 pairpaths stored: PairPath [_paths=[[996], []]] has read support: 14 PairPath [_paths=[[996, 986], []]] has read support: 4 componentReadHash, start node: 997 has size: 2 Node: 997 has 2 pairpaths stored: PairPath [_paths=[[997, 994, 996], []]] has read support: 6 PairPath [_paths=[[997, 994], []]] has read support: 2 componentReadHash, start node: 987 has size: 1 Node: 987 has 1 pairpaths stored: PairPath [_paths=[[987, 997], []]] has read support: 2 componentReadHash, start node: 989 has size: 2 Node: 989 has 2 pairpaths stored: PairPath [_paths=[[989, 990, 991, 997], []]] has read support: 6 PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] has read support: 2 componentReadHash, start node: 990 has size: 1 Node: 990 has 1 pairpaths stored: PairPath [_paths=[[990, 991, 997], []]] has read support: 2 ## Total number of pairpaths: 9 #### Component Read Summary AFTER PairPath-per-node Reduction ***** PairPath Counts ***** componentReadHash, start node: 994 has size: 1 Node: 994 has 1 pairpaths stored: PairPath [_paths=[[994, 996], []]] has read support: 2 componentReadHash, start node: 996 has size: 2 Node: 996 has 2 pairpaths stored: PairPath [_paths=[[996], []]] has read support: 14 PairPath [_paths=[[996, 986], []]] has read support: 4 componentReadHash, start node: 997 has size: 2 Node: 997 has 2 pairpaths stored: PairPath [_paths=[[997, 994, 996], []]] has read support: 6 PairPath [_paths=[[997, 994], []]] has read support: 2 componentReadHash, start node: 987 has size: 1 Node: 987 has 1 pairpaths stored: PairPath [_paths=[[987, 997], []]] has read support: 2 componentReadHash, start node: 989 has size: 2 Node: 989 has 2 pairpaths stored: PairPath [_paths=[[989, 990, 991, 997], []]] has read support: 6 PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] has read support: 2 componentReadHash, start node: 990 has size: 1 Node: 990 has 1 pairpaths stored: PairPath [_paths=[[990, 991, 997], []]] has read support: 2 ## Total number of pairpaths: 9 ### Extracting triplets from reads. Setting initial triplet adjacency_path for central node: 994 => [997, 994, 996] Setting initial triplet adjacency_path for central node: 990 => [989, 990, 991] Setting initial triplet adjacency_path for central node: 991 => [990, 991, 997] Setting initial triplet adjacency_path for central node: 997 => [991, 997, 994] triplet adjacency_path of node: 994 => [997, 994, 996] already captured. triplet adjacency_path of node: 990 => [989, 990, 991] already captured. triplet adjacency_path of node: 991 => [990, 991, 997] already captured. triplet adjacency_path of node: 991 => [990, 991, 997] already captured. ### 4 nodes have locked-in triplet paths: Triplet locks for: 994 : [[997, 994, 996]] Triplet locks for: 997 : [[991, 997, 994]] Triplet locks for: 990 : [[989, 990, 991]] Triplet locks for: 991 : [[990, 991, 997]] ### Extracting complex path prefixes from reads. -capturing path prefixes -removing prefixes that are subpaths of other prefixes EXTENDED_TRIPLET_CAPTURED: [989, 990, 991, 997, 994] EXTENDED_TRIPLET_CAPTURED: [989, 990, 991, 997, 994, 996] EXTENDED_TRIPLET_CAPTURED: [989, 990, 991, 997] EXTENDED_TRIPLET_CAPTURED: [990, 991, 997] EXTENDED_TRIPLET_CAPTURED: [989, 990, 991] #### Extended triplets from reads: Complex prefix paths for: 994 : [[989, 990, 991, 997, 994]] Complex prefix paths for: 996 : [[989, 990, 991, 997, 994, 996]] Complex prefix paths for: 997 : [[989, 990, 991, 997], [990, 991, 997]] Complex prefix paths for: 991 : [[989, 990, 991]] Adding edge from AGCCACAGGT...CTTCCTGTGA:W5(V986_717_D4) to T Adding edge from S to GCCTCATCAG...TTTCCAAGTA:W1(V987_945_D0) Adding edge from S to CCACATTTCT...CTTCCTCAAG:W2(V989_380_D0) SECTION ############### ## Starting Butterfly Assembly ## ################### PairPaths to assemble: Start Vertex:-1 PairPaths@BflyStart: PairPath [_paths=[[-1, 989], []]]=1 PairPaths@BflyStart: PairPath [_paths=[[-1, 987], []]]=1 Start Vertex:994 PairPaths@BflyStart: PairPath [_paths=[[994, 996], []]]=2 Start Vertex:996 PairPaths@BflyStart: PairPath [_paths=[[996, 986], []]]=4 PairPaths@BflyStart: PairPath [_paths=[[996], []]]=14 Start Vertex:997 PairPaths@BflyStart: PairPath [_paths=[[997, 994, 996], []]]=6 PairPaths@BflyStart: PairPath [_paths=[[997, 994], []]]=2 Start Vertex:986 PairPaths@BflyStart: PairPath [_paths=[[986, -2], []]]=1 Start Vertex:987 PairPaths@BflyStart: PairPath [_paths=[[987, 997], []]]=2 Start Vertex:989 PairPaths@BflyStart: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]]=2 PairPaths@BflyStart: PairPath [_paths=[[989, 990, 991, 997], []]]=6 Start Vertex:990 PairPaths@BflyStart: PairPath [_paths=[[990, 991, 997], []]]=2 QUEUE IS: [:W2147483647(V-1_D-1)] #### getAllProbablePaths() The next node in the queue C is -1 butterfly pct done: 1 / 8 = 12.5% pct done. ReadsStartingAtV_START_BFLY, Node: -1 read: PairPath [_paths=[[-1, 989], []]] ReadsStartingAtV_START_BFLY, Node: -1 read: PairPath [_paths=[[-1, 987], []]] Exploring extension of: 1 paths that end at vertex: -1 == Current Paths Constructed Up To Vertex: -1 : PathPartialReconstruction@[-1] : [-1] Adding the reads {PairPath [_paths=[[-1, 989], []]]=1, PairPath [_paths=[[-1, 987], []]]=1} to the path [-1] ################################################ ###### Exploring extension of v: -1 by successor: 987 ################################################ Count of paths ending at v: -1 = 1 path_ending_at_v: [-1] # [PathCounter(987)=0 Examining potential extension of path ending at node V: -1 by successor: 987, via path=[-1] path [-1] is too short to check for triplet support. ReadsOfPathUntilV: PATH: [-1] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 987] -readsOfPathUntilV: PairPath [_paths=[[-1, 987], []]] -checking if pp: PairPath [_paths=[[-1, 987], []]] supports extension of [-1, 987] => true examining subPath: [-1, 987] for reinforcement by read: [[-1, 987], []] :true the read PairPath [_paths=[[-1, 987], []]](1) enforces the sub-path ([-1, 987]) -found: 1 reads supporting subpath. the sub-path ([-1, 987]) has PASSED Successful extension of 987 to generate path [-1, 987] updateReadsOfPath: [-1, 987] read PairPath [_paths=[[-1, 987], []]] is consistent with 987 read PairPath [_paths=[[-1, 989], []]] is not consistent with 987 pct_contained_propagated: 0.0% 987 was added to the queue ################################################ ###### Exploring extension of v: -1 by successor: 989 ################################################ Count of paths ending at v: -1 = 1 path_ending_at_v: [-1] # [PathCounter(989)=0 Examining potential extension of path ending at node V: -1 by successor: 989, via path=[-1] path [-1] is too short to check for triplet support. ReadsOfPathUntilV: PATH: [-1] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 989] -readsOfPathUntilV: PairPath [_paths=[[-1, 987], []]] -checking if pp: PairPath [_paths=[[-1, 987], []]] supports extension of [-1, 989] => false examining subPath: [-1, 989] for reinforcement by read: [[-1, 987], []] :false the read PairPath [_paths=[[-1, 987], []]](1) does not enforce the sub-path ([-1, 989]) -readsOfPathUntilV: PairPath [_paths=[[-1, 989], []]] -checking if pp: PairPath [_paths=[[-1, 989], []]] supports extension of [-1, 989] => true examining subPath: [-1, 989] for reinforcement by read: [[-1, 989], []] :true the read PairPath [_paths=[[-1, 989], []]](1) enforces the sub-path ([-1, 989]) -found: 1 reads supporting subpath. the sub-path ([-1, 989]) has PASSED Successful extension of 989 to generate path [-1, 989] updateReadsOfPath: [-1, 989] read PairPath [_paths=[[-1, 987], []]] is not consistent with 989 read PairPath [_paths=[[-1, 989], []]] is consistent with 989 pct_contained_propagated: 0.0% 989 was added to the queue QUEUE IS: [GCCTCATCAG...TTTCCAAGTA:W1(V987_945_D0), CCACATTTCT...CTTCCTCAAG:W2(V989_380_D0)] #### getAllProbablePaths() The next node in the queue C is 987 butterfly pct done: 2 / 8 = 25.0% pct done. ReadsStartingAtV_START_BFLY, Node: 987 read: PairPath [_paths=[[987, 997], []]] Exploring extension of: 1 paths that end at vertex: 987 == Current Paths Constructed Up To Vertex: 987 : PathPartialReconstruction@[987] : [-1, 987] Adding the reads {PairPath [_paths=[[987, 997], []]]=2} to the path [-1, 987] ################################################ ###### Exploring extension of v: 987 by successor: 997 ################################################ Count of paths ending at v: 987 = 1 path_ending_at_v: [-1, 987] # [PathCounter(997)=0 Examining potential extension of path ending at node V: 987 by successor: 997, via path=[-1, 987] path [-1, 987] is too short to check for triplet support. ReadsOfPathUntilV: PATH: [-1, 987] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[987, 997], []]] -checking if subPath has enough read support. Exploring sub path: [987, 997] -readsOfPathUntilV: PairPath [_paths=[[-1, 987], []]] -checking if pp: PairPath [_paths=[[-1, 987], []]] supports extension of [-1, 987, 997] => false examining subPath: [987, 997] for reinforcement by read: [[-1, 987], []] :false the read PairPath [_paths=[[-1, 987], []]](1) does not enforce the sub-path ([987, 997]) -readsOfPathUntilV: PairPath [_paths=[[987, 997], []]] -checking if pp: PairPath [_paths=[[987, 997], []]] supports extension of [-1, 987, 997] => true examining subPath: [987, 997] for reinforcement by read: [[987, 997], []] :true the read PairPath [_paths=[[987, 997], []]](2) enforces the sub-path ([987, 997]) -found: 2 reads supporting subpath. the sub-path ([987, 997]) has PASSED Successful extension of 997 to generate path [-1, 987, 997] updateReadsOfPath: [-1, 987, 997] read PairPath [_paths=[[987, 997], []]] is consistent with 997 pct_contained_propagated: 50.0% 997 was added to the queue QUEUE IS: [CCACATTTCT...CTTCCTCAAG:W2(V989_380_D0), GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1)] #### getAllProbablePaths() The next node in the queue C is 989 butterfly pct done: 3 / 8 = 37.5% pct done. ReadsStartingAtV_START_BFLY, Node: 989 read: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsStartingAtV_START_BFLY, Node: 989 read: PairPath [_paths=[[989, 990, 991, 997], []]] Exploring extension of: 1 paths that end at vertex: 989 == Current Paths Constructed Up To Vertex: 989 : PathPartialReconstruction@[989] : [-1, 989] Adding the reads {PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]]=2, PairPath [_paths=[[989, 990, 991, 997], []]]=6} to the path [-1, 989] ################################################ ###### Exploring extension of v: 989 by successor: 990 ################################################ Count of paths ending at v: 989 = 1 path_ending_at_v: [-1, 989] # [PathCounter(990)=0 Examining potential extension of path ending at node V: 989 by successor: 990, via path=[-1, 989] path [-1, 989] is too short to check for triplet support. ReadsOfPathUntilV: PATH: [-1, 989] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 989, 990] -readsOfPathUntilV: PairPath [_paths=[[-1, 989], []]] -checking if pp: PairPath [_paths=[[-1, 989], []]] supports extension of [-1, 989, 990] => false examining subPath: [-1, 989, 990] for reinforcement by read: [[-1, 989], []] :false the read PairPath [_paths=[[-1, 989], []]](1) does not enforce the sub-path ([-1, 989, 990]) -readsOfPathUntilV: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] -checking if pp: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] supports extension of [-1, 989, 990] => true examining subPath: [-1, 989, 990] for reinforcement by read: [[989, 990, 991, 997, 994, 996], []] :true the read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]](2) enforces the sub-path ([-1, 989, 990]) -found: 2 reads supporting subpath. the sub-path ([-1, 989, 990]) has PASSED Successful extension of 990 to generate path [-1, 989, 990] updateReadsOfPath: [-1, 989, 990] read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is consistent with 990 read PairPath [_paths=[[989, 990, 991, 997], []]] is consistent with 990 pct_contained_propagated: 33.333336% 990 was added to the queue QUEUE IS: [GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1), CCTCATCAGCAAGAAGAAATCTTT:W7(V990_982_D1)] * delaying tackling vertex: 997 since a parent hasn't been visited yet. #### getAllProbablePaths() The next node in the queue C is 990 butterfly pct done: 4 / 8 = 50.0% pct done. ReadsStartingAtV_START_BFLY, Node: 990 read: PairPath [_paths=[[990, 991, 997], []]] Exploring extension of: 1 paths that end at vertex: 990 == Current Paths Constructed Up To Vertex: 990 : PathPartialReconstruction@[990] : [-1, 989, 990] Adding the reads {PairPath [_paths=[[990, 991, 997], []]]=2} to the path [-1, 989, 990] ################################################ ###### Exploring extension of v: 990 by successor: 991 ################################################ Count of paths ending at v: 990 = 1 path_ending_at_v: [-1, 989, 990] # [PathCounter(991)=0 Examining potential extension of path ending at node V: 990 by successor: 991, via path=[-1, 989, 990] TripletMapper doesnt contain node: 990 ReadsOfPathUntilV: PATH: [-1, 989, 990] ReadsOfPathUntiV: READ: PairPath [_paths=[[990, 991, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 989, 990, 991] -readsOfPathUntilV: PairPath [_paths=[[990, 991, 997], []]] -checking if pp: PairPath [_paths=[[990, 991, 997], []]] supports extension of [-1, 989, 990, 991] => false examining subPath: [-1, 989, 990, 991] for reinforcement by read: [[990, 991, 997], []] :false the read PairPath [_paths=[[990, 991, 997], []]](2) does not enforce the sub-path ([-1, 989, 990, 991]) -readsOfPathUntilV: PairPath [_paths=[[-1, 989], []]] -checking if pp: PairPath [_paths=[[-1, 989], []]] supports extension of [-1, 989, 990, 991] => false examining subPath: [-1, 989, 990, 991] for reinforcement by read: [[-1, 989], []] :false the read PairPath [_paths=[[-1, 989], []]](1) does not enforce the sub-path ([-1, 989, 990, 991]) -readsOfPathUntilV: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] -checking if pp: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] supports extension of [-1, 989, 990, 991] => true examining subPath: [-1, 989, 990, 991] for reinforcement by read: [[989, 990, 991, 997, 994, 996], []] :true the read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]](2) enforces the sub-path ([-1, 989, 990, 991]) -found: 2 reads supporting subpath. the sub-path ([-1, 989, 990, 991]) has PASSED Successful extension of 991 to generate path [-1, 989, 990, 991] updateReadsOfPath: [-1, 989, 990, 991] read PairPath [_paths=[[990, 991, 997], []]] is consistent with 991 read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is consistent with 991 read PairPath [_paths=[[989, 990, 991, 997], []]] is consistent with 991 pct_contained_propagated: 25.0% 991 was added to the queue QUEUE IS: [GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1), CTTTCCAAGTA:W8(V991_440_D2)] * delaying tackling vertex: 997 since a parent hasn't been visited yet. #### getAllProbablePaths() The next node in the queue C is 991 butterfly pct done: 5 / 8 = 62.5% pct done. ReadsStartingAtV_START_BFLY991 EMPTY Exploring extension of: 1 paths that end at vertex: 991 == Current Paths Constructed Up To Vertex: 991 : PathPartialReconstruction@[991] : [-1, 989, 990, 991] ################################################ ###### Exploring extension of v: 991 by successor: 997 ################################################ Count of paths ending at v: 991 = 1 path_ending_at_v: [-1, 989, 990, 991] # [PathCounter(997)=0 Examining potential extension of path ending at node V: 991 by successor: 997, via path=[-1, 989, 990, 991] TripletMapper doesnt contain node: 991 ReadsOfPathUntilV: PATH: [-1, 989, 990, 991] ReadsOfPathUntiV: READ: PairPath [_paths=[[990, 991, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [991, 997] -readsOfPathUntilV: PairPath [_paths=[[990, 991, 997], []]] -checking if pp: PairPath [_paths=[[990, 991, 997], []]] supports extension of [-1, 989, 990, 991, 997] => true examining subPath: [991, 997] for reinforcement by read: [[990, 991, 997], []] :true the read PairPath [_paths=[[990, 991, 997], []]](2) enforces the sub-path ([991, 997]) -found: 2 reads supporting subpath. the sub-path ([991, 997]) has PASSED Successful extension of 997 to generate path [-1, 989, 990, 991, 997] updateReadsOfPath: [-1, 989, 990, 991, 997] read PairPath [_paths=[[990, 991, 997], []]] is consistent with 997 read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is consistent with 997 read PairPath [_paths=[[989, 990, 991, 997], []]] is consistent with 997 pct_contained_propagated: 25.0% QUEUE IS: [GTGTCTTAAC...GAAGCTCCCT:W6(V997_451_D1)] #### getAllProbablePaths() The next node in the queue C is 997 butterfly pct done: 6 / 8 = 75.0% pct done. ReadsStartingAtV_START_BFLY, Node: 997 read: PairPath [_paths=[[997, 994, 996], []]] ReadsStartingAtV_START_BFLY, Node: 997 read: PairPath [_paths=[[997, 994], []]] Exploring extension of: 2 paths that end at vertex: 997 == Current Paths Constructed Up To Vertex: 997 : PathPartialReconstruction@[997] : [-1, 987, 997] PathPartialReconstruction@[997] : [-1, 989, 990, 991, 997] Adding the reads {PairPath [_paths=[[997, 994, 996], []]]=6, PairPath [_paths=[[997, 994], []]]=2} to the path [-1, 987, 997] Adding the reads {PairPath [_paths=[[997, 994, 996], []]]=6, PairPath [_paths=[[997, 994], []]]=2} to the path [-1, 989, 990, 991, 997] ################################################ ###### Exploring extension of v: 997 by successor: 994 ################################################ Count of paths ending at v: 997 = 2 path_ending_at_v: [-1, 989, 990, 991, 997] path_ending_at_v: [-1, 987, 997] # [PathCounter(994)=0 Examining potential extension of path ending at node V: 997 by successor: 994, via path=[-1, 989, 990, 991, 997] TripletMapper doesnt contain node: 997 ReadsOfPathUntilV: PATH: [-1, 989, 990, 991, 997] ReadsOfPathUntiV: READ: PairPath [_paths=[[990, 991, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [997, 994] -readsOfPathUntilV: PairPath [_paths=[[990, 991, 997], []]] -checking if pp: PairPath [_paths=[[990, 991, 997], []]] supports extension of [-1, 989, 990, 991, 997, 994] => false examining subPath: [997, 994] for reinforcement by read: [[990, 991, 997], []] :false the read PairPath [_paths=[[990, 991, 997], []]](2) does not enforce the sub-path ([997, 994]) -readsOfPathUntilV: PairPath [_paths=[[-1, 989], []]] -checking if pp: PairPath [_paths=[[-1, 989], []]] supports extension of [-1, 989, 990, 991, 997, 994] => false examining subPath: [997, 994] for reinforcement by read: [[-1, 989], []] :false the read PairPath [_paths=[[-1, 989], []]](1) does not enforce the sub-path ([997, 994]) -readsOfPathUntilV: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] -checking if pp: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994] => true examining subPath: [997, 994] for reinforcement by read: [[989, 990, 991, 997, 994, 996], []] :true the read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]](2) enforces the sub-path ([997, 994]) -found: 2 reads supporting subpath. the sub-path ([997, 994]) has PASSED Successful extension of 994 to generate path [-1, 989, 990, 991, 997, 994] updateReadsOfPath: [-1, 989, 990, 991, 997, 994] read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is consistent with 994 read PairPath [_paths=[[997, 994, 996], []]] is consistent with 994 read PairPath [_paths=[[997, 994], []]] is consistent with 994 pct_contained_propagated: 50.0% # [PathCounter(994)=1 Examining potential extension of path ending at node V: 997 by successor: 994, via path=[-1, 987, 997] TripletMapper doesnt contain node: 997 ReadsOfPathUntilV: PATH: [-1, 987, 997] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[987, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] -checking if subPath has enough read support. Exploring sub path: [997, 994] -readsOfPathUntilV: PairPath [_paths=[[-1, 987], []]] -checking if pp: PairPath [_paths=[[-1, 987], []]] supports extension of [-1, 987, 997, 994] => false examining subPath: [997, 994] for reinforcement by read: [[-1, 987], []] :false the read PairPath [_paths=[[-1, 987], []]](1) does not enforce the sub-path ([997, 994]) -readsOfPathUntilV: PairPath [_paths=[[987, 997], []]] -checking if pp: PairPath [_paths=[[987, 997], []]] supports extension of [-1, 987, 997, 994] => false examining subPath: [997, 994] for reinforcement by read: [[987, 997], []] :false the read PairPath [_paths=[[987, 997], []]](2) does not enforce the sub-path ([997, 994]) -readsOfPathUntilV: PairPath [_paths=[[997, 994, 996], []]] -checking if pp: PairPath [_paths=[[997, 994, 996], []]] supports extension of [-1, 987, 997, 994] => true examining subPath: [997, 994] for reinforcement by read: [[997, 994, 996], []] :true the read PairPath [_paths=[[997, 994, 996], []]](6) enforces the sub-path ([997, 994]) -found: 6 reads supporting subpath. the sub-path ([997, 994]) has PASSED Successful extension of 994 to generate path [-1, 987, 997, 994] updateReadsOfPath: [-1, 987, 997, 994] read PairPath [_paths=[[997, 994, 996], []]] is consistent with 994 read PairPath [_paths=[[997, 994], []]] is consistent with 994 pct_contained_propagated: 50.0% 994 was added to the queue QUEUE IS: [GAGCACTCTGAACCCTGTGAGGCA:W6(V994_981_D2)] #### getAllProbablePaths() The next node in the queue C is 994 butterfly pct done: 7 / 8 = 87.5% pct done. ReadsStartingAtV_START_BFLY, Node: 994 read: PairPath [_paths=[[994, 996], []]] Exploring extension of: 2 paths that end at vertex: 994 == Current Paths Constructed Up To Vertex: 994 : PathPartialReconstruction@[994] : [-1, 989, 990, 991, 997, 994] PathPartialReconstruction@[994] : [-1, 987, 997, 994] Adding the reads {PairPath [_paths=[[994, 996], []]]=2} to the path [-1, 989, 990, 991, 997, 994] Adding the reads {PairPath [_paths=[[994, 996], []]]=2} to the path [-1, 987, 997, 994] ################################################ ###### Exploring extension of v: 994 by successor: 996 ################################################ Count of paths ending at v: 994 = 2 path_ending_at_v: [-1, 989, 990, 991, 997, 994] path_ending_at_v: [-1, 987, 997, 994] # [PathCounter(996)=0 Examining potential extension of path ending at node V: 994 by successor: 996, via path=[-1, 989, 990, 991, 997, 994] TripletMapper doesnt contain node: 994 ReadsOfPathUntilV: PATH: [-1, 989, 990, 991, 997, 994] ReadsOfPathUntiV: READ: PairPath [_paths=[[990, 991, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [996] -readsOfPathUntilV: PairPath [_paths=[[990, 991, 997], []]] -checking if pp: PairPath [_paths=[[990, 991, 997], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996] => false examining subPath: [996] for reinforcement by read: [[990, 991, 997], []] :false the read PairPath [_paths=[[990, 991, 997], []]](2) does not enforce the sub-path ([996]) -readsOfPathUntilV: PairPath [_paths=[[994, 996], []]] -checking if pp: PairPath [_paths=[[994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996] => true examining subPath: [996] for reinforcement by read: [[994, 996], []] :true the read PairPath [_paths=[[994, 996], []]](2) enforces the sub-path ([996]) -found: 2 reads supporting subpath. the sub-path ([996]) has PASSED Successful extension of 996 to generate path [-1, 989, 990, 991, 997, 994, 996] updateReadsOfPath: [-1, 989, 990, 991, 997, 994, 996] read PairPath [_paths=[[994, 996], []]] is consistent with 996 read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is consistent with 996 read PairPath [_paths=[[997, 994, 996], []]] is consistent with 996 pct_contained_propagated: 57.14286% # [PathCounter(996)=1 Examining potential extension of path ending at node V: 994 by successor: 996, via path=[-1, 987, 997, 994] TripletMapper doesnt contain node: 994 ReadsOfPathUntilV: PATH: [-1, 987, 997, 994] ReadsOfPathUntiV: READ: PairPath [_paths=[[994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[987, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] -checking if subPath has enough read support. Exploring sub path: [996] -readsOfPathUntilV: PairPath [_paths=[[994, 996], []]] -checking if pp: PairPath [_paths=[[994, 996], []]] supports extension of [-1, 987, 997, 994, 996] => true examining subPath: [996] for reinforcement by read: [[994, 996], []] :true the read PairPath [_paths=[[994, 996], []]](2) enforces the sub-path ([996]) -found: 2 reads supporting subpath. the sub-path ([996]) has PASSED Successful extension of 996 to generate path [-1, 987, 997, 994, 996] updateReadsOfPath: [-1, 987, 997, 994, 996] read PairPath [_paths=[[994, 996], []]] is consistent with 996 read PairPath [_paths=[[997, 994, 996], []]] is consistent with 996 pct_contained_propagated: 60.000004% 996 was added to the queue QUEUE IS: [AGTCCACCAC...GGGAGCCACC:W6(V996_549_D3)] #### getAllProbablePaths() The next node in the queue C is 996 butterfly pct done: 8 / 8 = 100.0% pct done. ReadsStartingAtV_START_BFLY, Node: 996 read: PairPath [_paths=[[996, 986], []]] ReadsStartingAtV_START_BFLY, Node: 996 read: PairPath [_paths=[[996], []]] Exploring extension of: 2 paths that end at vertex: 996 == Current Paths Constructed Up To Vertex: 996 : PathPartialReconstruction@[996] : [-1, 989, 990, 991, 997, 994, 996] PathPartialReconstruction@[996] : [-1, 987, 997, 994, 996] Adding the reads {PairPath [_paths=[[996, 986], []]]=4, PairPath [_paths=[[996], []]]=14} to the path [-1, 989, 990, 991, 997, 994, 996] Adding the reads {PairPath [_paths=[[996, 986], []]]=4, PairPath [_paths=[[996], []]]=14} to the path [-1, 987, 997, 994, 996] ################################################ ###### Exploring extension of v: 996 by successor: 986 ################################################ Count of paths ending at v: 996 = 2 path_ending_at_v: [-1, 989, 990, 991, 997, 994, 996] path_ending_at_v: [-1, 987, 997, 994, 996] # [PathCounter(986)=0 Examining potential extension of path ending at node V: 996 by successor: 986, via path=[-1, 989, 990, 991, 997, 994, 996] TripletMapper doesnt contain node: 996 ReadsOfPathUntilV: PATH: [-1, 989, 990, 991, 997, 994, 996] ReadsOfPathUntiV: READ: PairPath [_paths=[[990, 991, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996, 986], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [996, 986] -readsOfPathUntilV: PairPath [_paths=[[990, 991, 997], []]] -checking if pp: PairPath [_paths=[[990, 991, 997], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986] => false examining subPath: [996, 986] for reinforcement by read: [[990, 991, 997], []] :false the read PairPath [_paths=[[990, 991, 997], []]](2) does not enforce the sub-path ([996, 986]) -readsOfPathUntilV: PairPath [_paths=[[994, 996], []]] -checking if pp: PairPath [_paths=[[994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986] => false examining subPath: [996, 986] for reinforcement by read: [[994, 996], []] :false the read PairPath [_paths=[[994, 996], []]](2) does not enforce the sub-path ([996, 986]) -readsOfPathUntilV: PairPath [_paths=[[-1, 989], []]] -checking if pp: PairPath [_paths=[[-1, 989], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986] => false examining subPath: [996, 986] for reinforcement by read: [[-1, 989], []] :false the read PairPath [_paths=[[-1, 989], []]](1) does not enforce the sub-path ([996, 986]) -readsOfPathUntilV: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] -checking if pp: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986] => false examining subPath: [996, 986] for reinforcement by read: [[989, 990, 991, 997, 994, 996], []] :false the read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]](2) does not enforce the sub-path ([996, 986]) -readsOfPathUntilV: PairPath [_paths=[[996, 986], []]] -checking if pp: PairPath [_paths=[[996, 986], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986] => true examining subPath: [996, 986] for reinforcement by read: [[996, 986], []] :true the read PairPath [_paths=[[996, 986], []]](4) enforces the sub-path ([996, 986]) -found: 4 reads supporting subpath. the sub-path ([996, 986]) has PASSED Successful extension of 986 to generate path [-1, 989, 990, 991, 997, 994, 996, 986] updateReadsOfPath: [-1, 989, 990, 991, 997, 994, 996, 986] read PairPath [_paths=[[996, 986], []]] is consistent with 986 read PairPath [_paths=[[996], []]] is consistent with 986 pct_contained_propagated: 77.77778% # [PathCounter(986)=1 Examining potential extension of path ending at node V: 996 by successor: 986, via path=[-1, 987, 997, 994, 996] TripletMapper doesnt contain node: 996 ReadsOfPathUntilV: PATH: [-1, 987, 997, 994, 996] ReadsOfPathUntiV: READ: PairPath [_paths=[[994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996, 986], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[987, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996], []]] -checking if subPath has enough read support. Exploring sub path: [996, 986] -readsOfPathUntilV: PairPath [_paths=[[994, 996], []]] -checking if pp: PairPath [_paths=[[994, 996], []]] supports extension of [-1, 987, 997, 994, 996, 986] => false examining subPath: [996, 986] for reinforcement by read: [[994, 996], []] :false the read PairPath [_paths=[[994, 996], []]](2) does not enforce the sub-path ([996, 986]) -readsOfPathUntilV: PairPath [_paths=[[-1, 987], []]] -checking if pp: PairPath [_paths=[[-1, 987], []]] supports extension of [-1, 987, 997, 994, 996, 986] => false examining subPath: [996, 986] for reinforcement by read: [[-1, 987], []] :false the read PairPath [_paths=[[-1, 987], []]](1) does not enforce the sub-path ([996, 986]) -readsOfPathUntilV: PairPath [_paths=[[996, 986], []]] -checking if pp: PairPath [_paths=[[996, 986], []]] supports extension of [-1, 987, 997, 994, 996, 986] => true examining subPath: [996, 986] for reinforcement by read: [[996, 986], []] :true the read PairPath [_paths=[[996, 986], []]](4) enforces the sub-path ([996, 986]) -found: 4 reads supporting subpath. the sub-path ([996, 986]) has PASSED Successful extension of 986 to generate path [-1, 987, 997, 994, 996, 986] updateReadsOfPath: [-1, 987, 997, 994, 996, 986] read PairPath [_paths=[[996, 986], []]] is consistent with 986 read PairPath [_paths=[[996], []]] is consistent with 986 pct_contained_propagated: 71.42857% 986 was added to the queue QUEUE IS: [AGCCACAGGT...CTTCCTGTGA:W5(V986_717_D4)] #### getAllProbablePaths() The next node in the queue C is 986 butterfly pct done: 9 / 8 = 112.5% pct done. ReadsStartingAtV_START_BFLY, Node: 986 read: PairPath [_paths=[[986, -2], []]] Exploring extension of: 2 paths that end at vertex: 986 == Current Paths Constructed Up To Vertex: 986 : PathPartialReconstruction@[986] : [-1, 989, 990, 991, 997, 994, 996, 986] PathPartialReconstruction@[986] : [-1, 987, 997, 994, 996, 986] Adding the reads {PairPath [_paths=[[986, -2], []]]=1} to the path [-1, 989, 990, 991, 997, 994, 996, 986] Adding the reads {PairPath [_paths=[[986, -2], []]]=1} to the path [-1, 987, 997, 994, 996, 986] ################################################ ###### Exploring extension of v: 986 by successor: -2 ################################################ Count of paths ending at v: 986 = 2 path_ending_at_v: [-1, 989, 990, 991, 997, 994, 996, 986] path_ending_at_v: [-1, 987, 997, 994, 996, 986] # [PathCounter(-2)=0 Examining potential extension of path ending at node V: 986 by successor: -2, via path=[-1, 989, 990, 991, 997, 994, 996, 986] TripletMapper doesnt contain node: 986 ReadsOfPathUntilV: PATH: [-1, 989, 990, 991, 997, 994, 996, 986] ReadsOfPathUntiV: READ: PairPath [_paths=[[990, 991, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 989], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[986, -2], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996, 986], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if subPath has enough read support. Exploring sub path: [996, 986, -2] -readsOfPathUntilV: PairPath [_paths=[[990, 991, 997], []]] -checking if pp: PairPath [_paths=[[990, 991, 997], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[990, 991, 997], []] :false the read PairPath [_paths=[[990, 991, 997], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[994, 996], []]] -checking if pp: PairPath [_paths=[[994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[994, 996], []] :false the read PairPath [_paths=[[994, 996], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[-1, 989], []]] -checking if pp: PairPath [_paths=[[-1, 989], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[-1, 989], []] :false the read PairPath [_paths=[[-1, 989], []]](1) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[986, -2], []]] -checking if pp: PairPath [_paths=[[986, -2], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[986, -2], []] :false the read PairPath [_paths=[[986, -2], []]](1) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] -checking if pp: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[989, 990, 991, 997, 994, 996], []] :false the read PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[996, 986], []]] -checking if pp: PairPath [_paths=[[996, 986], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[996, 986], []] :false the read PairPath [_paths=[[996, 986], []]](4) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[997, 994, 996], []]] -checking if pp: PairPath [_paths=[[997, 994, 996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[997, 994, 996], []] :false the read PairPath [_paths=[[997, 994, 996], []]](6) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[997, 994], []]] -checking if pp: PairPath [_paths=[[997, 994], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[997, 994], []] :false the read PairPath [_paths=[[997, 994], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[996], []]] -checking if pp: PairPath [_paths=[[996], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[996], []] :false the read PairPath [_paths=[[996], []]](14) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[989, 990, 991, 997], []]] -checking if pp: PairPath [_paths=[[989, 990, 991, 997], []]] supports extension of [-1, 989, 990, 991, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[989, 990, 991, 997], []] :false the read PairPath [_paths=[[989, 990, 991, 997], []]](6) does not enforce the sub-path ([996, 986, -2]) -found: 0 reads supporting subpath. the sub-path ([996, 986, -2]) has NOT PASSED Successful extension of -2 to generate path [-1, 989, 990, 991, 997, 994, 996, 986, -2] updateReadsOfPath: [-1, 989, 990, 991, 997, 994, 996, 986, -2] read PairPath [_paths=[[986, -2], []]] is consistent with -2 pct_contained_propagated: 90.0% # [PathCounter(-2)=1 Examining potential extension of path ending at node V: 986 by successor: -2, via path=[-1, 987, 997, 994, 996, 986] TripletMapper doesnt contain node: 986 ReadsOfPathUntilV: PATH: [-1, 987, 997, 994, 996, 986] ReadsOfPathUntiV: READ: PairPath [_paths=[[994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[986, -2], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 987], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996, 986], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[987, 997], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994, 996], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[997, 994], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[996], []]] -checking if subPath has enough read support. Exploring sub path: [996, 986, -2] -readsOfPathUntilV: PairPath [_paths=[[994, 996], []]] -checking if pp: PairPath [_paths=[[994, 996], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[994, 996], []] :false the read PairPath [_paths=[[994, 996], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[986, -2], []]] -checking if pp: PairPath [_paths=[[986, -2], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[986, -2], []] :false the read PairPath [_paths=[[986, -2], []]](1) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[-1, 987], []]] -checking if pp: PairPath [_paths=[[-1, 987], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[-1, 987], []] :false the read PairPath [_paths=[[-1, 987], []]](1) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[996, 986], []]] -checking if pp: PairPath [_paths=[[996, 986], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[996, 986], []] :false the read PairPath [_paths=[[996, 986], []]](4) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[987, 997], []]] -checking if pp: PairPath [_paths=[[987, 997], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[987, 997], []] :false the read PairPath [_paths=[[987, 997], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[997, 994, 996], []]] -checking if pp: PairPath [_paths=[[997, 994, 996], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[997, 994, 996], []] :false the read PairPath [_paths=[[997, 994, 996], []]](6) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[997, 994], []]] -checking if pp: PairPath [_paths=[[997, 994], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[997, 994], []] :false the read PairPath [_paths=[[997, 994], []]](2) does not enforce the sub-path ([996, 986, -2]) -readsOfPathUntilV: PairPath [_paths=[[996], []]] -checking if pp: PairPath [_paths=[[996], []]] supports extension of [-1, 987, 997, 994, 996, 986, -2] => false examining subPath: [996, 986, -2] for reinforcement by read: [[996], []] :false the read PairPath [_paths=[[996], []]](14) does not enforce the sub-path ([996, 986, -2]) -found: 0 reads supporting subpath. the sub-path ([996, 986, -2]) has NOT PASSED Successful extension of -2 to generate path [-1, 987, 997, 994, 996, 986, -2] updateReadsOfPath: [-1, 987, 997, 994, 996, 986, -2] read PairPath [_paths=[[986, -2], []]] is consistent with -2 pct_contained_propagated: 87.5% -2 was added to the queue QUEUE IS: [:W-1(V-2_D-1)] #### getAllProbablePaths() The next node in the queue C is -2 butterfly pct done: 10 / 8 = 125.0% pct done. ReadsStartingAtV_START_BFLY-2 EMPTY Exploring extension of: 2 paths that end at vertex: -2 == Current Paths Constructed Up To Vertex: -2 : PathPartialReconstruction@[-2] : [-1, 989, 990, 991, 997, 994, 996, 986, -2] PathPartialReconstruction@[-2] : [-1, 987, 997, 994, 996, 986, -2] the finished path: [-1, 989, 990, 991, 997, 994, 996, 986, -2] was added to the final paths, with 40 support the finished path: [-1, 987, 997, 994, 996, 986, -2] was added to the final paths, with 32 support -reconstructing sequence for path[: 1 of 2]: [-1, 987, 997, 994, 996, 986, -2] -reconstructing sequence for path[: 2 of 2]: [-1, 989, 990, 991, 997, 994, 996, 986, -2] **** Removing identical subsequences among: 2 paths. [0,1] FinalPath@BeforeFiltering: [-1, 987, 997, 994, 996, 986, -2] FinalPath@BeforeFiltering: [-1, 989, 990, 991, 997, 994, 996, 986, -2] ReadMappings BEFORE Path-to-orig_ID conversion: ## assignCompatibleReadsToPaths() assignCompatibleReadsToPaths: PairPath [_paths=[[-1, 989], []]] is NOT compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[-1, 987], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[994, 996], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[996, 986], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[996], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[997, 994, 996], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[997, 994], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[986, -2], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[987, 997], []]] is compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is NOT compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[989, 990, 991, 997], []]] is NOT compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[990, 991, 997], []]] is NOT compatible with [-1, 987, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[-1, 989], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[-1, 987], []]] is NOT compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[994, 996], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[996, 986], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[996], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[997, 994, 996], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[997, 994], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[986, -2], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[987, 997], []]] is NOT compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[989, 990, 991, 997], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] assignCompatibleReadsToPaths: PairPath [_paths=[[990, 991, 997], []]] is compatible with [-1, 989, 990, 991, 997, 994, 996, 986, -2] PRELIM_FINAL_PATH: [-1, 987, 997, 994, 996, 986, -2] contains: PairPath [_paths=[[994, 996], []]] count: 2 PairPath [_paths=[[986, -2], []]] count: 1 PairPath [_paths=[[-1, 987], []]] count: 1 PairPath [_paths=[[996, 986], []]] count: 4 PairPath [_paths=[[997, 994, 996], []]] count: 6 PairPath [_paths=[[987, 997], []]] count: 2 PairPath [_paths=[[997, 994], []]] count: 2 PairPath [_paths=[[996], []]] count: 14 Total support: 32 PRELIM_FINAL_PATH: [-1, 989, 990, 991, 997, 994, 996, 986, -2] contains: PairPath [_paths=[[994, 996], []]] count: 2 PairPath [_paths=[[990, 991, 997], []]] count: 2 PairPath [_paths=[[-1, 989], []]] count: 1 PairPath [_paths=[[986, -2], []]] count: 1 PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]] count: 2 PairPath [_paths=[[996, 986], []]] count: 4 PairPath [_paths=[[997, 994, 996], []]] count: 6 PairPath [_paths=[[997, 994], []]] count: 2 PairPath [_paths=[[996], []]] count: 14 PairPath [_paths=[[989, 990, 991, 997], []]] count: 6 Total support: 40 ## ILLUSTRATING FINAL ASSEMBLIES PATH: [-1, 987, 997, 994, 996, 986, -2] Path Illustration: ======= PATH: [-1, 987, 997, 994, 996, 986, -2] == Read: [[-1, 987], []] read_support: 1 == Read: [[987, 997], []] read_support: 2 === Read: [[997, 994, 996], []] read_support: 6 == Read: [[997, 994], []] read_support: 2 == Read: [[994, 996], []] read_support: 2 == Read: [[996, 986], []] read_support: 4 = Read: [[996], []] read_support: 14 == Read: [[986, -2], []] read_support: 1 PATH: [-1, 989, 990, 991, 997, 994, 996, 986, -2] Path Illustration: ========= PATH: [-1, 989, 990, 991, 997, 994, 996, 986, -2] == Read: [[-1, 989], []] read_support: 1 ====== Read: [[989, 990, 991, 997, 994, 996], []] read_support: 2 ==== Read: [[989, 990, 991, 997], []] read_support: 6 === Read: [[990, 991, 997], []] read_support: 2 === Read: [[997, 994, 996], []] read_support: 6 == Read: [[997, 994], []] read_support: 2 == Read: [[994, 996], []] read_support: 2 == Read: [[996, 986], []] read_support: 4 = Read: [[996], []] read_support: 14 == Read: [[986, -2], []] read_support: 1 Converting graph node IDs back to original IDs. -final_path: [-1, 987, 997, 994, 996, 986, -2] now set to: [-1, 945, 451, 981, 549, 717, -2] -and set to contents: <32, 0> pp: PairPath [_paths=[[994, 996], []]], updated_pp: PairPath [_paths=[[981, 549], []]], count: 2 pp: PairPath [_paths=[[986, -2], []]], updated_pp: PairPath [_paths=[[717, -2], []]], count: 1 pp: PairPath [_paths=[[-1, 987], []]], updated_pp: PairPath [_paths=[[-1, 945], []]], count: 1 pp: PairPath [_paths=[[996, 986], []]], updated_pp: PairPath [_paths=[[549, 717], []]], count: 4 pp: PairPath [_paths=[[997, 994, 996], []]], updated_pp: PairPath [_paths=[[451, 981, 549], []]], count: 6 pp: PairPath [_paths=[[987, 997], []]], updated_pp: PairPath [_paths=[[945, 451], []]], count: 2 pp: PairPath [_paths=[[997, 994], []]], updated_pp: PairPath [_paths=[[451, 981], []]], count: 2 pp: PairPath [_paths=[[996], []]], updated_pp: PairPath [_paths=[[549], []]], count: 14 -final_path: [-1, 989, 990, 991, 997, 994, 996, 986, -2] now set to: [-1, 380, 982, 440, 451, 981, 549, 717, -2] -and set to contents: <40, 0> pp: PairPath [_paths=[[994, 996], []]], updated_pp: PairPath [_paths=[[981, 549], []]], count: 2 pp: PairPath [_paths=[[990, 991, 997], []]], updated_pp: PairPath [_paths=[[982, 440, 451], []]], count: 2 pp: PairPath [_paths=[[-1, 989], []]], updated_pp: PairPath [_paths=[[-1, 380], []]], count: 1 pp: PairPath [_paths=[[986, -2], []]], updated_pp: PairPath [_paths=[[717, -2], []]], count: 1 pp: PairPath [_paths=[[989, 990, 991, 997, 994, 996], []]], updated_pp: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]], count: 2 pp: PairPath [_paths=[[996, 986], []]], updated_pp: PairPath [_paths=[[549, 717], []]], count: 4 pp: PairPath [_paths=[[997, 994, 996], []]], updated_pp: PairPath [_paths=[[451, 981, 549], []]], count: 6 pp: PairPath [_paths=[[997, 994], []]], updated_pp: PairPath [_paths=[[451, 981], []]], count: 2 pp: PairPath [_paths=[[996], []]], updated_pp: PairPath [_paths=[[549], []]], count: 14 pp: PairPath [_paths=[[989, 990, 991, 997], []]], updated_pp: PairPath [_paths=[[380, 982, 440, 451], []]], count: 6 ** Post-original ID conversion, path support: PRELIM_FINAL_PATH: [-1, 945, 451, 981, 549, 717, -2] contains: PairPath [_paths=[[549, 717], []]] count: 4 PairPath [_paths=[[945, 451], []]] count: 2 PairPath [_paths=[[717, -2], []]] count: 1 PairPath [_paths=[[451, 981, 549], []]] count: 6 PairPath [_paths=[[451, 981], []]] count: 2 PairPath [_paths=[[549], []]] count: 14 PairPath [_paths=[[-1, 945], []]] count: 1 PairPath [_paths=[[981, 549], []]] count: 2 Total support: 32 PRELIM_FINAL_PATH: [-1, 380, 982, 440, 451, 981, 549, 717, -2] contains: PairPath [_paths=[[549, 717], []]] count: 4 PairPath [_paths=[[982, 440, 451], []]] count: 2 PairPath [_paths=[[-1, 380], []]] count: 1 PairPath [_paths=[[717, -2], []]] count: 1 PairPath [_paths=[[451, 981, 549], []]] count: 6 PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] count: 2 PairPath [_paths=[[451, 981], []]] count: 2 PairPath [_paths=[[549], []]] count: 14 PairPath [_paths=[[981, 549], []]] count: 2 PairPath [_paths=[[380, 982, 440, 451], []]] count: 6 Total support: 40 SECTION ========= CD-HIT -like Removal of Too-Similar Sequences with Lesser Read Support ========= **** CD-HIT style path collapsing at end of run. [0,1] **** checking twoPathsAreTooSimilar ([-1, 380, 982, 440, 451, 981, 549, 717, -2],[-1, 945, 451, 981, 549, 717, -2]) **** getPrevCalcNumMismatches: Path1: [-1, 380, 982, 440, 451, 981, 549, 717, -2] Path2: [-1, 945, 451, 981, 549, 717, -2] Paths [-1, 380, 982, 440, 451, 981, 549, 717, -2][-1, 945, 451, 981, 549, 717, -2] share node 717 getting prefix alignment for [-1, 380, 982, 440, 451, 981, 549][-1, 945, 451, 981, 549] getPrevCalcNumMismatches: Path1: [-1, 380, 982, 440, 451, 981, 549] Path2: [-1, 945, 451, 981, 549] Paths [-1, 380, 982, 440, 451, 981, 549][-1, 945, 451, 981, 549] share node 549 getting prefix alignment for [-1, 380, 982, 440, 451, 981][-1, 945, 451, 981] getPrevCalcNumMismatches: Path1: [-1, 380, 982, 440, 451, 981] Path2: [-1, 945, 451, 981] Paths [-1, 380, 982, 440, 451, 981][-1, 945, 451, 981] share node 981 getting prefix alignment for [-1, 380, 982, 440, 451][-1, 945, 451] getPrevCalcNumMismatches: Path1: [-1, 380, 982, 440, 451] Path2: [-1, 945, 451] Paths [-1, 380, 982, 440, 451][-1, 945, 451] share node 451 getting prefix alignment for [-1, 380, 982, 440][-1, 945] getPrevCalcNumMismatches: Path1: [-1, 380, 982, 440] Path2: [-1, 945] -no shared node, alignment not cached, computing: [-1, 380, 982, 440] to [-1, 945] -path1s length: 94, path2s length: 59 -running Needleman-Wunsch alignment of path sequences Jun 05, 2024 11:53:13 AM jaligner.NeedlemanWunschGotoh construct INFO: Started... Jun 05, 2024 11:53:13 AM jaligner.NeedlemanWunschGotoh construct INFO: Finished. Jun 05, 2024 11:53:13 AM jaligner.NeedlemanWunschGotoh traceback INFO: Started... Jun 05, 2024 11:53:13 AM jaligner.NeedlemanWunschGotoh traceback INFO: Finished. A 1 GGCCACACGATGGCTTATCACGTCCACATTTCTACTGGCTACAAACAGAC 50 .|..||||||..|.| B 1 -----------------------------------AGAATACAAAATGCC 15 A 51 TTCCTCAAGCCTCATCAGCAAGAAGAAATCTTTCTTTCCAAGTA 94 ||||||.|||||||||||||.||||||||||||||||||||||| B 16 TTCCTCCAGCCTCATCAGCAGGAAGAAATCTTTCTTTCCAAGTA 59 Percent A in alignment = 59 / 94 = 62.765957% Percent B in alignment = 59 / 59 = 100.0% Matches: 51, Mismatches: 8, gaps: 0, align_len: 59 percent_identity: 86.440674, percent_gapped: 0.0 max_percent_aligned: 100.0 max internal gap length: 0 (start of graph) Total number of significant alignment diffs = (mismatches: 8 + internal_gaps: 0 + right_gap_len: 0 = 8 AlignmentStats: matches: 51, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 path prefix alignment stats for: [-1, 380, 982, 440] and [-1, 945] : matches: 51, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 getPrevCalcNumMismatches: Path1: [451] Path2: [451] paths are equivalent: Path1:[451], Path2:[451] and have alignment stats:matches: 97, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 getting suffix alignment for: [][] getPrevCalcNumMismatches: Path1: [] Path2: [] suffix alignment stats: matches: 0, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 combining suffix and prefix alignment stats: matches: 148, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 path prefix alignment stats for: [-1, 380, 982, 440, 451] and [-1, 945, 451] : matches: 148, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 getPrevCalcNumMismatches: Path1: [981] Path2: [981] paths are equivalent: Path1:[981], Path2:[981] and have alignment stats:matches: 47, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 getting suffix alignment for: [][] getPrevCalcNumMismatches: Path1: [] Path2: [] key: [];[], cached as: matches: 0, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 suffix alignment stats: matches: 0, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 combining suffix and prefix alignment stats: matches: 195, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 path prefix alignment stats for: [-1, 380, 982, 440, 451, 981] and [-1, 945, 451, 981] : matches: 195, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 getPrevCalcNumMismatches: Path1: [549] Path2: [549] paths are equivalent: Path1:[549], Path2:[549] and have alignment stats:matches: 191, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 getting suffix alignment for: [][] getPrevCalcNumMismatches: Path1: [] Path2: [] key: [];[], cached as: matches: 0, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 suffix alignment stats: matches: 0, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 combining suffix and prefix alignment stats: matches: 386, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 path prefix alignment stats for: [-1, 380, 982, 440, 451, 981, 549] and [-1, 945, 451, 981, 549] : matches: 386, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 getPrevCalcNumMismatches: Path1: [717] Path2: [717] paths are equivalent: Path1:[717], Path2:[717] and have alignment stats:matches: 65, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 getting suffix alignment for: [-2][-2] getPrevCalcNumMismatches: Path1: [-2] Path2: [-2] suffix alignment stats: matches: 0, mismatches: 0, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 0 combining suffix and prefix alignment stats: matches: 451, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 the two paths have these stats: numMM=8, max_internal_gap_length=0, identity=97.82%, tooSimilar: false ==== Running PATH alignment of : [-1, 380, 982, 440, 451, 981, 549, 717, -2] to [-1, 945, 451, 981, 549, 717, -2] :: numMM:8, max_internal_gap: 0, path_per_id = 97.82, tooSimilar: false matches: 451, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 *** REDUCE: they are PLENTY DIFFERENT *** SECTION ============= Begin Assembly =============== Assembling subcomponent 1 Subcomponent: 1, adding pairpath: PairPath [_paths=[[983, 984], []]] #### Component Read Summary BEFORE PairPath-per-node Reduction ***** PairPath Counts ***** componentReadHash, start node: 983 has size: 1 Node: 983 has 1 pairpaths stored: PairPath [_paths=[[983, 984], []]] has read support: 2 ## Total number of pairpaths: 1 #### Component Read Summary AFTER PairPath-per-node Reduction ***** PairPath Counts ***** componentReadHash, start node: 983 has size: 1 Node: 983 has 1 pairpaths stored: PairPath [_paths=[[983, 984], []]] has read support: 2 ## Total number of pairpaths: 1 ### Extracting triplets from reads. ### 0 nodes have locked-in triplet paths: ### Extracting complex path prefixes from reads. -capturing path prefixes -removing prefixes that are subpaths of other prefixes #### Extended triplets from reads: Adding edge from S to AAACCCAGCCCCGTGGAGGGAGCCACC:W1(V983_786_D0) Adding edge from AGCCACAGGT...CTTCCTGTGA:W5(V984_717_D1) to T SECTION ############### ## Starting Butterfly Assembly ## ################### PairPaths to assemble: Start Vertex:-1 PairPaths@BflyStart: PairPath [_paths=[[-1, 983], []]]=1 Start Vertex:983 PairPaths@BflyStart: PairPath [_paths=[[983, 984], []]]=2 Start Vertex:984 PairPaths@BflyStart: PairPath [_paths=[[984, -2], []]]=1 QUEUE IS: [:W2147483647(V-1_D-1)] #### getAllProbablePaths() The next node in the queue C is -1 butterfly pct done: 1 / 2 = 50.0% pct done. ReadsStartingAtV_START_BFLY, Node: -1 read: PairPath [_paths=[[-1, 983], []]] Exploring extension of: 1 paths that end at vertex: -1 == Current Paths Constructed Up To Vertex: -1 : PathPartialReconstruction@[-1] : [-1] Adding the reads {PairPath [_paths=[[-1, 983], []]]=1} to the path [-1] ################################################ ###### Exploring extension of v: -1 by successor: 983 ################################################ Count of paths ending at v: -1 = 1 path_ending_at_v: [-1] # [PathCounter(983)=0 Examining potential extension of path ending at node V: -1 by successor: 983, via path=[-1] path [-1] is too short to check for triplet support. ReadsOfPathUntilV: PATH: [-1] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 983], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 983] -readsOfPathUntilV: PairPath [_paths=[[-1, 983], []]] -checking if pp: PairPath [_paths=[[-1, 983], []]] supports extension of [-1, 983] => true examining subPath: [-1, 983] for reinforcement by read: [[-1, 983], []] :true the read PairPath [_paths=[[-1, 983], []]](1) enforces the sub-path ([-1, 983]) -found: 1 reads supporting subpath. the sub-path ([-1, 983]) has PASSED Successful extension of 983 to generate path [-1, 983] updateReadsOfPath: [-1, 983] read PairPath [_paths=[[-1, 983], []]] is consistent with 983 pct_contained_propagated: 0.0% 983 was added to the queue ################################################ ###### Exploring extension of v: -1 by successor: 987 ################################################ component either lacks: 987 or at sink ################################################ ###### Exploring extension of v: -1 by successor: 989 ################################################ component either lacks: 989 or at sink QUEUE IS: [AAACCCAGCCCCGTGGAGGGAGCCACC:W1(V983_786_D0)] #### getAllProbablePaths() The next node in the queue C is 983 butterfly pct done: 2 / 2 = 100.0% pct done. ReadsStartingAtV_START_BFLY, Node: 983 read: PairPath [_paths=[[983, 984], []]] Exploring extension of: 1 paths that end at vertex: 983 == Current Paths Constructed Up To Vertex: 983 : PathPartialReconstruction@[983] : [-1, 983] Adding the reads {PairPath [_paths=[[983, 984], []]]=2} to the path [-1, 983] ################################################ ###### Exploring extension of v: 983 by successor: 984 ################################################ Count of paths ending at v: 983 = 1 path_ending_at_v: [-1, 983] # [PathCounter(984)=0 Examining potential extension of path ending at node V: 983 by successor: 984, via path=[-1, 983] path [-1, 983] is too short to check for triplet support. ReadsOfPathUntilV: PATH: [-1, 983] ReadsOfPathUntiV: READ: PairPath [_paths=[[983, 984], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 983], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 983, 984] -readsOfPathUntilV: PairPath [_paths=[[983, 984], []]] -checking if pp: PairPath [_paths=[[983, 984], []]] supports extension of [-1, 983, 984] => true examining subPath: [-1, 983, 984] for reinforcement by read: [[983, 984], []] :true the read PairPath [_paths=[[983, 984], []]](2) enforces the sub-path ([-1, 983, 984]) -found: 2 reads supporting subpath. the sub-path ([-1, 983, 984]) has PASSED Successful extension of 984 to generate path [-1, 983, 984] updateReadsOfPath: [-1, 983, 984] read PairPath [_paths=[[983, 984], []]] is consistent with 984 pct_contained_propagated: 50.0% 984 was added to the queue QUEUE IS: [AGCCACAGGT...CTTCCTGTGA:W5(V984_717_D1)] #### getAllProbablePaths() The next node in the queue C is 984 butterfly pct done: 3 / 2 = 150.0% pct done. ReadsStartingAtV_START_BFLY, Node: 984 read: PairPath [_paths=[[984, -2], []]] Exploring extension of: 1 paths that end at vertex: 984 == Current Paths Constructed Up To Vertex: 984 : PathPartialReconstruction@[984] : [-1, 983, 984] Adding the reads {PairPath [_paths=[[984, -2], []]]=1} to the path [-1, 983, 984] ################################################ ###### Exploring extension of v: 984 by successor: -2 ################################################ Count of paths ending at v: 984 = 1 path_ending_at_v: [-1, 983, 984] # [PathCounter(-2)=0 Examining potential extension of path ending at node V: 984 by successor: -2, via path=[-1, 983, 984] TripletMapper doesnt contain node: 984 ReadsOfPathUntilV: PATH: [-1, 983, 984] ReadsOfPathUntiV: READ: PairPath [_paths=[[983, 984], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[984, -2], []]] ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 983], []]] -checking if subPath has enough read support. Exploring sub path: [-1, 983, 984, -2] -readsOfPathUntilV: PairPath [_paths=[[983, 984], []]] -checking if pp: PairPath [_paths=[[983, 984], []]] supports extension of [-1, 983, 984, -2] => false examining subPath: [-1, 983, 984, -2] for reinforcement by read: [[983, 984], []] :false the read PairPath [_paths=[[983, 984], []]](2) does not enforce the sub-path ([-1, 983, 984, -2]) -readsOfPathUntilV: PairPath [_paths=[[984, -2], []]] -checking if pp: PairPath [_paths=[[984, -2], []]] supports extension of [-1, 983, 984, -2] => false examining subPath: [-1, 983, 984, -2] for reinforcement by read: [[984, -2], []] :false the read PairPath [_paths=[[984, -2], []]](1) does not enforce the sub-path ([-1, 983, 984, -2]) -readsOfPathUntilV: PairPath [_paths=[[-1, 983], []]] -checking if pp: PairPath [_paths=[[-1, 983], []]] supports extension of [-1, 983, 984, -2] => false examining subPath: [-1, 983, 984, -2] for reinforcement by read: [[-1, 983], []] :false the read PairPath [_paths=[[-1, 983], []]](1) does not enforce the sub-path ([-1, 983, 984, -2]) -found: 0 reads supporting subpath. the sub-path ([-1, 983, 984, -2]) has NOT PASSED Successful extension of -2 to generate path [-1, 983, 984, -2] updateReadsOfPath: [-1, 983, 984, -2] read PairPath [_paths=[[984, -2], []]] is consistent with -2 pct_contained_propagated: 66.66667% -2 was added to the queue QUEUE IS: [:W-1(V-2_D-1)] #### getAllProbablePaths() The next node in the queue C is -2 butterfly pct done: 4 / 2 = 200.0% pct done. ReadsStartingAtV_START_BFLY-2 EMPTY Exploring extension of: 1 paths that end at vertex: -2 == Current Paths Constructed Up To Vertex: -2 : PathPartialReconstruction@[-2] : [-1, 983, 984, -2] sequence for path: [-1, 983, 984, -2] is too short: 92 No paths to pursue. Continue... SECTION ========= CD-HIT -like Removal of Too-Similar Sequences with Lesser Read Support ========= **** CD-HIT style path collapsing at end of run. [0,1] **** checking twoPathsAreTooSimilar ([-1, 380, 982, 440, 451, 981, 549, 717, -2],[-1, 945, 451, 981, 549, 717, -2]) **** getPrevCalcNumMismatches: Path1: [-1, 380, 982, 440, 451, 981, 549, 717, -2] Path2: [-1, 945, 451, 981, 549, 717, -2] key: [-1, 945, 451, 981, 549, 717, -2];[-1, 380, 982, 440, 451, 981, 549, 717, -2], cached as: matches: 451, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 the two paths have these stats: numMM=8, max_internal_gap_length=0, identity=97.82%, tooSimilar: false ==== Running PATH alignment of : [-1, 380, 982, 440, 451, 981, 549, 717, -2] to [-1, 945, 451, 981, 549, 717, -2] :: numMM:8, max_internal_gap: 0, path_per_id = 97.82, tooSimilar: false matches: 451, mismatches: 8, internal gaps: 0, left_gap: 0, right_gap: 0, total_diffs: 8 *** REDUCE: they are PLENTY DIFFERENT *** Grouping paths into genes Isoform_overlap: Path_i:[-1, 380, 982, 440, 451, 981, 549, 717, -2], Path_j: [-1, 945, 451, 981, 549, 717, -2], overlap = 87.14597% IsoformEdge linking: [-1, 380, 982, 440, 451, 981, 549, 717, -2] to [-1, 945, 451, 981, 549, 717, -2] IsoformClustering, number of clusters = 1 GeneCluster[1] contains: [-1, 945, 451, 981, 549, 717, -2] GeneCluster[1] contains: [-1, 380, 982, 440, 451, 981, 549, 717, -2] Sep Gene IDs:{[-1, 945, 451, 981, 549, 717, -2]=1, [-1, 380, 982, 440, 451, 981, 549, 717, -2]=1} SECTION ====== ## BFLY_EM_REDUCE ## ========== EM on: 2 paths. // initializing EM (round 0) Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.4291335 sum_frags=17.5 FRAGS_ASSIGNED: [2.0, 50.0%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.5, 50.0%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [3.0, 50.0%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [1.0, 50.0%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [7.0, 50.0%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [1.0, 50.0%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.57086647 sum_frags=25.5 FRAGS_ASSIGNED: [2.0, 50.0%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.5, 50.0%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [3.0, 50.0%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.0, 50.0%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [7.0, 50.0%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 50.0%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] ============================================ EM-round[0] #### ACCOUNTING FOR EXPR VALUES expr: 0.4291335 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.57086647 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 sum_pp_log_likelihood: -23.833495394134374 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -13.608721939671875 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -13.037947638954698 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.518973819477349 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.9583738485335935 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.75024309120156 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -13.037947638954698 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.916747697067187 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.4172338794703 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -6.804360969835938 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.916747697067187 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -39.113842916864094 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] ============================================ EM-round[1] Total frags: 43.0 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.4291335 sum_frags=15.444872 FRAGS_ASSIGNED: [1.7165341, 42.913353%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.42913353, 42.913353%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [2.5748012, 42.913353%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.85826707, 42.913353%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [6.0078697, 42.913357%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.85826707, 42.913353%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.57086647 sum_frags=27.555128 FRAGS_ASSIGNED: [2.2834659, 57.086647%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.57086647, 57.086647%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [3.4251988, 57.086647%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.1417329, 57.086647%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [7.9921303, 57.086647%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.1417329, 57.086647%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.851084579736636 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -13.858569839950583 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.882927091892052 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.441463545946026 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.962771144934159 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.776626869604954 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.882927091892052 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.925542289868318 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.47879602907823 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -6.9292849199752915 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.925542289868318 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -38.64878127567616 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[1] Prev: -264.91464, curr: -264.56433, delta: 0.35031128 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.38040692 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.6195931 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 ============================================ EM-round[2] Total frags: 43.0 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.38040692 sum_frags=14.0318 FRAGS_ASSIGNED: [1.5216277, 38.04069%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.38040692, 38.04069%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [2.2824416, 38.040695%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.76081383, 38.04069%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [5.325697, 38.04069%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.76081383, 38.04069%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.6195931 sum_frags=28.968197 FRAGS_ASSIGNED: [2.478372, 61.9593%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.619593, 61.9593%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [3.7175581, 61.9593%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.239186, 61.9593%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [8.674302, 61.9593%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.239186, 61.9593%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.863223915046387 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -14.050471368066567 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.782907194791283 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.391453597395642 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.965805978761597 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.79483587256958 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.782907194791283 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.931611957523193 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.52128370266236 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -7.025235684033284 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.931611957523193 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -38.34872158437385 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[2] Prev: -264.56433, curr: -264.39005, delta: 0.17428589 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.34665343 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.65334654 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 ============================================ EM-round[3] Total frags: 43.0 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.34665343 sum_frags=13.052951 FRAGS_ASSIGNED: [1.3866138, 34.665344%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.34665346, 34.665344%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [2.0799208, 34.665344%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.6933069, 34.665344%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [4.8531485, 34.665344%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.6933069, 34.665344%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.65334654 sum_frags=29.947048 FRAGS_ASSIGNED: [2.6133862, 65.334656%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.65334654, 65.334656%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [3.9200792, 65.334656%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.3066931, 65.334656%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [9.146852, 65.334656%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.3066931, 65.334656%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.871654349975895 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -14.195095277929715 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.71644277516921 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.358221387584605 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.967913587493974 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.80748152496384 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.71644277516921 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.935827174987947 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.55079022491563 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -7.0975476389648575 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.935827174987947 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -38.149328325507625 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[3] Prev: -264.39005, curr: -264.30258, delta: 0.08746338 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.3231515 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.67684853 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 ============================================ EM-round[4] Total frags: 43.0 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.3231515 sum_frags=12.371393 FRAGS_ASSIGNED: [1.292606, 32.31515%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.3231515, 32.31515%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [1.938909, 32.31515%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.646303, 32.31515%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [4.524121, 32.31515%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.646303, 32.31515%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.67684853 sum_frags=30.628607 FRAGS_ASSIGNED: [2.7073941, 67.68485%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.67684853, 67.68485%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [4.0610914, 67.68486%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.3536971, 67.68485%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [9.47588, 67.68485%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.3536971, 67.68485%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.87753497919904 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -14.302350298549943 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.671435565613965 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.335717782806983 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.96938374479976 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.81630246879856 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.671435565613965 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.93876748959952 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.57137242719665 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -7.151175149274971 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.93876748959952 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -38.0143066968419 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[4] Prev: -264.30258, curr: -264.25854, delta: 0.044036865 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.30672878 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.6932712 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 ============================================ EM-round[5] Total frags: 43.0 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.30672878 sum_frags=11.895135 FRAGS_ASSIGNED: [1.2269151, 30.672878%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.30672878, 30.672878%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [1.8403727, 30.672878%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.61345756, 30.672878%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [4.294203, 30.672878%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.61345756, 30.672878%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.6932712 sum_frags=31.104862 FRAGS_ASSIGNED: [2.7730846, 69.32712%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.69327116, 69.32712%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [4.159627, 69.32712%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.3865423, 69.32712%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [9.705796, 69.32712%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.3865423, 69.32712%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.88164963914862 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -14.38086508513366 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.640575967216929 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.320287983608464 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.970412409787155 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.82247445872293 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.640575967216929 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.94082481957431 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.58577373702016 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -7.19043254256683 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.94082481957431 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -37.92172790165078 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[5] Prev: -264.25854, curr: -264.23642, delta: 0.022125244 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.29522422 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.70477575 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 ============================================ EM-round[6] Total frags: 43.0 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.29522422 sum_frags=11.561502 FRAGS_ASSIGNED: [1.1808969, 29.522423%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.29522422, 29.522423%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [1.7713454, 29.522423%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.59044844, 29.522423%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [4.133139, 29.522423%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.59044844, 29.522423%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.70477575 sum_frags=31.438498 FRAGS_ASSIGNED: [2.819103, 70.47758%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.70477575, 70.47758%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [4.2286544, 70.47758%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.4095515, 70.47758%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [9.86686, 70.47758%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.4095515, 70.47758%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.88453453877154 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -14.437762328772989 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.619238094761245 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.309619047380623 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.971133634692885 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.82680180815731 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.619238094761245 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.94226726938577 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.59587088570039 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -7.218881164386494 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.94226726938577 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -37.85771428428374 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[6] Prev: -264.23642, curr: -264.22534, delta: 0.011077881 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.28715086 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.71284914 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 ============================================ EM-round[7] Total frags: 43.000004 Frag assignment for trans: [-1, 945, 451, 981, 549, 717, -2] len=367 expr=0.28715086 sum_frags=11.327374 FRAGS_ASSIGNED: [1.1486034, 28.715086%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[945, 451], []]] FRAGS_ASSIGNED: [0.28715086, 28.715086%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [1.7229052, 28.715086%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [0.5743017, 28.715086%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [4.020112, 28.715086%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 945], []]] FRAGS_ASSIGNED: [0.5743017, 28.715086%] for read: PairPath [_paths=[[981, 549], []]] Frag assignment for trans: [-1, 380, 982, 440, 451, 981, 549, 717, -2] len=402 expr=0.71284914 sum_frags=31.672628 FRAGS_ASSIGNED: [2.8513968, 71.28492%] for read: PairPath [_paths=[[549, 717], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[982, 440, 451], []]] FRAGS_ASSIGNED: [1.0, 100.0%] for read: PairPath [_paths=[[-1, 380], []]] FRAGS_ASSIGNED: [0.7128492, 71.28492%] for read: PairPath [_paths=[[717, -2], []]] FRAGS_ASSIGNED: [4.2770953, 71.28492%] for read: PairPath [_paths=[[451, 981, 549], []]] FRAGS_ASSIGNED: [2.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] FRAGS_ASSIGNED: [1.4256984, 71.28492%] for read: PairPath [_paths=[[451, 981], []]] FRAGS_ASSIGNED: [9.979889, 71.28492%] for read: PairPath [_paths=[[549], []]] FRAGS_ASSIGNED: [1.4256984, 71.28492%] for read: PairPath [_paths=[[981, 549], []]] FRAGS_ASSIGNED: [6.0, 100.0%] for read: PairPath [_paths=[[380, 982, 440, 451], []]] sum_pp_log_likelihood: -23.88656024720119 for PP: PairPath [_paths=[[549, 717], []]] sum_pp_log_likelihood: -14.47867955886598 for PP: PairPath [_paths=[[945, 451], []]] sum_pp_log_likelihood: -12.604398963940202 for PP: PairPath [_paths=[[982, 440, 451], []]] sum_pp_log_likelihood: -6.302199481970101 for PP: PairPath [_paths=[[-1, 380], []]] sum_pp_log_likelihood: -5.971640061800297 for PP: PairPath [_paths=[[717, -2], []]] sum_pp_log_likelihood: -35.82984037080178 for PP: PairPath [_paths=[[451, 981, 549], []]] sum_pp_log_likelihood: -12.604398963940202 for PP: PairPath [_paths=[[380, 982, 440, 451, 981, 549], []]] sum_pp_log_likelihood: -11.943280123600594 for PP: PairPath [_paths=[[451, 981], []]] sum_pp_log_likelihood: -83.60296086520415 for PP: PairPath [_paths=[[549], []]] sum_pp_log_likelihood: -7.23933977943299 for PP: PairPath [_paths=[[-1, 945], []]] sum_pp_log_likelihood: -11.943280123600594 for PP: PairPath [_paths=[[981, 549], []]] sum_pp_log_likelihood: -37.81319689182061 for PP: PairPath [_paths=[[380, 982, 440, 451], []]] EM round[7] Prev: -264.22534, curr: -264.2198, delta: 0.005554199 [seconds: 0] #### ACCOUNTING FOR EXPR VALUES expr: 0.28147835 for path: [-1, 945, 451, 981, 549, 717, -2] expr: 0.71852165 for path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] ** Sum expr: 1.0 Expression values for each candidate path: Expr=0.7185216546058655, sum_exp_frags=31.67262840270996, path: [-1, 380, 982, 440, 451, 981, 549, 717, -2] Expr=0.2814783453941345, sum_exp_frags=11.327374458312988, path: [-1, 945, 451, 981, 549, 717, -2] Keeping TOP isoform: [-1, 380, 982, 440, 451, 981, 549, 717, -2] as having _highest_ expr=0.71852165 and 100.0% dom. iso expr for gene. Keeping isoform: [-1, 945, 451, 981, 549, 717, -2] as having expr=0.28147835 and 39.17465% dom. iso expr for gene. EM_REDUCE retaining: [-1, 380, 982, 440, 451, 981, 549, 717, -2] EM_REDUCE retaining: [-1, 945, 451, 981, 549, 717, -2] FinalPath@AfterFiltering: [-1, 380, 982, 440, 451, 981, 549, 717, -2] FinalPath@AfterFiltering: [-1, 945, 451, 981, 549, 717, -2] Final Paths: 2 Final path reported: c1_g1_i1 len=402 path=[380:0-58 982:59-82 440:83-93 451:94-167 981:168-191 549:192-359 717:360-401] [-1, 380, 982, 440, 451, 981, 549, 717, -2] Final path reported: c1_g1_i2 len=367 path=[945:0-58 451:59-132 981:133-156 549:157-324 717:325-366] [-1, 945, 451, 981, 549, 717, -2] total number of paths reported = 2 from 2 components Done make[1]: Leaving directory '/<>' create-stamp debian/debhelper-build-stamp dh_prep debian/rules override_dh_auto_install make[1]: Entering directory '/<>' for target in Inchworm Chrysalis; do dh_auto_install \ --sourcedirectory=${target} --builddirectory=${target}_build; done cd Inchworm_build && make -j2 install DESTDIR=/<>/trinityrnaseq-2.15.1\+dfsg/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/Inchworm_build' /usr/bin/cmake -S/<>/Inchworm -B/<>/Inchworm_build --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[3]: Entering directory '/<>/Inchworm_build' make[3]: Nothing to be done for 'preinstall'. make[3]: Leaving directory '/<>/Inchworm_build' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /<>/debian/tmp/usr/bin/inchworm -- Installing: /<>/debian/tmp/usr/bin/FastaToDeBruijn -- Installing: /<>/debian/tmp/usr/bin/fastaToKmerCoverageStats make[2]: Leaving directory '/<>/Inchworm_build' cd Chrysalis_build && make -j2 install DESTDIR=/<>/trinityrnaseq-2.15.1\+dfsg/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/Chrysalis_build' /usr/bin/cmake -S/<>/Chrysalis -B/<>/Chrysalis_build --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[3]: Entering directory '/<>/Chrysalis_build' make[3]: Nothing to be done for 'preinstall'. make[3]: Leaving directory '/<>/Chrysalis_build' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /<>/debian/tmp/usr/bin/Chrysalis -- Installing: /<>/debian/tmp/usr/bin/GraphFromFasta -- Installing: /<>/debian/tmp/usr/bin/QuantifyGraph -- Installing: /<>/debian/tmp/usr/bin/ReadsToTranscripts -- Installing: /<>/debian/tmp/usr/bin/BubbleUpClustering -- Installing: /<>/debian/tmp/usr/bin/CreateIwormFastaBundle make[2]: Leaving directory '/<>/Chrysalis_build' for target in trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs trinity-plugins/bamsifter trinity-plugins/seqtk-trinity; do dh_auto_install \ --sourcedirectory=${target}; done cd trinity-plugins/slclust && make -j2 install DESTDIR=/<>/trinityrnaseq-2.15.1\+dfsg/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[2]: Entering directory '/<>/trinity-plugins/slclust' X=`pwd`; \ for i in src; \ do echo '<<<' $i '>>>'; cd $X/$i; make install; done <<< src >>> make[3]: Entering directory '/<>/trinity-plugins/slclust/src' mv slclust ../bin/ make[3]: Leaving directory '/<>/trinity-plugins/slclust/src' make[2]: Leaving directory '/<>/trinity-plugins/slclust' make[1]: Leaving directory '/<>' debian/rules override_dh_install-arch make[1]: Entering directory '/<>' dh_install -a find debian/trinityrnaseq -name '*.p?' | xargs sed -i \ 's=^#!/usr/local/bin/perl=#!/usr/bin/perl=' chmod u+x \ debian/trinityrnaseq/usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/class_to_separate_fpkm_matrices.pl \ debian/trinityrnaseq/usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/count_by_expression_quintile.pl \ debian/trinityrnaseq/usr/lib/trinityrnaseq/util/misc/capture_orig_n_unmapped_reads.pl \ debian/trinityrnaseq/usr/lib/trinityrnaseq/util/support_scripts/plugin_install_tests.sh \ debian/trinityrnaseq/usr/lib/trinityrnaseq/util/support_scripts/trinity_install_tests.sh chmod -R a-x debian/trinityrnaseq/usr/lib/trinityrnaseq/PerlLib/*.pm chmod -R a-x debian/trinityrnaseq/usr/lib/trinityrnaseq/PerlLib/*/*.pm find debian -name __pycache__ -type d | xargs rm -rf make[1]: Leaving directory '/<>' jh_installjavadoc dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link jh_installlibs jh_classpath jh_manifest jh_exec jh_depends dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/<>' dh_fixperms find debian -name genwig.sh -exec chmod +x \{\} \; for pl in `grep -Rl '#!/usr/bin/env[[:space:]]\+perl' debian/*/usr/*` ; do \ sed -i '1s?^#!/usr/bin/env[[:space:]]\+perl?#!/usr/bin/perl?' ${pl} ; \ done make[1]: Leaving directory '/<>' dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'trinityrnaseq' in '../trinityrnaseq_2.15.1+dfsg-5_amd64.deb'. dpkg-deb: building package 'trinityrnaseq-examples' in '../trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb'. dpkg-deb: building package 'trinityrnaseq-dbgsym' in '../trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb'. dpkg-genbuildinfo -O../trinityrnaseq_2.15.1+dfsg-5_amd64.buildinfo dpkg-genchanges -O../trinityrnaseq_2.15.1+dfsg-5_amd64.changes dpkg-genchanges: info: not including original source code in upload dpkg-source -Zxz --after-build . dpkg-buildpackage: info: binary and diff upload (original source NOT included) -------------------------------------------------------------------------------- Build finished at 2024-06-05T11:56:20Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ trinityrnaseq_2.15.1+dfsg-5_amd64.changes: ------------------------------------------ Format: 1.8 Date: Sat, 23 Dec 2023 23:34:33 +0100 Source: trinityrnaseq Binary: trinityrnaseq trinityrnaseq-dbgsym trinityrnaseq-examples Architecture: source amd64 Version: 2.15.1+dfsg-5 Distribution: perl-5.40-throwaway Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: trinityrnaseq - RNA-Seq De novo Assembly trinityrnaseq-examples - RNA-Seq De novo Assembly common example and testing files Closes: 1059072 Changes: trinityrnaseq (2.15.1+dfsg-5) unstable; urgency=medium . * Team upload. * Add support for loong64 Closes: #1059072 Checksums-Sha1: 71269d1bdf4825568c84280982a723879df9d0f8 1722 trinityrnaseq_2.15.1+dfsg-5.dsc 0ce99db551777c616526db8ae5ddbae1d64c3b39 39352 trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz 4c8dffea3b850d1faa06016b2d358079ffada1fd 10671984 trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb d2dd9bcfe3ef1d7c02fa845972e8f05f555ba578 299849540 trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb 391b3ec5434e0228a86f7d7c60355da54236d7c3 12754 trinityrnaseq_2.15.1+dfsg-5_amd64.buildinfo 2303899b7116f4c1f4e89af49a03a0d656e7b1c3 1720676 trinityrnaseq_2.15.1+dfsg-5_amd64.deb Checksums-Sha256: ba3b2832e68939d60363b273f44e0415914e2e598fc3ddf28562bbf1619d45df 1722 trinityrnaseq_2.15.1+dfsg-5.dsc aabf9b51f963d4149fba77327a1588591020b620128cd330cf0429e926f379cd 39352 trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz 2bd445670f305b71d5ebd7745b76deb333e05badf7471b234f83a5cb787bb8c6 10671984 trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb 90ae915026d2551c90acf41b6c2cb51667a28a2cb846b9679a75d0e07c061c24 299849540 trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb 0d9b4fb0963005a9bfe4a4c9c03d5f26c84d326492d1a826262bbc7e8c100201 12754 trinityrnaseq_2.15.1+dfsg-5_amd64.buildinfo bc85b64b5bd5c22f506a52bd78078d7df567fe8e2a8e8e5110d474bb92fc69db 1720676 trinityrnaseq_2.15.1+dfsg-5_amd64.deb Files: 9ab25308698cdddbb76dcab42674e7a9 1722 science optional trinityrnaseq_2.15.1+dfsg-5.dsc fda10dbb9b5b348e0f0081edd75e7e86 39352 science optional trinityrnaseq_2.15.1+dfsg-5.debian.tar.xz 51683e7e873cf9e5bb7a3e277f5b64e0 10671984 debug optional trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb 975746c4e806c8619b9b7ab89c1e645e 299849540 science optional trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb 7ab5bd6eb829a1c52e35ff0479c08975 12754 science optional trinityrnaseq_2.15.1+dfsg-5_amd64.buildinfo 5b9a344959fb0e217f9b568b38212252 1720676 science optional trinityrnaseq_2.15.1+dfsg-5_amd64.deb +------------------------------------------------------------------------------+ | Buildinfo | +------------------------------------------------------------------------------+ Format: 1.0 Source: trinityrnaseq Binary: trinityrnaseq trinityrnaseq-dbgsym trinityrnaseq-examples Architecture: amd64 source Version: 2.15.1+dfsg-5 Checksums-Md5: 9ab25308698cdddbb76dcab42674e7a9 1722 trinityrnaseq_2.15.1+dfsg-5.dsc 51683e7e873cf9e5bb7a3e277f5b64e0 10671984 trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb 975746c4e806c8619b9b7ab89c1e645e 299849540 trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb 5b9a344959fb0e217f9b568b38212252 1720676 trinityrnaseq_2.15.1+dfsg-5_amd64.deb Checksums-Sha1: 71269d1bdf4825568c84280982a723879df9d0f8 1722 trinityrnaseq_2.15.1+dfsg-5.dsc 4c8dffea3b850d1faa06016b2d358079ffada1fd 10671984 trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb d2dd9bcfe3ef1d7c02fa845972e8f05f555ba578 299849540 trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb 2303899b7116f4c1f4e89af49a03a0d656e7b1c3 1720676 trinityrnaseq_2.15.1+dfsg-5_amd64.deb Checksums-Sha256: ba3b2832e68939d60363b273f44e0415914e2e598fc3ddf28562bbf1619d45df 1722 trinityrnaseq_2.15.1+dfsg-5.dsc 2bd445670f305b71d5ebd7745b76deb333e05badf7471b234f83a5cb787bb8c6 10671984 trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb 90ae915026d2551c90acf41b6c2cb51667a28a2cb846b9679a75d0e07c061c24 299849540 trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb bc85b64b5bd5c22f506a52bd78078d7df567fe8e2a8e8e5110d474bb92fc69db 1720676 trinityrnaseq_2.15.1+dfsg-5_amd64.deb Build-Origin: Debian Build-Architecture: amd64 Build-Date: Wed, 05 Jun 2024 11:56:17 +0000 Build-Path: /<> Build-Tainted-By: merged-usr-via-aliased-dirs usr-local-has-programs Installed-Build-Depends: adduser (= 3.137), adwaita-icon-theme (= 46.0-1), at-spi2-common (= 2.52.0-1), autoconf (= 2.71-3), automake (= 1:1.16.5-1.3), autopoint (= 0.21-14), autotools-dev (= 20220109.1), base-files (= 13.2), base-passwd (= 3.6.3), bash (= 5.2.21-2+b1), binfmt-support (= 2.2.2-7), binutils (= 2.42-4), binutils-common (= 2.42-4), binutils-x86-64-linux-gnu (= 2.42-4), bsdextrautils (= 2.40.1-8), bsdutils (= 1:2.40.1-8), build-essential (= 12.10), bzip2 (= 1.0.8-5.1), ca-certificates (= 20240203), ca-certificates-java (= 20240118), cmake (= 3.29.4-1), cmake-data (= 3.29.4-1), coreutils (= 9.4-3.1), cpp (= 4:13.2.0-7), cpp-13 (= 13.2.0-25), cpp-13-x86-64-linux-gnu (= 13.2.0-25), cpp-x86-64-linux-gnu (= 4:13.2.0-7), dash (= 0.5.12-8), dctrl-tools (= 2.24-3+b1), debconf (= 1.5.86), debhelper (= 13.15.3), debianutils (= 5.17), default-jdk (= 2:1.17-75), default-jdk-headless (= 2:1.17-75), default-jre (= 2:1.17-75), default-jre-headless (= 2:1.17-75), devscripts (= 2.23.7), dh-autoreconf (= 20), dh-strip-nondeterminism (= 1.14.0-1), diffutils (= 1:3.10-1), dirmngr (= 2.2.43-7), dpkg (= 1.22.6), dpkg-dev (= 1.22.6), dwz (= 0.15-1+b1), fastjar (= 2:0.98-7), file (= 1:5.45-3), findutils (= 4.9.0-6), fontconfig (= 2.15.0-1.1), fontconfig-config (= 2.15.0-1.1), fonts-dejavu-core (= 2.37-8), fonts-dejavu-mono (= 2.37-8), g++ (= 4:13.2.0-7), g++-13 (= 13.2.0-25), g++-13-x86-64-linux-gnu (= 13.2.0-25), g++-x86-64-linux-gnu (= 4:13.2.0-7), gcc (= 4:13.2.0-7), gcc-13 (= 13.2.0-25), gcc-13-base (= 13.2.0-25), gcc-13-x86-64-linux-gnu (= 13.2.0-25), gcc-14-base (= 14.1.0-1), gcc-x86-64-linux-gnu (= 4:13.2.0-7), gettext (= 0.21-14+b1), gettext-base (= 0.21-14+b1), gnupg (= 2.2.43-7), gnupg-l10n (= 2.2.43-7), gpg (= 2.2.43-7), gpg-agent (= 2.2.43-7), gpgconf (= 2.2.43-7), gpgsm (= 2.2.43-7), gpgv (= 2.2.43-7), grep (= 3.11-4), groff-base (= 1.23.0-4), gtk-update-icon-cache (= 3.24.42-1), gzip (= 1.12-1.1), hicolor-icon-theme (= 0.18-1), hostname (= 3.23+nmu2), init-system-helpers (= 1.66), intltool-debian (= 0.35.0+20060710.6), jaligner (= 1.0+dfsg-11), jarwrapper (= 0.80), java-common (= 0.75), javahelper (= 0.80), libacl1 (= 2.3.2-2), libarchive-zip-perl (= 1.68-1), libarchive13t64 (= 3.7.2-2.1), libasan8 (= 14.1.0-1), libasound2-data (= 1.2.11-1), libasound2t64 (= 1.2.11-1+b1), libassuan0 (= 2.5.6-1+b1), libatinject-jsr330-api-java (= 1.0+ds1-5), libatk1.0-0t64 (= 2.52.0-1), libatomic1 (= 14.1.0-1), libattr1 (= 1:2.5.2-1), libaudit-common (= 1:3.1.2-2.1), libaudit1 (= 1:3.1.2-2.1), libavahi-client3 (= 0.8-13+b2), libavahi-common-data (= 0.8-13+b2), libavahi-common3 (= 0.8-13+b2), libb-hooks-op-check-perl (= 0.22-3+b2), libbinutils (= 2.42-4), libblkid1 (= 2.40.1-8), libbrotli1 (= 1.1.0-2+b3), libbsd0 (= 0.12.2-1), libbz2-1.0 (= 1.0.8-5.1), libc-bin (= 2.38-12), libc-dev-bin (= 2.38-12), libc6 (= 2.38-12), libc6-dev (= 2.38-12), libcairo2 (= 1.18.0-3+b1), libcap-ng0 (= 0.8.5-1), libcap2 (= 1:2.66-5), libcc1-0 (= 14.1.0-1), libclass-method-modifiers-perl (= 2.15-1), libclass-xsaccessor-perl (= 1.19-4+b4), libclone-perl (= 0.46-1+b3), libcom-err2 (= 1.47.1-1), libcrypt-dev (= 1:4.4.36-4), libcrypt1 (= 1:4.4.36-4), libctf-nobfd0 (= 2.42-4), libctf0 (= 2.42-4), libcups2t64 (= 2.4.7-1.2+b1), libcurl3t64-gnutls (= 8.8.0-1), libcurl4-gnutls-dev (= 8.8.0-1), libcurl4t64 (= 8.8.0-1), libdatrie1 (= 0.2.13-3), libdb5.3t64 (= 5.3.28+dfsg2-7), libdbus-1-3 (= 1.14.10-4+b1), libdebconfclient0 (= 0.272), libdebhelper-perl (= 13.15.3), libdeflate-dev (= 1.20-1), libdeflate0 (= 1.20-1), libdevel-callchecker-perl (= 0.009-1+b1), libdpkg-perl (= 1.22.6), libdrm-amdgpu1 (= 2.4.120-2), libdrm-common (= 2.4.120-2), libdrm-intel1 (= 2.4.120-2), libdrm-radeon1 (= 2.4.120-2), libdrm2 (= 2.4.120-2), libdynaloader-functions-perl (= 0.003-3), libedit2 (= 3.1-20240517-1), libelf1t64 (= 0.191-1+b1), libencode-locale-perl (= 1.05-3), liberror-prone-java (= 2.18.0-1), libexpat1 (= 2.6.2-1), libffi8 (= 3.4.6-1), libfile-dirlist-perl (= 0.05-3), libfile-homedir-perl (= 1.006-2), libfile-listing-perl (= 6.16-1), libfile-stripnondeterminism-perl (= 1.14.0-1), libfile-touch-perl (= 0.12-2), libfile-which-perl (= 1.27-2), libfontconfig1 (= 2.15.0-1.1), libfreetype6 (= 2.13.2+dfsg-1+b4), libfribidi0 (= 1.0.13-3+b1), libgcc-13-dev (= 13.2.0-25), libgcc-s1 (= 14.1.0-1), libgcrypt20 (= 1.10.3-3), libgdbm-compat4t64 (= 1.23-5.1+b1), libgdbm6t64 (= 1.23-5.1+b1), libgdk-pixbuf-2.0-0 (= 2.42.12+dfsg-1), libgdk-pixbuf2.0-common (= 2.42.12+dfsg-1), libgetopt-java (= 1.0.14+dfsg-6), libgif7 (= 5.2.2-1), libgl1 (= 1.7.0-1+b1), libgl1-mesa-dri (= 24.1.0-2), libglapi-mesa (= 24.1.0-2), libglib2.0-0t64 (= 2.80.2-2), libglvnd0 (= 1.7.0-1+b1), libglx-mesa0 (= 24.1.0-2), libglx0 (= 1.7.0-1+b1), libgmp10 (= 2:6.3.0+dfsg-2+b1), libgnutls30t64 (= 3.8.5-4), libgomp1 (= 14.1.0-1), libgpg-error0 (= 1.49-2), libgprofng0 (= 2.42-4), libgraphite2-3 (= 1.3.14-2), libgssapi-krb5-2 (= 1.20.1-6+b1), libgtk2.0-0t64 (= 2.24.33-4), libgtk2.0-common (= 2.24.33-4), libguava-java (= 32.0.1-1), libharfbuzz0b (= 8.3.0-2+b1), libhogweed6t64 (= 3.9.1-2.2), libhtml-parser-perl (= 3.82-1+b1), libhtml-tagset-perl (= 3.24-1), libhtml-tree-perl (= 5.07-3), libhts-dev (= 1.20+ds-1), libhts3t64 (= 1.20+ds-1), libhtscodecs2 (= 1.6.0-1+b1), libhttp-cookies-perl (= 6.11-1), libhttp-date-perl (= 6.06-1), libhttp-message-perl (= 6.46-1), libhttp-negotiate-perl (= 6.01-2), libhwasan0 (= 14.1.0-1), libicu72 (= 72.1-4+b1), libidn2-0 (= 2.3.7-2), libimport-into-perl (= 1.002005-2), libio-html-perl (= 1.004-3), libio-pty-perl (= 1:1.20-1+b2), libio-socket-ssl-perl (= 2.085-1), libipc-run-perl (= 20231003.0-2), libisl23 (= 0.26-3+b2), libitm1 (= 14.1.0-1), libjansson4 (= 2.14-2+b2), libjbig0 (= 2.1-6.1+b1), libjpeg62-turbo (= 1:2.1.5-3), libjs-jquery (= 3.6.1+dfsg+~3.5.14-1), libjsoncpp25 (= 1.9.5-6+b2), libjsr305-java (= 0.1~+svn49-11), libjung-free-java (= 2.1.1-2), libk5crypto3 (= 1.20.1-6+b1), libkeyutils1 (= 1.6.3-3), libkrb5-3 (= 1.20.1-6+b1), libkrb5support0 (= 1.20.1-6+b1), libksba8 (= 1.6.6-1), liblcms2-2 (= 2.14-2+b1), libldap-2.5-0 (= 2.5.17+dfsg-1+b1), liblerc4 (= 4.0.0+ds-4+b1), libllvm17t64 (= 1:17.0.6-12), liblsan0 (= 14.1.0-1), liblwp-mediatypes-perl (= 6.04-2), liblwp-protocol-https-perl (= 6.14-1), liblz4-1 (= 1.9.4-2), liblzma-dev (= 5.6.1+really5.4.5-1), liblzma5 (= 5.6.1+really5.4.5-1), libmagic-mgc (= 1:5.45-3), libmagic1t64 (= 1:5.45-3), libmd0 (= 1.1.0-2), libmodule-runtime-perl (= 0.016-2), libmoo-perl (= 2.005005-1), libmount1 (= 2.40.1-8), libmpc3 (= 1.3.1-1+b2), libmpfr6 (= 4.2.1-1+b1), libncursesw6 (= 6.5-2), libnet-http-perl (= 6.23-1), libnet-ssleay-perl (= 1.94-1+b2), libnettle8t64 (= 3.9.1-2.2), libnghttp2-14 (= 1.61.0-1+b1), libnpth0t64 (= 1.6-3.1), libnspr4 (= 2:4.35-1.1+b1), libnss3 (= 2:3.100-1), libp11-kit0 (= 0.25.3-5), libpam-modules (= 1.5.3-7), libpam-modules-bin (= 1.5.3-7), libpam-runtime (= 1.5.3-7), libpam0g (= 1.5.3-7), libpango-1.0-0 (= 1.52.2+ds-1), libpangocairo-1.0-0 (= 1.52.2+ds-1), libpangoft2-1.0-0 (= 1.52.2+ds-1), libparams-classify-perl (= 0.015-2+b4), libpciaccess0 (= 0.17-3+b1), libpcre2-8-0 (= 10.42-4+b1), libpcsclite1 (= 2.2.3-1), libperl5.40 (= 5.40.0~rc1-1), libpipeline1 (= 1.5.7-2), libpixman-1-0 (= 0.42.2-1+b1), libpng16-16t64 (= 1.6.43-5), libproc2-0 (= 2:4.0.4-4), libpsl5t64 (= 0.21.2-1.1), libpython3-stdlib (= 3.11.8-1), libpython3.11-minimal (= 3.11.9-1), libpython3.11-stdlib (= 3.11.9-1), libquadmath0 (= 14.1.0-1), libreadline8t64 (= 8.2-4), librhash0 (= 1.4.3-3+b1), librole-tiny-perl (= 2.002004-1), librtmp1 (= 2.4+20151223.gitfa8646d.1-2+b4), libsasl2-2 (= 2.1.28+dfsg1-6), libsasl2-modules-db (= 2.1.28+dfsg1-6), libseccomp2 (= 2.5.5-1), libselinux1 (= 3.5-2+b2), libsemanage-common (= 3.5-1), libsemanage2 (= 3.5-1+b3), libsensors-config (= 1:3.6.0-10), libsensors5 (= 1:3.6.0-10), libsepol2 (= 3.5-2+b1), libsframe1 (= 2.42-4), libsharpyuv0 (= 1.4.0-0.1), libsmartcols1 (= 2.40.1-8), libsqlite3-0 (= 3.46.0-1), libssh2-1t64 (= 1.11.0-5), libssl3t64 (= 3.2.2-1), libstdc++-13-dev (= 13.2.0-25), libstdc++6 (= 14.1.0-1), libsub-quote-perl (= 2.006008-1), libsystemd0 (= 256~rc3-7), libtasn1-6 (= 4.19.0-3+b2), libthai-data (= 0.1.29-2), libthai0 (= 0.1.29-2), libtiff6 (= 4.5.1+git230720-4), libtimedate-perl (= 2.3300-2), libtinfo6 (= 6.5-2), libtool (= 2.4.7-7), libtry-tiny-perl (= 0.31-2), libtsan2 (= 14.1.0-1), libubsan1 (= 14.1.0-1), libuchardet0 (= 0.0.8-1+b1), libudev1 (= 256~rc3-7), libunistring5 (= 1.2-1), liburi-perl (= 5.28-1), libuuid1 (= 2.40.1-8), libuv1t64 (= 1.48.0-4), libvulkan1 (= 1.3.283.0-1), libwebp7 (= 1.4.0-0.1), libwww-perl (= 6.77-1), libwww-robotrules-perl (= 6.02-1), libx11-6 (= 2:1.8.7-1+b1), libx11-data (= 2:1.8.7-1), libx11-xcb1 (= 2:1.8.7-1+b1), libxau6 (= 1:1.0.9-1+b1), libxcb-dri2-0 (= 1.17.0-2), libxcb-dri3-0 (= 1.17.0-2), libxcb-glx0 (= 1.17.0-2), libxcb-present0 (= 1.17.0-2), libxcb-randr0 (= 1.17.0-2), libxcb-render0 (= 1.17.0-2), libxcb-shm0 (= 1.17.0-2), libxcb-sync1 (= 1.17.0-2), libxcb-xfixes0 (= 1.17.0-2), libxcb1 (= 1.17.0-2), libxcomposite1 (= 1:0.4.5-1+b1), libxcursor1 (= 1:1.2.2-1), libxdamage1 (= 1:1.1.6-1+b1), libxdmcp6 (= 1:1.1.2-3+b1), libxext6 (= 2:1.3.4-1+b1), libxfixes3 (= 1:6.0.0-2+b1), libxi6 (= 2:1.8.1-1), libxinerama1 (= 2:1.1.4-3+b1), libxml2 (= 2.12.7+dfsg-3), libxrandr2 (= 2:1.5.4-1), libxrender1 (= 1:0.9.10-1.1+b1), libxshmfence1 (= 1.3-1+b1), libxtst6 (= 2:1.2.3-1.1+b1), libxxf86vm1 (= 1:1.1.4-1+b2), libz3-4 (= 4.8.12-3.1+b2), libzstd1 (= 1.5.5+dfsg2-2), linux-libc-dev (= 6.8.12-1), login (= 1:4.13+dfsg1-5), m4 (= 1.4.19-4), make (= 4.3-4.1), man-db (= 2.12.1-1), mawk (= 1.3.4.20240123-1), media-types (= 10.1.0), ncurses-base (= 6.5-2), ncurses-bin (= 6.5-2), netbase (= 6.4), openjdk-17-jdk (= 17.0.11+9-1), openjdk-17-jdk-headless (= 17.0.11+9-1), openjdk-17-jre (= 17.0.11+9-1), openjdk-17-jre-headless (= 17.0.11+9-1), openssl (= 3.2.2-1), passwd (= 1:4.13+dfsg1-5), patch (= 2.7.6-7), patchutils (= 0.4.2-1), perl (= 5.40.0~rc1-1), perl-base (= 5.40.0~rc1-1), perl-modules-5.40 (= 5.40.0~rc1-1), perl-openssl-defaults (= 7+b2), pinentry-curses (= 1.2.1-3+b2), po-debconf (= 1.0.21+nmu1), procps (= 2:4.0.4-4), python3 (= 3.11.8-1), python3-minimal (= 3.11.8-1), python3.11 (= 3.11.9-1), python3.11-minimal (= 3.11.9-1), readline-common (= 8.2-4), rpcsvc-proto (= 1.4.3-1), sed (= 4.9-2), sensible-utils (= 0.0.22), shared-mime-info (= 2.4-5), sysvinit-utils (= 3.09-1), tar (= 1.35+dfsg-3), tzdata (= 2024a-4), usr-is-merged (= 39), util-linux (= 2.40.1-8), wdiff (= 1.2.2-6), x11-common (= 1:7.7+23), xz-utils (= 5.6.1+really5.4.5-1), zlib1g (= 1:1.3.dfsg+really1.3.1-1), zlib1g-dev (= 1:1.3.dfsg+really1.3.1-1) Environment: DEB_BUILD_OPTIONS="parallel=2" LANG="en_GB.UTF-8" LC_ALL="C.UTF-8" LC_COLLATE="C.UTF-8" LD_LIBRARY_PATH="/usr/lib/libeatmydata" SOURCE_DATE_EPOCH="1703370873" +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ trinityrnaseq-dbgsym_2.15.1+dfsg-5_amd64.deb -------------------------------------------- new Debian package, version 2.0. size 10671984 bytes: control archive=1192 bytes. 900 bytes, 12 lines control 1468 bytes, 14 lines md5sums Package: trinityrnaseq-dbgsym Source: trinityrnaseq Version: 2.15.1+dfsg-5 Auto-Built-Package: debug-symbols Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 11101 Depends: trinityrnaseq (= 2.15.1+dfsg-5) Section: debug Priority: optional Description: debug symbols for trinityrnaseq Build-Ids: 09410a7ae60931d62900e13f7d17d7a3074cb639 0f4a9ed3f216b9a1b23ab39ae0f48de96962a815 129fdf69caeaabdaa6839cf5945cbd5718e4d6b4 140721f0fe60b7c04511319a44f379a562e95d87 22ad8640a6fc57cddc8e0e298338444d7917a01a 2bf88aa194f43ba644a92b206f8068a527156739 6113eb924eeed805174b74117081d928fd2f0df6 64fe17afbf9ca295d5bd5986e7f5d120303ecebf adeac1a556f8f24ff82a8b948aceac306fff9ac8 cdcdbf1c403b40b09c395bdcc1da282036447358 cf81a96f709cec7a4583d10b0098ff9db921e579 e2ecfa2097afac79667178b97c69befb642404e4 f02c537cadee34be9546f27bccd9a50162197872 drwxr-xr-x root/root 0 2023-12-23 22:34 ./ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/09/ -rw-r--r-- root/root 90968 2023-12-23 22:34 ./usr/lib/debug/.build-id/09/410a7ae60931d62900e13f7d17d7a3074cb639.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/0f/ -rw-r--r-- root/root 1559704 2023-12-23 22:34 ./usr/lib/debug/.build-id/0f/4a9ed3f216b9a1b23ab39ae0f48de96962a815.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/12/ -rw-r--r-- root/root 1434248 2023-12-23 22:34 ./usr/lib/debug/.build-id/12/9fdf69caeaabdaa6839cf5945cbd5718e4d6b4.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/14/ -rw-r--r-- root/root 24952 2023-12-23 22:34 ./usr/lib/debug/.build-id/14/0721f0fe60b7c04511319a44f379a562e95d87.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/22/ -rw-r--r-- root/root 1459424 2023-12-23 22:34 ./usr/lib/debug/.build-id/22/ad8640a6fc57cddc8e0e298338444d7917a01a.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/2b/ -rw-r--r-- root/root 738648 2023-12-23 22:34 ./usr/lib/debug/.build-id/2b/f88aa194f43ba644a92b206f8068a527156739.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/61/ -rw-r--r-- root/root 183424 2023-12-23 22:34 ./usr/lib/debug/.build-id/61/13eb924eeed805174b74117081d928fd2f0df6.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/64/ -rw-r--r-- root/root 1007360 2023-12-23 22:34 ./usr/lib/debug/.build-id/64/fe17afbf9ca295d5bd5986e7f5d120303ecebf.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/ad/ -rw-r--r-- root/root 645672 2023-12-23 22:34 ./usr/lib/debug/.build-id/ad/eac1a556f8f24ff82a8b948aceac306fff9ac8.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/cd/ -rw-r--r-- root/root 415664 2023-12-23 22:34 ./usr/lib/debug/.build-id/cd/cdbf1c403b40b09c395bdcc1da282036447358.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/cf/ -rw-r--r-- root/root 251048 2023-12-23 22:34 ./usr/lib/debug/.build-id/cf/81a96f709cec7a4583d10b0098ff9db921e579.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/e2/ -rw-r--r-- root/root 1279720 2023-12-23 22:34 ./usr/lib/debug/.build-id/e2/ecfa2097afac79667178b97c69befb642404e4.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.build-id/f0/ -rw-r--r-- root/root 1633672 2023-12-23 22:34 ./usr/lib/debug/.build-id/f0/2c537cadee34be9546f27bccd9a50162197872.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.dwz/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/debug/.dwz/x86_64-linux-gnu/ -rw-r--r-- root/root 610360 2023-12-23 22:34 ./usr/lib/debug/.dwz/x86_64-linux-gnu/trinityrnaseq.debug drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/doc/ lrwxrwxrwx root/root 0 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq-dbgsym -> trinityrnaseq trinityrnaseq-examples_2.15.1+dfsg-5_amd64.deb ---------------------------------------------- new Debian package, version 2.0. size 299849540 bytes: control archive=11732 bytes. 1059 bytes, 22 lines control 55148 bytes, 410 lines md5sums Package: trinityrnaseq-examples Source: trinityrnaseq Version: 2.15.1+dfsg-5 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 449931 Depends: perl:any, r-base-core Recommends: trinityrnaseq Section: science Priority: optional Homepage: https://github.com/trinityrnaseq/trinityrnaseq Description: RNA-Seq De novo Assembly common example and testing files Trinity represents a novel method for the efficient and robust de novo reconstruction of transcriptomes from RNA-seq data. Trinity combines three independent software modules: Inchworm, Chrysalis, and Butterfly, applied sequentially to process large volumes of RNA-seq reads. Trinity partitions the sequence data into many individual de Bruijn graphs, each representing the transcriptional complexity at a given gene or locus, and then processes each graph independently to extract full-length splicing isoforms and to tease apart transcripts derived from paralogous genes. . This package contains testing & example files. drwxr-xr-x root/root 0 2023-12-23 22:34 ./ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/ lrwxrwxrwx root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/sample_data -> ../../share/trinityrnaseq/sample_data drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/doc/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq-examples/ -rw-r--r-- root/root 2321 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq-examples/changelog.Debian.gz -rw-r--r-- root/root 24236 2023-02-05 18:46 ./usr/share/doc/trinityrnaseq-examples/changelog.gz -rw-r--r-- root/root 23659 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq-examples/copyright drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/ drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/ -rw-r--r-- root/root 240 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/Makefile drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/ -rw-r--r-- root/root 660 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/Makefile -rw-r--r-- root/root 128 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/README drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ -rwxr-xr-x root/root 209 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/align_reads_via_bowtie.sh -rw-r--r-- root/root 736082 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/bowtie2.sam.aligned.bam drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex01/ -rw-r--r-- root/root 63998 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex01/ex01.IGV.png -rw-r--r-- root/root 1008187 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex01/ex01.reads.left.fq -rw-r--r-- root/root 1008187 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex01/ex01.reads.right.fq -rw-r--r-- root/root 5740 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex01/ex01.refSeq drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/ -rw-r--r-- root/root 9363 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/ex02.refSeq -rw-r--r-- root/root 882572 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/ex2.reads.left.fq -rw-r--r-- root/root 882572 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/ex2.reads.right.fq -rw-r--r-- root/root 63057 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/example2.png -rw-r--r-- root/root 2187409 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/region2.sam -rw-r--r-- root/root 2196203 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex02/region2.sam.adj drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/ -rw-r--r-- root/root 1426 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/ex03.refSeq -rw-r--r-- root/root 530745 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/ex3.reads.left.fq -rw-r--r-- root/root 530745 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/ex3.reads.right.fq -rw-r--r-- root/root 49334 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/example3.png -rw-r--r-- root/root 1310112 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/region3.sam -rw-r--r-- root/root 1315441 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex03/region3.sam.adj drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/ -rw-r--r-- root/root 1242 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/ex04.refSeq -rw-r--r-- root/root 1173573 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/ex4.reads.left.fq -rw-r--r-- root/root 1173573 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/ex4.reads.right.fq -rw-r--r-- root/root 67415 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/example4.png -rw-r--r-- root/root 2936979 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/region4.sam -rw-r--r-- root/root 2948679 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex04/region4.sam.adj drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/ -rw-r--r-- root/root 318554 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/clean.left.fq -rw-r--r-- root/root 325036 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/clean.right.fq -rw-r--r-- root/root 3067 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/ex05.refSeq -rw-r--r-- root/root 350857 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/ex5.reads.left.fq -rw-r--r-- root/root 350857 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/ex5.reads.right.fq -rw-r--r-- root/root 49310 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/example5.png -rw-r--r-- root/root 11236 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/isoform_pair.fasta -rw-r--r-- root/root 313 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/isoform_pair.fasta.Bfly.dot -rw-r--r-- root/root 766 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/isoform_pair.fasta.gmap.bed -rw-r--r-- root/root 6644 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/isoform_pair.fasta.gmap.gff -rw-r--r-- root/root 875784 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/region5.sam -rw-r--r-- root/root 879267 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/region5.sam.adj -rw-r--r-- root/root 141 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/runMe.clean.sh -rw-r--r-- root/root 148 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex05/runMe.sh drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/ -rw-r--r-- root/root 3415 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/ex06.refSeq -rw-r--r-- root/root 572172 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/ex6.reads.left.fq -rw-r--r-- root/root 572172 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/ex6.reads.right.fq -rw-r--r-- root/root 56969 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/example6.png -rw-r--r-- root/root 1395377 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/region6.sam -rw-r--r-- root/root 1400954 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex06/region6.sam.adj drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/ -rw-r--r-- root/root 3710 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/ex07.refSeq -rw-r--r-- root/root 887975 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/ex7.reads.left.fq -rw-r--r-- root/root 887975 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/ex7.reads.right.fq -rw-r--r-- root/root 66560 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/example7.png -rw-r--r-- root/root 2225607 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/region7.sam -rw-r--r-- root/root 2234472 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex07/region7.sam.adj drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/ -rw-r--r-- root/root 2268 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/ex08.refSeq -rw-r--r-- root/root 242850 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/ex8.reads.left.fq -rw-r--r-- root/root 242850 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/ex8.reads.right.fq -rw-r--r-- root/root 74590 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/example8.png -rw-r--r-- root/root 599322 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/region8.sam -rw-r--r-- root/root 601721 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex08/region8.sam.adj drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/ -rw-r--r-- root/root 1305 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/ex09.refSeq -rw-r--r-- root/root 197170 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/ex9.reads.left.fq -rw-r--r-- root/root 197170 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/ex9.reads.right.fq -rw-r--r-- root/root 58933 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/example9.png -rw-r--r-- root/root 488135 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/region9.sam -rw-r--r-- root/root 490101 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/region9.sam.adj -rwxr-xr-x root/root 196 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/ex09/runMe.sh -rw-r--r-- root/root 31536 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/refSeqs.fa -rw-r--r-- root/root 430 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/__indiv_ex_sample_derived/refSeqs.fa.gene_trans_map -rwxr-xr-x root/root 1385 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/cleanme.pl -rw-r--r-- root/root 31536 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/longReads.fa drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/ -rwxr-xr-x root/root 1694 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe.diff_kmer_length.sh -rwxr-xr-x root/root 574 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe.noSeqtk.sh -rwxr-xr-x root/root 1021 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_CuffFly.sh -rwxr-xr-x root/root 1021 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_PasaFly.sh -rwxr-xr-x root/root 390 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_as_DS.sh -rwxr-xr-x root/root 1025 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_bowtie_components.sh -rwxr-xr-x root/root 550 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_docker.sh -rwxr-xr-x root/root 451 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_full_cleanup.sh -rwxr-xr-x root/root 659 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_include_long_reads.sh -rwxr-xr-x root/root 444 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_no_cleanup.sh -rwxr-xr-x root/root 878 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_no_para_iworm.sh -rwxr-xr-x root/root 489 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_no_salmon.sh -rwxr-xr-x root/root 893 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_no_salmon_no_cleanup.sh -rwxr-xr-x root/root 492 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_no_symlinks.sh -rwxr-xr-x root/root 1028 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_parallel_iworm_assembly.sh -rwxr-xr-x root/root 1026 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_piecemeal.sh -rwxr-xr-x root/root 475 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_trin_complete.sh -rwxr-xr-x root/root 516 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_use_bowtie2.sh -rwxr-xr-x root/root 717 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_use_my_ramdisk.sh -rwxr-xr-x root/root 769 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_use_workdir.sh -rwxr-xr-x root/root 355 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_using_Grid_LSF.sh -rwxr-xr-x root/root 374 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_using_Grid_SGE.sh -rwxr-xr-x root/root 625 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_using_Grid_uger.HpcGridRunner.singularity_intra.sh -rwxr-xr-x root/root 421 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_using_Grid_uger.sh -rwxr-xr-x root/root 939 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_wSuperReads.sh -rwxr-xr-x root/root 790 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_w_monitoring.sh -rwxr-xr-x root/root 747 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_with_qual_trimming.sh -rwxr-xr-x root/root 694 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_with_qual_trimming_and_normalization.sh -rwxr-xr-x root/root 1092 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__runMe_with_qual_trimming_and_normalize_libs_separately.sh -rwxr-xr-x root/root 239 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__run_PE_samples_file.min_kmer_cov_3.sh -rwxr-xr-x root/root 190 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__run_PE_samples_file.sh -rwxr-xr-x root/root 190 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__run_SE_samples_file.sh -rwxr-xr-x root/root 876 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__run_abundance_estimation_include_antisense.sh -rwxr-xr-x root/root 1561 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe.singleFQ.sh -rwxr-xr-x root/root 776 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_NO_normalization.sh -rw-r--r-- root/root 222 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_docker.sh -rwxr-xr-x root/root 1076 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_include_normalization.sh -rwxr-xr-x root/root 665 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_lenient_path_extension.sh -rwxr-xr-x root/root 216 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_singularity.intra.sh -rw-r--r-- root/root 194 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_singularity.sh -rwxr-xr-x root/root 249 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/__test_runMe_with_jaccard_clip.sh -rwxr-xr-x root/root 540 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/misc_run_tests/runMe_no_qualTrim.sh -rw-r--r-- root/root 618007 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/reads.left.fa.gz -rw-r--r-- root/root 1251134 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/reads.left.fq.gz -rw-r--r-- root/root 631850 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/reads.right.fa.gz -rw-r--r-- root/root 1272924 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/reads.right.fq.gz -rw-r--r-- root/root 1252769 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/reads2.left.fq.gz -rw-r--r-- root/root 1274455 2023-12-23 22:34 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/reads2.right.fq.gz -rwxr-xr-x root/root 842 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/runMe.sh -rw-r--r-- root/root 97 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/samples.PE.txt -rw-r--r-- root/root 59 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/samples.SE.txt -rwxr-xr-x root/root 96 2023-02-05 18:46 ./usr/share/trinityrnaseq/sample_data/test_Trinity_Assembly/test_FL.sh drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/ -rw-r--r-- root/root 534 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/Makefile -rw-r--r-- root/root 110 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/README.md drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/__regression_tests/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/__regression_tests/test_GraphFromFasta/ -rw-r--r-- root/root 1192251 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/__regression_tests/test_GraphFromFasta/both.fa.gz -rw-r--r-- root/root 159963 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/__regression_tests/test_GraphFromFasta/inchworm.K25.L25.fa.gz -rw-r--r-- root/root 1933 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/__regression_tests/test_GraphFromFasta/iworm_scaffolds.txt.gz -rw-r--r-- root/root 163 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/__regression_tests/test_GraphFromFasta/runMe.sh drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/ -rw-r--r-- root/root 1647 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/Makefile -rwxr-xr-x root/root 366 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/ensure_min_asm.pl -rw-r--r-- root/root 1263300 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/reads.ForRev_1.fastq.gz -rw-r--r-- root/root 1284691 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/reads.ForRev_2.fastq.gz -rw-r--r-- root/root 1251134 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/reads.left.fq.gz -rw-r--r-- root/root 1243779 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/reads.left.stripped.fq.gz -rw-r--r-- root/root 1272924 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/reads.right.fq.gz -rw-r--r-- root/root 1264543 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Assembly_DiffReadFormattings/reads.right.stripped.fq.gz drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/ -rw-r--r-- root/root 1764588 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_ds.10k.left.fq -rw-r--r-- root/root 581715 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_ds.10k.left.fq.gz -rw-r--r-- root/root 1764588 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_ds.10k.right.fq -rw-r--r-- root/root 557587 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_ds.10k.right.fq.gz -rw-r--r-- root/root 1764675 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_hs.10k.left.fq -rw-r--r-- root/root 580021 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_hs.10k.left.fq.gz -rw-r--r-- root/root 1764675 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_hs.10k.right.fq -rw-r--r-- root/root 563866 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_hs.10k.right.fq.gz -rw-r--r-- root/root 1764597 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_log.10k.left.fq -rw-r--r-- root/root 580202 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_log.10k.left.fq.gz -rw-r--r-- root/root 1764597 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_log.10k.right.fq -rw-r--r-- root/root 559783 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_log.10k.right.fq.gz -rw-r--r-- root/root 1764662 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_plat.10k.left.fq -rw-r--r-- root/root 577689 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_plat.10k.left.fq.gz -rw-r--r-- root/root 1764662 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_plat.10k.right.fq -rw-r--r-- root/root 554772 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Sp_plat.10k.right.fq.gz -rw-r--r-- root/root 259708 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta -rw-r--r-- root/root 23793 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gene_trans_map drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/ -rw-r--r-- root/root 22711 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.chromosome -rw-r--r-- root/root 42194 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.chromosome.iit -rw-r--r-- root/root 6 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.chrsubset -rw-r--r-- root/root 39349 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.contig -rw-r--r-- root/root 43870 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.contig.iit -rw-r--r-- root/root 81600 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.genomebits128 -rw-r--r-- root/root 81552 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.genomecomp -rw-r--r-- root/root 8388624 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.ref133offsets64meta -rw-r--r-- root/root 1016848 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.ref133offsets64strm -rw-r--r-- root/root 281792 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.ref133positions -rw-r--r-- root/root 4984 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.sachildexc -rw-r--r-- root/root 856 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.sachildguide1024 -rw-r--r-- root/root 4194312 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.saindex64meta -rw-r--r-- root/root 2423136 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.saindex64strm -rw-r--r-- root/root 543610 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.salcpchilddc -rw-r--r-- root/root 13168 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.salcpexc -rw-r--r-- root/root 852 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.salcpguide1024 -rw-r--r-- root/root 869776 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.sarray -rw-r--r-- root/root 19 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/Trinity.fasta.gmap/Trinity.fasta.gmap.version -rw-r--r-- root/root 567754 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/candidate.Trinity_trans.TMM.EXPR.matrix -rw-r--r-- root/root 513685 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/candidate.Trinity_trans.counts.matrix -rw-r--r-- root/root 144 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/candidate.samples.txt -rw-r--r-- root/root 227786 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/gsnap.cSorted.bam -rw-r--r-- root/root 37000 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/gsnap.cSorted.bam.bai -rw-r--r-- root/root 618007 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/reads.left.fa.gz -rw-r--r-- root/root 1251134 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/reads.left.fq.gz -rw-r--r-- root/root 631850 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/reads.right.fa.gz -rw-r--r-- root/root 1272924 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/reads.right.fq.gz -rw-r--r-- root/root 1252769 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/reads2.left.fq.gz -rw-r--r-- root/root 1274455 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/reads2.right.fq.gz -rw-r--r-- root/root 30564 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DATA/salmon-quasi-trans.isoform.TMM.EXPR.matrix drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/ -rw-r--r-- root/root 2164 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/Makefile -rw-r--r-- root/root 567754 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/Trinity_trans.TMM.EXPR.matrix -rw-r--r-- root/root 482260 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/Trinity_trans.TPM.not_cross_norm -rw-r--r-- root/root 513685 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/Trinity_trans.counts.matrix -rw-r--r-- root/root 52 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/notes -rw-r--r-- root/root 144 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/samples.txt -rw-r--r-- root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/test_PtR_PCA -rwxr-xr-x root/root 1064 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Candida_example/validate_results.pl -rw-r--r-- root/root 264 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Makefile drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/ -rw-r--r-- root/root 623 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/Makefile -rw-r--r-- root/root 479672 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/Trinity_genes.TMM.EXPR.matrix -rw-r--r-- root/root 427684 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/Trinity_genes.counts.matrix -rw-r--r-- root/root 264905 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/Trinity_genes.lengths -rw-r--r-- root/root 6467912 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/Trinotate_report.xls.gene_ontology -rw-r--r-- root/root 100 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/samples.txt -rw-r--r-- root/root 313961 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/trans.seq.lengths.txt -rwxr-xr-x root/root 917 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DE_analysis/Spombe_example/validate_results.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/ -rw-r--r-- root/root 66 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/Makefile -rwxr-xr-x root/root 817 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/cleanMe.pl -rwxr-xr-x root/root 2123 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/compare_dexseq_results.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/ -rw-r--r-- root/root 2445211 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sA_rep1_1.fastq.gz -rw-r--r-- root/root 2445287 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sA_rep1_2.fastq.gz -rw-r--r-- root/root 2431860 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sA_rep2_1.fastq.gz -rw-r--r-- root/root 2427697 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sA_rep2_2.fastq.gz -rw-r--r-- root/root 2443030 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sA_rep3_1.fastq.gz -rw-r--r-- root/root 2444852 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sA_rep3_2.fastq.gz -rw-r--r-- root/root 2424446 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sB_rep1_1.fastq.gz -rw-r--r-- root/root 2422304 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sB_rep1_2.fastq.gz -rw-r--r-- root/root 2419062 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sB_rep2_1.fastq.gz -rw-r--r-- root/root 2418415 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sB_rep2_2.fastq.gz -rw-r--r-- root/root 2441655 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sB_rep3_1.fastq.gz -rw-r--r-- root/root 2441428 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/data/sB_rep3_2.fastq.gz -rw-r--r-- root/root 818940 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/mini.Trinity_fmt.fasta -rw-r--r-- root/root 794820 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/minigenome.fa -rw-r--r-- root/root 1201199 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/minigenome.gtf -rwxr-xr-x root/root 433 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/plot_comparison.Rscript -rwxr-xr-x root/root 1174 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/runMe.sh -rw-r--r-- root/root 354 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/samples.txt -rwxr-xr-x root/root 541 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_DTU/test_for_cor.sh drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/ -rw-r--r-- root/root 1735 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/Makefile drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/ -rw-r--r-- root/root 2081131 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/acanth.E-inputs.gz -rw-r--r-- root/root 1163 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/acanth.ExN50.stats -rw-r--r-- root/root 9776790 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/axolotl.by-gene.E-inputs.gz -rw-r--r-- root/root 11443800 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/axolotl.by-transcript.E-inputs.gz -rw-r--r-- root/root 1177 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/axolotl.gene.ExN50.stats -rw-r--r-- root/root 1203 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/axolotl.transcript.ExN50.stats -rw-r--r-- root/root 3901 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/estimate_transcript_numbers_by_expression.Rmd -rw-r--r-- root/root 1118 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/mouse.50M.ExN50.stats -rw-r--r-- root/root 615417 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_ExN50/more_examples/mouse50M.E-inputs.gz drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/ -rw-r--r-- root/root 298 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Makefile drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/ -rw-r--r-- root/root 8646 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/Rplots.pdf -rw-r--r-- root/root 2964 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/__runGOseq.R -rw-r--r-- root/root 13040 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/diauxic_shift_induced.GOseq.depleted -rw-r--r-- root/root 6336 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/diauxic_shift_induced.GOseq.enriched -rw-r--r-- root/root 2080 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/heatshock.GOseq.depleted -rw-r--r-- root/root 8463 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe/heatshock.GOseq.enriched drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/ -rw-r--r-- root/root 70 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/Makefile -rw-r--r-- root/root 264905 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/Trinity.gene.lengths -rw-r--r-- root/root 479672 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/Trinity_genes.TMM.EXPR.matrix -rw-r--r-- root/root 427684 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/Trinity_genes.counts.matrix -rw-r--r-- root/root 6467912 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/Trinotate_report.xls.gene_ontology -rw-r--r-- root/root 21 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/contrasts.txt -rwxr-xr-x root/root 473 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/runMe.sh -rw-r--r-- root/root 100 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_analyzeDiffExprWithGOseq/samples.txt drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/ -rw-r--r-- root/root 64 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/Makefile -rw-r--r-- root/root 31319 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/Trinity.background -rw-r--r-- root/root 199068 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/Trinity.seq_lengths -rw-r--r-- root/root 16139866 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/Trinotate_report.xls -rw-r--r-- root/root 4656527 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/Trinotate_report.xls.trans.gene_ontology -rwxr-xr-x root/root 890 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/cleanme.pl -rw-r--r-- root/root 6001 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/ds_induced_vs_log.factors -rw-r--r-- root/root 3856 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/hs_induced_vs_log.factors -rwxr-xr-x root/root 461 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/Spombe_runGOseqOnly/runMe.sh drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/from_enrichnet.org/ -rw-r--r-- root/root 2349 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/from_enrichnet.org/Cancer_genes_Futreal2004.ids -rw-r--r-- root/root 697 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/from_enrichnet.org/Parkinsons_disease_Phenopedia2011.ids drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/test_GOplot/ -rw-r--r-- root/root 78603 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/test_GOplot/EC.david -rw-r--r-- root/root 167404 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/test_GOplot/EC.genelist -rw-r--r-- root/root 205 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOSeq_trinotate_pipe/test_GOplot/Makefile drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOplot/ -rw-r--r-- root/root 467 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOplot/Makefile drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOplot/data/ -rw-r--r-- root/root 4639 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOplot/data/Trinity_genes.counts.matrix.log_growth_vs_heatshock.edgeR.DE_results.P0.001_C2.DE.subset -rw-r--r-- root/root 20738 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOplot/data/Trinity_genes.counts.matrix.log_growth_vs_heatshock.edgeR.DE_results.P0.001_C2.DE.subset.GOseq.enriched -rw-r--r-- root/root 6467912 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GOplot/data/Trinotate_report.xls.gene_ontology drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/ -rw-r--r-- root/root 196 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/Makefile -rw-r--r-- root/root 127380 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/SP2.annot.bed.gz -rw-r--r-- root/root 553943 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/SP2.chr.SE.sam.gz -rw-r--r-- root/root 3742318 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/SP2.chr.bam -rw-r--r-- root/root 1736216 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/SP2.chr.fa.gz -rw-r--r-- root/root 19365249 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/chr17.illumina.bam -rw-r--r-- root/root 448855 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/chr17.pbio.bam -rwxr-xr-x root/root 1386 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/cleanme.pl -rw-r--r-- root/root 96306 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/mm9chr17.annotation.bed.gz -rw-r--r-- root/root 27717077 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/mm9chr17.fasta.gz -rw-r--r-- root/root 36329210 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/mm9chr17.tophat.bam drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/ -rwxr-xr-x root/root 874 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/__run_genome-guided_Trinity_use_existing_bam.use_LSF.sh -rwxr-xr-x root/root 803 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/__run_genome-guided_Trinity_use_existing_bam.use_PBS.sh -rwxr-xr-x root/root 644 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/__run_genome-guided_Trinity_use_existing_bam.use_SGE.sh -rwxr-xr-x root/root 336 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/run_Schizo_TrinityGG.SE.sh -rwxr-xr-x root/root 544 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/run_Schizo_TrinityGG.sh -rwxr-xr-x root/root 566 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/run_genome-guided_Trinity.sh -rwxr-xr-x root/root 1068 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/old/run_mouse_TrinityGG.sh -rwxr-xr-x root/root 435 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/run_Schizo_TrinityGG_jaccard_clip.sh -rwxr-xr-x root/root 770 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/run_chr17_GG_wLongreads.sh -rwxr-xr-x root/root 741 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/run_genome-guided_Trinity_use_existing_bam.sh -rwxr-xr-x root/root 427 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/run_small_GG_mutliScaff_test.sh -rw-r--r-- root/root 12479863 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/top100k.Left.fq.gz -rw-r--r-- root/root 12441281 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/top100k.Right.fq.gz -rw-r--r-- root/root 30155 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/top100k.genome.gz -rw-r--r-- root/root 19700965 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_GenomeGuidedTrinity/transAligns.cSorted.bam drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Glimma/ -rw-r--r-- root/root 238 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Glimma/Makefile -rw-r--r-- root/root 704004 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Glimma/my.DE_results -rw-r--r-- root/root 513685 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Glimma/my.counts.matrix -rw-r--r-- root/root 162 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Glimma/samples.txt drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/ -rw-r--r-- root/root 140 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/Makefile -rwxr-xr-x root/root 1164 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/cleanme.pl -rwxr-xr-x root/root 512 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/test_PE_normalization.mult_read_sets.sh -rwxr-xr-x root/root 386 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/test_PE_normalization.sh -rwxr-xr-x root/root 474 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/test_PE_normalization.w_base_cov_stats.sh -rwxr-xr-x root/root 358 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_InSilicoReadNormalization/test_SE_normalization.sh drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Inchworm/ -rw-r--r-- root/root 457374 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Inchworm/jellyfish.kmers.fa.gz -rw-r--r-- root/root 219 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_Inchworm/runMe_MPI.sh drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_LongReads/ -rw-r--r-- root/root 312 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_LongReads/Makefile -rw-r--r-- root/root 25842 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_LongReads/longreads.fa -rw-r--r-- root/root 4439259 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_LongReads/reads_1.fa -rw-r--r-- root/root 4439259 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_LongReads/reads_2.fa drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_PtR/ -rw-r--r-- root/root 1758 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_PtR/Makefile lrwxrwxrwx root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_PtR/candidate.Trinity_trans.TMM.EXPR.matrix -> ../test_DATA/candidate.Trinity_trans.TMM.EXPR.matrix lrwxrwxrwx root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_PtR/candidate.Trinity_trans.counts.matrix -> ../test_DATA/candidate.Trinity_trans.counts.matrix lrwxrwxrwx root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_PtR/candidate.samples.txt -> ../test_DATA/candidate.samples.txt drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/ -rw-r--r-- root/root 119 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/Makefile -rwxr-xr-x root/root 69 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/cleanMe.sh drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/ -rw-r--r-- root/root 260 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/Makefile drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_flush/ -rw-r--r-- root/root 315 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_flush/Makefile -rw-r--r-- root/root 7434 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_flush/S-Lap3.flush.fa -rw-r--r-- root/root 3023 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_flush/st.fasta -rw-r--r-- root/root 504 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_flush/st.gtf.expected_result -rw-r--r-- root/root 228 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_flush/st.gtf.expected_result.sort drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_fstExt/ -rw-r--r-- root/root 372 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_fstExt/Makefile -rw-r--r-- root/root 7450 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_fstExt/S-Lap3.fstExt.fa -rw-r--r-- root/root 662 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_fstExt/st.gtf.expected_result -rw-r--r-- root/root 294 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_fstExt/st.gtf.expected_result.sort -rw-r--r-- root/root 302 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/indiv_tests/S-Lap3_fstExt/st.gtf.expected_result.sort.alt -rw-r--r-- root/root 4673865 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/mouse.10M.altsplice.trin.fa.gz -rwxr-xr-x root/root 296 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_SuperTranscript/runMe.sh drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TPM_weighted_gene_length/ -rw-r--r-- root/root 225 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TPM_weighted_gene_length/Makefile -rw-r--r-- root/root 234314 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TPM_weighted_gene_length/Trinity.fasta -rw-r--r-- root/root 22635 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TPM_weighted_gene_length/Trinity.fasta.gene_trans_map -rw-r--r-- root/root 14291 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TPM_weighted_gene_length/Trinity.fasta.seqlens -rw-r--r-- root/root 28101 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TPM_weighted_gene_length/rsem.isoform.TMM.EXPR.matrix drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TissueSpecificityGraph/ -rw-r--r-- root/root 37622593 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TissueSpecificityGraph/DE_results.tar.gz -rw-r--r-- root/root 539 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TissueSpecificityGraph/Makefile -rw-r--r-- root/root 3467057 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_TissueSpecificityGraph/transcripts.TMM.fpkm.avg_reps.matrix.gz drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/ -rw-r--r-- root/root 1169 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/Makefile -rw-r--r-- root/root 88 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/samples_file.txt -rw-r--r-- root/root 1402193 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/small_1.fq.gz -rw-r--r-- root/root 1657462 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/small_2.fq.gz -rw-r--r-- root/root 254266 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/supertranscripts.fasta -rw-r--r-- root/root 439339 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/supertranscripts.gtf -rw-r--r-- root/root 4870350 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/whitefly_rnaseq_1.fq.gz -rw-r--r-- root/root 5756162 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_VariantCalling/whitefly_rnaseq_2.fq.gz drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/ -rw-r--r-- root/root 435 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/Makefile drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/ -rw-r--r-- root/root 1513 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/Makefile -rwxr-xr-x root/root 965 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/cleanme.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/ -rw-r--r-- root/root 178 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/drosoph_denovo.samples.txt -rw-r--r-- root/root 257 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/drosoph_ref.samples.txt -rw-r--r-- root/root 254 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/mouse_denovo.samples.txt -rw-r--r-- root/root 386 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/mouse_ref.samples.txt -rw-r--r-- root/root 279 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/schizo_denovo.samples.txt -rw-r--r-- root/root 334 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/schizo_ref.samples.txt -rw-r--r-- root/root 163 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/test_Drosoph_denovo.sh -rw-r--r-- root/root 158 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/test_Drosoph_ref.sh -rw-r--r-- root/root 203 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/test_Mouse_denovo.sh -rw-r--r-- root/root 208 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/test_Mouse_ref.sh -rw-r--r-- root/root 213 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/test_Schizo_denovo.sh -rw-r--r-- root/root 154 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/misc_tests/test_Schizo_ref.sh -rw-r--r-- root/root 395 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION/samples.txt drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/ -rw-r--r-- root/root 1307 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/Makefile -rwxr-xr-x root/root 708 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/cleanme.pl -rw-r--r-- root/root 426 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/PAIRED_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/samples.txt drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/ -rw-r--r-- root/root 1160 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/Makefile -rwxr-xr-x root/root 966 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/cleanme.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/ -rw-r--r-- root/root 107 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/drosoph_denovo.samples.txt -rw-r--r-- root/root 187 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/drosoph_ref.samples.txt -rw-r--r-- root/root 152 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/mouse_denovo.samples.txt -rw-r--r-- root/root 284 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/mouse_ref.samples.txt -rw-r--r-- root/root 165 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/schizo_denovo.samples.txt -rw-r--r-- root/root 221 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/schizo_ref.samples.txt -rw-r--r-- root/root 145 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/test_Drosoph_denovo.sh -rw-r--r-- root/root 158 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/test_Drosoph_ref.sh -rw-r--r-- root/root 185 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/test_Mouse_denovo.sh -rw-r--r-- root/root 208 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/test_Mouse_ref.sh -rw-r--r-- root/root 195 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/test_Schizo_denovo.sh -rw-r--r-- root/root 154 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/misc_tests/test_Schizo_ref.sh -rw-r--r-- root/root 241 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION/samples.txt drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/ -rw-r--r-- root/root 1301 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/Makefile -rwxr-xr-x root/root 707 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/cleanme.pl -rw-r--r-- root/root 273 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/SINGLE_END_ABUNDANCE_ESTIMATION_via_samples_file_direct/samples.txt -rwxr-xr-x root/root 3239 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/align_and_estimate_tester.pl -rw-r--r-- root/root 1105438 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/log.out -rwxr-xr-x root/root 138 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/pairs.Rscript -rwxr-xr-x root/root 501 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_align_and_estimate_abundance/plot_paired_comparisons.Rscript drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_filter_low_expr/ -rw-r--r-- root/root 709 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_filter_low_expr/Makefile -rw-r--r-- root/root 30572 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_filter_low_expr/kallisto-trans.TMM.EXPR.matrix drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_full_edgeR_pipeline/ -rw-r--r-- root/root 1375 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_full_edgeR_pipeline/Makefile -rwxr-xr-x root/root 935 2023-12-23 22:34 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_full_edgeR_pipeline/cleanme.pl -rw-r--r-- root/root 401 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_full_edgeR_pipeline/samples_n_reads_decribed.txt drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_profiling_report/ -rw-r--r-- root/root 226 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_profiling_report/Makefile drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_profiling_report/ex1/ -rw-r--r-- root/root 481412 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_profiling_report/ex1/collectl.dat drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_profiling_report/ex2/ -rw-r--r-- root/root 55045 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_profiling_report/ex2/collectl.dat drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/ -rw-r--r-- root/root 335 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/Makefile -rw-r--r-- root/root 7344186 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/gene_to_trans.txt -rwxr-xr-x root/root 360 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/plot_comparison.Rscript -rw-r--r-- root/root 156 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/quant_files.list drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188021/ -rw-r--r-- root/root 282 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188021/cmd_info.json -rw-r--r-- root/root 7903555 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188021/quant.sf drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188088/ -rw-r--r-- root/root 282 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188088/cmd_info.json -rw-r--r-- root/root 7683186 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188088/quant.sf drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188288/ -rw-r--r-- root/root 282 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188288/cmd_info.json -rw-r--r-- root/root 7779817 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188288/quant.sf drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188297/ -rw-r--r-- root/root 282 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188297/cmd_info.json -rw-r--r-- root/root 7719771 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188297/quant.sf drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188329/ -rw-r--r-- root/root 282 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188329/cmd_info.json -rw-r--r-- root/root 7828783 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188329/quant.sf drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188356/ -rw-r--r-- root/root 282 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188356/cmd_info.json -rw-r--r-- root/root 7853925 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/salmon/ERR188356/quant.sf -rwxr-xr-x root/root 904 2023-02-05 18:46 ./usr/share/trinityrnaseq/trinity_ext_sample_data/test_tximport/tximport_compare.Rscript trinityrnaseq_2.15.1+dfsg-5_amd64.deb ------------------------------------- new Debian package, version 2.0. size 1720676 bytes: control archive=16792 bytes. 1724 bytes, 20 lines control 52338 bytes, 522 lines md5sums Package: trinityrnaseq Version: 2.15.1+dfsg-5 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 7455 Depends: libc6 (>= 2.38), libgcc-s1 (>= 3.0), libgomp1 (>= 6), libhts3t64 (>= 1.17), libstdc++6 (>= 13.1), zlib1g (>= 1:1.1.4), perl:any, jaligner, libgetopt-java, libjung-free-java, bowtie, bowtie2, libwww-perl, default-jre-headless, samtools, jellyfish, r-base-core, rsem, berkeley-express, trimmomatic, parafly, ncbi-blast+, python3, liburi-perl, python3-htseq, subread, kallisto Recommends: curl, trinityrnaseq-examples, picard-tools, tabix, gmap, salmon, rna-star, hisat2, r-cran-tidyverse, r-cran-readr, r-bioc-edger, r-bioc-deseq2, r-bioc-rots, r-cran-cluster, r-cran-fastcluster, r-bioc-ctc, r-bioc-goseq, r-cran-goplot, r-cran-gplots, r-bioc-dexseq, r-cran-ape, r-bioc-biobase, r-bioc-qvalue, r-cran-argparse, r-cran-kernsmooth, python3-numpy, python3-hisat2 Suggests: collectl, transdecoder, r-bioc-tximport, r-bioc-tximportdata Section: science Priority: optional Homepage: https://github.com/trinityrnaseq/trinityrnaseq Description: RNA-Seq De novo Assembly Trinity represents a novel method for the efficient and robust de novo reconstruction of transcriptomes from RNA-seq data. Trinity combines three independent software modules: Inchworm, Chrysalis, and Butterfly, applied sequentially to process large volumes of RNA-seq reads. Trinity partitions the sequence data into many individual de Bruijn graphs, each representing the transcriptional complexity at a given gene or locus, and then processes each graph independently to extract full-length splicing isoforms and to tease apart transcripts derived from paralogous genes. drwxr-xr-x root/root 0 2023-12-23 22:34 ./ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/bin/ -rwxr-xr-x root/root 400080 2023-12-23 22:34 ./usr/bin/BubbleUpClustering -rwxr-xr-x root/root 371112 2023-12-23 22:34 ./usr/bin/Chrysalis -rwxr-xr-x root/root 276904 2023-12-23 22:34 ./usr/bin/CreateIwormFastaBundle -rwxr-xr-x root/root 158400 2023-12-23 22:34 ./usr/bin/FastaToDeBruijn -rwxr-xr-x root/root 424656 2023-12-23 22:34 ./usr/bin/GraphFromFasta -rwxr-xr-x root/root 375472 2023-12-23 22:34 ./usr/bin/QuantifyGraph -rwxr-xr-x root/root 338608 2023-12-23 22:34 ./usr/bin/ReadsToTranscripts -rwxr-xr-x root/root 148 2023-12-23 22:34 ./usr/bin/Trinity -rwxr-xr-x root/root 121536 2023-12-23 22:34 ./usr/bin/fastaToKmerCoverageStats -rwxr-xr-x root/root 199360 2023-12-23 22:34 ./usr/bin/inchworm drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/ drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/ -rwxr-xr-x root/root 1041 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/DE_graph_to_dot.pl -rwxr-xr-x root/root 3862 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/DTE_to_DTU.pl -rwxr-xr-x root/root 2993 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/GOplot.Rscript -rwxr-xr-x root/root 3203 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/Glimma.Trinity.Rscript -rwxr-xr-x root/root 89374 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/PtR drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/ -rw-r--r-- root/root 3434 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/edgeR.TMM.minimal.R -rw-r--r-- root/root 1281 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/edgeR_funcs.R -rw-r--r-- root/root 930 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/get_cluster_info.R -rw-r--r-- root/root 22183 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/heatmap.3.R -rw-r--r-- root/root 788 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/jaccard_distance.R -rw-r--r-- root/root 585 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/manually_define_clusters.R -rw-r--r-- root/root 2707 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/misc_rnaseq_funcs.R -rw-r--r-- root/root 6064 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/pairs3.R -rw-r--r-- root/root 1493 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/rnaseq_plot_funcs.R -rw-r--r-- root/root 1767 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/test.heatmap.3.R drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/tests/ -rw-r--r-- root/root 688 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/tests/test_heatmap_w_pca.R -rw-r--r-- root/root 4010 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/R/vioplot2.R -rwxr-xr-x root/root 858 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/ROKU.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/TissueEnrichment/ -rwxr-xr-x root/root 1041 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/TissueEnrichment/DE_graph_to_dot.pl -rwxr-xr-x root/root 5150 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/TissueEnrichment/DE_results_to_pairwise_summary.pl -rw-r--r-- root/root 338 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/TissueEnrichment/README.md -rwxr-xr-x root/root 926 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/TissueEnrichment/group_isoforms_by_tissue_enrichment.pl -rwxr-xr-x root/root 8406 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/TissueEnrichment/pairwise_DE_summary_to_DE_classification.pl -rwxr-xr-x root/root 1714 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/add_annot_to_trans_id.pl -rw-r--r-- root/root 2729 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/add_annotations_to_GO_and_lengths_file.R -rwxr-xr-x root/root 1071 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/add_blastx_hit_to_trinity_id.pl -rwxr-xr-x root/root 19473 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/analyze_diff_expr.pl -rwxr-xr-x root/root 1019 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/assign_tissue_specific.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/ drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/Islam_scde_data/ -rw-r--r-- root/root 1461097 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/Islam_scde_data/es.mef.fpkm.matrix -rw-r--r-- root/root 119452 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/MLF_ESC_NPC.cuff.genes.fpkm.matrix.gz -rwxr-xr-x root/root 675 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/cleanme.pl -rw-r--r-- root/root 139 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/orig.samples.txt -rwxr-xr-x root/root 1316 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/runMe.sh -rw-r--r-- root/root 118 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cluster_sample_data/samples.txt -rwxr-xr-x root/root 5922 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/compare_gene_trans_DE_ranks.pl -rwxr-xr-x root/root 3836 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/cut_tree_into_clusters.pl -rwxr-xr-x root/root 6864 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/define_clusters_by_cutting_tree.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/deprecated/ -rwxr-xr-x root/root 6981 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/deprecated/prep_n_run_GOplot.pl -rwxr-xr-x root/root 3931 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/diff_expr_analysis_to_heatmap_html.pl -rwxr-xr-x root/root 5992 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/diff_express.cgi -rwxr-xr-x root/root 3286 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/downsample_count_matrix.pl -rwxr-xr-x root/root 3884 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/extract_GO_enriched_genes.pl -rwxr-xr-x root/root 1040 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/filter_diff_expr.pl -rwxr-xr-x root/root 515 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/filter_matrix_min_sum_rowcounts.pl -rwxr-xr-x root/root 1858 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/get_tissue_enriched_DE_one_vs_all.pl -rwxr-xr-x root/root 502 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/get_transcript_lengths.pl -rwxr-xr-x root/root 6461 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/identify_diff_isoform_splicing.pl -rwxr-xr-x root/root 954 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/log2_transform_matrix.pl -rwxr-xr-x root/root 1065 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/log2_transform_median_center_fpkm_matrix.pl -rwxr-xr-x root/root 2997 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/matrix_to_gene_plots.pl -rwxr-xr-x root/root 2201 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/merge_matrices.pl -rwxr-xr-x root/root 491 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/merge_subclusters.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/ -rwxr-xr-x root/root 820 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/DE_pair_counts_to_matrix.pl -rwxr-xr-x root/root 3376 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/EBSeq_to_pairwise_summary.pl -rwxr-xr-x root/root 885 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/add_counts_to_classes.pl -rwxr-xr-x root/root 185 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/class_to_separate_fpkm_matrices.pl -rwxr-xr-x root/root 3297 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/edgeR_to_pairwise_summary.pl -rwxr-xr-x root/root 1780 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/examine_rank_correlation.pl -rwxr-xr-x root/root 1222 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/extract_venn_agree_from_summaries.pl -rwxr-xr-x root/root 3397 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/mmdiff_to_pairwise_summary.pl -rw-r--r-- root/root 1217 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/notes -rwxr-xr-x root/root 8377 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/pairwise_DE_summary_to_DE_classification.pl -rwxr-xr-x root/root 1165 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/venn_pairwise_summaries.pair_stats.pl -rwxr-xr-x root/root 2967 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/pairwise_summaries/venn_pairwise_summaries.pl -rwxr-xr-x root/root 932 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/plot_all_DE_MAplots.Rscript -rwxr-xr-x root/root 934 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/plot_all_DE_volcanos.Rscript -rwxr-xr-x root/root 3135 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/plot_expression_patterns.pl -rwxr-xr-x root/root 239 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/plot_log2FC_hist.Rscript -rwxr-xr-x root/root 8656 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/prune_isoforms_fasta.pl -rwxr-xr-x root/root 1915 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/prune_isoforms_gtf.pl -rwxr-xr-x root/root 1194 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/rank_roku_by_expr.pl -rwxr-xr-x root/root 3347 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/remove_batch_effects_from_count_matrix.pl -rwxr-xr-x root/root 1343 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/rename_matrix_column_labels.pl -rwxr-xr-x root/root 1327 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/rename_matrix_feature_identifiers.pl -rwxr-xr-x root/root 4626 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/replicates_to_sample_averages_matrix.pl -rwxr-xr-x root/root 30256 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/run_DE_analysis.pl -rwxr-xr-x root/root 10154 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/run_GOseq.pl -rwxr-xr-x root/root 6940 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/run_TMM_normalization_write_FPKM_matrix.pl -rwxr-xr-x root/root 859 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/stratify_diff_expression.pl -rwxr-xr-x root/root 534 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/subcluster_to_canvasXpress_html.make_index_html.pl -rwxr-xr-x root/root 3614 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/subcluster_to_canvasXpress_html.pl -rwxr-xr-x root/root 1427 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/summarize_diff_expr_across_min_threshold_ranges.pl -rwxr-xr-x root/root 1655 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/DifferentialExpression/validate_UP_subset.Rscript drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/ -rwxr-xr-x root/root 4173 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/FL_trans_analysis_pipeline.pl drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/R/ -rw-r--r-- root/root 1701 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/R/boot.tree.R -rwxr-xr-x root/root 493 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/compute_oracle.pl -rwxr-xr-x root/root 3212 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/count_by_expression_quintile.pl -rwxr-xr-x root/root 3458 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/fusion_comparisons_via_maps_files.pl -rwxr-xr-x root/root 650 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/get_genes_from_maps_file.pl -rwxr-xr-x root/root 2404 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/maps_file_to_paralog_representation.pl -rwxr-xr-x root/root 732 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/oracle_counter.pl -rwxr-xr-x root/root 994 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/tier_gene_trans_alignments.pl -rwxr-xr-x root/root 2002 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/tier_gene_trans_alignments.tiers_to_boxplot.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/util/ -rwxr-xr-x root/root 9358 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/util/blat_full_length_mappings.pl -rwxr-xr-x root/root 1166 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/util/blat_map_filter_with_isoforms.pl -rwxr-xr-x root/root 2599 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/util/blat_psl_to_align_summary_stats.pl -rwxr-xr-x root/root 4521 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/util/blat_query_top_hit_extractor.pl -rwxr-xr-x root/root 5983 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/FL_reconstruction_analysis/util/blat_top_tier_genes.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/AllelicVariants/ -rwxr-xr-x root/root 21121 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/AllelicVariants/VCF_to_annotated_SNP_report.pl -rwxr-xr-x root/root 12435 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/AllelicVariants/run_variant_calling.py drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/AllelicVariants/util/ -rwxr-xr-x root/root 2962 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/AllelicVariants/util/clean_bam.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/DTU/ -rw-r--r-- root/root 81 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/DTU/README.md -rwxr-xr-x root/root 9474 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/DTU/dexseq_wrapper.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/DTU/util/ -rwxr-xr-x root/root 680 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/DTU/util/reformat_featureCounts.pl -rw-r--r-- root/root 269 2023-02-05 18:46 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/README.md -rwxr-xr-x root/root 9248 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/Trinity_gene_splice_modeler.py drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/_misc/ -rwxr-xr-x root/root 1298 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/_misc/aln_before_after.pl -rwxr-xr-x root/root 16622 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/extract_supertranscript_from_reference.py drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/ -rwxr-xr-x root/root 10686 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Compact_graph_partial.py -rwxr-xr-x root/root 4127 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Compact_graph_pruner.py -rwxr-xr-x root/root 11495 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Compact_graph_whole.py -rwxr-xr-x root/root 1245 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/DP_matrix.py -rwxr-xr-x root/root 16077 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Gene_splice_modeler.py -rwxr-xr-x root/root 331 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/GraphCycleException.py -rwxr-xr-x root/root 18029 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Node_alignment.py -rwxr-xr-x root/root 5926 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Node_path.py -rwxr-xr-x root/root 7308 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Splice_model_refiner.py -rw-r--r-- root/root 35 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/TGLOBALS.py -rwxr-xr-x root/root 4497 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/TGraph.py -rwxr-xr-x root/root 9666 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/TNode.py -rwxr-xr-x root/root 2297 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Topological_sort.py -rwxr-xr-x root/root 4280 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Trinity_fasta_parser.py -rwxr-xr-x root/root 624 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/Trinity_util.py -rw-r--r-- root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Analysis/SuperTranscripts/pylib/__init__.py drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/ -rw-r--r-- root/root 3657 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Ascii_genome_illustrator.pm -rw-r--r-- root/root 1110 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/BED_utils.pm -rw-r--r-- root/root 5432 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/BHStats.pm drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/ -rw-r--r-- root/root 8812 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Alignment_segment.pm -rw-r--r-- root/root 31436 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Alternative_splice_comparer.pm -rw-r--r-- root/root 49911 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/CDNA_alignment.pm -rw-r--r-- root/root 11926 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/CDNA_stitcher.pm -rw-r--r-- root/root 3516 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Gene_obj_alignment_assembler.pm -rw-r--r-- root/root 19246 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Genome_based_cDNA_assembler.pm -rw-r--r-- root/root 20319 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Genome_based_cDNA_graph_assembler.pm -rw-r--r-- root/root 2927 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Overlap_assembler.pm -rw-r--r-- root/root 13156 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/PASA_alignment_assembler.pm -rw-r--r-- root/root 89302 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CDNA/Splice_graph_assembler.pm -rw-r--r-- root/root 2032 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CIGAR.pm -rw-r--r-- root/root 1172 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CMD_processor.pm -rw-r--r-- root/root 700 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/COMMON.pm drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CanvasXpress/ -rw-r--r-- root/root 4501 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/CanvasXpress/Heatmap.pm -rw-r--r-- root/root 2000 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/ColorGradient.pm -rw-r--r-- root/root 5700 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/DelimParser.pm -rw-r--r-- root/root 11394 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/EM.pm -rw-r--r-- root/root 6322 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Exons_to_geneobj.pm -rw-r--r-- root/root 4002 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Fasta_reader.pm -rw-r--r-- root/root 2677 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Fasta_retriever.pm -rw-r--r-- root/root 3587 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Fastq_reader.pm -rw-r--r-- root/root 4658 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/GFF3_alignment_utils.pm -rw-r--r-- root/root 8672 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/GFF3_utils.pm -rw-r--r-- root/root 2157 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/GFF_maker.pm -rw-r--r-- root/root 128211 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/GTF.pm -rw-r--r-- root/root 12557 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/GTF_utils.pm -rw-r--r-- root/root 146610 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Gene_obj.pm -rw-r--r-- root/root 1356 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Gene_obj_indexer.pm drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/ -rw-r--r-- root/root 3474 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/AlignGraph.pm -rw-r--r-- root/root 342 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/AlignNode.pm -rw-r--r-- root/root 3738 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/GenericGraph.pm -rw-r--r-- root/root 2182 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/GenericNode.pm -rw-r--r-- root/root 23692 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/KmerGraph.pm -rw-r--r-- root/root 3268 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/KmerNode.pm -rw-r--r-- root/root 5249 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/ReadCoverageGraph.pm -rw-r--r-- root/root 3037 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/ReadCoverageNode.pm -rw-r--r-- root/root 345 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/ReadManager.pm -rw-r--r-- root/root 992 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/ReadTracker.pm -rw-r--r-- root/root 6812 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/SAM_entry.pm -rw-r--r-- root/root 1123 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/SAM_reader.pm -rw-r--r-- root/root 859 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/SAM_to_AlignGraph.pm -rw-r--r-- root/root 24180 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/StringGraph.pm -rw-r--r-- root/root 3270 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/KmerGraphLib/StringNode.pm -rw-r--r-- root/root 2516 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Ktree.pm -rw-r--r-- root/root 9884 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Longest_orf.pm -rw-r--r-- root/root 17914 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Nuc_translator.pm -rw-r--r-- root/root 6685 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Overlap_info.pm -rw-r--r-- root/root 4430 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Overlap_piler.pm -rw-r--r-- root/root 5204 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/PSL_parser.pm -rw-r--r-- root/root 5620 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Pipeliner.pm -rw-r--r-- root/root 742 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Process_cmd.pm -rw-r--r-- root/root 11665 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/SAM_entry.pm -rw-r--r-- root/root 1625 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/SAM_reader.pm drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Simulate/ -rw-r--r-- root/root 8798 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Simulate/Uniform_Read_Generator.pm -rw-r--r-- root/root 1813 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/SingleLinkageClusterer.pm -rw-r--r-- root/root 6531 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/Thread_helper.pm -rw-r--r-- root/root 3701 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/TiedHash.pm -rw-r--r-- root/root 2742 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/VCF_parser.pm -rw-r--r-- root/root 3769 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/WigParser.pm -rwxr-xr-x root/root 1133 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/overlapping_nucs.ph -rwxr-xr-x root/root 594 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/test_Fasta_retriever.pl -rwxr-xr-x root/root 520 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/test_htc_gridrunner_LSF.pl -rwxr-xr-x root/root 559 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PerlLib/test_htc_gridrunner_SGE.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PyLib/ -rwxr-xr-x root/root 2702 2023-12-23 22:34 ./usr/lib/trinityrnaseq/PyLib/Pipeliner.py -rwxr-xr-x root/root 151747 2023-12-23 22:34 ./usr/lib/trinityrnaseq/Trinity drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/BIN/ -rwxr-xr-x root/root 23528 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/BIN/seqtk-trinity drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/COLLECTL/ -rwxr-xr-x root/root 600 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/COLLECTL/examine_resource_usage_profiling.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/COLLECTL/util/ -rwxr-xr-x root/root 7515 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/COLLECTL/util/collectl_dat_to_time_matrix.py -rwxr-xr-x root/root 1425 2023-02-05 18:46 ./usr/lib/trinityrnaseq/trinity-plugins/COLLECTL/util/plot_time_vs_resource.Rscript drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/DEXseq_util/ -rwxr-xr-x root/root 6237 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/DEXseq_util/dexseq_prepare_annotation.py drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/bamsifter/ -rwxr-xr-x root/root 27224 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/bamsifter/bamsifter drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/scaffold_iworm_contigs/ -rwxr-xr-x root/root 63912 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/scaffold_iworm_contigs/scaffold_iworm_contigs drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/slclust/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/slclust/bin/ -rwxr-xr-x root/root 43336 2023-12-23 22:34 ./usr/lib/trinityrnaseq/trinity-plugins/slclust/bin/slclust drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/ -rwxr-xr-x root/root 9082 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/N50stats.pl -rw-r--r-- root/root 5246 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/README -rw-r--r-- root/root 7056 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/TRINITY.CONFIG.template -rwxr-xr-x root/root 2234 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/pbs_check.pl -rwxr-xr-x root/root 893 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/trinity_kill.pl -rwxr-xr-x root/root 699 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_kill.sh -rw-r--r-- root/root 4646 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.cont -rw-r--r-- root/root 6393 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.header -rw-r--r-- root/root 1383 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.p1 -rw-r--r-- root/root 1858 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.p2 -rw-r--r-- root/root 1788 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.p3 -rw-r--r-- root/root 7533 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.p4a -rw-r--r-- root/root 2253 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.p4b -rw-r--r-- root/root 2101 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.p5b -rwxr-xr-x root/root 20085 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/PBS/trinity_pbs.sh drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/R/ -rw-r--r-- root/root 2541 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/R/expression_analysis_lib.R -rw-r--r-- root/root 1935 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/R/get_Poisson_conf_intervals.R -rwxr-xr-x root/root 3852 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/TrinityStats.pl -rwxr-xr-x root/root 11188 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/abundance_estimates_to_matrix.pl -rwxr-xr-x root/root 29532 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/align_and_estimate_abundance.pl -rwxr-xr-x root/root 8010 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/analyze_blastPlus_topHit_coverage.pl -rwxr-xr-x root/root 9564 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/filter_low_expr_transcripts.pl -rwxr-xr-x root/root 29437 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/insilico_read_normalization.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Artemis/ -rwxr-xr-x root/root 1365 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Artemis/join_multi_wig_to_graph_plot.pl -rwxr-xr-x root/root 1690 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/ButterflyFastaToGraphDot.pl -rwxr-xr-x root/root 2286 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/HiCpipe_nameSortedSam_to_raw.pl -rwxr-xr-x root/root 8801 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Monarch drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Monarch_util/ -rwxr-xr-x root/root 1876 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Monarch_util/generate_gene_alt_splicing_graphs.pl -rwxr-xr-x root/root 1317 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Monarch_util/generate_trans_graphs.pl -rwxr-xr-x root/root 878 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/N50.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/PerlLib/ -rw-r--r-- root/root 11079 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/PerlLib/SegmentGraph.pm -rwxr-xr-x root/root 1032 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_coordsorted_max_reads_per_position.pl -rwxr-xr-x root/root 3567 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_intron_extractor.pl -rwxr-xr-x root/root 7678 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_nameSorted_to_uniq_count_stats.pl -rwxr-xr-x root/root 1962 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_pair_to_bed.pl -rwxr-xr-x root/root 7552 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_show_alignment.pl -rwxr-xr-x root/root 4139 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_show_alignment.summarize_stats.pl -rwxr-xr-x root/root 4412 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_sortAny_to_count_stats.pl -rwxr-xr-x root/root 1013 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_toString.pl -rwxr-xr-x root/root 1460 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_to_bed.pl -rwxr-xr-x root/root 683 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_to_fasta.pl -rwxr-xr-x root/root 5168 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SAM_to_gff3.minimap2.pl -rw-r--r-- root/root 77 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/SRA_to_fastq.notes -rwxr-xr-x root/root 1665 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/SRA_to_fastq.pl -rwxr-xr-x root/root 1074 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/STAR_align_log_parser.py drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/TEST_SUPPORT/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/TEST_SUPPORT/BFLY_TESTING/ -rwxr-xr-x root/root 791 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/TEST_SUPPORT/BFLY_TESTING/graph_out_to_bfly_cmd.pl -rwxr-xr-x root/root 4761 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/TPM_weighted_gene_length.py -rwxr-xr-x root/root 4881 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/TophatCufflinksWrapper.pl -rwxr-xr-x root/root 9618 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Trinity_genome_aligned_gff3_to_regrouped_genes_gtf.pl -rwxr-xr-x root/root 1955 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/Trinity_node_seq_extractor.pl -rwxr-xr-x root/root 4606 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/acc_list_to_fasta_entries.pl -rwxr-xr-x root/root 36119 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/alexie_analyze_blast.pl -rwxr-xr-x root/root 1257 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/align_reads_launch_igv.pl -rwxr-xr-x root/root 2177 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/allele_simulator.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/alt_GG_read_partitioning_JCornish/ -rwxr-xr-x root/root 1605 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/alt_GG_read_partitioning_JCornish/genwig.sh -rw-r--r-- root/root 2318 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/alt_GG_read_partitioning_JCornish/genwig2.py drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/altsplice_simulation_toolkit/ -rwxr-xr-x root/root 795 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/altsplice_simulation_toolkit/sim_single_bubble.pl -rwxr-xr-x root/root 2673 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/analyze_blastPlus_topHit_coverage.annotate_details_w_FL_info.pl -rwxr-xr-x root/root 6006 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/analyze_blastPlus_topHit_coverage.by_prioritized_compreh_category.pl -rwxr-xr-x root/root 2155 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/analyze_blastPlus_topHit_coverage.extract_OS.pl -rwxr-xr-x root/root 1274 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/analyze_blastPlus_topHit_coverage.org_matrix.pl -rwxr-xr-x root/root 787 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/average.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/bam_gene_tests/ -rwxr-xr-x root/root 6175 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/bam_gene_tests/extract_bam_reads_per_target_gene.pl -rwxr-xr-x root/root 6073 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/bam_gene_tests/extract_bam_reads_per_target_transcript.pl -rwxr-xr-x root/root 674 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/bam_gene_tests/harvest_transcripts.pl -rwxr-xr-x root/root 1621 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/bam_gene_tests/write_trin_cmds.pl -rwxr-xr-x root/root 4931 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blast_outfmt6_group_segments.pl -rwxr-xr-x root/root 4429 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blast_outfmt6_group_segments.to_Markov_Clustering.pl -rwxr-xr-x root/root 3030 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blast_outfmt6_group_segments.tophit_coverage.pl -rwxr-xr-x root/root 624 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blastn_wrapper.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/ -rwxr-xr-x root/root 1750 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/blat_sam_add_reads2.pl -rwxr-xr-x root/root 2658 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/blat_to_sam.pl -rwxr-xr-x root/root 3072 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/blat_top_hit_extractor.pl -rwxr-xr-x root/root 7678 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/process_BLAT_alignments.pl -rwxr-xr-x root/root 7113 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/pslx_to_gff3.pl -rwxr-xr-x root/root 736 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/run_BLAT_shortReads.pl -rwxr-xr-x root/root 2421 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/blat_util/top_blat_sam_extractor.pl -rwxr-xr-x root/root 5590 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/capture_orig_n_unmapped_reads.pl -rwxr-xr-x root/root 220 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/cat_require_newlines.pl -rwxr-xr-x root/root 1376 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/cdhit_examine_isoforms.pl -rwxr-xr-x root/root 751 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/cdna_fasta_file_to_transcript_gtf.pl -rwxr-xr-x root/root 1005 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/check_chrysalis_graph_reciprocal_edges.pl -rwxr-xr-x root/root 1451 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/check_fastQ_pair_ordering.pl -rwxr-xr-x root/root 489 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/chrys_graph_to_dot.pl -rwxr-xr-x root/root 3760 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/collate_fqs.pl -rwxr-xr-x root/root 2795 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/combined_nameSorted_to_dup_pairs_removed.pl -rwxr-xr-x root/root 1333 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/compare_FL_stats.pl -rwxr-xr-x root/root 1878 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/compare_bflies.pl -rwxr-xr-x root/root 4101 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/component_to_graph_dot.pl -rwxr-xr-x root/root 4707 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/contig_ExN50_statistic.pl -rwxr-xr-x root/root 682 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/convert_fasta_identifiers_for_FL_analysis.pl -rwxr-xr-x root/root 1720 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/count_N50_given_MIN_FPKM_threshold.pl -rwxr-xr-x root/root 766 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/count_features_given_MIN_FPKM_threshold.pl -rwxr-xr-x root/root 665 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/count_iso_per_gene_dist.pl -rwxr-xr-x root/root 874 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/count_matrix_features_given_MIN_TPM_threshold.pl -rwxr-xr-x root/root 345 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/count_number_fasta_seqs.pl -rwxr-xr-x root/root 1087 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/count_trans_per_component.pl -rwxr-xr-x root/root 1659 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/decode_SAM_flag_value.pl -rwxr-xr-x root/root 2070 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/describe_SAM_read_flag_info.pl -rwxr-xr-x root/root 2474 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/determine_RF_strand_specificity.pl -rwxr-xr-x root/root 919 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/ensure_paired_end_bam_file.pl -rwxr-xr-x root/root 2410 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/examine_iworm_FL_across_threads.pl -rwxr-xr-x root/root 2751 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/examine_strand_specificity.pl -rwxr-xr-x root/root 2304 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/examine_weldmer_halves.pl -rwxr-xr-x root/root 6605 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/extract_fastQ_pairings.pl -rwxr-xr-x root/root 2663 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fan_out_fasta_seqs_to_indiv_files.pl -rwxr-xr-x root/root 736 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastQ_append_acc.pl -rwxr-xr-x root/root 2456 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastQ_rand_subset.SE.reservoir_sampling_reqiures_high_mem.pl -rwxr-xr-x root/root 2725 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastQ_rand_subset.pl -rwxr-xr-x root/root 3395 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastQ_rand_subset.reservoir_sampling_reqiures_high_mem.pl -rwxr-xr-x root/root 641 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastQ_top_N_records.pl -rwxr-xr-x root/root 447 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_file_reformatter.pl -rwxr-xr-x root/root 541 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_filter_by_min_length.pl -rwxr-xr-x root/root 676 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_remove_duplicates.pl -rwxr-xr-x root/root 496 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_seq_length.pl -rwxr-xr-x root/root 3233 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_to_cmd_generator.pl -rwxr-xr-x root/root 623 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_to_tab.pl -rwxr-xr-x root/root 615 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fasta_write_sense_n_anti.pl -rwxr-xr-x root/root 1575 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastq_cleaner.pl -rwxr-xr-x root/root 1294 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastq_interleave_pairs.pl -rwxr-xr-x root/root 2148 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastq_merge_sorted_tab_lists.pl -rwxr-xr-x root/root 6740 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastq_stats.pl -rwxr-xr-x root/root 1186 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/fastq_unweave_pairs.pl -rwxr-xr-x root/root 1124 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/filter_out_accs_from_fasta.pl -rwxr-xr-x root/root 7985 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/filter_similar_seqs_expr_and_strand_aware.pl -rwxr-xr-x root/root 4602 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/flattened_gff_n_genome_to_Trinity_emulator.pl -rwxr-xr-x root/root 1181 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/frag_boundary_to_wig.pl -rwxr-xr-x root/root 467 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/frag_to_bed.pl -rwxr-xr-x root/root 1976 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gene_gff3_to_introns.pl -rwxr-xr-x root/root 1995 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gene_to_shared_transcript_content.pl -rwxr-xr-x root/root 3171 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/genome_gff3_to_gene_gff3_partitions.pl -rwxr-xr-x root/root 1515 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/get_GC_content_dist.pl -rwxr-xr-x root/root 1729 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/get_longest_isoform_seq_per_trinity_gene.pl -rwxr-xr-x root/root 644 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/get_path_nodes_from_fasta.pl -rwxr-xr-x root/root 388 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/get_welds_from_chrysals_graphFromFasta_out.pl -rwxr-xr-x root/root 3032 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gff3_file_to_cdna.pl -rwxr-xr-x root/root 6878 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gff3_file_utr_coverage_trimmer.pl -rwxr-xr-x root/root 4596 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gff3_to_genome_feature_base_encoding.parse_SAM.pl -rwxr-xr-x root/root 2539 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gff3_to_genome_feature_base_encoding.pl -rwxr-xr-x root/root 4811 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gmap_gff3_chimera_jaccard_analyzer.pl -rwxr-xr-x root/root 972 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gmap_gff3_to_percent_length_stats.count_mapped_transcripts.pl -rwxr-xr-x root/root 1853 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gmap_gff3_to_percent_length_stats.pl -rwxr-xr-x root/root 1878 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gmap_native_to_format_converter.pl -rwxr-xr-x root/root 1838 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gtf_to_bed_format.pl -rwxr-xr-x root/root 3036 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/gtf_to_introns.pl -rwxr-xr-x root/root 350 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/hicpipe_raw_converter.pl -rwxr-xr-x root/root 4729 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/identify_distal_isoform_variations.pl -rwxr-xr-x root/root 4813 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/illustrate_ref_comparison.pl drwxr-xr-x root/root 0 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/insilico_norm_kmer_hists/ -rw-r--r-- root/root 3407 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/insilico_norm_kmer_hists/kmer_histo.NormMaxKCov50.txt -rw-r--r-- root/root 85416 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/insilico_norm_kmer_hists/kmer_histo.all.txt -rw-r--r-- root/root 423 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/insilico_norm_kmer_hists/plot_me.R -rw-r--r-- root/root 7900 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/insilico_norm_kmer_hists/result.pdf drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/ -rwxr-xr-x root/root 372 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/bam_to_cuff.pl -rwxr-xr-x root/root 404 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/cuff_gtf_to_bed.pl -rwxr-xr-x root/root 389 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/gene_gff3_to_bed_cmds.pl -rwxr-xr-x root/root 713 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/gmap_to_ref.pl -rw-r--r-- root/root 1742 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/notes -rwxr-xr-x root/root 955 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/run_trinity_WITH_LR.pl -rwxr-xr-x root/root 796 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/run_trinity_no_LR.pl -rwxr-xr-x root/root 868 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/sim_reads.pl -rwxr-xr-x root/root 406 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iso_reco_analysis/trans_gff3_to_bed_cmds.pl -rwxr-xr-x root/root 572 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/iworm_welds_to_dot.pl -rwxr-xr-x root/root 2748 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/jaccard_sam_pair_refiner.pl -rwxr-xr-x root/root 825 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/join_any.pl -rwxr-xr-x root/root 824 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/join_by_left_col.pl -rwxr-xr-x root/root 926 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/join_expr_vals_single_table.pl -rwxr-xr-x root/root 964 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/kmer_counter.pl -rwxr-xr-x root/root 6506 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/m8_blastclust.pl -rwxr-xr-x root/root 16745 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/map_gtf_transcripts_to_genome_annots.pl -rwxr-xr-x root/root 3085 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/merge_RSEM_output_to_matrix.pl -rwxr-xr-x root/root 1440 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/merge_blast_n_rsem_results.pl -rwxr-xr-x root/root 884 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/merge_replicate_bams_via_samples_file.pl -rwxr-xr-x root/root 1901 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/merge_rsem_n_express_for_compare.pl -rwxr-xr-x root/root 355 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/mpi_iworm_proc_contigs_to_fa.pl -rwxr-xr-x root/root 1721 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/nameSorted_SAM_to_FastQ.pl -rwxr-xr-x root/root 4031 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/nameSorted_SAM_to_paired_fastq.pl -rwxr-xr-x root/root 553 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/omp_iworm_thread_contigs_to_fa.pl -rwxr-xr-x root/root 436 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/organize_data_table_by_trinity_component.pl -rwxr-xr-x root/root 488 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/pair_up_fastq_files_1_2.pl -rwxr-xr-x root/root 581 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/pair_up_fastq_files_LeftRight.pl -rwxr-xr-x root/root 603 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/pair_up_fastq_files_R1_R2.pl -rwxr-xr-x root/root 1777 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/pairwise_kmer_content_comparer.pl -rwxr-xr-x root/root 886 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/plot_ExN50_statistic.Rscript -rwxr-xr-x root/root 850 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/plot_expressed_gene_dist.pl -rwxr-xr-x root/root 5277 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/plot_strand_specificity_dist_by_quantile.Rscript -rwxr-xr-x root/root 864 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/print.pl -rwxr-xr-x root/root 623 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/print_kmers.pl -rwxr-xr-x root/root 3820 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/process_GMAP_alignments_gff3_chimeras_ok.pl -rwxr-xr-x root/root 3215 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/process_minimap2_alignments.pl -rwxr-xr-x root/root 1969 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/prop_pair_sam_refiner.pl -rwxr-xr-x root/root 4222 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/randomly_mutate_seqs.pl -rwxr-xr-x root/root 3117 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/randomly_sample_PE_fastq.pl -rwxr-xr-x root/root 102 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/remove_cntrl_chars.pl -rwxr-xr-x root/root 1163 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/rename_fasta_accessions_using_Trinotate_annot_mappings.pl -rwxr-xr-x root/root 303 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/row_to_column.pl -rwxr-xr-x root/root 2305 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_DETONATE.pl -rwxr-xr-x root/root 4277 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_GSNAP.pl -rwxr-xr-x root/root 4886 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_HISAT.pl -rwxr-xr-x root/root 4013 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_HISAT2_via_samples_file.pl -rwxr-xr-x root/root 1204 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_HiCpipe_bowtie.pl -rwxr-xr-x root/root 6165 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_STAR.pl -rwxr-xr-x root/root 6719 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_STAR_via_samples_file.pl -rwxr-xr-x root/root 3202 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_Stringtie_via_bam_file_list.pl -rwxr-xr-x root/root 1842 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_TOPHAT.pl -rwxr-xr-x root/root 1861 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_bowtie2.pl -rwxr-xr-x root/root 3251 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_bwa.pl -rwxr-xr-x root/root 1157 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_bwasw_trinity.pl -rwxr-xr-x root/root 1390 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_jellyfish.pl -rwxr-xr-x root/root 1724 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_read_simulator_per_fasta_entry.pl -rwxr-xr-x root/root 2211 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_read_simulator_per_gene.pl -rwxr-xr-x root/root 2101 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/run_trimmomatic_qual_trimming.pl -rwxr-xr-x root/root 4188 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/seqinfo_refseq_to_dot.pl -rwxr-xr-x root/root 209 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/shuffle.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/ -rwxr-xr-x root/root 1020 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/audit_summary_stats.pl -rwxr-xr-x root/root 3547 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/audit_summary_stats.reexamine.pl -rwxr-xr-x root/root 983 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/info_files_to_eval_cmds.pl -rwxr-xr-x root/root 7510 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/partition_target_transcripts.pl -rwxr-xr-x root/root 13012 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/run_Trinity_eval.pl -rwxr-xr-x root/root 174 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/run_Trinity_eval.sh -rwxr-xr-x root/root 3068 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/run_simulate_reads.wgsim.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/util/ -rwxr-xr-x root/root 888 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/util/find_pruned_edges_shouldve_kept.pl -rwxr-xr-x root/root 569 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sim_test_framework/write_simulate_read_commands.pl -rwxr-xr-x root/root 9319 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/simulate_illuminaPE_from_transcripts.pl -rwxr-xr-x root/root 4062 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/simulate_illuminaPE_from_transcripts.wgsim.pl -rwxr-xr-x root/root 23714 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/simulate_reads_sam_and_fa.pl -rwxr-xr-x root/root 763 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sixFrameTranslation.pl -rwxr-xr-x root/root 1173 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/sort_fastq.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/splice_path_analysis/ -rwxr-xr-x root/root 6865 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/splice_path_analysis/assess_intron_path_sensitivity.pl -rwxr-xr-x root/root 1160 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/splice_path_analysis/assess_intron_path_sensitivity.summarizer.pl -rwxr-xr-x root/root 3620 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/splice_path_analysis/diff_splice_paths.pl -rwxr-xr-x root/root 1131 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/splice_path_analysis/intron_barcharter.pl -rwxr-xr-x root/root 425 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/strip_fasta_header.pl -rwxr-xr-x root/root 279 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/tab_to_fastQ.pl -rwxr-xr-x root/root 275 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/tab_to_fasta.pl -rwxr-xr-x root/root 625 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/tblastn_wrapper.pl -rwxr-xr-x root/root 1795 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/testUnlimitStacksize.pl -rwxr-xr-x root/root 4614 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/transcript_coverage_UTR_trimmer.pl -rwxr-xr-x root/root 5808 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/transcript_fasta_to_ORF_pics.pl -rwxr-xr-x root/root 1987 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/transcript_gff3_to_bed.pl -rwxr-xr-x root/root 1497 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/transdecoder_pep_to_false_fusion_finder.pl -rwxr-xr-x root/root 2252 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/trinity_component_distribution.pl -rwxr-xr-x root/root 1723 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/trinity_trans_matrix_to_rep_trans_gene_matrix.pl -rwxr-xr-x root/root 4650 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/misc/try_estimate_TPM_filtering_threshold.Rscript -rwxr-xr-x root/root 2634 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/misc/validate_fastqs.py -rwxr-xr-x root/root 1068 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/retrieve_sequences_from_fasta.pl -rwxr-xr-x root/root 3813 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/sift_bam_max_cov.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/ -rwxr-xr-x root/root 633 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/GG_partitioned_trinity_aggregator.pl -rwxr-xr-x root/root 2033 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_coordSorted_fragment_Read_coverage_writer.pl -rwxr-xr-x root/root 3220 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_coordSorted_fragment_coverage_writer2.pl -rwxr-xr-x root/root 800 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_extract_properly_mapped_pairs.pl -rwxr-xr-x root/root 1227 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_extract_uniquely_mapped_reads.pl -rwxr-xr-x root/root 935 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_filter_out_unmapped_reads.pl -rwxr-xr-x root/root 2595 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_ordered_pair_jaccard.pl -rwxr-xr-x root/root 2147 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_set_transcribed_orient_info.pl -rwxr-xr-x root/root 3767 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_strand_separator.pl -rwxr-xr-x root/root 8754 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/SAM_to_frag_coords.pl -rwxr-xr-x root/root 1311 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/add_LR_reads_to_iworm_bundle.pl -rwxr-xr-x root/root 1172 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/annotate_chrysalis_welds_with_iworm_names.pl -rwxr-xr-x root/root 1581 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/batch_cmds.pl -rwxr-xr-x root/root 8515 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/bowtie2_wrapper.pl -rwxr-xr-x root/root 1269 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/define_SAM_coverage_partitions2.pl -rwxr-xr-x root/root 1468 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/define_coverage_partitions.pl -rwxr-xr-x root/root 4821 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/eXpress_trans_to_gene_results.pl -rwxr-xr-x root/root 2289 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/ensure_coord_sorted_sam.pl -rwxr-xr-x root/root 7750 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/extract_reads_per_partition.pl -rwxr-xr-x root/root 3045 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/fastQ_to_fastA.pl -rwxr-xr-x root/root 2459 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/fastQ_to_tab.pl -rwxr-xr-x root/root 892 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/fasta_find_duplicates.pl -rwxr-xr-x root/root 695 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/fasta_to_tab.pl -rwxr-xr-x root/root 739 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/filter_iworm_by_min_length_or_cov.pl -rwxr-xr-x root/root 2819 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/filter_transcripts_require_min_cov.pl -rwxr-xr-x root/root 2158 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/fragment_coverage_writer.pl -rwxr-xr-x root/root 520 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/get_Trinity_gene_to_trans_map.pl -rwxr-xr-x root/root 4492 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/inchworm_transcript_splitter.pl -rwxr-xr-x root/root 8547 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/iworm_LR_to_scaff_pairs.pl -rwxr-xr-x root/root 1972 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/jaccard_fasta_clipper.pl -rwxr-xr-x root/root 7281 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/jaccard_wig_clipper.pl -rwxr-xr-x root/root 701 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/join_partitions_within_range.pl -rwxr-xr-x root/root 4610 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/kallisto_trans_to_gene_results.pl -rwxr-xr-x root/root 1070 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/merge_pair_and_LR_scaff_links.pl -rwxr-xr-x root/root 4319 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/nbkc_merge_left_right_stats.pl -rwxr-xr-x root/root 2767 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/nbkc_normalize.pl -rwxr-xr-x root/root 18780 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/ordered_fragment_coords_to_jaccard.pl -rwxr-xr-x root/root 1823 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/outfmt6_add_percent_match_length.pl -rwxr-xr-x root/root 6325 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/partition_chrysalis_graphs_n_reads.pl -rwxr-xr-x root/root 3881 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/partitioned_trinity_aggregator.pl -rwxr-xr-x root/root 416 2023-02-05 18:46 ./usr/lib/trinityrnaseq/util/support_scripts/plugin_install_tests.sh -rwxr-xr-x root/root 5821 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/prep_rnaseq_alignments_for_genome_assisted_assembly.pl -rwxr-xr-x root/root 1464 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/print_butterfly_assemblies.pl -rwxr-xr-x root/root 1628 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/process_GMAP_alignments_gff3_chimeras_ok.pl -rwxr-xr-x root/root 568 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/revcomp_fasta.pl -rwxr-xr-x root/root 5289 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/run_TMM_scale_matrix.pl -rwxr-xr-x root/root 2522 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/run_UpperQuartileNormalization_matrix.pl -rwxr-xr-x root/root 1077 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/salmon_runner.pl -rwxr-xr-x root/root 5006 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/salmon_trans_to_gene_results.pl -rwxr-xr-x root/root 8190 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/scaffold_iworm_contigs.pl -rwxr-xr-x root/root 2966 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/segment_GFF_partitions.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/tests/ -rw-r--r-- root/root 2921 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/tests/sample_data_tests.py -rw-r--r-- root/root 5352 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/tests/test_prep.py -rw-r--r-- root/root 12161 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/tests/tests.py -rwxr-xr-x root/root 1187 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/trinity_install_tests.sh -rwxr-xr-x root/root 840 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/trinity_installer.py -rwxr-xr-x root/root 1343 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/wig_clip_to_bed.pl -rwxr-xr-x root/root 1996 2023-12-23 22:34 ./usr/lib/trinityrnaseq/util/support_scripts/write_partitioned_trinity_cmds.pl drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/doc/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq/ -rw-r--r-- root/root 99 2023-02-05 18:46 ./usr/share/doc/trinityrnaseq/README -rw-r--r-- root/root 77 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq/TODO.Debian -rw-r--r-- root/root 2318 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq/changelog.Debian.gz -rw-r--r-- root/root 24236 2023-02-05 18:46 ./usr/share/doc/trinityrnaseq/changelog.gz -rw-r--r-- root/root 23659 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq/copyright -rw-r--r-- root/root 638 2023-12-23 22:34 ./usr/share/doc/trinityrnaseq/run-tests drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/java/ -rw-r--r-- root/root 233486 2023-12-23 22:34 ./usr/share/java/Butterfly-2.15.1.jar lrwxrwxrwx root/root 0 2023-12-23 22:34 ./usr/share/java/Butterfly.jar -> Butterfly-2.15.1.jar drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/man/ drwxr-xr-x root/root 0 2023-12-23 22:34 ./usr/share/man/man1/ -rw-r--r-- root/root 1824 2023-12-23 22:34 ./usr/share/man/man1/Trinity.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not cleaning session: cloned chroot in use +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: amd64 Build Type: full Build-Space: 1428056 Build-Time: 311 Distribution: perl-5.40-throwaway Host Architecture: amd64 Install-Time: 35 Job: /srv/debomatic/incoming/trinityrnaseq_2.15.1+dfsg-5.dsc Machine Architecture: amd64 Package: trinityrnaseq Package-Time: 363 Source-Version: 2.15.1+dfsg-5 Space: 1428056 Status: successful Version: 2.15.1+dfsg-5 -------------------------------------------------------------------------------- Finished at 2024-06-05T11:56:20Z Build needed 00:06:03, 1428056k disk space