sbuild (Debian sbuild) 0.85.10 (30 May 2024) on carme.larted.org.uk +==============================================================================+ | kmer 0~20150903+r2013-9 (amd64) Tue, 10 Sep 2024 16:02:21 +0000 | +==============================================================================+ Package: kmer Version: 0~20150903+r2013-9 Source Version: 0~20150903+r2013-9 Distribution: perl-5.40-throwaway Machine Architecture: amd64 Host Architecture: amd64 Build Architecture: amd64 Build Type: full I: NOTICE: Log filtering will replace 'var/run/schroot/mount/perl-5.40-amd64-debomatic-18a0c2f8-4e94-4c12-9a5b-04267eee819a' with '<>' +------------------------------------------------------------------------------+ | Chroot Setup Commands | +------------------------------------------------------------------------------+ /usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup kmer_0~20150903+r2013-9 perl-5.40-throwaway amd64 ------------------------------------------------------------------------------------------------------------------------ I: Finished running '/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup kmer_0~20150903+r2013-9 perl-5.40-throwaway amd64'. Finished processing commands. -------------------------------------------------------------------------------- I: NOTICE: Log filtering will replace 'build/kmer-npn6y8/resolver-Li9MQ3' with '<>' +------------------------------------------------------------------------------+ | Update chroot | +------------------------------------------------------------------------------+ Get:1 file:/srv/reprepro perl-5.40 InRelease [3042 B] Hit:2 http://deb.debian.org/debian unstable InRelease Hit:3 http://localhost:3142/debian sid InRelease Get:1 file:/srv/reprepro perl-5.40 InRelease [3042 B] Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- /srv/debomatic/incoming/kmer_0~20150903+r2013-9.dsc exists in /srv/debomatic/incoming; copying to chroot I: NOTICE: Log filtering will replace 'build/kmer-npn6y8/kmer-0~20150903+r2013' with '<>' I: NOTICE: Log filtering will replace 'build/kmer-npn6y8' with '<>' +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), dh-exec, dh-sequence-python3, python3-dev, build-essential, fakeroot Filtered Build-Depends: debhelper-compat (= 13), dh-exec, dh-sequence-python3, python3-dev, build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<>/apt_archive/sbuild-build-depends-main-dummy.deb'. Ign:1 copy:/<>/apt_archive ./ InRelease Get:2 copy:/<>/apt_archive ./ Release [609 B] Ign:3 copy:/<>/apt_archive ./ Release.gpg Get:4 copy:/<>/apt_archive ./ Sources [660 B] Get:5 copy:/<>/apt_archive ./ Packages [692 B] Fetched 1961 B in 0s (0 B/s) Reading package lists... Reading package lists... Install main build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following additional packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper dh-autoreconf dh-exec dh-python dh-strip-nondeterminism dwz fakeroot file gettext gettext-base groff-base intltool-debian libarchive-zip-perl libcom-err2 libdebhelper-perl libelf1t64 libexpat1 libexpat1-dev libfakeroot libfile-stripnondeterminism-perl libgssapi-krb5-2 libicu72 libjs-jquery libjs-sphinxdoc libjs-underscore libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 libmagic-mgc libmagic1t64 libnsl2 libpipeline1 libpython3-dev libpython3-stdlib libpython3.12-dev libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 libtirpc-common libtirpc3t64 libtool libuchardet0 libxml2 m4 man-db media-types netbase po-debconf python3 python3-autocommand python3-dev python3-inflect python3-jaraco.context python3-jaraco.functools python3-minimal python3-more-itertools python3-pkg-resources python3-setuptools python3-typeguard python3-typing-extensions python3-zipp python3.12 python3.12-dev python3.12-minimal sensible-utils tzdata zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make flit python3-build python3-installer python3-wheel gettext-doc libasprintf-dev libgettextpo-dev groff krb5-doc krb5-user libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libmail-box-perl python3-doc python3-tk python3-venv python-setuptools-doc python3.12-venv python3.12-doc binfmt-support Recommended packages: curl | wget | lynx libarchive-cpio-perl javascript-common krb5-locales libltdl-dev libmail-sendmail-perl ca-certificates The following NEW packages will be installed: autoconf automake autopoint autotools-dev bsdextrautils debhelper dh-autoreconf dh-exec dh-python dh-strip-nondeterminism dwz fakeroot file gettext gettext-base groff-base intltool-debian libarchive-zip-perl libcom-err2 libdebhelper-perl libelf1t64 libexpat1 libexpat1-dev libfakeroot libfile-stripnondeterminism-perl libgssapi-krb5-2 libicu72 libjs-jquery libjs-sphinxdoc libjs-underscore libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 libmagic-mgc libmagic1t64 libnsl2 libpipeline1 libpython3-dev libpython3-stdlib libpython3.12-dev libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 libtirpc-common libtirpc3t64 libtool libuchardet0 libxml2 m4 man-db media-types netbase po-debconf python3 python3-autocommand python3-dev python3-inflect python3-jaraco.context python3-jaraco.functools python3-minimal python3-more-itertools python3-pkg-resources python3-setuptools python3-typeguard python3-typing-extensions python3-zipp python3.12 python3.12-dev python3.12-minimal sbuild-build-depends-main-dummy sensible-utils tzdata zlib1g-dev 0 upgraded, 74 newly installed, 0 to remove and 0 not upgraded. Need to get 37.5 MB of archives. After this operation, 154 MB of additional disk space will be used. Get:1 copy:/<>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [900 B] Get:2 http://deb.debian.org/debian unstable/main amd64 libpython3.12-minimal amd64 3.12.6-1 [814 kB] Get:3 http://deb.debian.org/debian unstable/main amd64 libexpat1 amd64 2.6.3-1 [105 kB] Get:4 http://deb.debian.org/debian unstable/main amd64 python3.12-minimal amd64 3.12.6-1 [2168 kB] Get:5 http://deb.debian.org/debian unstable/main amd64 python3-minimal amd64 3.12.5-1 [26.7 kB] Get:6 http://deb.debian.org/debian unstable/main amd64 media-types all 10.1.0 [26.9 kB] Get:7 http://deb.debian.org/debian unstable/main amd64 netbase all 6.4 [12.8 kB] Get:8 http://deb.debian.org/debian unstable/main amd64 tzdata all 2024a-4 [255 kB] Get:9 http://deb.debian.org/debian unstable/main amd64 libkrb5support0 amd64 1.21.3-3 [32.5 kB] Get:10 http://deb.debian.org/debian unstable/main amd64 libcom-err2 amd64 1.47.1-1 [22.9 kB] Get:11 http://deb.debian.org/debian unstable/main amd64 libk5crypto3 amd64 1.21.3-3 [79.9 kB] Get:12 http://deb.debian.org/debian unstable/main amd64 libkeyutils1 amd64 1.6.3-3 [8952 B] Get:13 http://deb.debian.org/debian unstable/main amd64 libkrb5-3 amd64 1.21.3-3 [324 kB] Get:14 http://deb.debian.org/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.21.3-3 [136 kB] Get:15 http://deb.debian.org/debian unstable/main amd64 libtirpc-common all 1.3.4+ds-1.3 [10.9 kB] Get:16 http://deb.debian.org/debian unstable/main amd64 libtirpc3t64 amd64 1.3.4+ds-1.3 [82.7 kB] Get:17 http://deb.debian.org/debian unstable/main amd64 libnsl2 amd64 1.3.0-3+b2 [40.3 kB] Get:18 http://deb.debian.org/debian unstable/main amd64 libpython3.12-stdlib amd64 3.12.6-1 [1963 kB] Get:19 http://deb.debian.org/debian unstable/main amd64 python3.12 amd64 3.12.6-1 [669 kB] Get:20 http://deb.debian.org/debian unstable/main amd64 libpython3-stdlib amd64 3.12.5-1 [9588 B] Get:21 http://deb.debian.org/debian unstable/main amd64 python3 amd64 3.12.5-1 [27.6 kB] Get:22 http://deb.debian.org/debian unstable/main amd64 sensible-utils all 0.0.24 [24.8 kB] Get:23 http://deb.debian.org/debian unstable/main amd64 libmagic-mgc amd64 1:5.45-3 [314 kB] Get:24 http://deb.debian.org/debian unstable/main amd64 libmagic1t64 amd64 1:5.45-3 [105 kB] Get:25 http://deb.debian.org/debian unstable/main amd64 file amd64 1:5.45-3 [42.9 kB] Get:26 http://deb.debian.org/debian unstable/main amd64 gettext-base amd64 0.22.5-2 [200 kB] Get:27 http://deb.debian.org/debian unstable/main amd64 libuchardet0 amd64 0.0.8-1+b1 [68.8 kB] Get:28 http://deb.debian.org/debian unstable/main amd64 groff-base amd64 1.23.0-5 [1181 kB] Get:29 http://deb.debian.org/debian unstable/main amd64 bsdextrautils amd64 2.40.2-8 [97.3 kB] Get:30 http://deb.debian.org/debian unstable/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get:31 http://deb.debian.org/debian unstable/main amd64 man-db amd64 2.13.0-1 [1420 kB] Get:32 http://deb.debian.org/debian unstable/main amd64 m4 amd64 1.4.19-4 [287 kB] Get:33 http://deb.debian.org/debian unstable/main amd64 autoconf all 2.72-3 [493 kB] Get:34 http://deb.debian.org/debian unstable/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get:35 http://deb.debian.org/debian unstable/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get:36 http://deb.debian.org/debian unstable/main amd64 autopoint all 0.22.5-2 [723 kB] Get:37 http://deb.debian.org/debian unstable/main amd64 libdebhelper-perl all 13.20 [89.7 kB] Get:38 http://deb.debian.org/debian unstable/main amd64 libtool all 2.4.7-7 [517 kB] Get:39 http://deb.debian.org/debian unstable/main amd64 dh-autoreconf all 20 [17.1 kB] Get:40 http://deb.debian.org/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get:41 http://deb.debian.org/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get:42 http://deb.debian.org/debian unstable/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get:43 http://deb.debian.org/debian unstable/main amd64 libelf1t64 amd64 0.191-2 [188 kB] Get:44 http://deb.debian.org/debian unstable/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get:45 http://deb.debian.org/debian unstable/main amd64 libicu72 amd64 72.1-5 [9396 kB] Get:46 http://deb.debian.org/debian unstable/main amd64 libxml2 amd64 2.12.7+dfsg-3+b1 [671 kB] Get:47 http://deb.debian.org/debian unstable/main amd64 gettext amd64 0.22.5-2 [1601 kB] Get:48 http://deb.debian.org/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get:49 http://deb.debian.org/debian unstable/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get:50 http://deb.debian.org/debian unstable/main amd64 debhelper all 13.20 [915 kB] Get:51 http://deb.debian.org/debian unstable/main amd64 dh-exec amd64 0.30 [25.6 kB] Get:52 http://deb.debian.org/debian unstable/main amd64 python3-autocommand all 2.2.2-3 [13.6 kB] Get:53 http://deb.debian.org/debian unstable/main amd64 python3-more-itertools all 10.4.0-1 [63.7 kB] Get:54 http://deb.debian.org/debian unstable/main amd64 python3-typing-extensions all 4.12.2-2 [73.0 kB] Get:55 http://deb.debian.org/debian unstable/main amd64 python3-typeguard all 4.3.0-1 [36.5 kB] Get:56 http://deb.debian.org/debian unstable/main amd64 python3-inflect all 7.3.1-1 [42.2 kB] Get:57 http://deb.debian.org/debian unstable/main amd64 python3-jaraco.context all 6.0.0-1 [7984 B] Get:58 http://deb.debian.org/debian unstable/main amd64 python3-jaraco.functools all 4.0.2-1 [11.7 kB] Get:59 http://deb.debian.org/debian unstable/main amd64 python3-pkg-resources all 74.1.2-2 [213 kB] Get:60 http://deb.debian.org/debian unstable/main amd64 python3-zipp all 3.20.1-1 [10.2 kB] Get:61 http://deb.debian.org/debian unstable/main amd64 python3-setuptools all 74.1.2-2 [736 kB] Get:62 http://deb.debian.org/debian unstable/main amd64 dh-python all 6.20240824 [109 kB] Get:63 http://deb.debian.org/debian unstable/main amd64 libfakeroot amd64 1.36-1 [29.1 kB] Get:64 http://deb.debian.org/debian unstable/main amd64 fakeroot amd64 1.36-1 [75.1 kB] Get:65 http://deb.debian.org/debian unstable/main amd64 libexpat1-dev amd64 2.6.3-1 [157 kB] Get:66 http://deb.debian.org/debian unstable/main amd64 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB] Get:67 http://deb.debian.org/debian unstable/main amd64 libjs-underscore all 1.13.4~dfsg+~1.11.4-3 [116 kB] Get:68 http://deb.debian.org/debian unstable/main amd64 libjs-sphinxdoc all 7.4.7-3 [158 kB] Get:69 http://deb.debian.org/debian unstable/main amd64 libpython3.12t64 amd64 3.12.6-1 [2147 kB] Get:70 http://deb.debian.org/debian unstable/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1 [919 kB] Get:71 http://deb.debian.org/debian unstable/main amd64 libpython3.12-dev amd64 3.12.6-1 [5127 kB] Get:72 http://deb.debian.org/debian unstable/main amd64 libpython3-dev amd64 3.12.5-1 [9820 B] Get:73 http://deb.debian.org/debian unstable/main amd64 python3.12-dev amd64 3.12.6-1 [506 kB] Get:74 http://deb.debian.org/debian unstable/main amd64 python3-dev amd64 3.12.5-1 [26.2 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 37.5 MB in 0s (164 MB/s) Selecting previously unselected package libpython3.12-minimal:amd64. (Reading database ... 22985 files and directories currently installed.) Preparing to unpack .../libpython3.12-minimal_3.12.6-1_amd64.deb ... Unpacking libpython3.12-minimal:amd64 (3.12.6-1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.6.3-1_amd64.deb ... Unpacking libexpat1:amd64 (2.6.3-1) ... Selecting previously unselected package python3.12-minimal. Preparing to unpack .../python3.12-minimal_3.12.6-1_amd64.deb ... Unpacking python3.12-minimal (3.12.6-1) ... Setting up libpython3.12-minimal:amd64 (3.12.6-1) ... Setting up libexpat1:amd64 (2.6.3-1) ... Setting up python3.12-minimal (3.12.6-1) ... Selecting previously unselected package python3-minimal. (Reading database ... 23305 files and directories currently installed.) Preparing to unpack .../00-python3-minimal_3.12.5-1_amd64.deb ... Unpacking python3-minimal (3.12.5-1) ... Selecting previously unselected package media-types. Preparing to unpack .../01-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../02-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../03-tzdata_2024a-4_all.deb ... Unpacking tzdata (2024a-4) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../04-libkrb5support0_1.21.3-3_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-3) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../05-libcom-err2_1.47.1-1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.1-1) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../06-libk5crypto3_1.21.3-3_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-3) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../07-libkeyutils1_1.6.3-3_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-3) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../08-libkrb5-3_1.21.3-3_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-3) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../09-libgssapi-krb5-2_1.21.3-3_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-3) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../10-libtirpc-common_1.3.4+ds-1.3_all.deb ... Unpacking libtirpc-common (1.3.4+ds-1.3) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../11-libtirpc3t64_1.3.4+ds-1.3_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.4+ds-1.3) ... Selecting previously unselected package libnsl2:amd64. Preparing to unpack .../12-libnsl2_1.3.0-3+b2_amd64.deb ... Unpacking libnsl2:amd64 (1.3.0-3+b2) ... Selecting previously unselected package libpython3.12-stdlib:amd64. Preparing to unpack .../13-libpython3.12-stdlib_3.12.6-1_amd64.deb ... Unpacking libpython3.12-stdlib:amd64 (3.12.6-1) ... Selecting previously unselected package python3.12. Preparing to unpack .../14-python3.12_3.12.6-1_amd64.deb ... Unpacking python3.12 (3.12.6-1) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../15-libpython3-stdlib_3.12.5-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.12.5-1) ... Setting up python3-minimal (3.12.5-1) ... Selecting previously unselected package python3. (Reading database ... 24345 files and directories currently installed.) Preparing to unpack .../00-python3_3.12.5-1_amd64.deb ... Unpacking python3 (3.12.5-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../03-libmagic1t64_1%3a5.45-3_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.45-3_amd64.deb ... Unpacking file (1:5.45-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.22.5-2_amd64.deb ... Unpacking gettext-base (0.22.5-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../06-libuchardet0_0.0.8-1+b1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b1) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-5_amd64.deb ... Unpacking groff-base (1.23.0-5) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.40.2-8_amd64.deb ... Unpacking bsdextrautils (2.40.2-8) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../09-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.13.0-1_amd64.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.22.5-2_all.deb ... Unpacking autopoint (0.22.5-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.20_all.deb ... Unpacking libdebhelper-perl (13.20) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-7_all.deb ... Unpacking libtool (2.4.7-7) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../22-libelf1t64_0.191-2_amd64.deb ... Unpacking libelf1t64:amd64 (0.191-2) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../24-libicu72_72.1-5_amd64.deb ... Unpacking libicu72:amd64 (72.1-5) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../25-libxml2_2.12.7+dfsg-3+b1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg-3+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.22.5-2_amd64.deb ... Unpacking gettext (0.22.5-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.20_all.deb ... Unpacking debhelper (13.20) ... Selecting previously unselected package dh-exec. Preparing to unpack .../30-dh-exec_0.30_amd64.deb ... Unpacking dh-exec (0.30) ... Selecting previously unselected package python3-autocommand. Preparing to unpack .../31-python3-autocommand_2.2.2-3_all.deb ... Unpacking python3-autocommand (2.2.2-3) ... Selecting previously unselected package python3-more-itertools. Preparing to unpack .../32-python3-more-itertools_10.4.0-1_all.deb ... Unpacking python3-more-itertools (10.4.0-1) ... Selecting previously unselected package python3-typing-extensions. Preparing to unpack .../33-python3-typing-extensions_4.12.2-2_all.deb ... Unpacking python3-typing-extensions (4.12.2-2) ... Selecting previously unselected package python3-typeguard. Preparing to unpack .../34-python3-typeguard_4.3.0-1_all.deb ... Unpacking python3-typeguard (4.3.0-1) ... Selecting previously unselected package python3-inflect. Preparing to unpack .../35-python3-inflect_7.3.1-1_all.deb ... Unpacking python3-inflect (7.3.1-1) ... Selecting previously unselected package python3-jaraco.context. Preparing to unpack .../36-python3-jaraco.context_6.0.0-1_all.deb ... Unpacking python3-jaraco.context (6.0.0-1) ... Selecting previously unselected package python3-jaraco.functools. Preparing to unpack .../37-python3-jaraco.functools_4.0.2-1_all.deb ... Unpacking python3-jaraco.functools (4.0.2-1) ... Selecting previously unselected package python3-pkg-resources. Preparing to unpack .../38-python3-pkg-resources_74.1.2-2_all.deb ... Unpacking python3-pkg-resources (74.1.2-2) ... Selecting previously unselected package python3-zipp. Preparing to unpack .../39-python3-zipp_3.20.1-1_all.deb ... Unpacking python3-zipp (3.20.1-1) ... Selecting previously unselected package python3-setuptools. Preparing to unpack .../40-python3-setuptools_74.1.2-2_all.deb ... Unpacking python3-setuptools (74.1.2-2) ... Selecting previously unselected package dh-python. Preparing to unpack .../41-dh-python_6.20240824_all.deb ... Unpacking dh-python (6.20240824) ... Selecting previously unselected package libfakeroot:amd64. Preparing to unpack .../42-libfakeroot_1.36-1_amd64.deb ... Unpacking libfakeroot:amd64 (1.36-1) ... Selecting previously unselected package fakeroot. Preparing to unpack .../43-fakeroot_1.36-1_amd64.deb ... Unpacking fakeroot (1.36-1) ... Selecting previously unselected package libexpat1-dev:amd64. Preparing to unpack .../44-libexpat1-dev_2.6.3-1_amd64.deb ... Unpacking libexpat1-dev:amd64 (2.6.3-1) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../45-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libjs-underscore. Preparing to unpack .../46-libjs-underscore_1.13.4~dfsg+~1.11.4-3_all.deb ... Unpacking libjs-underscore (1.13.4~dfsg+~1.11.4-3) ... Selecting previously unselected package libjs-sphinxdoc. Preparing to unpack .../47-libjs-sphinxdoc_7.4.7-3_all.deb ... Unpacking libjs-sphinxdoc (7.4.7-3) ... Selecting previously unselected package libpython3.12t64:amd64. Preparing to unpack .../48-libpython3.12t64_3.12.6-1_amd64.deb ... Unpacking libpython3.12t64:amd64 (3.12.6-1) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../49-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1) ... Selecting previously unselected package libpython3.12-dev:amd64. Preparing to unpack .../50-libpython3.12-dev_3.12.6-1_amd64.deb ... Unpacking libpython3.12-dev:amd64 (3.12.6-1) ... Selecting previously unselected package libpython3-dev:amd64. Preparing to unpack .../51-libpython3-dev_3.12.5-1_amd64.deb ... Unpacking libpython3-dev:amd64 (3.12.5-1) ... Selecting previously unselected package python3.12-dev. Preparing to unpack .../52-python3.12-dev_3.12.6-1_amd64.deb ... Unpacking python3.12-dev (3.12.6-1) ... Selecting previously unselected package python3-dev. Preparing to unpack .../53-python3-dev_3.12.5-1_amd64.deb ... Unpacking python3-dev (3.12.5-1) ... Selecting previously unselected package sbuild-build-depends-main-dummy. Preparing to unpack .../54-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up libkeyutils1:amd64 (1.6.3-3) ... Setting up libicu72:amd64 (72.1-5) ... Setting up bsdextrautils (2.40.2-8) ... Setting up libmagic-mgc (1:5.45-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libtirpc-common (1.3.4+ds-1.3) ... Setting up libdebhelper-perl (13.20) ... Setting up libmagic1t64:amd64 (1:5.45-3) ... Setting up gettext-base (0.22.5-2) ... Setting up m4 (1.4.19-4) ... Setting up libcom-err2:amd64 (1.47.1-1) ... Setting up file (1:5.45-3) ... Setting up libfakeroot:amd64 (1.36-1) ... Setting up libelf1t64:amd64 (0.191-2) ... Setting up libkrb5support0:amd64 (1.21.3-3) ... Setting up tzdata (2024a-4) ... Current default time zone: 'Etc/UTC' Local time is now: Tue Sep 10 16:02:31 UTC 2024. Universal Time is now: Tue Sep 10 16:02:31 UTC 2024. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up fakeroot (1.36-1) ... update-alternatives: using /usr/bin/fakeroot-sysv to provide /usr/bin/fakeroot (fakeroot) in auto mode Setting up autotools-dev (20220109.1) ... Setting up libexpat1-dev:amd64 (2.6.3-1) ... Setting up autopoint (0.22.5-2) ... Setting up libk5crypto3:amd64 (1.21.3-3) ... Setting up autoconf (2.72-3) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.24) ... Setting up libuchardet0:amd64 (0.0.8-1+b1) ... Setting up netbase (6.4) ... Configuration file '/etc/protocols' ==> File on system created by you or by a script. ==> File also in package provided by package maintainer. ==> Using current old file as you requested. Configuration file '/etc/services' ==> File on system created by you or by a script. ==> File also in package provided by package maintainer. ==> Using current old file as you requested. Setting up libkrb5-3:amd64 (1.21.3-3) ... Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Setting up libxml2:amd64 (2.12.7+dfsg-3+b1) ... Setting up libjs-underscore (1.13.4~dfsg+~1.11.4-3) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up gettext (0.22.5-2) ... Setting up libtool (2.4.7-7) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-3) ... Setting up libjs-sphinxdoc (7.4.7-3) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-5) ... Setting up libtirpc3t64:amd64 (1.3.4+ds-1.3) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libnsl2:amd64 (1.3.0-3+b2) ... Setting up libpython3.12-stdlib:amd64 (3.12.6-1) ... Setting up python3.12 (3.12.6-1) ... Setting up debhelper (13.20) ... Setting up dh-exec (0.30) ... Setting up libpython3.12t64:amd64 (3.12.6-1) ... Setting up libpython3-stdlib:amd64 (3.12.5-1) ... Setting up python3 (3.12.5-1) ... Setting up libpython3.12-dev:amd64 (3.12.6-1) ... Setting up python3-zipp (3.20.1-1) ... Setting up python3-autocommand (2.2.2-3) ... Setting up python3.12-dev (3.12.6-1) ... Setting up python3-typing-extensions (4.12.2-2) ... Setting up python3-more-itertools (10.4.0-1) ... Setting up libpython3-dev:amd64 (3.12.5-1) ... Setting up python3-jaraco.functools (4.0.2-1) ... Setting up python3-jaraco.context (6.0.0-1) ... Setting up python3-typeguard (4.3.0-1) ... Setting up python3-inflect (7.3.1-1) ... Setting up python3-dev (3.12.5-1) ... Setting up python3-pkg-resources (74.1.2-2) ... Setting up python3-setuptools (74.1.2-2) ... Setting up dh-python (6.20240824) ... Setting up sbuild-build-depends-main-dummy (0.invalid.0) ... Processing triggers for libc-bin (2.40-2) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (amd64 included in any all) +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 6.9.7-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.9.7-1 (2024-06-27) amd64 (x86_64) Toolchain package versions: binutils_2.43.1-3 dpkg-dev_1.22.11 g++-13_13.3.0-6 g++-14_14.2.0-4 gcc-13_13.3.0-6 gcc-14_14.2.0-4 libc6-dev_2.40-2 libstdc++-13-dev_13.3.0-6 libstdc++-14-dev_14.2.0-4 libstdc++6_14.2.0-4 linux-libc-dev_6.10.9-1 Package versions: adduser_3.137 apt_2.9.8 autoconf_2.72-3 automake_1:1.16.5-1.3 autopoint_0.22.5-2 autotools-dev_20220109.1 base-files_13.5 base-passwd_3.6.4 bash_5.2.32-1 binutils_2.43.1-3 binutils-common_2.43.1-3 binutils-x86-64-linux-gnu_2.43.1-3 bsdextrautils_2.40.2-8 bsdutils_1:2.40.2-8 build-essential_12.10 bzip2_1.0.8-6 coreutils_9.4-3.1 cpp_4:14.1.0-2 cpp-13_13.3.0-6 cpp-13-x86-64-linux-gnu_13.3.0-6 cpp-14_14.2.0-4 cpp-14-x86-64-linux-gnu_14.2.0-4 cpp-x86-64-linux-gnu_4:14.1.0-2 dash_0.5.12-9 debconf_1.5.87 debhelper_13.20 debian-archive-keyring_2023.4 debianutils_5.20 dh-autoreconf_20 dh-exec_0.30 dh-python_6.20240824 dh-strip-nondeterminism_1.14.0-1 diffutils_1:3.10-1 dirmngr_2.2.43-8+b1 dpkg_1.22.11 dpkg-dev_1.22.11 dwz_0.15-1+b1 eatmydata_131-2 fakeroot_1.36-1 file_1:5.45-3 findutils_4.10.0-3 g++_4:14.1.0-2 g++-13_13.3.0-6 g++-13-x86-64-linux-gnu_13.3.0-6 g++-14_14.2.0-4 g++-14-x86-64-linux-gnu_14.2.0-4 g++-x86-64-linux-gnu_4:14.1.0-2 gcc_4:14.1.0-2 gcc-13_13.3.0-6 gcc-13-base_13.3.0-6 gcc-13-x86-64-linux-gnu_13.3.0-6 gcc-14_14.2.0-4 gcc-14-base_14.2.0-4 gcc-14-x86-64-linux-gnu_14.2.0-4 gcc-x86-64-linux-gnu_4:14.1.0-2 gettext_0.22.5-2 gettext-base_0.22.5-2 gnupg_2.2.43-8 gnupg-l10n_2.2.43-8 gnupg-utils_2.2.43-8+b1 gpg_2.2.43-8+b1 gpg-agent_2.2.43-8+b1 gpg-wks-client_2.2.43-8+b1 gpgconf_2.2.43-8+b1 gpgsm_2.2.43-8+b1 gpgv_2.2.43-8+b1 grep_3.11-4 groff-base_1.23.0-5 gzip_1.12-1.1 hostname_3.23+nmu2 init-system-helpers_1.66 intltool-debian_0.35.0+20060710.6 libacl1_2.3.2-2 libapt-pkg6.0t64_2.9.8 libarchive-zip-perl_1.68-1 libasan8_14.2.0-4 libassuan0_2.5.6-1+b1 libassuan9_3.0.1-2 libatomic1_14.2.0-4 libattr1_1:2.5.2-1 libaudit-common_1:4.0.1-1 libaudit1_1:4.0.1-1 libbinutils_2.43.1-3 libblkid1_2.40.2-8 libbsd0_0.12.2-1 libbz2-1.0_1.0.8-6 libc-bin_2.40-2 libc-dev-bin_2.40-2 libc-l10n_2.40-2 libc6_2.40-2 libc6-dev_2.40-2 libcap-ng0_0.8.5-2 libcap2_1:2.66-5 libcc1-0_14.2.0-4 libcom-err2_1.47.1-1 libcrypt-dev_1:4.4.36-5 libcrypt1_1:4.4.36-5 libctf-nobfd0_2.43.1-3 libctf0_2.43.1-3 libdb5.3t64_5.3.28+dfsg2-7 libdebconfclient0_0.272 libdebhelper-perl_13.20 libdpkg-perl_1.22.11 libeatmydata1_131-2 libelf1t64_0.191-2 libexpat1_2.6.3-1 libexpat1-dev_2.6.3-1 libfakeroot_1.36-1 libffi8_3.4.6-1 libfile-stripnondeterminism-perl_1.14.0-1 libgcc-13-dev_13.3.0-6 libgcc-14-dev_14.2.0-4 libgcc-s1_14.2.0-4 libgcrypt20_1.11.0-6 libgdbm-compat4t64_1.24-2 libgdbm6t64_1.24-2 libgmp10_2:6.3.0+dfsg-2+b1 libgnutls30t64_3.8.6-2 libgomp1_14.2.0-4 libgpg-error0_1.50-3 libgprofng0_2.43.1-3 libgssapi-krb5-2_1.21.3-3 libhogweed6t64_3.10-1 libhwasan0_14.2.0-4 libicu72_72.1-5 libidn2-0_2.3.7-2 libisl23_0.27-1 libitm1_14.2.0-4 libjansson4_2.14-2+b2 libjs-jquery_3.6.1+dfsg+~3.5.14-1 libjs-sphinxdoc_7.4.7-3 libjs-underscore_1.13.4~dfsg+~1.11.4-3 libk5crypto3_1.21.3-3 libkeyutils1_1.6.3-3 libkrb5-3_1.21.3-3 libkrb5support0_1.21.3-3 libksba8_1.6.7-2 libldap-2.5-0_2.5.18+dfsg-3+b1 liblsan0_14.2.0-4 liblz4-1_1.9.4-3 liblzma5_5.6.2-2 libmagic-mgc_1:5.45-3 libmagic1t64_1:5.45-3 libmd0_1.1.0-2 libmount1_2.40.2-8 libmpc3_1.3.1-1+b2 libmpfr6_4.2.1-1+b1 libncursesw6_6.5-2 libnettle8t64_3.10-1 libnpth0t64_1.6-3.1 libnsl2_1.3.0-3+b2 libp11-kit0_0.25.5-2 libpam-modules_1.5.3-7 libpam-modules-bin_1.5.3-7 libpam-runtime_1.5.3-7 libpam0g_1.5.3-7 libpcre2-8-0_10.42-4+b1 libperl5.38t64_5.38.2-5 libperl5.40_5.40.0-4 libpipeline1_1.5.8-1 libpython3-dev_3.12.5-1 libpython3-stdlib_3.12.5-1 libpython3.12-dev_3.12.6-1 libpython3.12-minimal_3.12.6-1 libpython3.12-stdlib_3.12.6-1 libpython3.12t64_3.12.6-1 libquadmath0_14.2.0-4 libreadline8t64_8.2-5 libsasl2-2_2.1.28+dfsg1-8 libsasl2-modules-db_2.1.28+dfsg1-8 libseccomp2_2.5.5-1+b1 libselinux1_3.7-3 libsemanage-common_3.7-2 libsemanage2_3.7-2 libsepol2_3.7-1 libsframe1_2.43.1-3 libsmartcols1_2.40.2-8 libsqlite3-0_3.46.1-1 libssl3t64_3.3.2-1 libstdc++-13-dev_13.3.0-6 libstdc++-14-dev_14.2.0-4 libstdc++6_14.2.0-4 libsystemd0_256.5-2 libtasn1-6_4.19.0-3+b2 libtinfo6_6.5-2 libtirpc-common_1.3.4+ds-1.3 libtirpc3t64_1.3.4+ds-1.3 libtool_2.4.7-7 libtsan2_14.2.0-4 libubsan1_14.2.0-4 libuchardet0_0.0.8-1+b1 libudev1_256.5-2 libunistring5_1.2-1 libuuid1_2.40.2-8 libxml2_2.12.7+dfsg-3+b1 libxxhash0_0.8.2-2+b1 libzstd1_1.5.6+dfsg-1 linux-libc-dev_6.10.9-1 locales-all_2.40-2 login_1:4.16.0-2+really2.40.2-8 login.defs_1:4.16.0-4 m4_1.4.19-4 make_4.3-4.1 man-db_2.13.0-1 mawk_1.3.4.20240819-3 media-types_10.1.0 ncurses-base_6.5-2 ncurses-bin_6.5-2 netbase_6.4 openssl-provider-legacy_3.3.2-1 passwd_1:4.16.0-4 patch_2.7.6-7 perl_5.40.0-4 perl-base_5.40.0-4 perl-modules-5.38_5.38.2-5 perl-modules-5.40_5.40.0-4 pinentry-curses_1.2.1-4+b1 po-debconf_1.0.21+nmu1 python3_3.12.5-1 python3-autocommand_2.2.2-3 python3-dev_3.12.5-1 python3-inflect_7.3.1-1 python3-jaraco.context_6.0.0-1 python3-jaraco.functools_4.0.2-1 python3-minimal_3.12.5-1 python3-more-itertools_10.4.0-1 python3-pkg-resources_74.1.2-2 python3-setuptools_74.1.2-2 python3-typeguard_4.3.0-1 python3-typing-extensions_4.12.2-2 python3-zipp_3.20.1-1 python3.12_3.12.6-1 python3.12-dev_3.12.6-1 python3.12-minimal_3.12.6-1 readline-common_8.2-5 rpcsvc-proto_1.4.3-1 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2 sensible-utils_0.0.24 sysvinit-utils_3.10-1 tar_1.35+dfsg-3 tzdata_2024a-4 usr-is-merged_39 util-linux_2.40.2-8 xz-utils_5.6.2-2 zlib1g_1:1.3.dfsg+really1.3.1-1 zlib1g-dev_1:1.3.dfsg+really1.3.1-1 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: kmer Binary: kmer, libkmer-dev, meryl, libmeryl-dev, leaff, sim4db, atac, kmer-examples Architecture: any all Version: 0~20150903+r2013-9 Maintainer: Debian Med Packaging Team Uploaders: Afif Elghraoui Homepage: http://kmer.sourceforge.net Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/kmer Vcs-Git: https://salsa.debian.org/med-team/kmer.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), dh-exec, dh-sequence-python3, python3-dev Package-List: atac deb science optional arch=any kmer deb science optional arch=all kmer-examples deb science optional arch=all leaff deb science optional arch=any libkmer-dev deb libdevel optional arch=any libmeryl-dev deb libdevel optional arch=any meryl deb science optional arch=any sim4db deb science optional arch=any Checksums-Sha1: 6da7324491e761437f27207f0b9135d767452e7a 1251653 kmer_0~20150903+r2013.orig.tar.gz bff8b0b6f815807795d55bf9adb33c18dee8cf94 2380056 kmer_0~20150903+r2013-9.debian.tar.xz Checksums-Sha256: 8fd9c289244e69e38bb7709f3523d39edf1c2ced2cbcc687fcf00ecfca78ea47 1251653 kmer_0~20150903+r2013.orig.tar.gz 27e69d0ec3c9f716d2a81a0aedd9c0d48c9807abf17815db0327f0f8901a0758 2380056 kmer_0~20150903+r2013-9.debian.tar.xz Files: 30b66a10ddc64022509dd8b85425880f 1251653 kmer_0~20150903+r2013.orig.tar.gz 5fb535fd2ba7759f38b418f0008eb2d5 2380056 kmer_0~20150903+r2013-9.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQIzBAEBCgAdFiEEck1gkzcRPHEFUNdHPCZ2P2xn5uIFAmbgD4MACgkQPCZ2P2xn 5uKZKA/+ItZCQH6KTrqdKHP/e+NVJ89S9hoixlgaKwxFxp+4xlJNQAxK22CN7mWe QFzs2miUWNDtrs1LwEjvCCcubEvwdsqy8w524udkZ8cXcOIPpbiamvFVT9CBH9mv GhYquR3pLIsNvJP4V2Wg0YpI4VO+AnLObpxhfAPw3YXFFV3yEsxV10XuoEwRJlSb DENV12lmnUlT2SmErXD+rwv/xBAIEsTBc5Jh6S0AJetqScE5d0uoBtpy0/bfShkj ebBCJYH2ufELcXm5ujgoHTBx1O+vjwtitHvYTdR7KIOFjNFTJeTBIBrTXNW4gxYg uXo+iS14JrHDDDLW01a8utkiVJaJfNRmNKUhSKAgBCHY2uQKVVZZhqfr93gzcNM+ GesWALfRz2kMmBP88GRV9Q2QyP7xmunAC/sLCS3r1eBOp5eM5W7ntkiM7hgdyvaI tMsXOC7rvN73pCd2PHu++mF1VbGM3vMR0lhQ8k+uDkFFCtqmbOBEurnW/HJvtHLa nm3yhWD3VjEjqHwr6QOKumfBPKdSdeMAnPX6FTrJnEyhEWLajKmDoGCXcZ9yDY5z tuQGDtx5+iYEvxl1Nyj9VpOVEfZtFq4CWBOak5GnCmzlL97IE66OaXGrDtLvb70p McpVXmtFKDvfVq/bhXYs3WNP3Y3snHh1p2DO8ee/71n4hE3rX0Y= =hXe+ -----END PGP SIGNATURE----- gpgv: Signature made Tue Sep 10 09:21:07 2024 UTC gpgv: using RSA key 724D609337113C710550D7473C26763F6C67E6E2 gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./kmer_0~20150903+r2013-9.dsc: no acceptable signature found dpkg-source: info: extracting kmer in /<> dpkg-source: info: unpacking kmer_0~20150903+r2013.orig.tar.gz dpkg-source: info: unpacking kmer_0~20150903+r2013-9.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying allow-freebsd-build.patch dpkg-source: info: applying atac-helper-script-paths.patch dpkg-source: info: applying atac-readme.patch dpkg-source: info: applying spelling.patch dpkg-source: info: applying linux-cflags.patch dpkg-source: info: applying fix_wrong_evaluation_order.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying drop_distutils Check disk space ---------------- Sufficient free space for build +------------------------------------------------------------------------------+ | Starting Timed Build Commands | +------------------------------------------------------------------------------+ /usr/share/debomatic/sbuildcommands/starting-build-commands/no-network kmer_0~20150903+r2013-9 perl-5.40-throwaway amd64 ------------------------------------------------------------------------------------------------------------------------ I: Finished running '/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network kmer_0~20150903+r2013-9 perl-5.40-throwaway amd64'. Finished processing commands. -------------------------------------------------------------------------------- User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf HOME=/sbuild-nonexistent LANG=en_GB.UTF-8 LANGUAGE=en_GB:en LC_ALL=C.UTF-8 LD_LIBRARY_PATH=/usr/lib/libeatmydata LD_PRELOAD=libeatmydata.so LOGNAME=debomatic PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games PWD=/<> SCHROOT_ALIAS_NAME=perl-5.40-throwaway-amd64-debomatic SCHROOT_CHROOT_NAME=perl-5.40-amd64-debomatic SCHROOT_COMMAND=env SCHROOT_GID=110 SCHROOT_GROUP=sbuild SCHROOT_SESSION_ID=perl-5.40-amd64-debomatic-18a0c2f8-4e94-4c12-9a5b-04267eee819a SCHROOT_UID=1002 SCHROOT_USER=debomatic SHELL=/bin/sh USER=debomatic dpkg-buildpackage ----------------- Command: dpkg-buildpackage --sanitize-env -us -uc -rfakeroot -Zxz dpkg-buildpackage: info: source package kmer dpkg-buildpackage: info: source version 0~20150903+r2013-9 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Michael R. Crusoe dpkg-source -Zxz --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean debian/rules override_dh_auto_clean make[1]: Entering directory '/<>' /usr/bin/make real-clean make[2]: Entering directory '/<>' rm -f ESTmapper/*.o ESTmapper/mergeCounts ESTmapper/terminate ESTmapper/Make.depends ESTmapper/mergeCounts.C.d ESTmapper/terminate.C.d ESTmapper/mergeCounts ESTmapper/terminate rm -f atac-driver/libatac/*.o atac-driver/libatac/*~ atac-driver/libatac/libatac.a atac-driver/libatac/Make.depends atac-driver/libatac/atacFeature.C.d atac-driver/libatac/atacFeatureList.C.d atac-driver/libatac/atacFile.C.d atac-driver/libatac/atacFileStreamMerge.C.d atac-driver/libatac/atacMatch.C.d atac-driver/libatac/atacMatchList.C.d atac-driver/libatac/atacMatchOrder.C.d rm -f atac-driver/alignOverlap/*.o atac-driver/alignOverlap/*~ atac-driver/alignOverlap/core atac-driver/alignOverlap/overlap-process1.C atac-driver/alignOverlap/overlap-process2.C atac-driver/alignOverlap/overlap atac-driver/alignOverlap/Make.depends atac-driver/alignOverlap/overlap.C.d atac-driver/alignOverlap/overlap-sort.C.d atac-driver/alignOverlap/overlap-printAnno.C.d atac-driver/alignOverlap/overlap-find.C.d rm -f atac-driver/gapShifter/*.o atac-driver/gapShifter/*~ atac-driver/gapShifter/core atac-driver/gapShifter/gapShifter atac-driver/gapShifter/extractSequence atac-driver/gapShifter/extractUnmapped atac-driver/gapShifter/coalesceMatches atac-driver/gapShifter/correctGaps atac-driver/gapShifter/testAtac atac-driver/gapShifter/cleanAtac atac-driver/gapShifter/projectFeatures atac-driver/gapShifter/Make.depends atac-driver/gapShifter/gapShifter.C.d atac-driver/gapShifter/extractSequence.C.d atac-driver/gapShifter/extractUnmapped.C.d atac-driver/gapShifter/coalesceMatches.C.d atac-driver/gapShifter/correctGaps.C.d atac-driver/gapShifter/testAtac.C.d atac-driver/gapShifter/cleanAtac.C.d atac-driver/gapShifter/projectFeatures.C.d rm -f atac-driver/lengthFilter/*.o atac-driver/lengthFilter/*~ atac-driver/lengthFilter/core atac-driver/lengthFilter/lengthFilter atac-driver/lengthFilter/Make.depends atac-driver/lengthFilter/lengthFilter.C.d rm -f atac-driver/matchExtender/*.o atac-driver/matchExtender/*~ atac-driver/matchExtender/core atac-driver/matchExtender/matchExtender atac-driver/matchExtender/Make.depends atac-driver/matchExtender/matchExtender.C.d atac-driver/matchExtender/matchExtender-dump.C.d atac-driver/matchExtender/matchExtender-func.C.d rm -f atac-driver/mismatchCounter/*.o atac-driver/mismatchCounter/*~ atac-driver/mismatchCounter/core atac-driver/mismatchCounter/mismatchCounter atac-driver/mismatchCounter/Make.depends atac-driver/mismatchCounter/mismatchCounter.C.d rm -f atac-driver/statsGenerator/*.o atac-driver/statsGenerator/*~ atac-driver/statsGenerator/core atac-driver/statsGenerator/statsGenerator atac-driver/statsGenerator/Make.depends atac-driver/statsGenerator/statsGenerator.C.d rm -f atac-driver/uniqueFilter/*.o atac-driver/uniqueFilter/*~ atac-driver/uniqueFilter/core atac-driver/uniqueFilter/uniqueFilter atac-driver/uniqueFilter/Make.depends atac-driver/uniqueFilter/uniqueFilter.C.d rm -f atac-driver/clumpMaker/*.o atac-driver/clumpMaker/*~ atac-driver/clumpMaker/core atac-driver/clumpMaker/clumpMaker atac-driver/clumpMaker/Make.depends atac-driver/clumpMaker/clumpMaker.C.d rm -f atac-driver/chainer/*.o atac-driver/chainer/*/*.o atac-driver/chainer/*.so atac-driver/chainer/python/*.pyc atac-driver/chainer/localAlignerInterfacemodule.so atac-driver/chainer/halignmodule.so atac-driver/chainer/Make.depends atac-driver/chainer/localalign/GF_ALN_dpaligner.C.d atac-driver/chainer/localalign/GF_ALN_local.C.d atac-driver/chainer/localalign/GF_ALN_overlap.C.d atac-driver/chainer/localalign/GF_ALN_loverlapper.C.d atac-driver/chainer/localalign/GF_ALN_pieceOlap.C.d atac-driver/chainer/localalign/localAlignerInterfacemodule.C.d atac-driver/chainer/halign/halign.C.d atac-driver/chainer/halign/halignmodule.C.d rm -f atac-driver/chimera/*.o atac-driver/chimera/*~ atac-driver/chimera/core atac-driver/chimera/happy-clones-span-clumps atac-driver/chimera/Make.depends atac-driver/chimera/happy-clones-span-clumps.C.d rm -f atac-driver/Make.depends rm -f seatac/*.o seatac/seatac seatac/heavychains seatac/filter-nop.so seatac/filter-heavychains.so seatac/Make.depends seatac/seatac.C.d seatac/configuration.C.d seatac/encodedQuery.C.d seatac/hitMatrix.C.d seatac/thr-search.C.d seatac/thr-loader.C.d seatac/thr-deadlock.C.d seatac/hitMatrix-sort.C.d rm -f leaff/*.o leaff/leaff leaff/Make.depends leaff/leaff.C.d leaff/blocks.C.d leaff/dups.C.d leaff/gc.C.d leaff/partition.C.d leaff/simseq.C.d leaff/stats.C.d rm -f meryl/*.o meryl/meryl meryl/simple meryl/mapMers meryl/mapMers-depth meryl/kmer-mask meryl/libmerylguts.a meryl/Make.depends meryl/args.C.d meryl/binaryOp.C.d meryl/build.C.d meryl/build-threads.C.d meryl/dump.C.d meryl/estimate.C.d meryl/merge.C.d meryl/unaryOp.C.d meryl/meryl.C.d meryl/simple.C.d meryl/mapMers.C.d meryl/mapMers-depth.C.d meryl/kmer-mask.C.d rm -f seagen/*.o seagen/seagen seagen/hitConverter seagen/filterEST seagen/filterMRNA seagen/filterNULL seagen/filtertest seagen/sortHits seagen/filterESTsimple seagen/Make.depends seagen/searchGENOME.C.d seagen/configuration.C.d seagen/encodedQuery.C.d seagen/thr-deadlock.C.d seagen/thr-loader.C.d seagen/thr-search.C.d seagen/thr-output.C.d seagen/hitMatrix-sort.C.d seagen/aHit.C.d seagen/hitConverter.C.d seagen/filterEST.C.d seagen/filterEST-complicated.C.d seagen/filterMRNA.C.d seagen/filterNULL.C.d seagen/sortHits.C.d seagen/filtertest.C.d seagen/hitReader.C.d seagen/hitMatrix.C.d rm -f sim4dbutils/*.o sim4dbutils/cleanPolishes sim4dbutils/fixPolishesIID sim4dbutils/comparePolishes sim4dbutils/convertToAtac sim4dbutils/convertToExtent sim4dbutils/convertPolishes sim4dbutils/detectChimera sim4dbutils/depthOfPolishes sim4dbutils/filterPolishes sim4dbutils/headPolishes sim4dbutils/mappedCoverage sim4dbutils/mergePolishes sim4dbutils/parseSNP sim4dbutils/pickBestPolish sim4dbutils/pickBestPair sim4dbutils/pickUniquePolish sim4dbutils/plotCoverageVsIdentity sim4dbutils/removeDuplicate sim4dbutils/sortPolishes sim4dbutils/summarizePolishes sim4dbutils/uniqPolishes sim4dbutils/vennPolishes sim4dbutils/realignPolishes sim4dbutils/removeRedundant sim4dbutils/reportAlignmentDifferences sim4dbutils/Make.depends sim4dbutils/cleanPolishes.C.d sim4dbutils/fixPolishesIID.C.d sim4dbutils/comparePolishes.C.d sim4dbutils/convertToAtac.C.d sim4dbutils/convertToExtent.C.d sim4dbutils/convertPolishes.C.d sim4dbutils/detectChimera.C.d sim4dbutils/depthOfPolishes.C.d sim4dbutils/filterPolishes.C.d sim4dbutils/headPolishes.C.d sim4dbutils/mappedCoverage.C.d sim4dbutils/mergePolishes.C.d sim4dbutils/parseSNP.C.d sim4dbutils/pickBestPolish.C.d sim4dbutils/pickBestPair.C.d sim4dbutils/pickUniquePolish.C.d sim4dbutils/plotCoverageVsIdentity.C.d sim4dbutils/removeDuplicate.C.d sim4dbutils/sortPolishes.C.d sim4dbutils/summarizePolishes.C.d sim4dbutils/uniqPolishes.C.d sim4dbutils/vennPolishes.C.d sim4dbutils/realignPolishes.C.d sim4dbutils/removeRedundant.C.d sim4dbutils/reportAlignmentDifferences.C.d sim4dbutils/s4p_overlap.C.d rm -f sim4db/*.o sim4db/sim4db sim4db/Make.depends sim4db/sim4th.C.d rm -f snapper/*.o snapper/snapper2 snapper/Make.depends snapper/snapper2.C.d snapper/configuration.C.d snapper/thr-search.C.d snapper/thr-filter.C.d snapper/thr-polish.C.d snapper/thr-polish-dp.C.d snapper/hitMatrix.C.d snapper/hitMatrix-sort.C.d rm -f tapper/*.o tapper/tagger tapper/tapper tapper/tapperconvert tapper/tappermerge tapper/tappersort tapper/tappererrorcorrect tapper/Make.depends tapper/tagger.C.d tapper/tapper.C.d tapper/tapperconvert.C.d tapper/tappermerge.C.d tapper/tappersort.C.d tapper/tappererrorcorrect.C.d rm -f /<>/libsim4/*.o /<>/libsim4/sim4core/*.o /<>/libsim4/sim4polish/*.o /<>/libsim4/libsim4.a /<>/libsim4/Make.depends /<>/libsim4/sim4core/sim4command.C.d /<>/libsim4/sim4core/sim4parameters.C.d /<>/libsim4/sim4core/sim4string.C.d /<>/libsim4/sim4core/Xtend1.C.d /<>/libsim4/sim4core/align.C.d /<>/libsim4/sim4core/exon_cores.C.d /<>/libsim4/sim4core/extend.C.d /<>/libsim4/sim4core/glimmerSplice.C.d /<>/libsim4/sim4core/greedy.C.d /<>/libsim4/sim4core/mspManager.C.d /<>/libsim4/sim4core/pluri_align.C.d /<>/libsim4/sim4core/poly.C.d /<>/libsim4/sim4core/sim4b1.C.d /<>/libsim4/sim4core/sim4b1a.C.d /<>/libsim4/sim4core/sim4b1-1.C.d /<>/libsim4/sim4core/sim4b1-2.C.d /<>/libsim4/sim4core/sim4b1-3.C.d /<>/libsim4/sim4core/sim4b1-4.C.d /<>/libsim4/sim4core/sim4b1_s.C.d /<>/libsim4/sim4core/sites.C.d /<>/libsim4/sim4core/sites_donor.C.d /<>/libsim4/sim4core/sites_acceptor.C.d /<>/libsim4/sim4core/sites_score.C.d /<>/libsim4/sim4core/splice.C.d /<>/libsim4/sim4core/table.C.d /<>/libsim4/sim4core/util.C.d /<>/libsim4/sim4polish/sim4polish-compare.C.d /<>/libsim4/sim4polish/sim4polish-copy.C.d /<>/libsim4/sim4polish/sim4polish-deleteexon.C.d /<>/libsim4/sim4polish/sim4polish-exons.C.d /<>/libsim4/sim4polish/sim4polish-polishtostring.C.d /<>/libsim4/sim4polish/sim4polish-read.C.d /<>/libsim4/sim4polish/sim4polish-stringtopolish.C.d /<>/libsim4/sim4polish/sim4polish-updatescores.C.d /<>/libsim4/sim4polish/sim4polish.C.d /<>/libsim4/sim4polish/sim4polishList.C.d /<>/libsim4/sim4polish/sim4polishBuilder.C.d /<>/libsim4/sim4polish/sim4polishFile.C.d /<>/libsim4/sim4polish/sim4polishReader.C.d /<>/libsim4/sim4polish/sim4polishWriter.C.d rm -f /<>/libkmer/*.o /<>/libkmer/existDB /<>/libkmer/positionDB /<>/libkmer/libkmer.a /<>/libkmer/Make.depends /<>/libkmer/existDB-create-from-fasta.C.d /<>/libkmer/existDB-create-from-meryl.C.d /<>/libkmer/existDB-create-from-sequence.C.d /<>/libkmer/existDB-state.C.d /<>/libkmer/existDB.C.d /<>/libkmer/positionDB-access.C.d /<>/libkmer/positionDB-dump.C.d /<>/libkmer/positionDB-file.C.d /<>/libkmer/positionDB-mismatch.C.d /<>/libkmer/positionDB-sort.C.d /<>/libkmer/positionDB.C.d /<>/libkmer/driver-existDB.C.d /<>/libkmer/driver-posDB.C.d rm -f /<>/libmeryl/*.o /<>/libmeryl/libmeryl.a /<>/libmeryl/Make.depends /<>/libmeryl/libmeryl.C.d rm -f /<>/libbio/*.o /<>/libbio/libbio.a /<>/libbio/Make.depends /<>/libbio/alphabet.c.d /<>/libbio/alphabet-acgtspace.c.d /<>/libbio/alphabet-colorspace.c.d /<>/libbio/halign.c.d /<>/libbio/reversecomplement.c.d /<>/libbio/kmer.C.d rm -f /<>/libseq/*.o /<>/libseq/test-seqCache /<>/libseq/test-seqStream /<>/libseq/test-merStream /<>/libseq/libseq.a /<>/libseq/Make.depends /<>/libseq/fastaFile.C.d /<>/libseq/fastaStdin.C.d /<>/libseq/fastqFile.C.d /<>/libseq/fastqStdin.C.d /<>/libseq/seqStore.C.d /<>/libseq/sffFile.C.d /<>/libseq/seqFactory.C.d /<>/libseq/seqCache.C.d /<>/libseq/seqStream.C.d /<>/libseq/merStream.C.d /<>/libseq/test-seqCache.C.d /<>/libseq/test-seqStream.C.d /<>/libseq/test-merStream.C.d rm -f /<>/libutil/mt19937ar/*.o /<>/libutil/mt19937ar/test.c /<>/libutil/mt19937ar/diffs /<>/libutil/mt19937ar/mt19937ar-test /<>/libutil/mt19937ar/libmt19937ar.a /<>/libutil/mt19937ar/Make.depends /<>/libutil/mt19937ar/mt19937ar.c.d /<>/libutil/mt19937ar/test.c.d /<>/libutil/mt19937ar/*.o /<>/libutil/mt19937ar/test.c /<>/libutil/mt19937ar/diffs /<>/libutil/mt19937ar/mt19937ar-test rm -f /<>/libutil/kazlib/*.o /<>/libutil/kazlib/libkaz.a /<>/libutil/kazlib/Make.depends /<>/libutil/kazlib/dict.c.d /<>/libutil/kazlib/except.c.d /<>/libutil/kazlib/hash.c.d /<>/libutil/kazlib/list.c.d /<>/libutil/kazlib/sfx.c.d rm -f /<>/libutil/*.o /<>/libutil/libutil.a /<>/libutil/Make.depends /<>/libutil/file.c.d /<>/libutil/md5.c.d /<>/libutil/palloc.c.d /<>/libutil/qsort_mt.c.d /<>/libutil/util.c.d /<>/libutil/bigQueue.C.d /<>/libutil/bitPackedArray.C.d /<>/libutil/bitPackedFile.C.d /<>/libutil/fibonacciNumbers.C.d /<>/libutil/readBuffer.C.d /<>/libutil/recordFile.C.d /<>/libutil/speedCounter.C.d /<>/libutil/sweatShop.C.d rm -f Make.depends Make.compilers make[2]: Leaving directory '/<>' rm -rf installdir make[1]: Leaving directory '/<>' dh_clean dpkg-source -Zxz -b . dpkg-source: info: using source format '3.0 (quilt)' dpkg-source: info: building kmer using existing ./kmer_0~20150903+r2013.orig.tar.gz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: building kmer in kmer_0~20150903+r2013-9.debian.tar.xz dpkg-source: info: building kmer in kmer_0~20150903+r2013-9.dsc debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/<>' # The Makefile apparently doesn't use regular LDFLAGS. # It defines CLDFLAGS and CXXLDFLAGS as empty strings, so let's # use them here. /usr/bin/make install \ CLDFLAGS="-Wl,-z,relro -Wl,-z,now" \ CXXLDFLAGS="-Wl,-z,relro -Wl,-z,now" make[2]: Entering directory '/<>' making /<>/libutil/kazlib/sfx.c.d making /<>/libutil/kazlib/list.c.d making /<>/libutil/kazlib/hash.c.d making /<>/libutil/kazlib/except.c.d making /<>/libutil/kazlib/dict.c.d gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/mt19937ar/mt19937ar.o -c /<>/libutil/mt19937ar/mt19937ar.c /<>/libutil/mt19937ar/mt19937ar.c: In function ‘mtRandomGaussian’: /<>/libutil/mt19937ar/mt19937ar.c:166:34: warning: variable ‘y2’ set but not used [-Wunused-but-set-variable] 166 | double x1=0, x2=0, w=0, y1=0, y2=0; | ^~ gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/mt19937ar/mt19937ar-test.o -c /<>/libutil/mt19937ar/mt19937ar-test.c gcc -Wl,-z,relro -Wl,-z,now -o /<>/libutil/mt19937ar/mt19937ar-test /<>/libutil/mt19937ar/mt19937ar.o /<>/libutil/mt19937ar/mt19937ar-test.o -pthread -ldl -lm /<>/libutil/mt19937ar/mt19937ar-test | diff - /<>/libutil/mt19937ar/mt19937ar.out > /<>/libutil/mt19937ar/diffs 2>&1 if test -s /<>/libutil/mt19937ar/diffs ; then echo 'MT19937: TEST FAILED'; else echo 'MT19937: Test Passed'; fi MT19937: Test Passed touch /<>/libutil/mt19937ar/test.c /<>/libutil/mt19937ar/mt19937ar-test | diff - /<>/libutil/mt19937ar/mt19937ar.out making /<>/libutil/mt19937ar/test.c.d making /<>/libutil/mt19937ar/mt19937ar.c.d making /<>/libutil/sweatShop.C.d making /<>/libutil/speedCounter.C.d making /<>/libutil/recordFile.C.d making /<>/libutil/readBuffer.C.d making /<>/libutil/fibonacciNumbers.C.d making /<>/libutil/bitPackedFile.C.d making /<>/libutil/bitPackedArray.C.d making /<>/libutil/bigQueue.C.d making /<>/libutil/util.c.d making /<>/libutil/qsort_mt.c.d making /<>/libutil/palloc.c.d making /<>/libutil/md5.c.d making /<>/libutil/file.c.d making /<>/libseq/test-merStream.C.d making /<>/libseq/test-seqStream.C.d making /<>/libseq/test-seqCache.C.d making /<>/libseq/merStream.C.d making /<>/libseq/seqStream.C.d making /<>/libseq/seqCache.C.d making /<>/libseq/seqFactory.C.d making /<>/libseq/sffFile.C.d making /<>/libseq/seqStore.C.d making /<>/libseq/fastqStdin.C.d making /<>/libseq/fastqFile.C.d making /<>/libseq/fastaStdin.C.d making /<>/libseq/fastaFile.C.d making /<>/libbio/kmer.C.d making /<>/libbio/reversecomplement.c.d making /<>/libbio/halign.c.d making /<>/libbio/alphabet-colorspace.c.d making /<>/libbio/alphabet-acgtspace.c.d making /<>/libbio/alphabet.c.d making /<>/libmeryl/libmeryl.C.d making /<>/libkmer/driver-posDB.C.d making /<>/libkmer/driver-existDB.C.d making /<>/libkmer/positionDB.C.d making /<>/libkmer/positionDB-sort.C.d making /<>/libkmer/positionDB-mismatch.C.d making /<>/libkmer/positionDB-file.C.d making /<>/libkmer/positionDB-dump.C.d making /<>/libkmer/positionDB-access.C.d making /<>/libkmer/existDB.C.d making /<>/libkmer/existDB-state.C.d making /<>/libkmer/existDB-create-from-sequence.C.d making /<>/libkmer/existDB-create-from-meryl.C.d making /<>/libkmer/existDB-create-from-fasta.C.d making /<>/libsim4/sim4polish/sim4polishWriter.C.d making /<>/libsim4/sim4polish/sim4polishReader.C.d making /<>/libsim4/sim4polish/sim4polishFile.C.d making /<>/libsim4/sim4polish/sim4polishBuilder.C.d making /<>/libsim4/sim4polish/sim4polishList.C.d making /<>/libsim4/sim4polish/sim4polish.C.d making /<>/libsim4/sim4polish/sim4polish-updatescores.C.d making /<>/libsim4/sim4polish/sim4polish-stringtopolish.C.d making /<>/libsim4/sim4polish/sim4polish-read.C.d making /<>/libsim4/sim4polish/sim4polish-polishtostring.C.d making /<>/libsim4/sim4polish/sim4polish-exons.C.d making /<>/libsim4/sim4polish/sim4polish-deleteexon.C.d making /<>/libsim4/sim4polish/sim4polish-copy.C.d making /<>/libsim4/sim4polish/sim4polish-compare.C.d making /<>/libsim4/sim4core/util.C.d making /<>/libsim4/sim4core/table.C.d making /<>/libsim4/sim4core/splice.C.d making /<>/libsim4/sim4core/sites_score.C.d making /<>/libsim4/sim4core/sites_acceptor.C.d making /<>/libsim4/sim4core/sites_donor.C.d making /<>/libsim4/sim4core/sites.C.d making /<>/libsim4/sim4core/sim4b1_s.C.d making /<>/libsim4/sim4core/sim4b1-4.C.d making /<>/libsim4/sim4core/sim4b1-3.C.d making /<>/libsim4/sim4core/sim4b1-2.C.d making /<>/libsim4/sim4core/sim4b1-1.C.d making /<>/libsim4/sim4core/sim4b1a.C.d making /<>/libsim4/sim4core/sim4b1.C.d making /<>/libsim4/sim4core/poly.C.d making /<>/libsim4/sim4core/pluri_align.C.d making /<>/libsim4/sim4core/mspManager.C.d making /<>/libsim4/sim4core/greedy.C.d making /<>/libsim4/sim4core/glimmerSplice.C.d making /<>/libsim4/sim4core/extend.C.d making /<>/libsim4/sim4core/exon_cores.C.d making /<>/libsim4/sim4core/align.C.d making /<>/libsim4/sim4core/Xtend1.C.d making /<>/libsim4/sim4core/sim4string.C.d making /<>/libsim4/sim4core/sim4parameters.C.d making /<>/libsim4/sim4core/sim4command.C.d making tapper/tappererrorcorrect.C.d making tapper/tappersort.C.d making tapper/tappermerge.C.d making tapper/tapperconvert.C.d making tapper/tapper.C.d making tapper/tagger.C.d making snapper/hitMatrix-sort.C.d making snapper/hitMatrix.C.d making snapper/thr-polish-dp.C.d making snapper/thr-polish.C.d making snapper/thr-filter.C.d making snapper/thr-search.C.d making snapper/configuration.C.d making snapper/snapper2.C.d making sim4db/sim4th.C.d making sim4dbutils/s4p_overlap.C.d making sim4dbutils/reportAlignmentDifferences.C.d making sim4dbutils/removeRedundant.C.d making sim4dbutils/realignPolishes.C.d making sim4dbutils/vennPolishes.C.d making sim4dbutils/uniqPolishes.C.d making sim4dbutils/summarizePolishes.C.d making sim4dbutils/sortPolishes.C.d making sim4dbutils/removeDuplicate.C.d making sim4dbutils/plotCoverageVsIdentity.C.d making sim4dbutils/pickUniquePolish.C.d making sim4dbutils/pickBestPair.C.d making sim4dbutils/pickBestPolish.C.d making sim4dbutils/parseSNP.C.d making sim4dbutils/mergePolishes.C.d making sim4dbutils/mappedCoverage.C.d making sim4dbutils/headPolishes.C.d making sim4dbutils/filterPolishes.C.d making sim4dbutils/depthOfPolishes.C.d making sim4dbutils/detectChimera.C.d making sim4dbutils/convertPolishes.C.d making sim4dbutils/convertToExtent.C.d making sim4dbutils/convertToAtac.C.d making sim4dbutils/comparePolishes.C.d making sim4dbutils/fixPolishesIID.C.d making sim4dbutils/cleanPolishes.C.d making seagen/hitMatrix.C.d making seagen/hitReader.C.d making seagen/filtertest.C.d making seagen/sortHits.C.d making seagen/filterNULL.C.d making seagen/filterMRNA.C.d making seagen/filterEST-complicated.C.d making seagen/filterEST.C.d making seagen/hitConverter.C.d making seagen/aHit.C.d making seagen/hitMatrix-sort.C.d making seagen/thr-output.C.d making seagen/thr-search.C.d making seagen/thr-loader.C.d making seagen/thr-deadlock.C.d making seagen/encodedQuery.C.d making seagen/configuration.C.d making seagen/searchGENOME.C.d making meryl/kmer-mask.C.d making meryl/mapMers-depth.C.d making meryl/mapMers.C.d making meryl/simple.C.d making meryl/meryl.C.d making meryl/unaryOp.C.d making meryl/merge.C.d making meryl/estimate.C.d making meryl/dump.C.d making meryl/build-threads.C.d making meryl/build.C.d making meryl/binaryOp.C.d making meryl/args.C.d making leaff/stats.C.d making leaff/simseq.C.d making leaff/partition.C.d making leaff/gc.C.d making leaff/dups.C.d making leaff/blocks.C.d making leaff/leaff.C.d making seatac/hitMatrix-sort.C.d making seatac/thr-deadlock.C.d making seatac/thr-loader.C.d making seatac/thr-search.C.d making seatac/hitMatrix.C.d making seatac/encodedQuery.C.d making seatac/configuration.C.d making seatac/seatac.C.d making atac-driver/chimera/happy-clones-span-clumps.C.d making atac-driver/chainer/halign/halignmodule.C.d making atac-driver/chainer/halign/halign.C.d making atac-driver/chainer/localalign/localAlignerInterfacemodule.C.d making atac-driver/chainer/localalign/GF_ALN_pieceOlap.C.d making atac-driver/chainer/localalign/GF_ALN_loverlapper.C.d making atac-driver/chainer/localalign/GF_ALN_overlap.C.d making atac-driver/chainer/localalign/GF_ALN_local.C.d making atac-driver/chainer/localalign/GF_ALN_dpaligner.C.d making atac-driver/clumpMaker/clumpMaker.C.d making atac-driver/uniqueFilter/uniqueFilter.C.d making atac-driver/statsGenerator/statsGenerator.C.d making atac-driver/mismatchCounter/mismatchCounter.C.d making atac-driver/matchExtender/matchExtender-func.C.d making atac-driver/matchExtender/matchExtender-dump.C.d making atac-driver/matchExtender/matchExtender.C.d making atac-driver/lengthFilter/lengthFilter.C.d making atac-driver/gapShifter/projectFeatures.C.d making atac-driver/gapShifter/cleanAtac.C.d making atac-driver/gapShifter/testAtac.C.d making atac-driver/gapShifter/correctGaps.C.d making atac-driver/gapShifter/coalesceMatches.C.d making atac-driver/gapShifter/extractUnmapped.C.d making atac-driver/gapShifter/extractSequence.C.d making atac-driver/gapShifter/gapShifter.C.d making atac-driver/alignOverlap/overlap-find.C.d making atac-driver/alignOverlap/overlap-printAnno.C.d making atac-driver/alignOverlap/overlap-sort.C.d making atac-driver/alignOverlap/overlap.C.d making atac-driver/libatac/atacMatchOrder.C.d making atac-driver/libatac/atacMatchList.C.d making atac-driver/libatac/atacMatch.C.d making atac-driver/libatac/atacFileStreamMerge.C.d making atac-driver/libatac/atacFile.C.d making atac-driver/libatac/atacFeatureList.C.d making atac-driver/libatac/atacFeature.C.d making ESTmapper/terminate.C.d making ESTmapper/mergeCounts.C.d g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o ESTmapper/mergeCounts.o -c ESTmapper/mergeCounts.C ESTmapper/mergeCounts.C: In function ‘int main(int, char**)’: ESTmapper/mergeCounts.C:33:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 33 | fgets(buf, 256, Fs[i]); | ~~~~~^~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o ESTmapper/mergeCounts ESTmapper/mergeCounts.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o ESTmapper/terminate.o -c ESTmapper/terminate.C In file included from /<>/libutil/util++.H:4, from ESTmapper/terminate.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ ESTmapper/terminate.C: In member function ‘void iidReaderWriter::load(uint32)’: ESTmapper/terminate.C:82:13: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 82 | fscanf(inFile, uint32FMT, &iid); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ ESTmapper/terminate.C:85:15: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 85 | fscanf(inFile, uint32FMT, &iid); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4command.o -c /<>/libsim4/sim4core/sim4command.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libsim4/sim4core/sim4command.H:4, from /<>/libsim4/sim4core/sim4command.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4core/sim4command.C: In member function ‘void sim4command::finalize()’: /<>/libsim4/sim4core/sim4command.C:147:6: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else] 147 | if (_genLo > _genHi) | ^ /<>/libsim4/sim4core/sim4command.C: In member function ‘char* sim4command::getESTheader()’: /<>/libsim4/sim4core/sim4command.C:184:22: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 184 | static char *xxx = "anonymous cDNA sequence"; | ^~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4core/sim4command.C: In member function ‘char* sim4command::getGENheader()’: /<>/libsim4/sim4core/sim4command.C:222:15: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 222 | char *xxx = "anonymous genomic sequence"; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4parameters.o -c /<>/libsim4/sim4core/sim4parameters.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/mspManager.H:8, from /<>/libsim4/sim4core/sim4parameters.H:4, from /<>/libsim4/sim4core/sim4parameters.C:2: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4string.o -c /<>/libsim4/sim4core/sim4string.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4string.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4core/sim4string.C: In member function ‘void Sim4::IDISPLAY(sim4polishBuilder&, char*, char*, char*, char*, int, int, int*, int, int, int, Exon*)’: /<>/libsim4/sim4core/sim4string.C:681:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 681 | builder.addExonAlignment("Empty exon list; no alignment possible!", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4core/sim4string.C:682:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 682 | "Empty exon list; no alignment possible!"); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4core/sim4string.C:694:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 694 | builder.addExonAlignment("Alignment fragment not found; no alignment possible!", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4core/sim4string.C:695:30: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 695 | "Alignment fragment not found; no alignment possible!"); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/Xtend1.o -c /<>/libsim4/sim4core/Xtend1.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/Xtend1.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/align.o -c /<>/libsim4/sim4core/align.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/align.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4core/align.C: In member function ‘void Sim4::path(int, int, char, int, int, char, int, edit_script**, edit_script**)’: /<>/libsim4/sim4core/align.C:777:13: warning: ‘head2’ may be used uninitialized [-Wmaybe-uninitialized] 777 | if (head2) *tail = tail2; | ^~~~~ /<>/libsim4/sim4core/align.C:557:38: note: ‘head2’ declared here 557 | edit_script *head1, *tail1, *head2, *tail2; | ^~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/exon_cores.o -c /<>/libsim4/sim4core/exon_cores.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/exon_cores.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/extend.o -c /<>/libsim4/sim4core/extend.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/extend.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/glimmerSplice.o -c /<>/libsim4/sim4core/glimmerSplice.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/glimmerSplice.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4core/glimmerSplice.C: In function ‘void readModel(Fixed_Length_ICM_t*, const char*)’: /<>/libsim4/sim4core/glimmerSplice.C:53:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 53 | fread (line, sizeof (char), ID_STRING_LEN, fp); // skip the text header line | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4core/glimmerSplice.C:84:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 84 | fread ((*fixed).permutation, sizeof (int), (*fixed).length, fp); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/greedy.o -c /<>/libsim4/sim4core/greedy.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/greedy.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/mspManager.o -c /<>/libsim4/sim4core/mspManager.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/mspManager.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/pluri_align.o -c /<>/libsim4/sim4core/pluri_align.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/pluri_align.C:2: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/poly.o -c /<>/libsim4/sim4core/poly.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/poly.C:2: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1.o -c /<>/libsim4/sim4core/sim4b1.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1a.o -c /<>/libsim4/sim4core/sim4b1a.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1a.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1-1.o -c /<>/libsim4/sim4core/sim4b1-1.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1-1.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1-2.o -c /<>/libsim4/sim4core/sim4b1-2.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1-2.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1-3.o -c /<>/libsim4/sim4core/sim4b1-3.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1-3.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1-4.o -c /<>/libsim4/sim4core/sim4b1-4.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1-4.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sim4b1_s.o -c /<>/libsim4/sim4core/sim4b1_s.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sim4b1_s.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sites.o -c /<>/libsim4/sim4core/sites.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sites.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4core/sites.C: In function ‘int readtree(Sim4*, char*, tree*, int)’: /<>/libsim4/sim4core/sites.C:452:6: warning: variable ‘len’ set but not used [-Wunused-but-set-variable] 452 | int len; | ^~~ /<>/libsim4/sim4core/sites.C: In function ‘int Is_Cod_NonCod(const int*, double*, int)’: /<>/libsim4/sim4core/sites.C:751:12: warning: ‘scores’ may be used uninitialized [-Wmaybe-uninitialized] 751 | double *scores; | ^~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sites_donor.o -c /<>/libsim4/sim4core/sites_donor.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sites_donor.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sites_acceptor.o -c /<>/libsim4/sim4core/sites_acceptor.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sites_acceptor.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/sites_score.o -c /<>/libsim4/sim4core/sites_score.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/sites_score.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/splice.o -c /<>/libsim4/sim4core/splice.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/splice.C:2: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/table.o -c /<>/libsim4/sim4core/table.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/table.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4core/table.C: In member function ‘void Sim4::bld_table(char*, int, mss_t, int)’: /<>/libsim4/sim4core/table.C:112:9: warning: this ‘if’ clause does not guard... [-Wmisleading-indentation] 112 | if (emer < 0) | ^~ /<>/libsim4/sim4core/table.C:115:11: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘if’ 115 | ecode <<= 2; | ^~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4core/util.o -c /<>/libsim4/sim4core/util.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4core/sim4.H:15, from /<>/libsim4/sim4core/util.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-compare.o -c /<>/libsim4/sim4polish/sim4polish-compare.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-compare.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4polish/sim4polish-compare.C:249:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 249 | fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno)); | ^ /<>/libsim4/sim4polish/sim4polish-compare.C:249:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 249 | fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno)); | ^ /<>/libsim4/sim4polish/sim4polish-compare.C:365:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 365 | fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno)); | ^ /<>/libsim4/sim4polish/sim4polish-compare.C:365:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 365 | fprintf(stderr, "s4p_compareExons()-- Can't allocate "uint32FMT" + "uint32FMT" words for counting exons.\n%s\n", A->_numExons, B->_numExons, strerror(errno)); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-copy.o -c /<>/libsim4/sim4polish/sim4polish-copy.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-copy.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-deleteexon.o -c /<>/libsim4/sim4polish/sim4polish-deleteexon.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-deleteexon.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-exons.o -c /<>/libsim4/sim4polish/sim4polish-exons.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-exons.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-polishtostring.o -c /<>/libsim4/sim4polish/sim4polish-polishtostring.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-polishtostring.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:58:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | sprintf(gpp, "%c"uint32FMT" ", gaptyp, gapcnt); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:68:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | sprintf(gpp, "%c"uint32FMT" ", gaptyp, gapcnt); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:80:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 80 | sprintf(gpp, "%c"uint32FMT" ", gaptyp, gapcnt); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:91:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | sprintf(gpp, "%c"uint32FMT"", gaptyp, gapcnt); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:163:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 163 | fprintf(stderr, "sim4reader: Unknown matchOrientation '"uint32FMT"' in printPolish()\n", _matchOrientation); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:176:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 176 | fprintf(stderr, "sim4reader: Unknown strandOrientation '"uint32FMT"' in printPolish()\n", _matchOrientation); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:88: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:100: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:181:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | sprintf(outc, "sim4begin\n"uint32FMT"["uint32FMT"-"uint32FMT"-"uint32FMT"] "uint32FMT"["uint32FMT"-"uint32FMT"] <"uint32FMT"-"uint32FMT"-"uint32FMT"-%s-%s>\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:212:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | sprintf(outc, ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">%s\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:323:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 323 | fprintf(stderr, "sim4reader: Unknown strandOrientation '"uint32FMT"' in printPolishGFF3()\n", _matchOrientation); | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:346:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 346 | sprintf(outc, uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:346:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 346 | sprintf(outc, uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:346:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 346 | sprintf(outc, uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:350:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 350 | sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:350:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 350 | sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:350:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 350 | sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:350:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 350 | sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:350:91: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 350 | sprintf(outc, "ID=sim4db"uint32FMT";Name="uint32FMT":%s;Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:354:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 354 | sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:354:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 354 | sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:354:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 354 | sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:354:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 354 | sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:354:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 354 | sprintf(outc, "targetLen="uint32FMT";pA="uint32FMT";pT="uint32FMT";genRegion="uint32FMT"-"uint32FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:363:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 363 | sprintf(outc, uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:363:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 363 | sprintf(outc, uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:363:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 363 | sprintf(outc, uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:368:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 368 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:368:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 368 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:368:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 368 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:368:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 368 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:368:91: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 368 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;Gap=%s;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:371:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:371:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:371:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:371:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"", | ^ /<>/libsim4/sim4polish/sim4polish-polishtostring.C:371:91: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | sprintf(outc, "Parent=sim4db"uint32FMT";Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c;nMatches="uint32FMT"", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-read.o -c /<>/libsim4/sim4polish/sim4polish-read.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-read.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4polish/sim4polish-read.C:46:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(stderr, "sim4reader: Got '%s', expecting 'sim4begin' at byte "uint64FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-read.C:65:2: warning: #warning LAZY PROGRAMMER did not extend an array [-Wcpp] 65 | #warning LAZY PROGRAMMER did not extend an array | ^~~~~~~ /<>/libsim4/sim4polish/sim4polish-read.C:126:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 126 | fprintf(stderr, "sim4reader: Got '%s', expecting GFF3 mRNA line at byte "uint64FMT"\n", | ^ /<>/libsim4/sim4polish/sim4polish-read.C:150:2: warning: #warning LAZY PROGRAMMER did not extend an array [-Wcpp] 150 | #warning LAZY PROGRAMMER did not extend an array | ^~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-stringtopolish.o -c /<>/libsim4/sim4polish/sim4polish-stringtopolish.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:42:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | uint32 r = sscanf(lines[cl], ""uint32FMT"["uint32FMT" "uint32FMT" "uint32FMT"] "uint32FMT"["uint32FMT" "uint32FMT"] <"uint32FMT" "uint32FMT" "uint32FMT" %s %s>", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:55:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:72:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 72 | fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:127:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | while (sscanf(lines[cl], ""uint32FMT"-"uint32FMT" ("uint32FMT"-"uint32FMT") <"uint32FMT"-"uint32FMT"-"uint32FMT">", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:169:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 169 | fprintf(stderr, "sim4polish::s4p_linesToPolishS4DB()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:243:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 243 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:243:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 243 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:243:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 243 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:243:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 243 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\tmRNA\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:246:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 246 | fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:275:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 275 | r = sscanf(crttok, "ID=sim4db"uint32FMT"", &matchID); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:280:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 280 | r = sscanf(crttok, "Name="uint32FMT":%s", &_estID, _estDefLine); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:285:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 285 | r = sscanf(crttok, "Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c", &_estID, _estDefLine, &dummy1, &dummy2, &mOri); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:285:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 285 | r = sscanf(crttok, "Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c", &_estID, _estDefLine, &dummy1, &dummy2, &mOri); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:285:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 285 | r = sscanf(crttok, "Target="uint32FMT":%s "uint32FMT" "uint32FMT" %c", &_estID, _estDefLine, &dummy1, &dummy2, &mOri); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:293:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 293 | r = sscanf(crttok, "targetLen="uint32FMT"", &_estLen); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:296:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 296 | r = sscanf(crttok, "pA="uint32FMT"", &_estPolyA); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:299:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 299 | r = sscanf(crttok, "pT="uint32FMT"", &_estPolyT); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:302:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 302 | r = sscanf(crttok, "genRegion="uint32FMT"-"uint32FMT"", &_genRegionOffset, &dummy1); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:302:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 302 | r = sscanf(crttok, "genRegion="uint32FMT"-"uint32FMT"", &_genRegionOffset, &dummy1); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:313:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 313 | fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:339:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 339 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:339:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 339 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:339:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 339 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:339:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 339 | r = sscanf(lines[cl], ""uint32FMT":%s\tsim4db\texon\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t.\t", | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:342:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 342 | fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:366:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 366 | r = sscanf(crttok, "Parent=sim4db"uint32FMT"", &dummy1); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:370:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 370 | r = sscanf(crttok, "Target=%s "uint32FMT" "uint32FMT" %c", &dummybuf, &exon._estFrom, &exon._estTo, &mOri); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:370:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 370 | r = sscanf(crttok, "Target=%s "uint32FMT" "uint32FMT" %c", &dummybuf, &exon._estFrom, &exon._estTo, &mOri); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:377:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 377 | r = sscanf(crttok, "nMatches="uint32FMT"", &exon._numMatches); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:403:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 403 | fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:437:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 437 | fprintf(stderr, "sim4polish::s4p_linesToPolishGFF3()-- byte "uint32FMT": '%s'\n", startPosition, lines[cl]); | ^ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C: In member function ‘void sim4polish::s4p_linesToPolishS4DB(uint32, uint32, char**, uint32*)’: /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:140:13: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess] 140 | memcpy(nnn, _exons, sizeof(sim4polishExon) * _numExons); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here 49 | class sim4polishExon { | ^~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C: In member function ‘void sim4polish::s4p_linesToPolishGFF3(uint32, uint32, char**, uint32*)’: /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:261:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 261 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:261:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 261 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:262:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 262 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:262:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 262 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:263:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 263 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:263:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 263 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:264:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 264 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:264:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 264 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:265:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 265 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:265:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 265 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:266:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 266 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:266:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 266 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:267:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 267 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:267:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 267 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:268:5: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 268 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:268:35: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 268 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:346:17: warning: comparison of integer expressions of different signedness: ‘int’ and ‘uint32’ {aka ‘unsigned int’} [-Wsign-compare] 346 | if ((dummy1 != _genID) || strcmp(dummybuf, _genDefLine) || | ~~~~~~~^~~~~~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:347:40: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses] 347 | (sOri != '+') && (sOri != '-') && (sOri != '.')) | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:352:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 352 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:352:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 352 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:353:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 353 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:353:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 353 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:354:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 354 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:354:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 354 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:355:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 355 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:355:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 355 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:356:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 356 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:356:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 356 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:357:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 357 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:357:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 357 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:358:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 358 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:358:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 358 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:359:7: warning: this ‘while’ clause does not guard... [-Wmisleading-indentation] 359 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:359:37: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the ‘while’ 359 | while (*clptr!='\t') clptr++; clptr++; | ^~~~~ /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:370:30: warning: format ‘%s’ expects argument of type ‘char*’, but argument 3 has type ‘char (*)[1000]’ [-Wformat=] 370 | r = sscanf(crttok, "Target=%s "uint32FMT" "uint32FMT" %c", &dummybuf, &exon._estFrom, &exon._estTo, &mOri); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~ | | | char (*)[1000] /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:383:39: warning: format ‘%s’ expects argument of type ‘char*’, but argument 3 has type ‘char (*)[1000]’ [-Wformat=] 383 | r = sscanf(crttok, "intron=%s", &dummybuf); | ~^ ~~~~~~~~~ | | | | | char (*)[1000] | char* /<>/libsim4/sim4polish/sim4polish-stringtopolish.C:414:13: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess] 414 | memcpy(nnn, _exons, sizeof(sim4polishExon) * _numExons); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here 49 | class sim4polishExon { | ^~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish-updatescores.o -c /<>/libsim4/sim4polish/sim4polish-updatescores.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish-updatescores.C:2: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polish.o -c /<>/libsim4/sim4polish/sim4polish.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polish.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polishList.o -c /<>/libsim4/sim4polish/sim4polishList.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libsim4/sim4polish/sim4polishList.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polishBuilder.o -c /<>/libsim4/sim4polish/sim4polishBuilder.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libsim4/sim4polish/sim4polishBuilder.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4polish/sim4polishBuilder.C: In member function ‘sim4polish* sim4polishBuilder::release()’: /<>/libsim4/sim4polish/sim4polishBuilder.C:246:11: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess] 246 | memcpy(it->_exons + i, ex[i], sizeof(sim4polishExon)); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /<>/libsim4/sim4polish/sim4polishBuilder.H:4, from /<>/libsim4/sim4polish/sim4polishBuilder.C:7: /<>/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here 49 | class sim4polishExon { | ^~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polishFile.o -c /<>/libsim4/sim4polish/sim4polishFile.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polishFile.H:4, from /<>/libsim4/sim4polish/sim4polishFile.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libsim4/sim4polish/sim4polishFile.C:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Failed to reposition %s to record "uint32FMT", only "uint32FMT" records\n", _path, ordinal, _polishRecordLen), exit(1); | ^ /<>/libsim4/sim4polish/sim4polishFile.C:120:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Failed to reposition %s to record "uint32FMT", only "uint32FMT" records\n", _path, ordinal, _polishRecordLen), exit(1); | ^ /<>/libsim4/sim4polish/sim4polishFile.C:248:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stderr, "polishes: "uint32FMT"\r", _polishRecordLen); | ^ /<>/libsim4/sim4polish/sim4polishFile.C: In member function ‘void sim4polishFile::loadIndex()’: /<>/libsim4/sim4polish/sim4polishFile.C:141:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 141 | fread(&magic, sizeof(char), 8, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:145:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 145 | fread(&_polishRecordLen, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:151:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 151 | fread( _polishRecord, sizeof(polishRecord), _polishRecordLen, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:152:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 152 | fread( _polishRecordEST, sizeof(uint32), _polishRecordLen, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:153:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 153 | fread( _polishRecordGEN, sizeof(uint32), _polishRecordLen, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:155:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 155 | fread(&_maxEST, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:156:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 156 | fread(&_maxGEN, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:161:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 161 | fread( _ESTiidLocation, sizeof(uint32), _maxEST, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polishFile.C:162:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 162 | fread( _GENiidLocation, sizeof(uint32), _maxGEN, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polishReader.o -c /<>/libsim4/sim4polish/sim4polishReader.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polishReader.H:4, from /<>/libsim4/sim4polish/sim4polishReader.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/sim4polish/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libsim4/sim4polish/sim4polishWriter.o -c /<>/libsim4/sim4polish/sim4polishWriter.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4polish/sim4polishWriter.H:4, from /<>/libsim4/sim4polish/sim4polishWriter.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ rm -f /<>/libsim4/libsim4.a && ar ruvs /<>/libsim4/libsim4.a /<>/libsim4/sim4core/sim4command.o /<>/libsim4/sim4core/sim4parameters.o /<>/libsim4/sim4core/sim4string.o /<>/libsim4/sim4core/Xtend1.o /<>/libsim4/sim4core/align.o /<>/libsim4/sim4core/exon_cores.o /<>/libsim4/sim4core/extend.o /<>/libsim4/sim4core/glimmerSplice.o /<>/libsim4/sim4core/greedy.o /<>/libsim4/sim4core/mspManager.o /<>/libsim4/sim4core/pluri_align.o /<>/libsim4/sim4core/poly.o /<>/libsim4/sim4core/sim4b1.o /<>/libsim4/sim4core/sim4b1a.o /<>/libsim4/sim4core/sim4b1-1.o /<>/libsim4/sim4core/sim4b1-2.o /<>/libsim4/sim4core/sim4b1-3.o /<>/libsim4/sim4core/sim4b1-4.o /<>/libsim4/sim4core/sim4b1_s.o /<>/libsim4/sim4core/sites.o /<>/libsim4/sim4core/sites_donor.o /<>/libsim4/sim4core/sites_acceptor.o /<>/libsim4/sim4core/sites_score.o /<>/libsim4/sim4core/splice.o /<>/libsim4/sim4core/table.o /<>/libsim4/sim4core/util.o /<>/libsim4/sim4polish/sim4polish-compare.o /<>/libsim4/sim4polish/sim4polish-copy.o /<>/libsim4/sim4polish/sim4polish-deleteexon.o /<>/libsim4/sim4polish/sim4polish-exons.o /<>/libsim4/sim4polish/sim4polish-polishtostring.o /<>/libsim4/sim4polish/sim4polish-read.o /<>/libsim4/sim4polish/sim4polish-stringtopolish.o /<>/libsim4/sim4polish/sim4polish-updatescores.o /<>/libsim4/sim4polish/sim4polish.o /<>/libsim4/sim4polish/sim4polishList.o /<>/libsim4/sim4polish/sim4polishBuilder.o /<>/libsim4/sim4polish/sim4polishFile.o /<>/libsim4/sim4polish/sim4polishReader.o /<>/libsim4/sim4polish/sim4polishWriter.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libsim4/libsim4.a a - /<>/libsim4/sim4core/sim4command.o a - /<>/libsim4/sim4core/sim4parameters.o a - /<>/libsim4/sim4core/sim4string.o a - /<>/libsim4/sim4core/Xtend1.o a - /<>/libsim4/sim4core/align.o a - /<>/libsim4/sim4core/exon_cores.o a - /<>/libsim4/sim4core/extend.o a - /<>/libsim4/sim4core/glimmerSplice.o a - /<>/libsim4/sim4core/greedy.o a - /<>/libsim4/sim4core/mspManager.o a - /<>/libsim4/sim4core/pluri_align.o a - /<>/libsim4/sim4core/poly.o a - /<>/libsim4/sim4core/sim4b1.o a - /<>/libsim4/sim4core/sim4b1a.o a - /<>/libsim4/sim4core/sim4b1-1.o a - /<>/libsim4/sim4core/sim4b1-2.o a - /<>/libsim4/sim4core/sim4b1-3.o a - /<>/libsim4/sim4core/sim4b1-4.o a - /<>/libsim4/sim4core/sim4b1_s.o a - /<>/libsim4/sim4core/sites.o a - /<>/libsim4/sim4core/sites_donor.o a - /<>/libsim4/sim4core/sites_acceptor.o a - /<>/libsim4/sim4core/sites_score.o a - /<>/libsim4/sim4core/splice.o a - /<>/libsim4/sim4core/table.o a - /<>/libsim4/sim4core/util.o a - /<>/libsim4/sim4polish/sim4polish-compare.o a - /<>/libsim4/sim4polish/sim4polish-copy.o a - /<>/libsim4/sim4polish/sim4polish-deleteexon.o a - /<>/libsim4/sim4polish/sim4polish-exons.o a - /<>/libsim4/sim4polish/sim4polish-polishtostring.o a - /<>/libsim4/sim4polish/sim4polish-read.o a - /<>/libsim4/sim4polish/sim4polish-stringtopolish.o a - /<>/libsim4/sim4polish/sim4polish-updatescores.o a - /<>/libsim4/sim4polish/sim4polish.o a - /<>/libsim4/sim4polish/sim4polishList.o a - /<>/libsim4/sim4polish/sim4polishBuilder.o a - /<>/libsim4/sim4polish/sim4polishFile.o a - /<>/libsim4/sim4polish/sim4polishReader.o a - /<>/libsim4/sim4polish/sim4polishWriter.o g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/fastaFile.o -c /<>/libseq/fastaFile.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/fastaFile.H:4, from /<>/libseq/fastaFile.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/fastaFile.C:151:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 151 | fprintf(stderr, "fastaFile::getSequence(full)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastaFile.C:151:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 151 | fprintf(stderr, "fastaFile::getSequence(full)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastaFile.C:252:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 252 | fprintf(stderr, "fastaFile::getSequence(part)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastaFile.C:252:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 252 | fprintf(stderr, "fastaFile::getSequence(part)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastaFile.C: In member function ‘void fastaFile::loadIndex(char*)’: /<>/libseq/fastaFile.C:357:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 357 | fread(&_header, sizeof(fastaFileHeader), 1, I); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/fastaFile.C:379:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 379 | fread(_index, sizeof(fastaFileIndex), _header._numberOfSequences, I); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/fastaFile.C:380:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 380 | fread(_names, sizeof(char), _header._namesLength, I); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/fastaStdin.o -c /<>/libseq/fastaStdin.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/fastaStdin.H:4, from /<>/libseq/fastaStdin.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/fastaStdin.C: In member function ‘virtual bool fastaStdin::getSequence(uint32, char*&, uint32&, uint32&, char*&, uint32&, uint32&)’: /<>/libseq/fastaStdin.C:110:9: warning: unused variable ‘ret’ [-Wunused-variable] 110 | bool ret = true; | ^~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/fastqFile.o -c /<>/libseq/fastqFile.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/fastqFile.H:4, from /<>/libseq/fastqFile.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/fastqFile.C:141:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 141 | fprintf(stderr, "fastqFile::getSequence(full)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastqFile.C:141:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 141 | fprintf(stderr, "fastqFile::getSequence(full)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastqFile.C:253:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 253 | fprintf(stderr, "fastqFile::getSequence(part)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastqFile.C:253:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 253 | fprintf(stderr, "fastqFile::getSequence(part)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/fastqFile.C:533:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 533 | fprintf(stderr, "REALLOC len="uint32FMT" from "uint32FMT" to "uint32FMT"\n", indexLen, indexMax, indexMax * 2); | ^ /<>/libseq/fastqFile.C:533:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 533 | fprintf(stderr, "REALLOC len="uint32FMT" from "uint32FMT" to "uint32FMT"\n", indexLen, indexMax, indexMax * 2); | ^ /<>/libseq/fastqFile.C:533:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 533 | fprintf(stderr, "REALLOC len="uint32FMT" from "uint32FMT" to "uint32FMT"\n", indexLen, indexMax, indexMax * 2); | ^ /<>/libseq/fastqFile.C: In member function ‘void fastqFile::loadIndex(char*)’: /<>/libseq/fastqFile.C:354:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 354 | fread(&_header, sizeof(fastqFileHeader), 1, I); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/fastqFile.C:374:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 374 | fread(_index, sizeof(fastqFileIndex), _header._numberOfSequences, I); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/fastqFile.C:375:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 375 | fread(_names, sizeof(char), _header._namesLength, I); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/fastqStdin.o -c /<>/libseq/fastqStdin.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/fastqStdin.H:4, from /<>/libseq/fastqStdin.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/fastqStdin.C: In member function ‘virtual bool fastqStdin::getSequence(uint32, char*&, uint32&, uint32&, char*&, uint32&, uint32&)’: /<>/libseq/fastqStdin.C:110:9: warning: unused variable ‘ret’ [-Wunused-variable] 110 | bool ret = true; | ^~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/seqStore.o -c /<>/libseq/seqStore.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/seqStore.H:4, from /<>/libseq/seqStore.C:2: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/seqStore.C:129:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "seqStore::getSequence(full)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/seqStore.C:129:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "seqStore::getSequence(full)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/seqStore.C:197:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 197 | fprintf(stderr, "seqStore::getSequence(part)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/seqStore.C:197:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 197 | fprintf(stderr, "seqStore::getSequence(part)-- iid "uint32FMT" more than number of sequences "uint32FMT"\n", | ^ /<>/libseq/seqStore.C:203:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stderr, "seqStore::getSequence(part)-- for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n", | ^ /<>/libseq/seqStore.C:203:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stderr, "seqStore::getSequence(part)-- for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n", | ^ /<>/libseq/seqStore.C:203:96: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stderr, "seqStore::getSequence(part)-- for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n", | ^ /<>/libseq/seqStore.C:203:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stderr, "seqStore::getSequence(part)-- for iid "uint32FMT"; invalid bgn="uint32FMT" end="uint32FMT"; seqLen="uint32FMT"\n", | ^ /<>/libseq/seqStore.C:463:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 463 | fprintf(stderr, "constructSeqStore()-- sequence %s too long, must be shorter than "uint64FMT" Gbp.\n", | ^ /<>/libseq/seqStore.C:467:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 467 | fprintf(stderr, "constructSeqStore()-- too many sequences, must be fewer than "uint64FMT".\n", | ^ /<>/libseq/seqStore.C:620:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 620 | fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n", | ^ /<>/libseq/seqStore.C:620:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 620 | fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n", | ^ /<>/libseq/seqStore.C:620:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 620 | fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n", | ^ /<>/libseq/seqStore.C:620:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 620 | fprintf(stderr, "constructSeqStore()-- seqStore '%s' constructed ("uint32FMT" sequences, "uint64FMT" ACGT letters, "uint32FMT" ACGT blocks, "uint32FMT" GAP blocks).\n", | ^ /<>/libseq/seqStore.C: In function ‘void constructSeqStore(char*, seqCache*)’: /<>/libseq/seqStore.C:410:9: warning: ‘memset’ used with constant zero length parameter; this could be due to transposed parameters [-Wmemset-transposed-args] 410 | memset(&HEAD, sizeof(seqStoreHeader), 0); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C: In constructor ‘seqStore::seqStore(const char*)’: /<>/libseq/seqStore.C:21:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 21 | fread(&_header, sizeof(seqStoreHeader), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C: In member function ‘virtual seqFile* seqStore::openFile(const char*)’: /<>/libseq/seqStore.C:73:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 73 | fread(&magic1, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C:74:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 74 | fread(&magic2, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C: In member function ‘void seqStore::loadIndex()’: /<>/libseq/seqStore.C:318:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 318 | fread(&_header, sizeof(seqStoreHeader), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C:329:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 329 | fread( _index, sizeof(seqStoreIndex), _header._numberOfSequences, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C:343:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 343 | fread( _block, sizeof(seqStoreBlock), _header._numberOfBlocks, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/seqStore.C:347:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 347 | fread( _names, sizeof(char), _header._namesLength, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/sffFile.o -c /<>/libseq/sffFile.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/sffFile.H:4, from /<>/libseq/sffFile.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/seqFactory.o -c /<>/libseq/seqFactory.C In file included from /<>/libseq/seqFactory.H:4, from /<>/libseq/seqFactory.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libseq/fastaFile.H:4, from /<>/libseq/seqFactory.C:3: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/seqCache.o -c /<>/libseq/seqCache.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/seqCache.H:4, from /<>/libseq/seqCache.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/seqCache.C:171:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stderr, "seqCache::loadAllSequences()-- Failed to load iid "uint32FMT".\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/seqStream.o -c /<>/libseq/seqStream.C In file included from /<>/libseq/seqFactory.H:4, from /<>/libseq/seqStream.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libseq/seqStream.H:4, from /<>/libseq/seqStream.C:2: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libseq/seqStream.C:236:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 236 | fprintf(stderr, "seqStream::setRange()-- ERROR: range ("uint64FMT","uint64FMT") too big; only "uint64FMT" positions.\n", | ^ /<>/libseq/seqStream.C:236:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 236 | fprintf(stderr, "seqStream::setRange()-- ERROR: range ("uint64FMT","uint64FMT") too big; only "uint64FMT" positions.\n", | ^ /<>/libseq/seqStream.C:236:82: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 236 | fprintf(stderr, "seqStream::setRange()-- ERROR: range ("uint64FMT","uint64FMT") too big; only "uint64FMT" positions.\n", | ^ /<>/libseq/seqStream.C:268:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 268 | fprintf(stderr, "seqStream::sequenceNumberOfPosition()-- WARNING: position p="uint64FMT" too big; only "uint64FMT" positions.\n", | ^ /<>/libseq/seqStream.C:268:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 268 | fprintf(stderr, "seqStream::sequenceNumberOfPosition()-- WARNING: position p="uint64FMT" too big; only "uint64FMT" positions.\n", | ^ /<>/libseq/seqStream.C:340:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 340 | fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #1 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n", | ^ /<>/libseq/seqStream.C:340:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 340 | fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #1 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n", | ^ /<>/libseq/seqStream.C:340:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 340 | fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #1 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n", | ^ /<>/libseq/seqStream.C:386:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 386 | fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #2 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n", | ^ /<>/libseq/seqStream.C:386:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 386 | fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #2 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n", | ^ /<>/libseq/seqStream.C:386:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 386 | fprintf(stderr, "seqStream::fillBuffer()-- Failed to getSequence(part) #2 iid="uint32FMT" bgn="uint32FMT" end="uint32FMT"\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/merStream.o -c /<>/libseq/merStream.C In file included from /<>/libutil/util++.H:4, from /<>/libseq/merStream.H:4, from /<>/libseq/merStream.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/test-seqCache.o -c /<>/libseq/test-seqCache.C In file included from /<>/libseq/test-seqCache.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libseq/seqCache.H:4, from /<>/libseq/test-seqCache.C:3: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/libseq/test-seqCache.C:7: /<>/libseq/test-correctSequence.H:33:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stderr, "generateCorrectSequence()-- Using seed "uint32FMT"\n", seed); | ^ /<>/libseq/test-correctSequence.H:34:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-correctSequence.H:34:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-correctSequence.H:34:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-seqCache.C:15:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 15 | fprintf(stderr, "testID:"uint32FMT" - empty sequence\n", testID); | ^ /<>/libseq/test-seqCache.C:22:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 22 | fprintf(stderr, "testID:"uint32FMT" - header differs '%s' vs '%s'\n", testID, S->header(), correctSequence[sid].header); | ^ /<>/libseq/test-seqCache.C:26:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 26 | fprintf(stderr, "testID:"uint32FMT" - header length differs "uint32FMT" vs "uint32FMT"\n", testID, S->headerLength(), correctSequence[sid].headerLength); | ^ /<>/libseq/test-seqCache.C:26:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 26 | fprintf(stderr, "testID:"uint32FMT" - header length differs "uint32FMT" vs "uint32FMT"\n", testID, S->headerLength(), correctSequence[sid].headerLength); | ^ /<>/libseq/test-seqCache.C:26:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 26 | fprintf(stderr, "testID:"uint32FMT" - header length differs "uint32FMT" vs "uint32FMT"\n", testID, S->headerLength(), correctSequence[sid].headerLength); | ^ /<>/libseq/test-seqCache.C:30:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 30 | fprintf(stderr, "testID:"uint32FMT" - sequence differs\n", testID); | ^ /<>/libseq/test-seqCache.C:34:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "testID:"uint32FMT" - sequence length differs strlen "uint32FMT" vs "uint32FMT"\n", testID, (uint32)strlen(S->sequence()), correctSequence[sid].sequenceLength); | ^ /<>/libseq/test-seqCache.C:34:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "testID:"uint32FMT" - sequence length differs strlen "uint32FMT" vs "uint32FMT"\n", testID, (uint32)strlen(S->sequence()), correctSequence[sid].sequenceLength); | ^ /<>/libseq/test-seqCache.C:34:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "testID:"uint32FMT" - sequence length differs strlen "uint32FMT" vs "uint32FMT"\n", testID, (uint32)strlen(S->sequence()), correctSequence[sid].sequenceLength); | ^ /<>/libseq/test-seqCache.C:38:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 38 | fprintf(stderr, "testID:"uint32FMT" - sequence length differs "uint32FMT" vs "uint32FMT"\n", testID, S->sequenceLength(), correctSequence[sid].sequenceLength); | ^ /<>/libseq/test-seqCache.C:38:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 38 | fprintf(stderr, "testID:"uint32FMT" - sequence length differs "uint32FMT" vs "uint32FMT"\n", testID, S->sequenceLength(), correctSequence[sid].sequenceLength); | ^ /<>/libseq/test-seqCache.C:38:77: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 38 | fprintf(stderr, "testID:"uint32FMT" - sequence length differs "uint32FMT" vs "uint32FMT"\n", testID, S->sequenceLength(), correctSequence[sid].sequenceLength); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/test-seqStream.o -c /<>/libseq/test-seqStream.C In file included from /<>/libseq/test-seqStream.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libseq/seqCache.H:4, from /<>/libseq/test-seqStream.C:3: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/libseq/test-seqStream.C:7: /<>/libseq/test-correctSequence.H:33:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stderr, "generateCorrectSequence()-- Using seed "uint32FMT"\n", seed); | ^ /<>/libseq/test-correctSequence.H:34:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-correctSequence.H:34:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-correctSequence.H:34:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-seqStream.C:17:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | fprintf(stderr, "testIndexing()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen); | ^ /<>/libseq/test-seqStream.C:17:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | fprintf(stderr, "testIndexing()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen); | ^ /<>/libseq/test-seqStream.C:55:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "lengthOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n", | ^ /<>/libseq/test-seqStream.C:55:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "lengthOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n", | ^ /<>/libseq/test-seqStream.C:55:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "lengthOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n", | ^ /<>/libseq/test-seqStream.C:60:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 60 | fprintf(stderr, "startOf "uint32FMT" returned "uint64FMT", not correct "uint64FMT"\n", | ^ /<>/libseq/test-seqStream.C:60:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 60 | fprintf(stderr, "startOf "uint32FMT" returned "uint64FMT", not correct "uint64FMT"\n", | ^ /<>/libseq/test-seqStream.C:60:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 60 | fprintf(stderr, "startOf "uint32FMT" returned "uint64FMT", not correct "uint64FMT"\n", | ^ /<>/libseq/test-seqStream.C:65:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(stderr, "IIDOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n", | ^ /<>/libseq/test-seqStream.C:65:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(stderr, "IIDOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n", | ^ /<>/libseq/test-seqStream.C:65:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(stderr, "IIDOf "uint32FMT" returned "uint32FMT", not correct "uint32FMT"\n", | ^ /<>/libseq/test-seqStream.C:74:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 74 | fprintf(stderr, "sequenceNumberOfPosition "uint64FMT" returned "uint32FMT", not correct "uint32FMT".\n", | ^ /<>/libseq/test-seqStream.C:74:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 74 | fprintf(stderr, "sequenceNumberOfPosition "uint64FMT" returned "uint32FMT", not correct "uint32FMT".\n", | ^ /<>/libseq/test-seqStream.C:74:82: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 74 | fprintf(stderr, "sequenceNumberOfPosition "uint64FMT" returned "uint32FMT", not correct "uint32FMT".\n", | ^ /<>/libseq/test-seqStream.C:95:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 95 | fprintf(stderr, "wrong separator at sep "uint32FMT" got %d expected %d\n", x, s, sep); | ^ /<>/libseq/test-seqStream.C:124:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- letter wrong got'%c'\n", sp, si, st, ch, chainSeq[sib]); | ^ /<>/libseq/test-seqStream.C:124:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- letter wrong got'%c'\n", sp, si, st, ch, chainSeq[sib]); | ^ /<>/libseq/test-seqStream.C:124:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- letter wrong got'%c'\n", sp, si, st, ch, chainSeq[sib]); | ^ /<>/libseq/test-seqStream.C:128:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]); | ^ /<>/libseq/test-seqStream.C:128:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]); | ^ /<>/libseq/test-seqStream.C:128:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]); | ^ /<>/libseq/test-seqStream.C:128:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqPos wrong got "uint32FMT"\n", sp, si, st, ch, chainSeqPos[sib]); | ^ /<>/libseq/test-seqStream.C:132:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]); | ^ /<>/libseq/test-seqStream.C:132:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]); | ^ /<>/libseq/test-seqStream.C:132:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]); | ^ /<>/libseq/test-seqStream.C:132:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- seqIID wrong got"uint32FMT"\n", sp, si, st, ch, chainSeqIID[sib]); | ^ /<>/libseq/test-seqStream.C:136:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]); | ^ /<>/libseq/test-seqStream.C:136:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]); | ^ /<>/libseq/test-seqStream.C:136:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]); | ^ /<>/libseq/test-seqStream.C:136:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "sp="uint32FMT" si="uint32FMT" st="uint64FMT" ch=%c -- strPos wrong got "uint64FMT"\n", sp, si, st, ch, chainStrPos[sib]); | ^ /<>/libseq/test-seqStream.C:145:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 145 | fprintf(stderr, "iterated length wrong; sib="uint32FMT" sie="uint32FMT"\n", sib, sie); | ^ /<>/libseq/test-seqStream.C:145:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 145 | fprintf(stderr, "iterated length wrong; sib="uint32FMT" sie="uint32FMT"\n", sib, sie); | ^ /<>/libseq/test-seqStream.C:159:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 159 | fprintf(stderr, "testChaining()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen); | ^ /<>/libseq/test-seqStream.C:159:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 159 | fprintf(stderr, "testChaining()-- numSeq="uint32FMT" sep=%c sepLen="uint32FMT"\n", numSeq, sep, sepLen); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libseq/test-merStream.o -c /<>/libseq/test-merStream.C In file included from /<>/libseq/test-merStream.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libseq/seqCache.H:4, from /<>/libseq/test-merStream.C:3: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/libseq/test-merStream.C:7: /<>/libseq/test-correctSequence.H:33:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stderr, "generateCorrectSequence()-- Using seed "uint32FMT"\n", seed); | ^ /<>/libseq/test-correctSequence.H:34:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-correctSequence.H:34:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-correctSequence.H:34:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(stderr, "generateCorrectSequence()-- Generating "uint32FMT" sequences of length "uint32FMT" to "uint32FMT"\n", numSeq, minLen, maxLen); | ^ /<>/libseq/test-merStream.C:11:2: warning: #warning HOW DO WE TEST IF WE GET ALL THE MERS? [-Wcpp] 11 | #warning HOW DO WE TEST IF WE GET ALL THE MERS? | ^~~~~~~ /<>/libseq/test-merStream.C:33:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n", | ^ /<>/libseq/test-merStream.C:33:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n", | ^ /<>/libseq/test-merStream.C:33:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n", | ^ /<>/libseq/test-merStream.C:33:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 33 | fprintf(stdout, "MS pos="uint32FMT" posInSeq="uint64FMT" posInStr="uint64FMT" seqNum="uint64FMT"\n", | ^ /<>/libseq/test-merStream.C:39:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 39 | fprintf(stdout, "MS pos="uint32FMT" failed '%s' != '%s'.\n", pos, testmer, seq + pos); | ^ /<>/libseq/test-merStream.C:124:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "mer stream position out of range; at "uint32FMT", range "uint32FMT"-"uint32FMT"\n", | ^ /<>/libseq/test-merStream.C:124:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "mer stream position out of range; at "uint32FMT", range "uint32FMT"-"uint32FMT"\n", | ^ /<>/libseq/test-merStream.C:124:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "mer stream position out of range; at "uint32FMT", range "uint32FMT"-"uint32FMT"\n", | ^ /<>/libseq/test-merStream.C: In function ‘int main(int, char**)’: /<>/libseq/test-merStream.C:223:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 223 | testMerStreamSimple(MS, 20, "GGGTCAACTCCGCCCGCACTCTAGC", SP); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/test-merStream.C:225:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 225 | testMerStreamSimple(MS, 20, "GGGTCAACTCCGCCCGCACTCTAGC", SP); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/test-merStream.C:228:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 228 | testMerStreamSimple(MS, 20, "GGGTCAACTCCGCCCGCACTCTAGC", SP); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/test-merStream.C:243:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 243 | testMerStreamSimple(MS, 20, "GATCACTCGCGCACTCTAGCA", SP); | ^~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/test-merStream.C:245:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 245 | testMerStreamSimple(MS, 20, "GATCACTCGCGCACTCTAGCA", SP); | ^~~~~~~~~~~~~~~~~~~~~~~ /<>/libseq/test-merStream.C:248:33: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 248 | testMerStreamSimple(MS, 20, "GATCACTCGCGCACTCTAGCA", SP); | ^~~~~~~~~~~~~~~~~~~~~~~ rm -f /<>/libseq/libseq.a && ar ruvs /<>/libseq/libseq.a /<>/libseq/fastaFile.o /<>/libseq/fastaStdin.o /<>/libseq/fastqFile.o /<>/libseq/fastqStdin.o /<>/libseq/seqStore.o /<>/libseq/sffFile.o /<>/libseq/seqFactory.o /<>/libseq/seqCache.o /<>/libseq/seqStream.o /<>/libseq/merStream.o /<>/libseq/test-seqCache.o /<>/libseq/test-seqStream.o /<>/libseq/test-merStream.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libseq/libseq.a a - /<>/libseq/fastaFile.o a - /<>/libseq/fastaStdin.o a - /<>/libseq/fastqFile.o a - /<>/libseq/fastqStdin.o a - /<>/libseq/seqStore.o a - /<>/libseq/sffFile.o a - /<>/libseq/seqFactory.o a - /<>/libseq/seqCache.o a - /<>/libseq/seqStream.o a - /<>/libseq/merStream.o a - /<>/libseq/test-seqCache.o a - /<>/libseq/test-seqStream.o a - /<>/libseq/test-merStream.o gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libbio/alphabet.o -c /<>/libbio/alphabet.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libbio/alphabet-acgtspace.o -c /<>/libbio/alphabet-acgtspace.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libbio/alphabet-colorspace.o -c /<>/libbio/alphabet-colorspace.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libbio/halign.o -c /<>/libbio/halign.c /<>/libbio/halign.c: In function ‘align_path’: /<>/libbio/halign.c:385:7: warning: ‘head2’ may be used uninitialized [-Wmaybe-uninitialized] 385 | if (head2) *tail = tail2; | ^~~~~ /<>/libbio/halign.c:163:32: note: ‘head2’ declared here 163 | edit_script *head1, *tail1, *head2, *tail2; | ^~~~~ gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libbio/reversecomplement.o -c /<>/libbio/reversecomplement.c g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libbio/kmer.o -c /<>/libbio/kmer.C In file included from /<>/libbio/kmer.H:28, from /<>/libbio/kmer.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/kmer.H:29: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ rm -f /<>/libbio/libbio.a && ar ruvs /<>/libbio/libbio.a /<>/libbio/alphabet.o /<>/libbio/alphabet-acgtspace.o /<>/libbio/alphabet-colorspace.o /<>/libbio/halign.o /<>/libbio/reversecomplement.o /<>/libbio/kmer.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libbio/libbio.a a - /<>/libbio/alphabet.o a - /<>/libbio/alphabet-acgtspace.o a - /<>/libbio/alphabet-colorspace.o a - /<>/libbio/halign.o a - /<>/libbio/reversecomplement.o a - /<>/libbio/kmer.o gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/file.o -c /<>/libutil/file.c /<>/libutil/file.c: In function ‘openFile’: /<>/libutil/file.c:382:9: warning: variable ‘isRW’ set but not used [-Wunused-but-set-variable] 382 | int isRW = 1; | ^~~~ gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/md5.o -c /<>/libutil/md5.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/palloc.o -c /<>/libutil/palloc.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/qsort_mt.o -c /<>/libutil/qsort_mt.c /<>/libutil/qsort_mt.c: In function ‘qsort_algo’: /<>/libutil/qsort_mt.c:264:13: warning: variable ‘id’ set but not used [-Wunused-but-set-variable] 264 | pthread_t id; | ^~ /<>/libutil/qsort_mt.c: In function ‘qsort_thread’: /<>/libutil/qsort_mt.c:370:13: warning: variable ‘id’ set but not used [-Wunused-but-set-variable] 370 | pthread_t id; | ^~ gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/util.o -c /<>/libutil/util.c g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/bigQueue.o -c /<>/libutil/bigQueue.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/bigQueue.H:4, from /<>/libutil/bigQueue.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libutil/bigQueue.C: In member function ‘void bigQueue::mergeTemporaryFiles()’: /<>/libutil/bigQueue.C:204:16: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 204 | fread(thing, _objectSize, 1, _temporaryFiles[i]); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/bigQueue.C:255:14: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 255 | fread(thing, _objectSize, 1, _temporaryFiles[fileid]); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/bigQueue.C: In member function ‘bool bigQueue::next()’: /<>/libutil/bigQueue.C:302:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 302 | fread(_thingBuffer, _objectSize, 1, _temporaryFiles[0]); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/bitPackedArray.o -c /<>/libutil/bitPackedArray.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/bitPackedArray.C:8: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libutil/bitPackedArray.C:35:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 35 | fprintf(stderr, "bitPackedArray::get()-- element index "uint64FMT" is out of range, only "uint64FMT" elements.\n", | ^ /<>/libutil/bitPackedArray.C:35:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 35 | fprintf(stderr, "bitPackedArray::get()-- element index "uint64FMT" is out of range, only "uint64FMT" elements.\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/bitPackedFile.o -c /<>/libutil/bitPackedFile.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/bitPackedFile.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libutil/bitPackedFile.C:168:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 168 | fprintf(stderr, " at position "uint64HEX"\n", file_offset); | ^ /<>/libutil/bitPackedFile.C:367:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 367 | fprintf(stderr, "bitPackedFile::seekNormal() '%s' seek to pos="uint64FMT" failed: %s\n", | ^ /<>/libutil/bitPackedFile.C:376:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 376 | fprintf(stderr, "bitPackedFile::seekNormal() '%s' read of "uint64FMT" bytes failed': %s\n", | ^ /<>/libutil/bitPackedFile.C: In constructor ‘bitPackedFile::bitPackedFile(const char*, uint64, bool)’: /<>/libutil/bitPackedFile.C:109:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 109 | write(_file, t, sizeof(char) * 16); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/bitPackedFile.C:110:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 110 | write(_file, &at, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/bitPackedFile.C:111:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 111 | write(_file, &bt, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/bitPackedFile.C: In member function ‘void bitPackedFile::flushDirty()’: /<>/libutil/bitPackedFile.C:232:8: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 232 | write(_file, _bfr, sizeof(uint64) * _bfrmax); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/fibonacciNumbers.o -c /<>/libutil/fibonacciNumbers.C In file included from /<>/libutil/fibonacciNumbers.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/readBuffer.o -c /<>/libutil/readBuffer.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/readBuffer.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libutil/readBuffer.C:132:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "readBuffer::fillBuffer()-- only read "uint64FMT" bytes, couldn't read "uint64FMT" bytes from '%s': %s\n", | ^ /<>/libutil/readBuffer.C:132:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "readBuffer::fillBuffer()-- only read "uint64FMT" bytes, couldn't read "uint64FMT" bytes from '%s': %s\n", | ^ /<>/libutil/readBuffer.C:165:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 165 | fprintf(stderr, "readBuffer()-- '%s' couldn't seek to position "int64FMT": %s\n", | ^ /<>/libutil/readBuffer.C:228:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 228 | fprintf(stderr, "readBuffer()-- couldn't read "uint64FMT" bytes from '%s': n%s\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/recordFile.o -c /<>/libutil/recordFile.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/recordFile.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libutil/recordFile.C:227:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 227 | fprintf(stderr, "recordFile::seek() '%s' seek to record="uint64FMT" at fileposition="uint64FMT" failed: %s\n", | ^ /<>/libutil/recordFile.C:227:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 227 | fprintf(stderr, "recordFile::seek() '%s' seek to record="uint64FMT" at fileposition="uint64FMT" failed: %s\n", | ^ /<>/libutil/recordFile.C:233:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 233 | fprintf(stderr, "recordFile::seek() '%s' read of "uint64FMT" bytes failed at record "uint64FMT", fileposition "uint64FMT"': %s\n", | ^ /<>/libutil/recordFile.C:233:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 233 | fprintf(stderr, "recordFile::seek() '%s' read of "uint64FMT" bytes failed at record "uint64FMT", fileposition "uint64FMT"': %s\n", | ^ /<>/libutil/recordFile.C:233:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 233 | fprintf(stderr, "recordFile::seek() '%s' read of "uint64FMT" bytes failed at record "uint64FMT", fileposition "uint64FMT"': %s\n", | ^ /<>/libutil/recordFile.C: In constructor ‘recordFile::recordFile(const char*, uint32, uint32, char)’: /<>/libutil/recordFile.C:68:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 68 | write(_file, &recordFileMagic1, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:69:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 69 | write(_file, &recordFileMagic2, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:70:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 70 | write(_file, &_numRecords, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:71:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 71 | write(_file, &_recordSize, sizeof(uint32)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:72:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 72 | write(_file, &_headerSize, sizeof(uint32)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:73:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 73 | write(_file, _header, sizeof(char) * _headerSize); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:112:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 112 | read(_file, &m1, sizeof(uint64)); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:113:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 113 | read(_file, &m2, sizeof(uint64)); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:114:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 114 | read(_file, &_numRecords, sizeof(uint64)); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:115:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 115 | read(_file, &_recordSize, sizeof(uint32)); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:116:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 116 | read(_file, &_headerSize, sizeof(uint32)); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:117:9: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 117 | read(_file, _header, sizeof(char) * _headerSize); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C: In destructor ‘recordFile::~recordFile()’: /<>/libutil/recordFile.C:151:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 151 | write(_file, &recordFileMagic1, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:152:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 152 | write(_file, &recordFileMagic2, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:153:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 153 | write(_file, &_numRecords, sizeof(uint64)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:154:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 154 | write(_file, &_recordSize, sizeof(uint32)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:155:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 155 | write(_file, &_headerSize, sizeof(uint32)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C:156:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 156 | write(_file, _header, sizeof(char) * _headerSize); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C: In member function ‘void recordFile::flushDirty()’: /<>/libutil/recordFile.C:197:8: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 197 | write(_file, _bfr, _recordSize * _rec); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/recordFile.C: In member function ‘void recordFile::seek(uint64, bool)’: /<>/libutil/recordFile.C:231:7: warning: ignoring return value of ‘ssize_t read(int, void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 231 | read(_file, _bfr, _recordSize * _bfrmax); | ~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/speedCounter.o -c /<>/libutil/speedCounter.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/speedCounter.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/sweatShop.o -c /<>/libutil/sweatShop.C In file included from /<>/libutil/util++.H:4, from /<>/libutil/sweatShop.H:7, from /<>/libutil/sweatShop.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libutil/sweatShop.C:127:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "sweatShop::setThreadData()-- worker ID "uint32FMT" more than number of workers="uint32FMT"\n", t, _numberOfWorkers), exit(1); | ^ /<>/libutil/sweatShop.C:127:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "sweatShop::setThreadData()-- worker ID "uint32FMT" more than number of workers="uint32FMT"\n", t, _numberOfWorkers), exit(1); | ^ /<>/libutil/sweatShop.C:390:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r", | ^ /<>/libutil/sweatShop.C:390:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r", | ^ /<>/libutil/sweatShop.C:390:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r", | ^ /<>/libutil/sweatShop.C:390:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r", | ^ /<>/libutil/sweatShop.C:390:135: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" loaded; "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" written; "uint64FMTW(8)" queued for output)\r", | ^ /<>/libutil/sweatShop.C:425:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 425 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" queued for output)\n", | ^ /<>/libutil/sweatShop.C:425:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 425 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" queued for output)\n", | ^ /<>/libutil/sweatShop.C:425:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 425 | fprintf(stderr, " %6.1f/s - "uint64FMTW(8)" queued for compute; "uint64FMTW(8)" finished; "uint64FMTW(8)" queued for output)\n", | ^ /<>/libutil/sweatShop.C:560:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 560 | fprintf(stderr, "sweatShop::run()-- Failed to launch worker thread "uint32FMT": %s.\n", i, strerror(err)), exit(1); | ^ /<>/libutil/sweatShop.C:580:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 580 | fprintf(stderr, "sweatShop::run()-- Failed to join worker thread "uint32FMT": %s.\n", i, strerror(err)), exit(1); | ^ gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/kazlib/dict.o -c /<>/libutil/kazlib/dict.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/kazlib/except.o -c /<>/libutil/kazlib/except.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/kazlib/hash.o -c /<>/libutil/kazlib/hash.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/kazlib/list.o -c /<>/libutil/kazlib/list.c gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/kazlib/sfx.o -c /<>/libutil/kazlib/sfx.c rm -f /<>/libutil/libutil.a && ar ruvs /<>/libutil/libutil.a /<>/libutil/file.o /<>/libutil/md5.o /<>/libutil/palloc.o /<>/libutil/qsort_mt.o /<>/libutil/util.o /<>/libutil/bigQueue.o /<>/libutil/bitPackedArray.o /<>/libutil/bitPackedFile.o /<>/libutil/fibonacciNumbers.o /<>/libutil/readBuffer.o /<>/libutil/recordFile.o /<>/libutil/speedCounter.o /<>/libutil/sweatShop.o /<>/libutil/mt19937ar/mt19937ar.o /<>/libutil/kazlib/dict.o /<>/libutil/kazlib/except.o /<>/libutil/kazlib/hash.o /<>/libutil/kazlib/list.o /<>/libutil/kazlib/sfx.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libutil/libutil.a a - /<>/libutil/file.o a - /<>/libutil/md5.o a - /<>/libutil/palloc.o a - /<>/libutil/qsort_mt.o a - /<>/libutil/util.o a - /<>/libutil/bigQueue.o a - /<>/libutil/bitPackedArray.o a - /<>/libutil/bitPackedFile.o a - /<>/libutil/fibonacciNumbers.o a - /<>/libutil/readBuffer.o a - /<>/libutil/recordFile.o a - /<>/libutil/speedCounter.o a - /<>/libutil/sweatShop.o a - /<>/libutil/mt19937ar/mt19937ar.o a - /<>/libutil/kazlib/dict.o a - /<>/libutil/kazlib/except.o a - /<>/libutil/kazlib/hash.o a - /<>/libutil/kazlib/list.o a - /<>/libutil/kazlib/sfx.o g++ -Wl,-z,relro -Wl,-z,now -o ESTmapper/terminate ESTmapper/terminate.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacFeature.o -c atac-driver/libatac/atacFeature.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atacFeature.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30, from atac-driver/libatac/atacFeature.C:24: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.C:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "Feature longer than sequence (by "uint32FMT"bp): seqLen="uint32FMTW(8)" %s\n", | ^ atac-driver/libatac/atacFeature.C:109:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "Feature longer than sequence (by "uint32FMT"bp): seqLen="uint32FMTW(8)" %s\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacFeatureList.o -c atac-driver/libatac/atacFeatureList.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atacFeatureList.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30, from atac-driver/libatac/atacFeatureList.C:24: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/atacFeatureList.C: In member function ‘void atacFeatureList::add(atacFeature&)’: atac-driver/libatac/atacFeatureList.C:50:52: warning: operation on ‘((atacFeatureList*)this)->atacFeatureList::_featuresLen’ may be undefined [-Wsequence-point] 50 | _features[_featuresLen].featureiid = _featuresLen++; | ~~~~~~~~~~~~^~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacFile.o -c atac-driver/libatac/atacFile.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atacFile.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30, from atac-driver/libatac/atacFile.C:24: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/atacFile.C: In member function ‘void atacFileBase::readHeader(char*, FILE*)’: atac-driver/libatac/atacFile.C:255:7: warning: the address of ‘atacFileBase::_fileA’ will never be NULL [-Waddress] 255 | if (_fileA && _fileA[0]) { | ^~~~~~ atac-driver/libatac/atac.H:59:22: note: ‘atacFileBase::_fileA’ declared here 59 | char _fileA[1024]; // The name of our genome files | ^~~~~~ atac-driver/libatac/atacFile.C:262:7: warning: the address of ‘atacFileBase::_fileB’ will never be NULL [-Waddress] 262 | if (_fileB && _fileB[0]) { | ^~~~~~ atac-driver/libatac/atac.H:60:22: note: ‘atacFileBase::_fileB’ declared here 60 | char _fileB[1024]; | ^~~~~~ atac-driver/libatac/atacFile.C: In member function ‘atacMatch* atacFileStream::nextMatch(char)’: atac-driver/libatac/atacFile.C:76:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 76 | fgets(_inLine, 1024, _inFile); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~ atac-driver/libatac/atacFile.C: In member function ‘atacFeature* atacFileStream::nextFeature(char*)’: atac-driver/libatac/atacFile.C:105:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 105 | fgets(_inLine, 1024, _inFile); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~ atac-driver/libatac/atacFile.C: In constructor ‘atacFile::atacFile(const char*)’: atac-driver/libatac/atacFile.C:171:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 171 | fgets(inLine, 1024, inFile); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~ atac-driver/libatac/atacFile.C: In member function ‘void atacFileBase::readHeader(char*, FILE*)’: atac-driver/libatac/atacFile.C:206:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 206 | fgets(inLine, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~~~ atac-driver/libatac/atacFile.C:245:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 245 | fgets(inLine, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacFileStreamMerge.o -c atac-driver/libatac/atacFileStreamMerge.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atacFileStreamMerge.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30, from atac-driver/libatac/atacFileStreamMerge.C:24: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/atacFileStreamMerge.C: In member function ‘void atacFileStreamMerge::addFile(const char*)’: atac-driver/libatac/atacFileStreamMerge.C:86:11: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class afsm’; use copy-assignment or copy-initialization instead [-Wclass-memaccess] 86 | memcpy(F, _files, sizeof(afsm) * _filesLen); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ atac-driver/libatac/atacFileStreamMerge.C:27:7: note: ‘class afsm’ declared here 27 | class afsm { | ^~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacMatch.o -c atac-driver/libatac/atacMatch.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atac.H:26, from atac-driver/libatac/atacMatch.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/atacMatch.C:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "Match longer than sequence (by "uint32FMT"bp) in 1: seqLen="uint32FMTW(8)" %s\n", | ^ atac-driver/libatac/atacMatch.C:131:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "Match longer than sequence (by "uint32FMT"bp) in 1: seqLen="uint32FMTW(8)" %s\n", | ^ atac-driver/libatac/atacMatch.C:139:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 139 | fprintf(stderr, "Match longer than sequence (by "uint32FMT"bp) in 2: seqLen="uint32FMTW(8)" %s\n", | ^ atac-driver/libatac/atacMatch.C:139:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 139 | fprintf(stderr, "Match longer than sequence (by "uint32FMT"bp) in 2: seqLen="uint32FMTW(8)" %s\n", | ^ atac-driver/libatac/atacMatch.C: In constructor ‘atacMatch::atacMatch(char*, char*, uint32, char*, uint32, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: atac-driver/libatac/atacMatch.C:50:10: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ specified bound 16 equals destination size [-Wstringop-truncation] 50 | strncpy(matchuid, muid, 16); | ^ atac-driver/libatac/atacMatch.C: In member function ‘void atacMatch::decode(char*)’: atac-driver/libatac/atacMatch.C:100:10: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ specified bound 16 equals destination size [-Wstringop-truncation] 100 | strncpy(matchuid, S[2], 16); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacMatchList.o -c atac-driver/libatac/atacMatchList.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atacMatchList.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30, from atac-driver/libatac/atacMatchList.C:24: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/libatac/atacMatchOrder.o -c atac-driver/libatac/atacMatchOrder.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/libatac/atacMatchOrder.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from atac-driver/libatac/atac.H:30, from atac-driver/libatac/atacMatchOrder.C:24: atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from atac-driver/libatac/atac.H:34: atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from atac-driver/libatac/atac.H:37: atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/libatac/atacMatchOrder.C:38:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 38 | sprintf(n.matchuid, "merge"uint32FMT, mergeuid); | ^ rm -f atac-driver/libatac/libatac.a && ar ruvs atac-driver/libatac/libatac.a atac-driver/libatac/atacFeature.o atac-driver/libatac/atacFeatureList.o atac-driver/libatac/atacFile.o atac-driver/libatac/atacFileStreamMerge.o atac-driver/libatac/atacMatch.o atac-driver/libatac/atacMatchList.o atac-driver/libatac/atacMatchOrder.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating atac-driver/libatac/libatac.a a - atac-driver/libatac/atacFeature.o a - atac-driver/libatac/atacFeatureList.o a - atac-driver/libatac/atacFile.o a - atac-driver/libatac/atacFileStreamMerge.o a - atac-driver/libatac/atacMatch.o a - atac-driver/libatac/atacMatchList.o a - atac-driver/libatac/atacMatchOrder.o g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap.o -c atac-driver/alignOverlap/overlap.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ atac-driver/alignOverlap/overlap.C:123:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 123 | fprintf(stderr, "unmapped: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.unmapped.getSum(), statsB.unmapped.getSum()); | ^ atac-driver/alignOverlap/overlap.C:123:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 123 | fprintf(stderr, "unmapped: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.unmapped.getSum(), statsB.unmapped.getSum()); | ^ atac-driver/alignOverlap/overlap.C:124:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "unique mapping 1: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.map1unique.getSum(), statsB.map1unique.getSum()); | ^ atac-driver/alignOverlap/overlap.C:124:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 124 | fprintf(stderr, "unique mapping 1: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.map1unique.getSum(), statsB.map1unique.getSum()); | ^ atac-driver/alignOverlap/overlap.C:125:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 125 | fprintf(stderr, "unique mapping 2: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.map2unique.getSum(), statsB.map2unique.getSum()); | ^ atac-driver/alignOverlap/overlap.C:125:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 125 | fprintf(stderr, "unique mapping 2: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.map2unique.getSum(), statsB.map2unique.getSum()); | ^ atac-driver/alignOverlap/overlap.C:126:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 126 | fprintf(stderr, "different: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.different.getSum(), statsB.different.getSum()); | ^ atac-driver/alignOverlap/overlap.C:126:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 126 | fprintf(stderr, "different: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.different.getSum(), statsB.different.getSum()); | ^ atac-driver/alignOverlap/overlap.C:127:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "wild diff: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.wilddiff.getSum(), statsB.wilddiff.getSum()); | ^ atac-driver/alignOverlap/overlap.C:127:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "wild diff: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.wilddiff.getSum(), statsB.wilddiff.getSum()); | ^ atac-driver/alignOverlap/overlap.C:128:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "same: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.same.getSum(), statsB.same.getSum()); | ^ atac-driver/alignOverlap/overlap.C:128:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "same: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.same.getSum(), statsB.same.getSum()); | ^ atac-driver/alignOverlap/overlap.C:129:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "inconsistent: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.inconsistent.getSum(), statsB.inconsistent.getSum()); | ^ atac-driver/alignOverlap/overlap.C:129:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "inconsistent: A:"uint32FMTW(10)" B:"uint32FMTW(10)"\n", statsA.inconsistent.getSum(), statsB.inconsistent.getSum()); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap-find.o -c atac-driver/alignOverlap/overlap-find.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap-find.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ atac-driver/alignOverlap/overlap-find.C:45:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 45 | fprintf(stderr, "isolated Unique: map1: "uint32FMT" map2: "uint32FMT"\n", sumA, sumB); | ^ atac-driver/alignOverlap/overlap-find.C:45:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 45 | fprintf(stderr, "isolated Unique: map1: "uint32FMT" map2: "uint32FMT"\n", sumA, sumB); | ^ atac-driver/alignOverlap/overlap-find.C:59:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 59 | fprintf(stderr, "got invalid type; "uint32FMT" -- %c\n", type, (char)type), exit(1); | ^ atac-driver/alignOverlap/overlap-find.C:91:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(stderr, "%s: "uint32FMT" len:"uint32FMT"\n", msg, count, len); | ^ atac-driver/alignOverlap/overlap-find.C:91:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(stderr, "%s: "uint32FMT" len:"uint32FMT"\n", msg, count, len); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap-matchTree.o -c atac-driver/alignOverlap/overlap-matchTree.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap-matchTree.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap-printAnno.o -c atac-driver/alignOverlap/overlap-printAnno.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap-printAnno.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ atac-driver/alignOverlap/overlap-printAnno.C:46:14: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(F, "%c "uint32FMTW(4)":"uint32FMTW(09)"-"uint32FMTW(09)"["uint32FMTW(6)"] ", | ^ atac-driver/alignOverlap/overlap-printAnno.C:46:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(F, "%c "uint32FMTW(4)":"uint32FMTW(09)"-"uint32FMTW(09)"["uint32FMTW(6)"] ", | ^ atac-driver/alignOverlap/overlap-printAnno.C:46:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(F, "%c "uint32FMTW(4)":"uint32FMTW(09)"-"uint32FMTW(09)"["uint32FMTW(6)"] ", | ^ atac-driver/alignOverlap/overlap-printAnno.C:46:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(F, "%c "uint32FMTW(4)":"uint32FMTW(09)"-"uint32FMTW(09)"["uint32FMTW(6)"] ", | ^ atac-driver/alignOverlap/overlap-printAnno.C:63:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 63 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m1->iid2, sta, end); | ^ atac-driver/alignOverlap/overlap-printAnno.C:63:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 63 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m1->iid2, sta, end); | ^ atac-driver/alignOverlap/overlap-printAnno.C:63:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 63 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m1->iid2, sta, end); | ^ atac-driver/alignOverlap/overlap-printAnno.C:65:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m1->iid1, m1->pos1 + off1, m1->pos1 + off1 + len); | ^ atac-driver/alignOverlap/overlap-printAnno.C:65:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m1->iid1, m1->pos1 + off1, m1->pos1 + off1 + len); | ^ atac-driver/alignOverlap/overlap-printAnno.C:65:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m1->iid1, m1->pos1 + off1, m1->pos1 + off1 + len); | ^ atac-driver/alignOverlap/overlap-printAnno.C:69:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 69 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", uint32ZERO, uint32ZERO, uint32ZERO); | ^ atac-driver/alignOverlap/overlap-printAnno.C:69:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 69 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", uint32ZERO, uint32ZERO, uint32ZERO); | ^ atac-driver/alignOverlap/overlap-printAnno.C:69:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 69 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", uint32ZERO, uint32ZERO, uint32ZERO); | ^ atac-driver/alignOverlap/overlap-printAnno.C:85:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 85 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m2->iid2, sta, end); | ^ atac-driver/alignOverlap/overlap-printAnno.C:85:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 85 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m2->iid2, sta, end); | ^ atac-driver/alignOverlap/overlap-printAnno.C:85:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 85 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m2->iid2, sta, end); | ^ atac-driver/alignOverlap/overlap-printAnno.C:87:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m2->iid1, m2->pos1 + off2, m2->pos1 + off2 + len); | ^ atac-driver/alignOverlap/overlap-printAnno.C:87:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m2->iid1, m2->pos1 + off2, m2->pos1 + off2 + len); | ^ atac-driver/alignOverlap/overlap-printAnno.C:87:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", m2->iid1, m2->pos1 + off2, m2->pos1 + off2 + len); | ^ atac-driver/alignOverlap/overlap-printAnno.C:91:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", uint32ZERO, uint32ZERO, uint32ZERO); | ^ atac-driver/alignOverlap/overlap-printAnno.C:91:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", uint32ZERO, uint32ZERO, uint32ZERO); | ^ atac-driver/alignOverlap/overlap-printAnno.C:91:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(F, "("uint32FMTW(8)": "uint32FMTW(9)"-"uint32FMTW(9)") ", uint32ZERO, uint32ZERO, uint32ZERO); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap-sort.o -c atac-driver/alignOverlap/overlap-sort.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap-sort.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ ln -f /<>/atac-driver/alignOverlap/overlap-process.C /<>/atac-driver/alignOverlap/overlap-process1.C g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -DINDEX=1 -DNAME=process1 -DPOS1=pos1 -DPOS2=pos2 -DLEN2=len2 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap-process1.o -c atac-driver/alignOverlap/overlap-process1.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap-process1.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ ln -f /<>/atac-driver/alignOverlap/overlap-process.C /<>/atac-driver/alignOverlap/overlap-process2.C g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -DINDEX=2 -DNAME=process2 -DPOS1=pos2 -DPOS2=pos1 -DLEN2=len1 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/alignOverlap/overlap-process2.o -c atac-driver/alignOverlap/overlap-process2.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/alignOverlap/overlap.H:26, from atac-driver/alignOverlap/overlap-process2.C:19: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/alignOverlap/overlap.H:28: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ In file included from atac-driver/alignOverlap/overlap.H:41: atac-driver/alignOverlap/overlap-span.H:75:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ atac-driver/alignOverlap/overlap-span.H:75:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | fprintf(stderr, "span_t::split()-- _beg="uint32FMT" _end="uint32FMT" postition="uint32FMT"?\n", _beg, _end, position); | ^ In file included from atac-driver/alignOverlap/overlap.H:45: atac-driver/alignOverlap/overlap-stats.H:64:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(out, uint32FMT" "uint32FMT"\n", i, hist[i]); | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/alignOverlap/overlap atac-driver/alignOverlap/overlap.o atac-driver/alignOverlap/overlap-find.o atac-driver/alignOverlap/overlap-matchTree.o atac-driver/alignOverlap/overlap-printAnno.o atac-driver/alignOverlap/overlap-sort.o atac-driver/alignOverlap/overlap-process1.o atac-driver/alignOverlap/overlap-process2.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/gapShifter.o -c atac-driver/gapShifter/gapShifter.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/atac-driver/libatac/atac.H:26, from atac-driver/gapShifter/gapShifter.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:203:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stderr, "iid1 "uint32FMT", iid2 "uint32FMT"\n", iid1, iid2); | ^ atac-driver/gapShifter/gapShifter.C:203:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stderr, "iid1 "uint32FMT", iid2 "uint32FMT"\n", iid1, iid2); | ^ atac-driver/gapShifter/gapShifter.C:223:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 223 | fprintf(stderr, "iid1 "uint32FMT", iid2 "uint32FMT"\n", iid1, iid2); | ^ atac-driver/gapShifter/gapShifter.C:223:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 223 | fprintf(stderr, "iid1 "uint32FMT", iid2 "uint32FMT"\n", iid1, iid2); | ^ atac-driver/gapShifter/gapShifter.C:510:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 510 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:510:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 510 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:510:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 510 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:510:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 510 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:510:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 510 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:515:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 515 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:515:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 515 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:515:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 515 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:515:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 515 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:515:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 515 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:523:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 523 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:523:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 523 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:523:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 523 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:523:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 523 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:523:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 523 | fprintf(logFile, "%s\t%s\t%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\t", | ^ atac-driver/gapShifter/gapShifter.C:528:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 528 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:528:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 528 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:528:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 528 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:528:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 528 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:528:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 528 | fprintf(logFile, "%s:"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t->\t"uint32FMT"\t"uint32FMT"\n", | ^ atac-driver/gapShifter/gapShifter.C:738:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 738 | fprintf(stderr, "Shifting gaps of length at most "uint32FMT" bases, to the %s.\n", gapLimit, (shiftRight) ? "right" : "left"); | ^ atac-driver/gapShifter/gapShifter.C:750:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 750 | fprintf(stderr, "numShifted = "uint32FMT"\n", numShifted); | ^ atac-driver/gapShifter/gapShifter.C:751:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 751 | fprintf(stderr, "numNotShifted = "uint32FMT"\n", numNotShifted); | ^ atac-driver/gapShifter/gapShifter.C:752:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 752 | fprintf(stderr, "numDiffSeq = "uint32FMT"\n", numDiffSeq); | ^ atac-driver/gapShifter/gapShifter.C:753:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 753 | fprintf(stderr, "numDiffOri = "uint32FMT"\n", numDiffOri); | ^ atac-driver/gapShifter/gapShifter.C:754:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 754 | fprintf(stderr, "numZeroLen = "uint32FMT"\n", numZeroLen); | ^ atac-driver/gapShifter/gapShifter.C:755:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 755 | fprintf(stderr, "numOutOfOrder = "uint32FMT"\n", numOutOfOrder); | ^ atac-driver/gapShifter/gapShifter.C:756:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 756 | fprintf(stderr, "numNotAdjacent = "uint32FMT"\n", numNotAdjacent); | ^ atac-driver/gapShifter/gapShifter.C:757:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 757 | fprintf(stderr, "numNoGap = "uint32FMT"\n", numNoGap); | ^ atac-driver/gapShifter/gapShifter.C:758:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 758 | fprintf(stderr, "numGapTooBig = "uint32FMT"\n", numGapTooBig); | ^ atac-driver/gapShifter/gapShifter.C:759:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 759 | fprintf(stderr, "numOverlapping = "uint32FMT"\n", numOverlapping); | ^ atac-driver/gapShifter/gapShifter.C:762:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 762 | fprintf(stderr, "amountShifted["uint32FMT"] = "uint32FMT" (number of gaps shifted by [number of bases])\n", x, amountShifted[x]); | ^ atac-driver/gapShifter/gapShifter.C:762:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 762 | fprintf(stderr, "amountShifted["uint32FMT"] = "uint32FMT" (number of gaps shifted by [number of bases])\n", x, amountShifted[x]); | ^ atac-driver/gapShifter/gapShifter.C:764:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 764 | fprintf(stderr, "shifted "uint32FMT" out of "uint32FMT" (%6.2f%%)\n", gapsShifted, ML.numMatches(), (double)gapsShifted / (double)ML.numMatches() * 100.0); | ^ atac-driver/gapShifter/gapShifter.C:764:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 764 | fprintf(stderr, "shifted "uint32FMT" out of "uint32FMT" (%6.2f%%)\n", gapsShifted, ML.numMatches(), (double)gapsShifted / (double)ML.numMatches() * 100.0); | ^ atac-driver/gapShifter/gapShifter.C:780:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 780 | fprintf(stdout, "M u %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/gapShifter.C:780:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 780 | fprintf(stdout, "M u %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/gapShifter.C:780:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 780 | fprintf(stdout, "M u %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/gapShifter.C:780:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 780 | fprintf(stdout, "M u %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/gapShifter.C:780:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 780 | fprintf(stdout, "M u %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/gapShifter.C:780:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 780 | fprintf(stdout, "M u %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/gapShifter atac-driver/gapShifter/gapShifter.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/extractSequence.o -c atac-driver/gapShifter/extractSequence.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/atac-driver/libatac/atac.H:26, from atac-driver/gapShifter/extractSequence.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/extractSequence.C:110:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(Aoutput, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" match %s(%s)\n", | ^ atac-driver/gapShifter/extractSequence.C:110:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(Aoutput, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" match %s(%s)\n", | ^ atac-driver/gapShifter/extractSequence.C:110:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(Aoutput, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" match %s(%s)\n", | ^ atac-driver/gapShifter/extractSequence.C:121:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 121 | fprintf(Boutput, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" match %s(%s)\n", | ^ atac-driver/gapShifter/extractSequence.C:121:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 121 | fprintf(Boutput, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" match %s(%s)\n", | ^ atac-driver/gapShifter/extractSequence.C:121:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 121 | fprintf(Boutput, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" match %s(%s)\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/extractSequence atac-driver/gapShifter/extractSequence.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/extractUnmapped.o -c atac-driver/gapShifter/extractUnmapped.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/gapShifter/extractUnmapped.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/gapShifter/extractUnmapped.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/extractUnmapped.C:105:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 105 | fprintf(output, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" between match %s(%s) and %s(%s)\n", | ^ atac-driver/gapShifter/extractUnmapped.C:105:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 105 | fprintf(output, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" between match %s(%s) and %s(%s)\n", | ^ atac-driver/gapShifter/extractUnmapped.C:105:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 105 | fprintf(output, "%s extracted from iid "uint32FMT" pos "uint32FMT" "uint32FMT" between match %s(%s) and %s(%s)\n", | ^ atac-driver/gapShifter/extractUnmapped.C:583:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 583 | fprintf(stderr, "Done masking. "uint32FMT" in A, "uint32FMT" in B.\n", stats[0], stats[1]); | ^ atac-driver/gapShifter/extractUnmapped.C:583:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 583 | fprintf(stderr, "Done masking. "uint32FMT" in A, "uint32FMT" in B.\n", stats[0], stats[1]); | ^ atac-driver/gapShifter/extractUnmapped.C: In function ‘int main(int, char**)’: atac-driver/gapShifter/extractUnmapped.C:541:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 541 | fgets(L, 1024, F); | ~~~~~^~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/extractUnmapped atac-driver/gapShifter/extractUnmapped.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/coalesceMatches.o -c atac-driver/gapShifter/coalesceMatches.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/gapShifter/coalesceMatches.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/gapShifter/coalesceMatches.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/coalesceMatches atac-driver/gapShifter/coalesceMatches.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/correctGaps.o -c atac-driver/gapShifter/correctGaps.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/gapShifter/correctGaps.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/gapShifter/correctGaps.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/correctGaps.C:138:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 138 | fprintf(logFile, "HEY! F gap of size "uint32FMT" not in a run?\n", gap1); | ^ atac-driver/gapShifter/correctGaps.C:200:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 200 | fprintf(logFile, "HEY! R gap of size "uint32FMT" not in a run?\n", gap1); | ^ atac-driver/gapShifter/correctGaps.C:222:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(logFile, "CLOSE "uint32FMT"----------------------------------------\n", gap1); | ^ atac-driver/gapShifter/correctGaps.C:235:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 235 | fprintf(logFile, "At gapSize="uint32FMT" closed "uint32FMT" f-gaps and "uint32FMT" r-gaps.\n", gapsize, fgaps, rgaps); | ^ atac-driver/gapShifter/correctGaps.C:235:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 235 | fprintf(logFile, "At gapSize="uint32FMT" closed "uint32FMT" f-gaps and "uint32FMT" r-gaps.\n", gapsize, fgaps, rgaps); | ^ atac-driver/gapShifter/correctGaps.C:235:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 235 | fprintf(logFile, "At gapSize="uint32FMT" closed "uint32FMT" f-gaps and "uint32FMT" r-gaps.\n", gapsize, fgaps, rgaps); | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/correctGaps atac-driver/gapShifter/correctGaps.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/testAtac.o -c atac-driver/gapShifter/testAtac.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/gapShifter/testAtac.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/gapShifter/testAtac.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/testAtac.C:89:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 89 | fprintf(stderr, "match "uint32FMT" is only %6.2f%% identity: ", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/testAtac atac-driver/gapShifter/testAtac.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/cleanAtac.o -c atac-driver/gapShifter/cleanAtac.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/gapShifter/cleanAtac.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/gapShifter/cleanAtac.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/cleanAtac.C:149:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 149 | fprintf(stderr, "match "uint32FMT" is only %6.2f%% identity and "uint32FMT" long: ", | ^ atac-driver/gapShifter/cleanAtac.C:149:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 149 | fprintf(stderr, "match "uint32FMT" is only %6.2f%% identity and "uint32FMT" long: ", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/cleanAtac atac-driver/gapShifter/cleanAtac.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/gapShifter/projectFeatures.o -c atac-driver/gapShifter/projectFeatures.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/gapShifter/projectFeatures.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/gapShifter/projectFeatures.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/gapShifter/projectFeatures.C:72:2: warning: #warning BROKEN [-Wcpp] 72 | #warning BROKEN | ^~~~~~~ atac-driver/gapShifter/projectFeatures.C:132:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:132:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:132:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:132:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:132:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:132:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:132:124: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "M u Aprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:146:124: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 146 | fprintf(stdout, "M u Bprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:171:124: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "M u Cprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:112: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/gapShifter/projectFeatures.C:192:124: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u Dprojected"uint32FMT" %s.%s %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/gapShifter/projectFeatures atac-driver/gapShifter/projectFeatures.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/lengthFilter/lengthFilter.o -c atac-driver/lengthFilter/lengthFilter.C In file included from /<>/libutil/util++.H:4, from atac-driver/lengthFilter/lengthFilter.C:24: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ atac-driver/lengthFilter/lengthFilter.C:46:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | sprintf(inLine, "/globalMatchMinSize="uint32FMT"\n", minLength); | ^ atac-driver/lengthFilter/lengthFilter.C:57:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 57 | fprintf(stdout, "/globalMatchMinSize="uint32FMT"\n", minLength); | ^ atac-driver/lengthFilter/lengthFilter.C:114:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 114 | fprintf(stderr, "lengthFilter: Discarded "uint32FMTW(8)" matches with total length "uint32FMTW(10)", %7.3f%% of the sequence in matches.\n", | ^ atac-driver/lengthFilter/lengthFilter.C:114:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 114 | fprintf(stderr, "lengthFilter: Discarded "uint32FMTW(8)" matches with total length "uint32FMTW(10)", %7.3f%% of the sequence in matches.\n", | ^ atac-driver/lengthFilter/lengthFilter.C:116:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 116 | fprintf(stderr, "lengthFilter: Saved "uint32FMTW(8)" matches with total length "uint32FMTW(10)", %7.3f%% of the sequence in matches.\n", | ^ atac-driver/lengthFilter/lengthFilter.C:116:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 116 | fprintf(stderr, "lengthFilter: Saved "uint32FMTW(8)" matches with total length "uint32FMTW(10)", %7.3f%% of the sequence in matches.\n", | ^ atac-driver/lengthFilter/lengthFilter.C: In function ‘void readHeader(char*, FILE*, uint32&, FILE*)’: atac-driver/lengthFilter/lengthFilter.C:34:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 34 | fgets(inLine, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~~~ atac-driver/lengthFilter/lengthFilter.C:53:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 53 | fgets(inLine, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~~~ atac-driver/lengthFilter/lengthFilter.C: In function ‘int main(int, char**)’: atac-driver/lengthFilter/lengthFilter.C:111:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 111 | fgets(inLine, 1024, stdin); | ~~~~~^~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/lengthFilter/lengthFilter atac-driver/lengthFilter/lengthFilter.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/matchExtender/matchExtender.o -c atac-driver/matchExtender/matchExtender.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/atac-driver/libatac/atac.H:26, from atac-driver/matchExtender/matchExtender.C:27: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/matchExtender/matchExtender.C:192:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" 1\n", | ^ atac-driver/matchExtender/matchExtender.C:192:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" 1\n", | ^ atac-driver/matchExtender/matchExtender.C:192:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" 1\n", | ^ atac-driver/matchExtender/matchExtender.C:192:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" 1\n", | ^ atac-driver/matchExtender/matchExtender.C:192:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" 1\n", | ^ atac-driver/matchExtender/matchExtender.C:192:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 192 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" 1\n", | ^ atac-driver/matchExtender/matchExtender.C:201:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" -1\n", | ^ atac-driver/matchExtender/matchExtender.C:201:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" -1\n", | ^ atac-driver/matchExtender/matchExtender.C:201:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" -1\n", | ^ atac-driver/matchExtender/matchExtender.C:201:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" -1\n", | ^ atac-driver/matchExtender/matchExtender.C:201:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" -1\n", | ^ atac-driver/matchExtender/matchExtender.C:201:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stdout, "M u %s . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" -1\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/matchExtender/matchExtender-dump.o -c atac-driver/matchExtender/matchExtender-dump.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/matchExtender/matchExtender-dump.C:25: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/matchExtender/match.H:8, from atac-driver/matchExtender/matchExtender-dump.C:26: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:31:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 31 | fprintf(out, "%s: ID:%s range1:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT")\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:31:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 31 | fprintf(out, "%s: ID:%s range1:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT")\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:31:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 31 | fprintf(out, "%s: ID:%s range1:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT")\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:31:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 31 | fprintf(out, "%s: ID:%s range1:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT")\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:34:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(out, "%s ID:%s range2:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT") diag:"uint32FMT" %s\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:34:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(out, "%s ID:%s range2:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT") diag:"uint32FMT" %s\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:34:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(out, "%s ID:%s range2:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT") diag:"uint32FMT" %s\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:34:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(out, "%s ID:%s range2:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT") diag:"uint32FMT" %s\n", | ^ atac-driver/matchExtender/matchExtender-dump.C:34:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 34 | fprintf(out, "%s ID:%s range2:"uint32FMT","uint32FMT" _pos="uint32FMT" (seqlen="uint32FMT") diag:"uint32FMT" %s\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/matchExtender/matchExtender-func.o -c atac-driver/matchExtender/matchExtender-func.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/matchExtender/matchExtender-func.C:26: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/matchExtender/matchExtender-func.C:27: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/matchExtender/matchExtender atac-driver/matchExtender/matchExtender.o atac-driver/matchExtender/matchExtender-dump.o atac-driver/matchExtender/matchExtender-func.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/mismatchCounter/mismatchCounter.o -c atac-driver/mismatchCounter/mismatchCounter.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from atac-driver/mismatchCounter/mismatchCounter.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/mismatchCounter/mismatchCounter.C:25: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/mismatchCounter/mismatchCounter.C:197:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 197 | fprintf(stderr, "globalSequence = "uint32FMT"\n", globalSequence); | ^ atac-driver/mismatchCounter/mismatchCounter.C:198:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 198 | fprintf(stderr, "globalMismatches = "uint32FMT"\n", globalMismatches); | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/mismatchCounter/mismatchCounter atac-driver/mismatchCounter/mismatchCounter.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/statsGenerator/statsGenerator.o -c atac-driver/statsGenerator/statsGenerator.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/atac-driver/libatac/atac.H:26, from atac-driver/statsGenerator/statsGenerator.C:26: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/statsGenerator/statsGenerator.C:91:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(stdout, "histogram %s "uint32FMT" items %8.3f average %8.3f std.dev.\n", | ^ atac-driver/statsGenerator/statsGenerator.C:102:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 102 | fprintf(out, uint64FMT" "uint32FMT"\n", i * _b, _h[i]); | ^ atac-driver/statsGenerator/statsGenerator.C:103:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 103 | fprintf(out, ">"uint64FMT" "uint32FMT"\n", _m, _l); | ^ atac-driver/statsGenerator/statsGenerator.C:103:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 103 | fprintf(out, ">"uint64FMT" "uint32FMT"\n", _m, _l); | ^ atac-driver/statsGenerator/statsGenerator.C:133:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 133 | fprintf(out, "plot [0:"uint64FMT"][0:"uint64FMT"] \"%s.%s.histogramdat\" using 2 with lines\n", | ^ atac-driver/statsGenerator/statsGenerator.C:133:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 133 | fprintf(out, "plot [0:"uint64FMT"][0:"uint64FMT"] \"%s.%s.histogramdat\" using 2 with lines\n", | ^ atac-driver/statsGenerator/statsGenerator.C:136:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(out, "plot [0:"uint64FMT"][0:"uint64FMT"] \"%s.%s.histogramdat\" using 2 with lines\n", | ^ atac-driver/statsGenerator/statsGenerator.C:136:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(out, "plot [0:"uint64FMT"][0:"uint64FMT"] \"%s.%s.histogramdat\" using 2 with lines\n", | ^ atac-driver/statsGenerator/statsGenerator.C:172:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 172 | fprintf(stdout, "totalLength %s "uint64FMT" %s "uint64FMT" # all letters, including N\n", | ^ atac-driver/statsGenerator/statsGenerator.C:172:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 172 | fprintf(stdout, "totalLength %s "uint64FMT" %s "uint64FMT" # all letters, including N\n", | ^ atac-driver/statsGenerator/statsGenerator.C:193:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "totalLength %s "uint64FMT" %s "uint64FMT" # ACGT only\n", | ^ atac-driver/statsGenerator/statsGenerator.C:193:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "totalLength %s "uint64FMT" %s "uint64FMT" # ACGT only\n", | ^ atac-driver/statsGenerator/statsGenerator.C:282:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 282 | fprintf(stdout, "numberOfItems "uint64FMT"\n", (uint64)ifa.numberOfIntervals()); | ^ atac-driver/statsGenerator/statsGenerator.C:283:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 283 | fprintf(stdout, "totalLength "uint64FMT" # sum of lengths of all features\n", ifa.sumOfLengths()); | ^ atac-driver/statsGenerator/statsGenerator.C:285:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 285 | fprintf(stdout, "numberOfItems "uint64FMT" # after merging overlapping regions\n", (uint64)ifa.numberOfIntervals()); | ^ atac-driver/statsGenerator/statsGenerator.C:286:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "coveredLength "uint64FMT" # sequence covered by a feature, including N\n", ifa.sumOfLengths()); | ^ atac-driver/statsGenerator/statsGenerator.C:287:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 287 | fprintf(stdout, "coveredLength "uint64FMT" # sequence covered by a feature, ACGT only\n", tandemRepeatACGTLength(ifa, offset1, A)); | ^ atac-driver/statsGenerator/statsGenerator.C:289:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 289 | fprintf(stdout, "numberOfItems "uint64FMT" # after merging overlapping regions, only in matches\n", (uint64)mma.numberOfIntervals()); | ^ atac-driver/statsGenerator/statsGenerator.C:290:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 290 | fprintf(stdout, "inMatches "uint64FMT" # sequence covered by a feature and in a match, including N\n", mma.sumOfLengths()); | ^ atac-driver/statsGenerator/statsGenerator.C:291:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 291 | fprintf(stdout, "inMatches "uint64FMT" # sequence covered by a feature and in a match, ACGT only\n", tandemRepeatACGTLength(mma, offset1, A)); | ^ atac-driver/statsGenerator/statsGenerator.C:295:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 295 | fprintf(stdout, "numberOfItems "uint64FMT"\n", (uint64)ifb.numberOfIntervals()); | ^ atac-driver/statsGenerator/statsGenerator.C:296:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 296 | fprintf(stdout, "totalLength "uint64FMT" # sum of lengths of all features\n", ifb.sumOfLengths()); | ^ atac-driver/statsGenerator/statsGenerator.C:298:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 298 | fprintf(stdout, "numberOfItems "uint64FMT" # after merging overlapping regions\n", (uint64)ifb.numberOfIntervals()); | ^ atac-driver/statsGenerator/statsGenerator.C:299:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 299 | fprintf(stdout, "coveredLength "uint64FMT" # sequence covered by a feature, including N\n", ifb.sumOfLengths()); | ^ atac-driver/statsGenerator/statsGenerator.C:300:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 300 | fprintf(stdout, "coveredLength "uint64FMT" # sequence covered by a feature, ACGT only\n", tandemRepeatACGTLength(ifb, offset2, B)); | ^ atac-driver/statsGenerator/statsGenerator.C:302:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 302 | fprintf(stdout, "numberOfItems "uint64FMT" # after merging overlapping regions, only in matches\n", (uint64)mmb.numberOfIntervals()); | ^ atac-driver/statsGenerator/statsGenerator.C:303:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 303 | fprintf(stdout, "inMatches "uint64FMT" # sequence covered by a feature and in a match, including N\n", mmb.sumOfLengths()); | ^ atac-driver/statsGenerator/statsGenerator.C:304:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 304 | fprintf(stdout, "inMatches "uint64FMT" # sequence covered by a feature and in a match, ACGT only\n", tandemRepeatACGTLength(mmb, offset2, B)); | ^ atac-driver/statsGenerator/statsGenerator.C:335:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 335 | fprintf(stdout, "numberOfItems "uint64FMT"\n", (uint64)matches.numberOfMatches()); | ^ atac-driver/statsGenerator/statsGenerator.C:337:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 337 | fprintf(stdout, "matchLength %s "uint64FMT" %s "uint64FMT" # Sum of lengths of sequence in matches\n", | ^ atac-driver/statsGenerator/statsGenerator.C:337:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 337 | fprintf(stdout, "matchLength %s "uint64FMT" %s "uint64FMT" # Sum of lengths of sequence in matches\n", | ^ atac-driver/statsGenerator/statsGenerator.C:349:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 349 | fprintf(stdout, "coveredLength %s "uint64FMT" %s "uint64FMT" # sequence covered by a match, including N\n", | ^ atac-driver/statsGenerator/statsGenerator.C:349:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 349 | fprintf(stdout, "coveredLength %s "uint64FMT" %s "uint64FMT" # sequence covered by a match, including N\n", | ^ atac-driver/statsGenerator/statsGenerator.C:353:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 353 | fprintf(stdout, "coveredLength %s "uint64FMT" %s "uint64FMT" # sequence covered by a match, ACGT only (new)\n", | ^ atac-driver/statsGenerator/statsGenerator.C:353:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 353 | fprintf(stdout, "coveredLength %s "uint64FMT" %s "uint64FMT" # sequence covered by a match, ACGT only (new)\n", | ^ atac-driver/statsGenerator/statsGenerator.C:409:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 409 | fprintf(out, uint64FMT" "uint32FMT"\n", n, n50[iter-1]); | ^ atac-driver/statsGenerator/statsGenerator.C:507:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 507 | fprintf(stdout, "chrCoveredLength["uint32FMTW(2)"] %s "uint64FMT" "uint64FMT" %6.2f%% "uint64FMT" "uint64FMT" %6.2f%% # seqCov, totalSeq for both ALL and ACGTonly\n", | ^ atac-driver/statsGenerator/statsGenerator.C:507:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 507 | fprintf(stdout, "chrCoveredLength["uint32FMTW(2)"] %s "uint64FMT" "uint64FMT" %6.2f%% "uint64FMT" "uint64FMT" %6.2f%% # seqCov, totalSeq for both ALL and ACGTonly\n", | ^ atac-driver/statsGenerator/statsGenerator.C:507:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 507 | fprintf(stdout, "chrCoveredLength["uint32FMTW(2)"] %s "uint64FMT" "uint64FMT" %6.2f%% "uint64FMT" "uint64FMT" %6.2f%% # seqCov, totalSeq for both ALL and ACGTonly\n", | ^ atac-driver/statsGenerator/statsGenerator.C:507:82: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 507 | fprintf(stdout, "chrCoveredLength["uint32FMTW(2)"] %s "uint64FMT" "uint64FMT" %6.2f%% "uint64FMT" "uint64FMT" %6.2f%% # seqCov, totalSeq for both ALL and ACGTonly\n", | ^ atac-driver/statsGenerator/statsGenerator.C:507:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 507 | fprintf(stdout, "chrCoveredLength["uint32FMTW(2)"] %s "uint64FMT" "uint64FMT" %6.2f%% "uint64FMT" "uint64FMT" %6.2f%% # seqCov, totalSeq for both ALL and ACGTonly\n", | ^ atac-driver/statsGenerator/statsGenerator.C:516:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 516 | sprintf(label, "chr"uint32FMTW(02)"full", c); | ^ atac-driver/statsGenerator/statsGenerator.C:520:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | sprintf(label, "chr"uint32FMTW(02)"acgt", c); | ^ atac-driver/statsGenerator/statsGenerator.C:628:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 628 | fprintf(stdout, "runMissingFull %s "uint64FMT" %s "uint64FMT" # sequence in run, not covered, including N\n", | ^ atac-driver/statsGenerator/statsGenerator.C:628:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 628 | fprintf(stdout, "runMissingFull %s "uint64FMT" %s "uint64FMT" # sequence in run, not covered, including N\n", | ^ atac-driver/statsGenerator/statsGenerator.C:631:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 631 | fprintf(stdout, "runMissingFull %s "uint64FMT" %s "uint64FMT" # sequence in run, not covered, ACGT only\n", | ^ atac-driver/statsGenerator/statsGenerator.C:631:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 631 | fprintf(stdout, "runMissingFull %s "uint64FMT" %s "uint64FMT" # sequence in run, not covered, ACGT only\n", | ^ atac-driver/statsGenerator/statsGenerator.C: In function ‘void tandemRepeatStats(atacFileStream&, atacFileStream&, atacFile&, seqCache*, seqCache*)’: atac-driver/statsGenerator/statsGenerator.C:267:37: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 267 | while ((f = featuresA.nextFeature("tr")) != 0L) | ^~~~ atac-driver/statsGenerator/statsGenerator.C:269:37: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 269 | while ((f = featuresB.nextFeature("tr")) != 0L) | ^~~~ atac-driver/statsGenerator/statsGenerator.C: In function ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’: atac-driver/statsGenerator/statsGenerator.C:99:29: warning: ‘.histogramdat’ directive writing 13 bytes into a region of size between 0 and 1023 [-Wformat-overflow=] 99 | sprintf(filename, "%s.%s.histogramdat", prefix, label); | ^~~~~~~~~~~~~ In file included from /usr/include/stdio.h:970, from atac-driver/statsGenerator/statsGenerator.C:21: In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘void histogram::dump(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:99:12, inlined from ‘void histogram::dump(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:95:14, inlined from ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’ at atac-driver/statsGenerator/statsGenerator.C:517:23: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output 15 or more bytes (assuming 1038) into a destination of size 1024 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ atac-driver/statsGenerator/statsGenerator.C: In function ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’: atac-driver/statsGenerator/statsGenerator.C:127:29: warning: ‘.histogram.gnuplot’ directive writing 18 bytes into a region of size between 0 and 1023 [-Wformat-overflow=] 127 | sprintf(filename, "%s.%s.histogram.gnuplot", prefix, label); | ^~~~~~~~~~~~~~~~~~ In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘void histogram::plot(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:127:12, inlined from ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’ at atac-driver/statsGenerator/statsGenerator.C:518:23: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output 20 or more bytes (assuming 1043) into a destination of size 1024 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ atac-driver/statsGenerator/statsGenerator.C: In function ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’: atac-driver/statsGenerator/statsGenerator.C:140:37: warning: ‘%s’ directive writing up to 1023 bytes into a region of size 1013 [-Wformat-overflow=] 140 | sprintf(filename, "gnuplot < %s.%s.histogram.gnuplot", prefix, label); | ^~ ...... 518 | hist1full[c]->plot(prefix, label); | ~~~~~ In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘void histogram::plot(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:140:12, inlined from ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’ at atac-driver/statsGenerator/statsGenerator.C:518:23: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output 30 or more bytes (assuming 1053) into a destination of size 1024 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ atac-driver/statsGenerator/statsGenerator.C: In function ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’: atac-driver/statsGenerator/statsGenerator.C:99:29: warning: ‘.histogramdat’ directive writing 13 bytes into a region of size between 0 and 1023 [-Wformat-overflow=] 99 | sprintf(filename, "%s.%s.histogramdat", prefix, label); | ^~~~~~~~~~~~~ In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘void histogram::dump(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:99:12, inlined from ‘void histogram::dump(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:95:14, inlined from ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’ at atac-driver/statsGenerator/statsGenerator.C:521:23: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output 15 or more bytes (assuming 1038) into a destination of size 1024 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ atac-driver/statsGenerator/statsGenerator.C: In function ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’: atac-driver/statsGenerator/statsGenerator.C:127:29: warning: ‘.histogram.gnuplot’ directive writing 18 bytes into a region of size between 0 and 1023 [-Wformat-overflow=] 127 | sprintf(filename, "%s.%s.histogram.gnuplot", prefix, label); | ^~~~~~~~~~~~~~~~~~ In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘void histogram::plot(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:127:12, inlined from ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’ at atac-driver/statsGenerator/statsGenerator.C:522:23: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output 20 or more bytes (assuming 1043) into a destination of size 1024 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ atac-driver/statsGenerator/statsGenerator.C: In function ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’: atac-driver/statsGenerator/statsGenerator.C:140:37: warning: ‘%s’ directive writing up to 1023 bytes into a region of size 1013 [-Wformat-overflow=] 140 | sprintf(filename, "gnuplot < %s.%s.histogram.gnuplot", prefix, label); | ^~ ...... 522 | hist1acgt[c]->plot(prefix, label); | ~~~~~ In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘void histogram::plot(const char*, const char*)’ at atac-driver/statsGenerator/statsGenerator.C:140:12, inlined from ‘void MappedByChromosome(atacFile&, atacMatchList&, seqCache*, seqCache*, char*)’ at atac-driver/statsGenerator/statsGenerator.C:522:23: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output 30 or more bytes (assuming 1053) into a destination of size 1024 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/statsGenerator/statsGenerator atac-driver/statsGenerator/statsGenerator.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/uniqueFilter/uniqueFilter.o -c atac-driver/uniqueFilter/uniqueFilter.C In file included from /<>/libutil/util++.H:4, from atac-driver/uniqueFilter/uniqueFilter.C:23: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30, from atac-driver/uniqueFilter/uniqueFilter.C:24: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:226:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 226 | fprintf(stderr, "Sorting error -- have negative coverage (axis="uint32FMT" position="uint32FMT")!\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:226:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 226 | fprintf(stderr, "Sorting error -- have negative coverage (axis="uint32FMT" position="uint32FMT")!\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:236:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 236 | fprintf(stderr, "offsetsToCoverage()-- Found "uint64FMT" bases at coverage "uint32FMT" or greater.\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:236:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 236 | fprintf(stderr, "offsetsToCoverage()-- Found "uint64FMT" bases at coverage "uint32FMT" or greater.\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:370:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 370 | fprintf(stderr, "Got fwd intersection on i="uint32FMT" matchNumber="uint32FMT"\n", i, matchNumber); | ^ atac-driver/uniqueFilter/uniqueFilter.C:370:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 370 | fprintf(stderr, "Got fwd intersection on i="uint32FMT" matchNumber="uint32FMT"\n", i, matchNumber); | ^ atac-driver/uniqueFilter/uniqueFilter.C:371:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:371:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:371:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:371:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 371 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:374:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 374 | fprintf(stdout, "--key1 beg="uint32FMT" end="uint32FMT"\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:374:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 374 | fprintf(stdout, "--key1 beg="uint32FMT" end="uint32FMT"\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:379:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 379 | fprintf(stderr, "Got rev intersection on i="uint32FMT" matchNumber="uint32FMT"\n", i, matchNumber); | ^ atac-driver/uniqueFilter/uniqueFilter.C:379:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 379 | fprintf(stderr, "Got rev intersection on i="uint32FMT" matchNumber="uint32FMT"\n", i, matchNumber); | ^ atac-driver/uniqueFilter/uniqueFilter.C:380:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 380 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:380:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 380 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:380:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 380 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:380:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 380 | fprintf(stdout, "--"uint32FMT" "uint32FMT" 1 "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:383:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 383 | fprintf(stdout, "--key2 beg="uint32FMT" end="uint32FMT"\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:383:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 383 | fprintf(stdout, "--key2 beg="uint32FMT" end="uint32FMT"\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:418:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 418 | #define D08D2 uint32FMTW(8)" "uint32FMTW(8) | ^ atac-driver/uniqueFilter/uniqueFilter.C:419:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 419 | #define KEY1THING "key1 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:419:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 419 | #define KEY1THING "key1 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:419:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 419 | #define KEY1THING "key1 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:419:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 419 | #define KEY1THING "key1 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:419:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 419 | #define KEY1THING "key1 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:420:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 420 | #define KEY2THING "key2 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:420:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 420 | #define KEY2THING "key2 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:420:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 420 | #define KEY2THING "key2 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:420:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 420 | #define KEY2THING "key2 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:420:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 420 | #define KEY2THING "key2 = "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" thing = "D08D2" "D08D2"\n" | ^ atac-driver/uniqueFilter/uniqueFilter.C:818:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 818 | fprintf(stderr, "match "uint32FMT" is outside the extent!\n", i); | ^ atac-driver/uniqueFilter/uniqueFilter.C:828:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 828 | fprintf(stdout, "M %s %s."uint32FMT" . %s "uint32FMT" "uint32FMT" 1 %s "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:828:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 828 | fprintf(stdout, "M %s %s."uint32FMT" . %s "uint32FMT" "uint32FMT" 1 %s "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:828:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 828 | fprintf(stdout, "M %s %s."uint32FMT" . %s "uint32FMT" "uint32FMT" 1 %s "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:828:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 828 | fprintf(stdout, "M %s %s."uint32FMT" . %s "uint32FMT" "uint32FMT" 1 %s "uint32FMT" "uint32FMT" %d\n", | ^ atac-driver/uniqueFilter/uniqueFilter.C:828:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 828 | fprintf(stdout, "M %s %s."uint32FMT" . %s "uint32FMT" "uint32FMT" 1 %s "uint32FMT" "uint32FMT" %d\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/uniqueFilter/uniqueFilter atac-driver/uniqueFilter/uniqueFilter.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/clumpMaker/clumpMaker.o -c atac-driver/clumpMaker/clumpMaker.C In file included from atac-driver/clumpMaker/clumpMaker.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15, from /<>/atac-driver/libatac/atac.H:26, from atac-driver/clumpMaker/clumpMaker.C:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/atac-driver/libatac/atac.H:30: /<>/atac-driver/libatac/atacMatch.H:64:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ /<>/atac-driver/libatac/atacMatch.H:64:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(f, "M %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT" %d %s:"uint32FMT" "uint32FMT" "uint32FMT" %d\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:34: /<>/atac-driver/libatac/atacFeature.H:71:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ /<>/atac-driver/libatac/atacFeature.H:71:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 71 | fprintf(f, "F %s %s %s %s:"uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ In file included from /<>/atac-driver/libatac/atac.H:37: /<>/atac-driver/libatac/fasta-accessor.H:12:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:12:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 12 | fprintf(stderr, "%s-- position "uint32FMT" larger than length "uint32FMT"\n", \ | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:107:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "FastAAccessor::setRange()-- base="uint32FMT" and length="uint32FMT" exceed sequence length of "uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:127:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "operator[]-- Tried to access to "uint32FMT", but range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:144:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | fprintf(stderr, "setPosition()-- Tried to set to "uint32FMT", but range is "uint32FMT"-"uint32FMT".\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:166:136: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 166 | fprintf(stderr, "FastAAccessor::extendLeft()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ /<>/atac-driver/libatac/fasta-accessor.H:180:137: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "FastAAccessor::extendRight()-- extend by "int32FMT" makes invalid: length is "uint32FMT", new range is "uint32FMT"-"uint32FMT"\n", | ^ atac-driver/clumpMaker/clumpMaker.C:341:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 341 | sprintf(C.matchuid, "clump"int32FMTW(06), cc); | ^ atac-driver/clumpMaker/clumpMaker.C:377:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 377 | sprintf(hits[mm].match.parentuid, "clump"int32FMTW(06), cc); | ^ atac-driver/clumpMaker/clumpMaker.C: In function ‘int main(int, char**)’: atac-driver/clumpMaker/clumpMaker.C:220:12: warning: variable ‘isSorted’ set but not used [-Wunused-but-set-variable] 220 | bool isSorted = false; | ^~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/clumpMaker/clumpMaker atac-driver/clumpMaker/clumpMaker.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chainer/localalign/GF_ALN_dpaligner.o -c atac-driver/chainer/localalign/GF_ALN_dpaligner.C g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chainer/localalign/GF_ALN_local.o -c atac-driver/chainer/localalign/GF_ALN_local.C atac-driver/chainer/localalign/GF_ALN_local.C: In function ‘void Align_Recursion(const char*, int, const char*, int, const Trapezoid*, int, int, int, double, int)’: atac-driver/chainer/localalign/GF_ALN_local.C:872:15: warning: variable ‘indel’ set but not used [-Wunused-but-set-variable] 872 | int j, mid, indel; | ^~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chainer/localalign/GF_ALN_overlap.o -c atac-driver/chainer/localalign/GF_ALN_overlap.C atac-driver/chainer/localalign/GF_ALN_overlap.C: In function ‘void AVLinit()’: atac-driver/chainer/localalign/GF_ALN_overlap.C:93:17: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 93 | OutOfMemory("Candidate list"); | ^~~~~~~~~~~~~~~~ atac-driver/chainer/localalign/GF_ALN_overlap.C: In function ‘AVLnode* NEW(AVLnode*, Candidate*, AVLnode*)’: atac-driver/chainer/localalign/GF_ALN_overlap.C:125:21: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 125 | OutOfMemory("Candidate list"); | ^~~~~~~~~~~~~~~~ atac-driver/chainer/localalign/GF_ALN_overlap.C: In function ‘Local_Overlap* Find_Local_Overlap(int, int, int, int, Local_Segment*, int, int, double)’: atac-driver/chainer/localalign/GF_ALN_overlap.C:396:19: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 396 | OutOfMemory("Overlap Trace Array"); | ^~~~~~~~~~~~~~~~~~~~~ atac-driver/chainer/localalign/GF_ALN_overlap.C:662:19: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 662 | OutOfMemory("Overlap descriptor"); | ^~~~~~~~~~~~~~~~~~~~ atac-driver/chainer/localalign/GF_ALN_overlap.C:614:20: warning: variable ‘beg’ set but not used [-Wunused-but-set-variable] 614 | int best, end, beg; | ^~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chainer/localalign/GF_ALN_loverlapper.o -c atac-driver/chainer/localalign/GF_ALN_loverlapper.C g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chainer/localalign/GF_ALN_pieceOlap.o -c atac-driver/chainer/localalign/GF_ALN_pieceOlap.C g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -I/usr/include/python3.12 -o atac-driver/chainer/localalign/localAlignerInterfacemodule.o -c atac-driver/chainer/localalign/localAlignerInterfacemodule.C atac-driver/chainer/localalign/localAlignerInterfacemodule.C: In function ‘PyObject* spam_syntenicSegments(PyObject*, PyObject*)’: atac-driver/chainer/localalign/localAlignerInterfacemodule.C:176:18: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 176 | char *Aseq = "undefined"; | ^~~~~~~~~~~ atac-driver/chainer/localalign/localAlignerInterfacemodule.C:179:18: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 179 | char *Bseq = "undefined"; | ^~~~~~~~~~~ rm -f atac-driver/chainer/localAlignerInterfacemodule.so && g++ -Wl,-z,relro -Wl,-z,now -shared -o atac-driver/chainer/localAlignerInterfacemodule.so atac-driver/chainer/localalign/GF_ALN_dpaligner.o atac-driver/chainer/localalign/GF_ALN_local.o atac-driver/chainer/localalign/GF_ALN_overlap.o atac-driver/chainer/localalign/GF_ALN_loverlapper.o atac-driver/chainer/localalign/GF_ALN_pieceOlap.o atac-driver/chainer/localalign/localAlignerInterfacemodule.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chainer/halign/halign.o -c atac-driver/chainer/halign/halign.C atac-driver/chainer/halign/halign.C: In function ‘int diff(const char*, const char*, int, int, int*, int*, int*, int*, int, int, int, int, int, int, int, int, int, EditScript**, EditScript**)’: atac-driver/chainer/halign/halign.C:295:9: warning: variable ‘cost1’ set but not used [-Wunused-but-set-variable] 295 | int cost1, cost2; | ^~~~~ atac-driver/chainer/halign/halign.C:295:16: warning: variable ‘cost2’ set but not used [-Wunused-but-set-variable] 295 | int cost1, cost2; | ^~~~~ atac-driver/chainer/halign/halign.C:345:9: warning: variable ‘cost1’ set but not used [-Wunused-but-set-variable] 345 | int cost1, cost2; | ^~~~~ atac-driver/chainer/halign/halign.C:345:16: warning: variable ‘cost2’ set but not used [-Wunused-but-set-variable] 345 | int cost1, cost2; | ^~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -I/usr/include/python3.12 -o atac-driver/chainer/halign/halignmodule.o -c atac-driver/chainer/halign/halignmodule.C rm -f atac-driver/chainer/halignmodule.so && g++ -Wl,-z,relro -Wl,-z,now -shared -o atac-driver/chainer/halignmodule.so atac-driver/chainer/halign/halign.o atac-driver/chainer/halign/halignmodule.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/atac-driver/libatac/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o atac-driver/chimera/happy-clones-span-clumps.o -c atac-driver/chimera/happy-clones-span-clumps.C In file included from /<>/libutil/util++.H:4, from atac-driver/chimera/happy-clones-span-clumps.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ atac-driver/chimera/happy-clones-span-clumps.C:202:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 202 | fprintf(stderr, "ERROR: increase scaffoldsMax "uint32FMT"\n", scaffoldid); | ^ atac-driver/chimera/happy-clones-span-clumps.C:229:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(stderr, "Deleted "uint32FMT" scaffolds with less than 2 clumps.\n", deleted); | ^ atac-driver/chimera/happy-clones-span-clumps.C:230:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 230 | fprintf(stderr, "Remain "uint32FMT" scaffolds with more than 2 clumps.\n", remain); | ^ atac-driver/chimera/happy-clones-span-clumps.C:248:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" begin "uint32FMT" end "uint32FMT"\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:248:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" begin "uint32FMT" end "uint32FMT"\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:248:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" begin "uint32FMT" end "uint32FMT"\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:248:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" begin "uint32FMT" end "uint32FMT"\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:255:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 255 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and clump "uint32FMT" OVERLAP\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:255:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 255 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and clump "uint32FMT" OVERLAP\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:255:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 255 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and clump "uint32FMT" OVERLAP\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:263:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 263 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and "uint32FMT" confirmed by "uint32FMT" clones.\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:263:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 263 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and "uint32FMT" confirmed by "uint32FMT" clones.\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:263:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 263 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and "uint32FMT" confirmed by "uint32FMT" clones.\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:263:85: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 263 | fprintf(stdout, "scaffold "uint32FMT" clump "uint32FMT" and "uint32FMT" confirmed by "uint32FMT" clones.\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:449:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 449 | fprintf(stdout, "%s spans clump in scaffold %s,"uint32FMT"\n", ina, A[7], scfa); | ^ atac-driver/chimera/happy-clones-span-clumps.C:453:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 453 | fprintf(stdout, "%s spans clump in scaffold %s,"uint32FMT" \n", inb, B[7], scfb); | ^ atac-driver/chimera/happy-clones-span-clumps.C:464:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 464 | fprintf(stdout, "scaffold %s,"uint32FMT" clump "uint32FMT" "uint32FMT" confirmed by %s\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:464:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 464 | fprintf(stdout, "scaffold %s,"uint32FMT" clump "uint32FMT" "uint32FMT" confirmed by %s\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C:464:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 464 | fprintf(stdout, "scaffold %s,"uint32FMT" clump "uint32FMT" "uint32FMT" confirmed by %s\n", | ^ atac-driver/chimera/happy-clones-span-clumps.C: In function ‘int main(int, char**)’: atac-driver/chimera/happy-clones-span-clumps.C:393:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 393 | char *uidmapName = "/project/huref6/assembly/fasta/HUREF6A.info"; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C: In function ‘atacClumpCoordTree* buildCoordTree(char*)’: atac-driver/chimera/happy-clones-span-clumps.C:313:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 313 | fgets(inl, 1024, inf); | ~~~~~^~~~~~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C:340:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 340 | fgets(inl, 1024, inf); | ~~~~~^~~~~~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C: In function ‘int main(int, char**)’: atac-driver/chimera/happy-clones-span-clumps.C:402:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 402 | fgets(L, 1024, F); | ~~~~~^~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C:409:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 409 | fgets(L, 1024, F); | ~~~~~^~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C:426:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 426 | fgets(ina, 1024, inf); chomp(ina); | ~~~~~^~~~~~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C:427:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 427 | fgets(inb, 1024, inf); chomp(inb); | ~~~~~^~~~~~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C:473:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 473 | fgets(ina, 1024, inf); chomp(ina); | ~~~~~^~~~~~~~~~~~~~~~ atac-driver/chimera/happy-clones-span-clumps.C:474:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 474 | fgets(inb, 1024, inf); chomp(inb); | ~~~~~^~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o atac-driver/chimera/happy-clones-span-clumps atac-driver/chimera/happy-clones-span-clumps.o /<>/atac-driver/libatac/libatac.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/seatac.o -c seatac/seatac.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/seatac.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/seatac.C:201:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r", | ^ seatac/seatac.C:201:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r", | ^ seatac/seatac.C:201:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r", | ^ seatac/seatac.C:201:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | "O:"uint32FMTW(7)" S:"uint32FMTW(7)" I:"uint32FMTW(7)" T:"uint32FMTW(7)" (%5.1f%%; %8.3f/sec) Finish in %5.2f seconds.\r", | ^ seatac/seatac.C:239:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "\n"uint32FMTW(7)" sequences (%5.1f%%; %8.3f/sec) %5.2f seconds.\n", | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/configuration.o -c seatac/configuration.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/configuration.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/configuration.C:259:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 259 | fprintf(out, "/seatacNumSearchThreads="uint32FMT"\n", _numSearchThreads); | ^ seatac/configuration.C:260:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 260 | fprintf(out, "/seatacLoaderHighWaterMark="uint32FMT"\n", _loaderHighWaterMark); | ^ seatac/configuration.C:264:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 264 | fprintf(out, "/seatacWriterHighWaterMark="uint32FMT"\n", _writerHighWaterMark); | ^ seatac/configuration.C:267:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 267 | fprintf(out, "/seatacMaxDiagonal="uint32FMT"\n", _maxDiagonal); | ^ seatac/configuration.C:268:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 268 | fprintf(out, "/seatacMaxGap="uint32FMT"\n", _maxGap); | ^ seatac/configuration.C:269:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(out, "/seatacQsOverlap="uint32FMT"\n", _qsOverlap); | ^ seatac/configuration.C:270:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 270 | fprintf(out, "/seatacDsOverlap="uint32FMT"\n", _dsOverlap); | ^ seatac/configuration.C:271:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 271 | fprintf(out, "/seatacMinLength="uint32FMT"\n", _minLength + _merSize); | ^ seatac/configuration.C:272:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 272 | fprintf(out, "/seatacMerSize="uint32FMT"\n", _merSize); | ^ seatac/configuration.C:273:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 273 | fprintf(out, "/seatacMerSkip="uint32FMT"\n", _merSkip); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/encodedQuery.o -c seatac/encodedQuery.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/encodedQuery.C:3: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/hitMatrix.o -c seatac/hitMatrix.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/hitMatrix.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/thr-search.o -c seatac/thr-search.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/thr-search.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/thr-search.C:3:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 3 | char const *srchGbye = "[%ld] computed: "uint64FMTW(8)" blocked: "uint64FMTW(4)"/"uint64FMTW(4)" encodeTime: %7.2f searchTime: %7.2f processTime: %7.2f\n"; | ^ seatac/thr-search.C:3:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 3 | char const *srchGbye = "[%ld] computed: "uint64FMTW(8)" blocked: "uint64FMTW(4)"/"uint64FMTW(4)" encodeTime: %7.2f searchTime: %7.2f processTime: %7.2f\n"; | ^ seatac/thr-search.C:3:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 3 | char const *srchGbye = "[%ld] computed: "uint64FMTW(8)" blocked: "uint64FMTW(4)"/"uint64FMTW(4)" encodeTime: %7.2f searchTime: %7.2f processTime: %7.2f\n"; | ^ seatac/thr-search.C:130:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, uint64FMT" Blocked by output (idx = "uint32FMT", outputPos = "uint32FMT").\n", (long)U, idx, outputPos); | ^ seatac/thr-search.C:130:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, uint64FMT" Blocked by output (idx = "uint32FMT", outputPos = "uint32FMT").\n", (long)U, idx, outputPos); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/thr-loader.o -c seatac/thr-loader.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/thr-loader.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/thr-loader.C: In function ‘void* loaderThread(void*)’: seatac/thr-loader.C:68:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 68 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/thr-deadlock.o -c seatac/thr-deadlock.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/seatac.H:20, from seatac/thr-deadlock.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/seatac.H:25: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10, from seatac/seatac.H:27: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/hitMatrix-sort.o -c seatac/hitMatrix-sort.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seatac/hitMatrix.H:8, from seatac/hitMatrix-sort.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/hitMatrix.H:9: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seatac/hitMatrix.H:10: seatac/filterObj.H:148:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:148:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT" bytes.\n", theOutputPos, theOutputMax); | ^ seatac/filterObj.H:157:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:157:111: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | "M x ############ . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filterObj.H:212:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "WARNING: there isn't enough space in the match to insert the match id "uint64FMT" '%s'!\n", | ^ seatac/hitMatrix.H:84:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/hitMatrix.H:84:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seatac/filterObj.H: In member function ‘void filterObj::addHit(char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/filterObj.H:146:21: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 146 | } catch (std::bad_alloc) { | ^~~~~~~~~ seatac/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seatac/hitMatrix.H:82:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 82 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/existDB-create-from-fasta.o -c /<>/libkmer/existDB-create-from-fasta.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/existDB.H:7, from /<>/libkmer/existDB-create-from-fasta.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/existDB-create-from-fasta.C:136:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "existDB::createFromFastA()-- hashTable is "uint64FMT"MB\n", _hashTableWords >> 17); | ^ /<>/libkmer/existDB-create-from-fasta.C:137:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | fprintf(stderr, "existDB::createFromFastA()-- buckets is "uint64FMT"MB\n", _bucketsWords >> 17); | ^ /<>/libkmer/existDB-create-from-fasta.C:139:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 139 | fprintf(stderr, "existDB::createFromFastA()-- counts is "uint64FMT"MB\n", _countsWords >> 17); | ^ /<>/libkmer/existDB-create-from-fasta.C:239:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n", | ^ /<>/libkmer/existDB-create-from-fasta.C:239:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n", | ^ /<>/libkmer/existDB-create-from-fasta.C:239:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/existDB-create-from-meryl.o -c /<>/libkmer/existDB-create-from-meryl.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/existDB.H:7, from /<>/libkmer/existDB-create-from-meryl.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/existDB-create-from-meryl.C:27:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 27 | fprintf(stderr, "createFromMeryl()-- ERROR: requested merSize ("uint32FMT") is different than merSize in meryl database ("uint32FMT").\n", | ^ /<>/libkmer/existDB-create-from-meryl.C:27:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 27 | fprintf(stderr, "createFromMeryl()-- ERROR: requested merSize ("uint32FMT") is different than merSize in meryl database ("uint32FMT").\n", | ^ /<>/libkmer/existDB-create-from-meryl.C:54:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stderr, "createFromMeryl()-- tableSizeInEntries "uint64FMT"\n", tableSizeInEntries); | ^ /<>/libkmer/existDB-create-from-meryl.C:55:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "createFromMeryl()-- count range "uint32FMT"-"uint32FMT"\n", lo, hi); | ^ /<>/libkmer/existDB-create-from-meryl.C:55:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "createFromMeryl()-- count range "uint32FMT"-"uint32FMT"\n", lo, hi); | ^ /<>/libkmer/existDB-create-from-meryl.C:104:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 104 | fprintf(stderr, "createFromMeryl()-- numberOfMers "uint64FMT"\n", numberOfMers); | ^ /<>/libkmer/existDB-create-from-meryl.C:116:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 116 | fprintf(stderr, "existDB::createFromMeryl()-- Found "uint64FMT" mers between count of "uint32FMT" and "uint32FMT"\n", | ^ /<>/libkmer/existDB-create-from-meryl.C:116:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 116 | fprintf(stderr, "existDB::createFromMeryl()-- Found "uint64FMT" mers between count of "uint32FMT" and "uint32FMT"\n", | ^ /<>/libkmer/existDB-create-from-meryl.C:116:101: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 116 | fprintf(stderr, "existDB::createFromMeryl()-- Found "uint64FMT" mers between count of "uint32FMT" and "uint32FMT"\n", | ^ /<>/libkmer/existDB-create-from-meryl.C:135:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 135 | fprintf(stderr, "existDB::createFromMeryl()-- hashTable is "uint64FMT"MB\n", _hashTableWords >> 17); | ^ /<>/libkmer/existDB-create-from-meryl.C:136:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "existDB::createFromMeryl()-- buckets is "uint64FMT"MB\n", _bucketsWords >> 17); | ^ /<>/libkmer/existDB-create-from-meryl.C:138:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 138 | fprintf(stderr, "existDB::createFromMeryl()-- counts is "uint64FMT"MB\n", _countsWords >> 17); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/existDB-create-from-sequence.o -c /<>/libkmer/existDB-create-from-sequence.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/existDB.H:7, from /<>/libkmer/existDB-create-from-sequence.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/existDB-create-from-sequence.C:136:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | fprintf(stderr, "existDB::createFromSequence()-- hashTable is "uint64FMT"MB\n", _hashTableWords >> 17); | ^ /<>/libkmer/existDB-create-from-sequence.C:137:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | fprintf(stderr, "existDB::createFromSequence()-- buckets is "uint64FMT"MB\n", _bucketsWords >> 17); | ^ /<>/libkmer/existDB-create-from-sequence.C:139:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 139 | fprintf(stderr, "existDB::createFromSequence()-- counts is "uint64FMT"MB\n", _countsWords >> 17); | ^ /<>/libkmer/existDB-create-from-sequence.C:239:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n", | ^ /<>/libkmer/existDB-create-from-sequence.C:239:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n", | ^ /<>/libkmer/existDB-create-from-sequence.C:239:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 239 | fprintf(stderr, "Compressed from "uint64FMT" to "uint64FMT" ("uint64FMT" bits)\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/existDB-state.o -c /<>/libkmer/existDB-state.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/existDB.H:7, from /<>/libkmer/existDB-state.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/existDB-state.C:169:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 169 | fprintf(stream, "merSizeInBases: "uint32FMT"\n", _merSizeInBases); | ^ /<>/libkmer/existDB-state.C:170:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 170 | fprintf(stream, "tableBits "uint32FMT"\n", 2 * _merSizeInBases - _shift1); | ^ /<>/libkmer/existDB-state.C:172:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 172 | fprintf(stream, "_hashTableWords "uint64FMT" ("uint64FMT" KB)\n", _hashTableWords, _hashTableWords >> 7); | ^ /<>/libkmer/existDB-state.C:172:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 172 | fprintf(stream, "_hashTableWords "uint64FMT" ("uint64FMT" KB)\n", _hashTableWords, _hashTableWords >> 7); | ^ /<>/libkmer/existDB-state.C:173:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 173 | fprintf(stream, "_bucketsWords "uint64FMT" ("uint64FMT" KB)\n", _bucketsWords, _bucketsWords >> 7); | ^ /<>/libkmer/existDB-state.C:173:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 173 | fprintf(stream, "_bucketsWords "uint64FMT" ("uint64FMT" KB)\n", _bucketsWords, _bucketsWords >> 7); | ^ /<>/libkmer/existDB-state.C:174:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 174 | fprintf(stream, "_countsWords "uint64FMT" ("uint64FMT" KB)\n", _countsWords, _countsWords >> 7); | ^ /<>/libkmer/existDB-state.C:174:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 174 | fprintf(stream, "_countsWords "uint64FMT" ("uint64FMT" KB)\n", _countsWords, _countsWords >> 7); | ^ /<>/libkmer/existDB-state.C:176:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 176 | fprintf(stream, "_shift1: "uint32FMT"\n", _shift1); | ^ /<>/libkmer/existDB-state.C:177:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 177 | fprintf(stream, "_shift2 "uint32FMT"\n", _shift2); | ^ /<>/libkmer/existDB-state.C:178:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 178 | fprintf(stream, "_mask1 "uint64HEX"\n", _mask1); | ^ /<>/libkmer/existDB-state.C:179:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 179 | fprintf(stream, "_mask2 "uint64HEX"\n", _mask2); | ^ /<>/libkmer/existDB-state.C:183:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 183 | fprintf(stream, "_hshWidth "uint32FMT"\n", _hshWidth); | ^ /<>/libkmer/existDB-state.C:191:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 191 | fprintf(stream, "_chkWidth "uint32FMT"\n", _chkWidth); | ^ /<>/libkmer/existDB-state.C:199:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 199 | fprintf(stream, "_cntWidth "uint32FMT"\n", _cntWidth); | ^ /<>/libkmer/existDB-state.C: In member function ‘bool existDB::loadState(const char*, bool, bool)’: /<>/libkmer/existDB-state.C:80:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 80 | fread(cigam, sizeof(char), 16, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:124:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 124 | fread(&_merSizeInBases, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:125:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 125 | fread(&_shift1, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:126:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 126 | fread(&_shift2, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:127:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 127 | fread(&_mask1, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:128:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 128 | fread(&_mask2, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:129:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 129 | fread(&_hshWidth, sizeof(uint32), 1, F); // only valid if _compressedHash | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:130:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 130 | fread(&_chkWidth, sizeof(uint32), 1, F); // only valid if _compressedBucket | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:131:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 131 | fread(&_cntWidth, sizeof(uint32), 1, F); // only valid if _compressedCounts | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:133:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 133 | fread(&_hashTableWords, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:134:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 134 | fread(&_bucketsWords, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:135:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 135 | fread(&_countsWords, sizeof(uint64), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:148:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 148 | fread(_hashTable, sizeof(uint64), _hashTableWords, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:149:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 149 | fread(_buckets, sizeof(uint64), _bucketsWords, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C:152:12: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 152 | fread(_counts, sizeof(uint64), _countsWords, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/existDB-state.C: In member function ‘void existDB::saveState(const char*)’: /<>/libkmer/existDB-state.C:24:10: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output truncated before terminating nul copying 16 bytes from a string of the same length [-Wstringop-truncation] 24 | strncpy(cigam, magic, 16); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/existDB.o -c /<>/libkmer/existDB.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/existDB.H:7, from /<>/libkmer/existDB.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/existDB.C:44:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 44 | fprintf(stderr, "existDB::existDB()-- Got "uint32FMT", expected "uint32FMT"\n", _merSizeInBases, merSize); | ^ /<>/libkmer/existDB.C:44:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 44 | fprintf(stderr, "existDB::existDB()-- Got "uint32FMT", expected "uint32FMT"\n", _merSizeInBases, merSize); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/positionDB-access.o -c /<>/libkmer/positionDB-access.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/positionDB-access.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/libkmer/positionDB-access.C:2: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/positionDB-access.C:22:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 22 | fprintf(stderr, "positionDB::get()-- Can't allocate space for more positions, requested "uint64FMT" uint64's.\n", posnMax); | ^ /<>/libkmer/positionDB-access.C:215:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 215 | fprintf(stderr, "positionDB::filter()-- Filtering out kmers less than "uint64FMT" and more than "uint64FMT"\n", lo, hi); | ^ /<>/libkmer/positionDB-access.C:215:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 215 | fprintf(stderr, "positionDB::filter()-- Filtering out kmers less than "uint64FMT" and more than "uint64FMT"\n", lo, hi); | ^ /<>/libkmer/positionDB-access.C:339:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 339 | fprintf(stderr, "positionDB::filter()-- Filtered "uint64FMT" kmers less than "uint64FMT"\n", loCount, lo); | ^ /<>/libkmer/positionDB-access.C:339:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 339 | fprintf(stderr, "positionDB::filter()-- Filtered "uint64FMT" kmers less than "uint64FMT"\n", loCount, lo); | ^ /<>/libkmer/positionDB-access.C:340:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 340 | fprintf(stderr, "positionDB::filter()-- Filtered "uint64FMT" kmers more than "uint64FMT"\n", hiCount, hi); | ^ /<>/libkmer/positionDB-access.C:340:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 340 | fprintf(stderr, "positionDB::filter()-- Filtered "uint64FMT" kmers more than "uint64FMT"\n", hiCount, hi); | ^ /<>/libkmer/positionDB-access.C:341:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 341 | fprintf(stderr, "positionDB::filter()-- Saved "uint64FMT" kmers with acceptable count\n", okCount); | ^ /<>/libkmer/positionDB-access.C: In member function ‘void positionDB::filter(uint64, uint64)’: /<>/libkmer/positionDB-access.C:204:11: warning: unused variable ‘vv’ [-Wunused-variable] 204 | uint64 vv; | ^~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/positionDB-dump.o -c /<>/libkmer/positionDB-dump.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/positionDB.H:5, from /<>/libkmer/positionDB-dump.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/positionDB-dump.C:25:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 25 | fprintf(F, "B "uint64FMT" "uint64FMT"-"uint64FMT"\n", h, st, ed); | ^ /<>/libkmer/positionDB-dump.C:25:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 25 | fprintf(F, "B "uint64FMT" "uint64FMT"-"uint64FMT"\n", h, st, ed); | ^ /<>/libkmer/positionDB-dump.C:25:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 25 | fprintf(F, "B "uint64FMT" "uint64FMT"-"uint64FMT"\n", h, st, ed); | ^ /<>/libkmer/positionDB-dump.C:32:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(F, "%c chk="uint64HEX" pos="uint64FMT" siz="uint64FMT, | ^ /<>/libkmer/positionDB-dump.C:32:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(F, "%c chk="uint64HEX" pos="uint64FMT" siz="uint64FMT, | ^ /<>/libkmer/positionDB-dump.C:32:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(F, "%c chk="uint64HEX" pos="uint64FMT" siz="uint64FMT, | ^ /<>/libkmer/positionDB-dump.C:40:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 40 | fprintf(F, " "uint64FMT, getDecodedValue(_positions, pos, _posnWidth)); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/positionDB-file.o -c /<>/libkmer/positionDB-file.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/positionDB.H:5, from /<>/libkmer/positionDB-file.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/positionDB-file.C:197:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 197 | fprintf(stream, "merSizeInBases: "uint32FMT"\n", _merSizeInBases); | ^ /<>/libkmer/positionDB-file.C:198:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 198 | fprintf(stream, "merSkipInBases: "uint32FMT"\n", _merSkipInBases); | ^ /<>/libkmer/positionDB-file.C:199:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 199 | fprintf(stream, "tableSizeInBits: "uint32FMT"\n", _tableSizeInBits); | ^ /<>/libkmer/positionDB-file.C:200:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 200 | fprintf(stream, "tableSizeInEntries: "uint64FMT"\n", _tableSizeInEntries); | ^ /<>/libkmer/positionDB-file.C:201:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 201 | fprintf(stream, "hashWidth: "uint32FMT"\n", _hashWidth); | ^ /<>/libkmer/positionDB-file.C:202:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 202 | fprintf(stream, "chckWidth: "uint32FMT"\n", _chckWidth); | ^ /<>/libkmer/positionDB-file.C:203:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 203 | fprintf(stream, "posnWidth: "uint32FMT"\n", _posnWidth); | ^ /<>/libkmer/positionDB-file.C:204:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stream, "numberOfMers: "uint64FMT"\n", _numberOfMers); | ^ /<>/libkmer/positionDB-file.C:205:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 205 | fprintf(stream, "numberOfPositions: "uint64FMT"\n", _numberOfPositions); | ^ /<>/libkmer/positionDB-file.C:206:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 206 | fprintf(stream, "numberOfDistinct: "uint64FMT"\n", _numberOfDistinct); | ^ /<>/libkmer/positionDB-file.C:207:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 207 | fprintf(stream, "numberOfUnique: "uint64FMT"\n", _numberOfUnique); | ^ /<>/libkmer/positionDB-file.C:208:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 208 | fprintf(stream, "numberOfEntries: "uint64FMT"\n", _numberOfEntries); | ^ /<>/libkmer/positionDB-file.C:209:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 209 | fprintf(stream, "maximumEntries: "uint64FMT"\n", _maximumEntries); | ^ /<>/libkmer/positionDB-file.C: In member function ‘void positionDB::saveState(const char*)’: /<>/libkmer/positionDB-file.C:63:22: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast] 63 | _hashTable_FW = (uint32 *)((_hashTable_FW) ? uint32ONE : uint32ZERO); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/positionDB-file.C:37:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 37 | write(F, magic, sizeof(char) * 16); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/positionDB-file.C:39:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 39 | write(F, faild, sizeof(char) * 16); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libkmer/positionDB-file.C:95:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 95 | write(F, magic, sizeof(char) * 16); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/positionDB-mismatch.o -c /<>/libkmer/positionDB-mismatch.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/positionDB.H:5, from /<>/libkmer/positionDB-mismatch.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/positionDB-mismatch.C:324:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 324 | fprintf(stderr, "positionDB::getUpToNMismatches()-- Can't allocate space for initial positions, requested "uint64FMT" uint64's.\n", posnMax); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/positionDB-sort.o -c /<>/libkmer/positionDB-sort.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/positionDB.H:5, from /<>/libkmer/positionDB-sort.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/positionDB-sort.C:37:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 37 | fprintf(stdout, "ERROR: Bucket "uint64FMT" starts at "uint64FMT" ends at "uint64FMT"?\n", b, st, ed); | ^ /<>/libkmer/positionDB-sort.C:37:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 37 | fprintf(stdout, "ERROR: Bucket "uint64FMT" starts at "uint64FMT" ends at "uint64FMT"?\n", b, st, ed); | ^ /<>/libkmer/positionDB-sort.C:37:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 37 | fprintf(stdout, "ERROR: Bucket "uint64FMT" starts at "uint64FMT" ends at "uint64FMT"?\n", b, st, ed); | ^ /<>/libkmer/positionDB-sort.C:78:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 78 | fprintf(stdout, "ERROR: unset posn bucket="uint64FMT" t="int64FMT" le="uint32FMT"\n", b, t, le); | ^ /<>/libkmer/positionDB-sort.C:78:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 78 | fprintf(stdout, "ERROR: unset posn bucket="uint64FMT" t="int64FMT" le="uint32FMT"\n", b, t, le); | ^ /<>/libkmer/positionDB-sort.C:78:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 78 | fprintf(stdout, "ERROR: unset posn bucket="uint64FMT" t="int64FMT" le="uint32FMT"\n", b, t, le); | ^ /<>/libkmer/positionDB-sort.C:86:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 86 | fprintf(stdout, uint32FMTW(4)"] chck="uint64HEX" posn="uint64FMT"\n", t, _sortedChck[t], _sortedPosn[t]); | ^ /<>/libkmer/positionDB-sort.C:86:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 86 | fprintf(stdout, uint32FMTW(4)"] chck="uint64HEX" posn="uint64FMT"\n", t, _sortedChck[t], _sortedPosn[t]); | ^ /<>/libkmer/positionDB-sort.C:110:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n", | ^ /<>/libkmer/positionDB-sort.C:110:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n", | ^ /<>/libkmer/positionDB-sort.C:110:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n", | ^ /<>/libkmer/positionDB-sort.C:110:77: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n", | ^ /<>/libkmer/positionDB-sort.C:110:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "ERROR: bucket="uint64FMT" t="uint32FMT" le="uint32FMT": "uint64HEX" > "uint64HEX"\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/positionDB.o -c /<>/libkmer/positionDB.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/positionDB.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/libkmer/positionDB.C:7: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/positionDB.C:46:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer size is wrong (found "uint32FMT", wanted "uint32FMT").\n", | ^ /<>/libkmer/positionDB.C:46:107: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 46 | fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer size is wrong (found "uint32FMT", wanted "uint32FMT").\n", | ^ /<>/libkmer/positionDB.C:52:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 52 | fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer skip is wrong (found "uint32FMT", wanted "uint32FMT").\n", | ^ /<>/libkmer/positionDB.C:52:107: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 52 | fprintf(stderr, "positionDB()-- Tried to read state from '%s', but mer skip is wrong (found "uint32FMT", wanted "uint32FMT").\n", | ^ /<>/libkmer/positionDB.C:58:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | fprintf(stderr, "positionDB()-- Tried to read state from '%s', but max number of mismatches is wrong (found "uint32FMT", wanted "uint32FMT").\n", | ^ /<>/libkmer/positionDB.C:58:123: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | fprintf(stderr, "positionDB()-- Tried to read state from '%s', but max number of mismatches is wrong (found "uint32FMT", wanted "uint32FMT").\n", | ^ /<>/libkmer/positionDB.C:127:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, " sm = "uint64FMT"\n", sm); | ^ /<>/libkmer/positionDB.C:128:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, " lg = "uint64FMT"\n", lg); | ^ /<>/libkmer/positionDB.C:129:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, " merSize = "uint32FMT" bits\n", 2 * merSize); | ^ /<>/libkmer/positionDB.C:130:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, " approxMers = "uint64FMT" mers\n", approxMers); | ^ /<>/libkmer/positionDB.C:131:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, " posnWidth = "uint64FMT" bits\n", posnWidth); | ^ /<>/libkmer/positionDB.C:142:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 142 | fprintf(stderr, "potential configurations for approximately "uint64FMT" "uint32FMT"-mers (posnW="uint64FMT").\n", | ^ /<>/libkmer/positionDB.C:142:77: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 142 | fprintf(stderr, "potential configurations for approximately "uint64FMT" "uint32FMT"-mers (posnW="uint64FMT").\n", | ^ /<>/libkmer/positionDB.C:142:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 142 | fprintf(stderr, "potential configurations for approximately "uint64FMT" "uint32FMT"-mers (posnW="uint64FMT").\n", | ^ /<>/libkmer/positionDB.C:200:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 200 | fprintf(stderr, "tblBits="uint64FMTW(2)" shifts="uint32FMTW(02)","uint32FMTW(02)" -- size %8.3fGB -- work %8.3f%s\n", | ^ /<>/libkmer/positionDB.C:200:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 200 | fprintf(stderr, "tblBits="uint64FMTW(2)" shifts="uint32FMTW(02)","uint32FMTW(02)" -- size %8.3fGB -- work %8.3f%s\n", | ^ /<>/libkmer/positionDB.C:200:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 200 | fprintf(stderr, "tblBits="uint64FMTW(2)" shifts="uint32FMTW(02)","uint32FMTW(02)" -- size %8.3fGB -- work %8.3f%s\n", | ^ /<>/libkmer/positionDB.C:217:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 217 | fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n", | ^ /<>/libkmer/positionDB.C:217:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 217 | fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n", | ^ /<>/libkmer/positionDB.C:217:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 217 | fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n", | ^ /<>/libkmer/positionDB.C:217:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 217 | fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n", | ^ /<>/libkmer/positionDB.C:217:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 217 | fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n", | ^ /<>/libkmer/positionDB.C:217:122: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 217 | fprintf(stderr, "tblBits="uint32FMT" s1="uint32FMT" s2="uint32FMT" -- merSize="uint32FMT" bits + posnWidth="uint64FMT" bits (est "uint64FMT" mers) FINAL\n", | ^ /<>/libkmer/positionDB.C:326:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 326 | fprintf(stderr, "positionDB()-- bktAlloc = new uint64 ["uint64FMT"]\n", _tableSizeInEntries / 2 + 4); | ^ /<>/libkmer/positionDB.C:348:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 348 | fprintf(stderr, " Allocated bucket size counting space with total size "uint64FMT" KB\n", _tableSizeInEntries >> 8); | ^ /<>/libkmer/positionDB.C:392:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 392 | fprintf(stderr, " Found "uint64FMT" mers (max position = "uint64FMT")\n", _numberOfMers, _numberOfPositions); | ^ /<>/libkmer/positionDB.C:392:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 392 | fprintf(stderr, " Found "uint64FMT" mers (max position = "uint64FMT")\n", _numberOfMers, _numberOfPositions); | ^ /<>/libkmer/positionDB.C:430:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 430 | fprintf(stderr, " Allocated "uint64FMT"KB for buckets ("uint64FMT" 64-bit words)\n", bucketsSpace >> 7, bucketsSpace); | ^ /<>/libkmer/positionDB.C:430:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 430 | fprintf(stderr, " Allocated "uint64FMT"KB for buckets ("uint64FMT" 64-bit words)\n", bucketsSpace >> 7, bucketsSpace); | ^ /<>/libkmer/positionDB.C:435:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 435 | fprintf(stderr, "positionDB()-- _countingBuckets = new uint64 ["uint64FMT"]\n", bucketsSpace); | ^ /<>/libkmer/positionDB.C:553:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 553 | fprintf(stderr, " Sorting and repacking buckets ("uint64FMT" buckets).\n", _tableSizeInEntries); | ^ /<>/libkmer/positionDB.C:565:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 565 | " Found "uint64FMTW(12)" total mers\n" | ^ /<>/libkmer/positionDB.C:566:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 566 | " Found "uint64FMTW(12)" distinct mers\n" | ^ /<>/libkmer/positionDB.C:567:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 567 | " Found "uint64FMTW(12)" unique mers\n" | ^ /<>/libkmer/positionDB.C:568:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 568 | " Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n", | ^ /<>/libkmer/positionDB.C:568:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 568 | " Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n", | ^ /<>/libkmer/positionDB.C:637:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 637 | fprintf(stderr, " Allocated "uint64FMTW(10)"KB for hash table ("uint64FMT" 64-bit words)\n", hs >> 7, hs); | ^ /<>/libkmer/positionDB.C:637:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 637 | fprintf(stderr, " Allocated "uint64FMTW(10)"KB for hash table ("uint64FMT" 64-bit words)\n", hs >> 7, hs); | ^ /<>/libkmer/positionDB.C:643:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 643 | fprintf(stderr, "positionDB()-- _hashTable_BP = new uint64 ["uint64FMT"]\n", hs); | ^ /<>/libkmer/positionDB.C:662:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 662 | fprintf(stderr, " Reusing bucket space; Have: "uint64FMT" Need: "uint64FMT" (64-bit words)\n", bucketsSpace, bs); | ^ /<>/libkmer/positionDB.C:662:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 662 | fprintf(stderr, " Reusing bucket space; Have: "uint64FMT" Need: "uint64FMT" (64-bit words)\n", bucketsSpace, bs); | ^ /<>/libkmer/positionDB.C:669:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 669 | fprintf(stderr, " Allocated "uint64FMTW(10)"KB for buckets ("uint64FMT" 64-bit words)\n", bs >> 7, bs); | ^ /<>/libkmer/positionDB.C:669:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 669 | fprintf(stderr, " Allocated "uint64FMTW(10)"KB for buckets ("uint64FMT" 64-bit words)\n", bs >> 7, bs); | ^ /<>/libkmer/positionDB.C:674:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 674 | fprintf(stderr, "positionDB()-- _buckets = new uint64 ["uint64FMT"]\n", bs); | ^ /<>/libkmer/positionDB.C:680:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 680 | fprintf(stderr, " Allocated "uint64FMTW(10)"KB for positions ("uint64FMT" 64-bit words)\n", ps >> 7, ps); | ^ /<>/libkmer/positionDB.C:680:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 680 | fprintf(stderr, " Allocated "uint64FMTW(10)"KB for positions ("uint64FMT" 64-bit words)\n", ps >> 7, ps); | ^ /<>/libkmer/positionDB.C:685:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 685 | fprintf(stderr, "positionDB()-- _positions = new uint64 ["uint64FMT"\n", ps); | ^ /<>/libkmer/positionDB.C:695:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 695 | fprintf(stderr, " Transferring to final structure ("uint64FMT" buckets).\n", _tableSizeInEntries); | ^ /<>/libkmer/positionDB.C:878:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 878 | fprintf(stderr, "positionDB()-- ERROR: Got position "uint64FMT", but only "uint64FMT" available!\n", | ^ /<>/libkmer/positionDB.C:878:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 878 | fprintf(stderr, "positionDB()-- ERROR: Got position "uint64FMT", but only "uint64FMT" available!\n", | ^ /<>/libkmer/positionDB.C:916:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 916 | fprintf(stderr, " Avail: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (64-bit words)\n", bs, ps); | ^ /<>/libkmer/positionDB.C:916:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 916 | fprintf(stderr, " Avail: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (64-bit words)\n", bs, ps); | ^ /<>/libkmer/positionDB.C:917:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 917 | fprintf(stderr, " Avail: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries); | ^ /<>/libkmer/positionDB.C:917:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 917 | fprintf(stderr, " Avail: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries); | ^ /<>/libkmer/positionDB.C:918:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 918 | fprintf(stderr, " Used: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (64-bit words)\n", currentBbit / 64, currentPbit / 64); | ^ /<>/libkmer/positionDB.C:918:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 918 | fprintf(stderr, " Used: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (64-bit words)\n", currentBbit / 64, currentPbit / 64); | ^ /<>/libkmer/positionDB.C:928:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 928 | fprintf(stderr, " Used: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries); | ^ /<>/libkmer/positionDB.C:928:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 928 | fprintf(stderr, " Used: Bucket "uint64FMTW(12)" Position "uint64FMTW(12)" (entries)\n", _numberOfDistinct, _numberOfEntries); | ^ /<>/libkmer/positionDB.C:930:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 930 | " Found "uint64FMTW(12)" total mers\n" | ^ /<>/libkmer/positionDB.C:931:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 931 | " Found "uint64FMTW(12)" distinct mers\n" | ^ /<>/libkmer/positionDB.C:932:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 932 | " Found "uint64FMTW(12)" unique mers\n" | ^ /<>/libkmer/positionDB.C:933:13: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 933 | " Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n", | ^ /<>/libkmer/positionDB.C:933:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 933 | " Need "uint64FMT" non-unique position list entries ("uint64FMT" maximum count)\n", | ^ /<>/libkmer/positionDB.C:955:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 955 | fprintf(stderr, " Rebuilding the hash table, from "uint32FMT" bits wide to "uint32FMT" bits wide.\n", | ^ /<>/libkmer/positionDB.C:955:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 955 | fprintf(stderr, " Rebuilding the hash table, from "uint32FMT" bits wide to "uint32FMT" bits wide.\n", | ^ /<>/libkmer/positionDB.C:990:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 990 | fprintf(stderr, " Loading "uint64FMT" mercounts.\n", counts->numberOfDistinctMers()); | ^ /<>/libkmer/positionDB.C:1013:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1013 | fprintf(stderr, " Loaded "uint64FMT" mercounts; largest is "uint64FMT".\n", countsLoaded, largestMerylCount); | ^ /<>/libkmer/positionDB.C:1013:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1013 | fprintf(stderr, " Loaded "uint64FMT" mercounts; largest is "uint64FMT".\n", countsLoaded, largestMerylCount); | ^ /<>/libkmer/positionDB.C:1017:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1017 | fprintf(stderr, " Compress sizes from "uint32FMT" bits to "uint32FMT" bits.\n", | ^ /<>/libkmer/positionDB.C:1017:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1017 | fprintf(stderr, " Compress sizes from "uint32FMT" bits to "uint32FMT" bits.\n", | ^ /<>/libkmer/positionDB.C: In member function ‘void positionDB::build(merStream*, existDB*, existDB*, merylStreamReader*, uint32, uint32, bool)’: /<>/libkmer/positionDB.C:324:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 324 | } catch (std::bad_alloc) { | ^~~~~~~~~ /<>/libkmer/positionDB.C:433:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 433 | } catch (std::bad_alloc) { | ^~~~~~~~~ /<>/libkmer/positionDB.C:641:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 641 | } catch (std::bad_alloc) { | ^~~~~~~~~ /<>/libkmer/positionDB.C:672:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 672 | } catch (std::bad_alloc) { | ^~~~~~~~~ /<>/libkmer/positionDB.C:683:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 683 | } catch (std::bad_alloc) { | ^~~~~~~~~ rm -f /<>/libkmer/libkmer.a && ar ruvs /<>/libkmer/libkmer.a /<>/libkmer/existDB-create-from-fasta.o /<>/libkmer/existDB-create-from-meryl.o /<>/libkmer/existDB-create-from-sequence.o /<>/libkmer/existDB-state.o /<>/libkmer/existDB.o /<>/libkmer/positionDB-access.o /<>/libkmer/positionDB-dump.o /<>/libkmer/positionDB-file.o /<>/libkmer/positionDB-mismatch.o /<>/libkmer/positionDB-sort.o /<>/libkmer/positionDB.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libkmer/libkmer.a a - /<>/libkmer/existDB-create-from-fasta.o a - /<>/libkmer/existDB-create-from-meryl.o a - /<>/libkmer/existDB-create-from-sequence.o a - /<>/libkmer/existDB-state.o a - /<>/libkmer/existDB.o a - /<>/libkmer/positionDB-access.o a - /<>/libkmer/positionDB-dump.o a - /<>/libkmer/positionDB-file.o a - /<>/libkmer/positionDB-mismatch.o a - /<>/libkmer/positionDB-sort.o a - /<>/libkmer/positionDB.o g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libmeryl/libmeryl.o -c /<>/libmeryl/libmeryl.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libmeryl/libmeryl.H:4, from /<>/libmeryl/libmeryl.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libmeryl/libmeryl.C:72:2: warning: #warning not checking pmagic [-Wcpp] 72 | #warning not checking pmagic | ^~~~~~~ /<>/libmeryl/libmeryl.C:134:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 134 | fprintf(stderr, "merylStreamReader()-- ERROR: User requested mersize "uint32FMT" but '%s' is mersize "uint32FMT"\n", | ^ /<>/libmeryl/libmeryl.C:134:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 134 | fprintf(stderr, "merylStreamReader()-- ERROR: User requested mersize "uint32FMT" but '%s' is mersize "uint32FMT"\n", | ^ /<>/libmeryl/libmeryl.C:6:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 6 | static char *ImagicV = "merylStreamIv03\n"; | ^~~~~~~~~~~~~~~~~~~ /<>/libmeryl/libmeryl.C:7:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 7 | static char *ImagicX = "merylStreamIvXX\n"; | ^~~~~~~~~~~~~~~~~~~ /<>/libmeryl/libmeryl.C:8:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 8 | static char *DmagicV = "merylStreamDv03\n"; | ^~~~~~~~~~~~~~~~~~~ /<>/libmeryl/libmeryl.C:9:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 9 | static char *DmagicX = "merylStreamDvXX\n"; | ^~~~~~~~~~~~~~~~~~~ /<>/libmeryl/libmeryl.C:10:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 10 | static char *PmagicV = "merylStreamPv03\n"; | ^~~~~~~~~~~~~~~~~~~ /<>/libmeryl/libmeryl.C:11:24: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 11 | static char *PmagicX = "merylStreamPvXX\n"; | ^~~~~~~~~~~~~~~~~~~ /<>/libmeryl/libmeryl.C: In constructor ‘merylStreamReader::merylStreamReader(const char*, uint32)’: /<>/libmeryl/libmeryl.C:42:11: warning: variable ‘Pmagic’ set but not used [-Wunused-but-set-variable] 42 | char Pmagic[16] = {0}; | ^~~~~~ /<>/libmeryl/libmeryl.C: In member function ‘void merylStreamWriter::addMer(uint64, uint32, uint64, uint32, uint32, uint32*)’: /<>/libmeryl/libmeryl.C:469:31: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses] 469 | (prefix <= _thisMerPre) && (mer < _thisMerMer)) { | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~ rm -f /<>/libmeryl/libmeryl.a && ar ruvs /<>/libmeryl/libmeryl.a /<>/libmeryl/libmeryl.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libmeryl/libmeryl.a a - /<>/libmeryl/libmeryl.o g++ -Wl,-z,relro -Wl,-z,now -o seatac/seatac seatac/seatac.o seatac/configuration.o seatac/encodedQuery.o seatac/hitMatrix.o seatac/thr-search.o seatac/thr-loader.o seatac/thr-deadlock.o seatac/hitMatrix-sort.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/heavychains-driver.o -c seatac/heavychains-driver.C In file included from seatac/heavychains.H:11, from seatac/heavychains-driver.C:24: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ seatac/heavychains.H: In member function ‘double DPTree::matchScore(kd_node, Match&)’: seatac/heavychains.H:374:19: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses] 374 | if ( (flo.X() && node[flo.intv].lo <= p.xlo || | ~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/heavychains.o -c seatac/heavychains.C In file included from seatac/heavychains.H:11, from seatac/heavychains.C:22: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ seatac/heavychains.C:96:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 96 | fprintf(stderr,"HeavyChains: filtering strands "uint32FMT" "uint32FMT" "uint32FMT"\n", iid1, iid2, Plen); | ^ seatac/heavychains.C:96:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 96 | fprintf(stderr,"HeavyChains: filtering strands "uint32FMT" "uint32FMT" "uint32FMT"\n", iid1, iid2, Plen); | ^ seatac/heavychains.C:96:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 96 | fprintf(stderr,"HeavyChains: filtering strands "uint32FMT" "uint32FMT" "uint32FMT"\n", iid1, iid2, Plen); | ^ seatac/heavychains.C:164:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 164 | fprintf(stderr, "heavychains: out "uint32FMTW(8)" %8d %8d -- "uint32FMTW(8)" %8d %8d\n", | ^ seatac/heavychains.C:164:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 164 | fprintf(stderr, "heavychains: out "uint32FMTW(8)" %8d %8d -- "uint32FMTW(8)" %8d %8d\n", | ^ seatac/heavychains.C:169:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 169 | fprintf(outF, "M x H"uint64FMT" . %s:"uint32FMT" %d %d %d %s:"uint32FMT" %d %d %d > /hf=%.1f /hr=%.1f\n", | ^ seatac/heavychains.C:169:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 169 | fprintf(outF, "M x H"uint64FMT" . %s:"uint32FMT" %d %d %d %s:"uint32FMT" %d %d %d > /hf=%.1f /hr=%.1f\n", | ^ seatac/heavychains.C:169:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 169 | fprintf(outF, "M x H"uint64FMT" . %s:"uint32FMT" %d %d %d %s:"uint32FMT" %d %d %d > /hf=%.1f /hr=%.1f\n", | ^ seatac/heavychains.C:186:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 186 | fprintf(stderr, "HeavyChains: finished strands "uint32FMTW(8)" "uint32FMTW(8)" maxlen1=%f maxlen2=%f maxScoreFwd=%f maxScoreRef=%f\n", | ^ seatac/heavychains.C:186:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 186 | fprintf(stderr, "HeavyChains: finished strands "uint32FMTW(8)" "uint32FMTW(8)" maxlen1=%f maxlen2=%f maxScoreFwd=%f maxScoreRef=%f\n", | ^ seatac/heavychains.H: In member function ‘double DPTree::matchScore(kd_node, Match&)’: seatac/heavychains.H:374:19: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses] 374 | if ( (flo.X() && node[flo.intv].lo <= p.xlo || | ~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o seatac/heavychains seatac/heavychains-driver.o seatac/heavychains.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/filter-nop.o -c seatac/filter-nop.C In file included from /<>/libbio/bio.h:4, from seatac/filter-nop.C:9: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seatac/filter-nop.C:10: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ seatac/filter-nop.C:67:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C:67:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C:67:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C:67:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C:67:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C:67:90: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C:67:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | "M x . . %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s "uint32FMT"\n", | ^ seatac/filter-nop.C: In function ‘void* construct(char*)’: seatac/filter-nop.C:116:16: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 116 | char *seq1 = "UNK"; | ^~~~~ seatac/filter-nop.C:117:16: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 117 | char *seq2 = "UNK"; | ^~~~~ rm -f seatac/filter-nop.so && g++ -Wl,-z,relro -Wl,-z,now -shared -o seatac/filter-nop.so seatac/filter-nop.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seatac/filter-heavychains.o -c seatac/filter-heavychains.C In file included from /<>/libutil/util++.H:4, from seatac/filter-heavychains.C:24: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seatac/filter-heavychains.C:25: seatac/heavychains.H: In member function ‘double DPTree::matchScore(kd_node, Match&)’: seatac/heavychains.H:374:19: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses] 374 | if ( (flo.X() && node[flo.intv].lo <= p.xlo || | ~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~ seatac/heavychains.H: In function ‘void addHit(void*, char, uint32, uint32, uint32, uint32, uint32, uint32, uint32)’: seatac/heavychains.H:53:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation] 53 | strncpy(assemblyId1, assemblyid1, 31); | ^ seatac/heavychains.H:54:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation] 54 | strncpy(assemblyId2, assemblyid2, 31); | ^ seatac/heavychains.H:53:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation] 53 | strncpy(assemblyId1, assemblyid1, 31); | ^ seatac/heavychains.H:54:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation] 54 | strncpy(assemblyId2, assemblyid2, 31); | ^ seatac/heavychains.H:53:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation] 53 | strncpy(assemblyId1, assemblyid1, 31); | ^ seatac/heavychains.H:54:12: warning: ‘char* __builtin_strncpy(char*, const char*, long unsigned int)’ output may be truncated copying 31 bytes from a string of length 31 [-Wstringop-truncation] 54 | strncpy(assemblyId2, assemblyid2, 31); | ^ rm -f seatac/filter-heavychains.so && g++ -Wl,-z,relro -Wl,-z,now -shared -o seatac/filter-heavychains.so seatac/filter-heavychains.o seatac/heavychains.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/leaff.o -c leaff/leaff.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from leaff/leaff.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ leaff/leaff.C:311:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 311 | fprintf(stderr, "WARNING: Didn't find sequence with iid '"uint32FMT"'\n", sid); | ^ leaff/leaff.C:400:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 400 | fprintf(stdout, "G\tseq\t%s:"uint32FMT"\t"uint32FMT"\t%s\n", | ^ leaff/leaff.C:400:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 400 | fprintf(stdout, "G\tseq\t%s:"uint32FMT"\t"uint32FMT"\t%s\n", | ^ leaff/leaff.C:469:22: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 469 | sprintf(def, "random"uint32FMTW(06), i); | ^ leaff/leaff.C:727:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 727 | fprintf(stderr, "Couldn't read "uint64FMT" bytes from '%s': %s\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/blocks.o -c leaff/blocks.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from leaff/blocks.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ leaff/blocks.C:32:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:32:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:32:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:32:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:40:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 40 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:40:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 40 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:40:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 40 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:40:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 40 | fprintf(stdout, "%c "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ leaff/blocks.C:42:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | fprintf(stdout, ". "uint32FMT" "uint32FMT" "uint32FMT"\n", s, pos, uint32ZERO); | ^ leaff/blocks.C:42:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | fprintf(stdout, ". "uint32FMT" "uint32FMT" "uint32FMT"\n", s, pos, uint32ZERO); | ^ leaff/blocks.C:42:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 42 | fprintf(stdout, ". "uint32FMT" "uint32FMT" "uint32FMT"\n", s, pos, uint32ZERO); | ^ leaff/blocks.C: In function ‘void dumpBlocks(char*)’: leaff/blocks.C:7:16: warning: unused variable ‘S’ [-Wunused-variable] 7 | seqInCore *S = 0L; | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/dups.o -c leaff/dups.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from leaff/dups.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ leaff/dups.C:26:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 26 | fprintf(stdout, uint32FMT" <-> "uint32FMT"\n", sa->getIID(), sb->getIID()); | ^ leaff/dups.C:28:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 28 | fprintf(stderr, "COLLISION DETECTED BETWEEN %s:"uint32FMT" AND %s:"uint32FMT"!\nPLEASE REPORT THIS TO bri@walenz.org!\n", | ^ leaff/dups.C:28:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 28 | fprintf(stderr, "COLLISION DETECTED BETWEEN %s:"uint32FMT" AND %s:"uint32FMT"!\nPLEASE REPORT THIS TO bri@walenz.org!\n", | ^ leaff/dups.C:52:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 52 | fprintf(stderr, "Internal error: found two copies of the same sequence iid ("uint32FMT")!\n", result[idx].i); | ^ leaff/dups.C:60:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 60 | fprintf(stdout, uint32FMT":%s\n"uint32FMT":%s\n\n", | ^ leaff/dups.C:64:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(stderr, "COLLISION DETECTED BETWEEN IID "uint32FMT" AND "uint32FMT"!\nPLEASE REPORT THIS TO bri@walenz.org!\n", | ^ leaff/dups.C:64:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 64 | fprintf(stderr, "COLLISION DETECTED BETWEEN IID "uint32FMT" AND "uint32FMT"!\nPLEASE REPORT THIS TO bri@walenz.org!\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/gc.o -c leaff/gc.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from leaff/gc.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ leaff/gc.C:68:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/partition.o -c leaff/partition.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from leaff/partition.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ leaff/partition.C:55:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | fprintf(stderr, "ERROR: Failed to partition "uint32FMT"\n", i); | ^ leaff/partition.C:62:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | sprintf(filename, "%s-"uint32FMTW(03)".fasta", prefix, o); | ^ leaff/partition.C:77:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 77 | fprintf(stderr, "Huh? '%s' "uint32FMT" != "uint32FMT"\n", S->header(), S->sequenceLength(), p[i].length); | ^ leaff/partition.C:77:51: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 77 | fprintf(stderr, "Huh? '%s' "uint32FMT" != "uint32FMT"\n", S->header(), S->sequenceLength(), p[i].length); | ^ leaff/partition.C:96:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 96 | fprintf(stdout, uint32FMT"]("uint32FMT")", o, sizeP); | ^ leaff/partition.C:99:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 99 | fprintf(stdout, " "uint32FMT"("uint32FMT")", p[i].index, p[i].length); | ^ leaff/partition.C:99:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 99 | fprintf(stdout, " "uint32FMT"("uint32FMT")", p[i].index, p[i].length); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/simseq.o -c leaff/simseq.C In file included from /<>/libbio/bio.h:4, from leaff/simseq.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o leaff/stats.o -c leaff/stats.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from leaff/stats.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ leaff/stats.C:110:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "numSeqs "uint32FMT"\n", numSeq); | ^ leaff/stats.C:112:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 112 | fprintf(stdout, "SPAN (smallest "uint32FMT" largest "uint32FMT")\n", Ls[numSeq-1], Ls[0]); | ^ leaff/stats.C:112:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 112 | fprintf(stdout, "SPAN (smallest "uint32FMT" largest "uint32FMT")\n", Ls[numSeq-1], Ls[0]); | ^ leaff/stats.C:114:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 114 | fprintf(stdout, "n"uint32FMT" "uint32FMT" at index "uint32FMT"\n", 10 * i, n50s[i], l50s[i]); | ^ leaff/stats.C:114:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 114 | fprintf(stdout, "n"uint32FMT" "uint32FMT" at index "uint32FMT"\n", 10 * i, n50s[i], l50s[i]); | ^ leaff/stats.C:114:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 114 | fprintf(stdout, "n"uint32FMT" "uint32FMT" at index "uint32FMT"\n", 10 * i, n50s[i], l50s[i]); | ^ leaff/stats.C:115:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 115 | fprintf(stdout, "totLen "uint64FMTW(10)"\n", Ss); | ^ leaff/stats.C:116:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 116 | fprintf(stdout, "refLen "uint64FMTW(10)"\n", Rs); | ^ leaff/stats.C:118:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 118 | fprintf(stdout, "BASES (smallest "uint32FMT" largest "uint32FMT")\n", Lb[numSeq-1], Lb[0]); | ^ leaff/stats.C:118:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 118 | fprintf(stdout, "BASES (smallest "uint32FMT" largest "uint32FMT")\n", Lb[numSeq-1], Lb[0]); | ^ leaff/stats.C:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stdout, "n"uint32FMT" "uint32FMT" at index "uint32FMT"\n", 10 * i, n50b[i], l50b[i]); | ^ leaff/stats.C:120:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stdout, "n"uint32FMT" "uint32FMT" at index "uint32FMT"\n", 10 * i, n50b[i], l50b[i]); | ^ leaff/stats.C:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stdout, "n"uint32FMT" "uint32FMT" at index "uint32FMT"\n", 10 * i, n50b[i], l50b[i]); | ^ leaff/stats.C:121:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 121 | fprintf(stdout, "totLen "uint64FMTW(10)"\n", Sb); | ^ leaff/stats.C:122:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 122 | fprintf(stdout, "refLen "uint64FMTW(10)"\n", Rb); | ^ g++ -Wl,-z,relro -Wl,-z,now -o leaff/leaff leaff/leaff.o leaff/blocks.o leaff/dups.o leaff/gc.o leaff/partition.o leaff/simseq.o leaff/stats.o /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/meryl.o -c meryl/meryl.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/meryl.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/args.o -c meryl/args.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/args.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/args.C:26:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 26 | fprintf(stderr, "writeString()-- Failed to write string of length "uint32FMT": %s\n", len, strerror(errno)); | ^ meryl/args.C: In function ‘char* readString(FILE*)’: meryl/args.C:40:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 40 | fread(&len, sizeof(uint32), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~ meryl/args.C:50:10: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 50 | fread(str, sizeof(char), len, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ meryl/args.C: In constructor ‘merylArgs::merylArgs(const char*)’: meryl/args.C:513:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 513 | fread(magic, sizeof(char), 16, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~ meryl/args.C:521:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 521 | fread(this, sizeof(merylArgs), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/binaryOp.o -c meryl/binaryOp.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/meryl.H:4, from meryl/binaryOp.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/binaryOp.C:43:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stderr, "ERROR - mersize of '%s' is "uint32FMT"\n", args->mergeFiles[0], A->merSize()); | ^ meryl/binaryOp.C:44:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 44 | fprintf(stderr, "ERROR - mersize of '%s' is "uint32FMT"\n", args->mergeFiles[1], B->merSize()); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/build.o -c meryl/build.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/build.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/build.C:153:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 153 | sprintf(cmd, "qsub -t 1-"uint64FMT" -cwd -b n -j y -o %s-count-\\$TASK_ID.err %s -N mc%s %s-count.sh", | ^ meryl/build.C:156:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 156 | sprintf(cmd, "qsub -t 1-"uint64FMT" -cwd -b n -j y -o %s-count-\\$TASK_ID.err -N mc%s %s-count.sh", | ^ meryl/build.C:238:2: warning: #warning not submitting prepareBatch to grid [-Wcpp] 238 | #warning not submitting prepareBatch to grid | ^~~~~~~ meryl/build.C:293:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 293 | fprintf(stderr, " numMersActual = "uint64FMT"\n", args->numMersActual); | ^ meryl/build.C:294:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 294 | fprintf(stderr, " mersPerBatch = "uint64FMT"\n", args->mersPerBatch); | ^ meryl/build.C:295:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 295 | fprintf(stderr, " basesPerBatch = "uint64FMT"\n", args->basesPerBatch); | ^ meryl/build.C:296:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 296 | fprintf(stderr, " numBuckets = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2); | ^ meryl/build.C:296:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 296 | fprintf(stderr, " numBuckets = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2); | ^ meryl/build.C:297:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 297 | fprintf(stderr, " bucketPointerWidth = "uint32FMT"\n", args->bucketPointerWidth); | ^ meryl/build.C:298:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 298 | fprintf(stderr, " merDataWidth = "uint32FMT"\n", args->merDataWidth); | ^ meryl/build.C:305:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 305 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:305:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 305 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:305:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 305 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:305:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 305 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:310:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 310 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:310:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 310 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:310:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 310 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:310:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 310 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^ meryl/build.C:314:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 314 | fprintf(stderr, " numMersActual = "uint64FMT"\n", args->numMersActual); | ^ meryl/build.C:315:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 315 | fprintf(stderr, " mersPerBatch = "uint64FMT"\n", args->mersPerBatch); | ^ meryl/build.C:316:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 316 | fprintf(stderr, " basesPerBatch = "uint64FMT"\n", args->basesPerBatch); | ^ meryl/build.C:317:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 317 | fprintf(stderr, " numBuckets = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2); | ^ meryl/build.C:317:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 317 | fprintf(stderr, " numBuckets = "uint64FMT" ("uint32FMT" bits)\n", args->numBuckets, args->numBuckets_log2); | ^ meryl/build.C:318:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 318 | fprintf(stderr, " bucketPointerWidth = "uint32FMT"\n", args->bucketPointerWidth); | ^ meryl/build.C:319:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 319 | fprintf(stderr, " merDataWidth = "uint32FMT"\n", args->merDataWidth); | ^ meryl/build.C:342:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 342 | sprintf(filename, "%s.batch"uint64FMT".mcdat", args->outputFile, segment); | ^ meryl/build.C:346:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 346 | fprintf(stderr, "Found result for batch "uint64FMT" in %s.\n", segment, filename); | ^ meryl/build.C:352:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 352 | fprintf(stderr, "Computing segment "uint64FMT" of "uint64FMT".\n", segment+1, args->segmentLimit); | ^ meryl/build.C:352:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 352 | fprintf(stderr, "Computing segment "uint64FMT" of "uint64FMT".\n", segment+1, args->segmentLimit); | ^ meryl/build.C:365:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 365 | fprintf(stderr, " Allocating "uint64FMT"MB for mer storage ("uint32FMT" bits wide).\n", | ^ meryl/build.C:365:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 365 | fprintf(stderr, " Allocating "uint64FMT"MB for mer storage ("uint32FMT" bits wide).\n", | ^ meryl/build.C:384:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 384 | fprintf(stderr, " Allocating "uint64FMT"MB for mer position storage.\n", | ^ meryl/build.C:390:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " Allocating "uint64FMT"MB for bucket pointer table ("uint32FMT" bits wide).\n", | ^ meryl/build.C:390:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 390 | fprintf(stderr, " Allocating "uint64FMT"MB for bucket pointer table ("uint32FMT" bits wide).\n", | ^ meryl/build.C:396:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 396 | fprintf(stderr, " Allocating "uint64FMT"MB for counting the size of each bucket.\n", args->numBuckets >> 18); | ^ meryl/build.C:477:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 477 | fprintf(stderr, " Releasing "uint64FMT"MB from counting the size of each bucket.\n", args->numBuckets >> 18); | ^ meryl/build.C:532:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 532 | sprintf(batchOutputFile, "%s.batch"uint64FMT, args->outputFile, segment); | ^ meryl/build.C:552:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 552 | fprintf(stderr, "ERROR: In segment "uint64FMT"\n", segment); | ^ meryl/build.C:553:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 553 | fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") ends before it starts!\n", | ^ meryl/build.C:553:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 553 | fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") ends before it starts!\n", | ^ meryl/build.C:555:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 555 | fprintf(stderr, "ERROR: start="uint64FMT"\n", st); | ^ meryl/build.C:556:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 556 | fprintf(stderr, "ERROR: end ="uint64FMT"\n", ed); | ^ meryl/build.C:561:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 561 | fprintf(stderr, "ERROR: In segment "uint64FMT"\n", segment); | ^ meryl/build.C:562:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 562 | fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") is HUGE!\n", | ^ meryl/build.C:562:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 562 | fprintf(stderr, "ERROR: Bucket "uint64FMT" (out of "uint64FMT") is HUGE!\n", | ^ meryl/build.C:564:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 564 | fprintf(stderr, "ERROR: start="uint64FMT"\n", st); | ^ meryl/build.C:565:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 565 | fprintf(stderr, "ERROR: end ="uint64FMT"\n", ed); | ^ meryl/build.C:667:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 667 | fprintf(stderr, "Segment "uint64FMT" finished.\n", segment); | ^ meryl/build.C:705:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 705 | fprintf(stdout, "%s -countbatch "uint64FMT" -o %s\n", args->execName, s, args->outputFile); | ^ meryl/build.C:783:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 783 | sprintf(argv[argc], "%s.batch"uint32FMT, args->outputFile, i); | ^ meryl/build.C:807:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 807 | sprintf(filename, "%s.batch"uint32FMT".mcidx", args->outputFile, i); | ^ meryl/build.C:809:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 809 | sprintf(filename, "%s.batch"uint32FMT".mcdat", args->outputFile, i); | ^ meryl/build.C:811:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 811 | sprintf(filename, "%s.batch"uint32FMT".mcpos", args->outputFile, i); | ^ meryl/build.C: In function ‘void prepareBatch(merylArgs*)’: meryl/build.C:310:23: warning: format ‘%u’ expects argument of type ‘unsigned int’, but argument 4 has type ‘uint64’ {aka ‘long unsigned int’} [-Wformat=] 310 | fprintf(stderr, "Computing "uint64FMT" segments using "uint32FMT" threads and "uint64FMT"MB memory ("uint64FMT"MB if in one batch).\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 311 | estimateMemory(args->merSize, args->mersPerBatch, args->positionsEnabled) * args->numThreads, 312 | estimateMemory(args->merSize, args->numMersActual, args->positionsEnabled)); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | | | uint64 {aka long unsigned int} meryl/build.C:310:23: warning: format ‘%lu’ expects a matching ‘long unsigned int’ argument [-Wformat=] meryl/build.C:310:23: warning: format ‘%lu’ expects a matching ‘long unsigned int’ argument [-Wformat=] meryl/build.C: In function ‘void runSegment(merylArgs*, uint64)’: meryl/build.C:412:8: warning: unused variable ‘mstring’ [-Wunused-variable] 412 | char mstring[256]; | ^~~~~~~ meryl/build.C: In function ‘void build(merylArgs*)’: meryl/build.C:769:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 769 | arga[argc] = false; argv[argc++] = "meryl-build-merge"; | ^~~~~~~~~~~~~~~~~~~ meryl/build.C:770:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 770 | arga[argc] = false; argv[argc++] = "-M"; | ^~~~ meryl/build.C:771:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 771 | arga[argc] = false; argv[argc++] = "merge"; | ^~~~~~~ meryl/build.C:775:22: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 775 | argv[argc++] = "-v"; | ^~~~ meryl/build.C:780:22: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 780 | argv[argc++] = "-s"; | ^~~~ meryl/build.C:787:41: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings] 787 | arga[argc] = false; argv[argc++] = "-o"; | ^~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/build-threads.o -c meryl/build-threads.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/build-threads.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/dump.o -c meryl/dump.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/meryl.H:4, from meryl/dump.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/dump.C:17:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | fprintf(stdout, ">"uint64FMT"\n%s\n", | ^ meryl/dump.C:35:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 35 | fprintf(stdout, ">"uint64FMT, M->theCount()); | ^ meryl/dump.C:37:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 37 | fprintf(stdout, " "uint32FMT, M->getPosition(i)); | ^ meryl/dump.C:50:2: warning: #warning make this a test [-Wcpp] 50 | #warning make this a test | ^~~~~~~ meryl/dump.C:72:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 72 | fprintf(stdout, "Found "uint64FMT" mers.\n", M->numberOfTotalMers()); | ^ meryl/dump.C:73:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 73 | fprintf(stdout, "Found "uint64FMT" distinct mers.\n", M->numberOfDistinctMers()); | ^ meryl/dump.C:74:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 74 | fprintf(stdout, "Found "uint64FMT" unique mers.\n", M->numberOfUniqueMers()); | ^ meryl/dump.C:87:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(stderr, "Found "uint64FMT" mers.\n", M->numberOfTotalMers()); | ^ meryl/dump.C:88:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 88 | fprintf(stderr, "Found "uint64FMT" distinct mers.\n", M->numberOfDistinctMers()); | ^ meryl/dump.C:89:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 89 | fprintf(stderr, "Found "uint64FMT" unique mers.\n", M->numberOfUniqueMers()); | ^ meryl/dump.C:91:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(stderr, "Largest mercount is "uint64FMT"; "uint64FMT" mers are too big for histogram.\n", | ^ meryl/dump.C:91:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 91 | fprintf(stderr, "Largest mercount is "uint64FMT"; "uint64FMT" mers are too big for histogram.\n", | ^ meryl/dump.C:101:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 101 | fprintf(stdout, uint32FMT"\t"uint64FMT"\t%.4f\t%.4f\n", | ^ meryl/dump.C:148:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, uint32FMT"\t"uint64FMT"\n", d, hist[d]); | ^ meryl/dump.C:151:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 151 | fprintf(stderr, "huge\t"uint64FMT"\n", histHuge); | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/estimate.o -c meryl/estimate.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/estimate.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/estimate.C:54:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stdout, "Can fit "uint64FMT" mers into table with prefix of "uint64FMT" bits, using %.3fMB (%.3fMB for positions)\n", | ^ meryl/estimate.C:54:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stdout, "Can fit "uint64FMT" mers into table with prefix of "uint64FMT" bits, using %.3fMB (%.3fMB for positions)\n", | ^ meryl/estimate.C:162:28: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 162 | fprintf(stderr, uint64FMT" "uint32FMT"-mers can be computed using "uint64FMT"MB memory.\n", | ^ meryl/estimate.C:162:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 162 | fprintf(stderr, uint64FMT" "uint32FMT"-mers can be computed using "uint64FMT"MB memory.\n", | ^ meryl/estimate.C: In function ‘uint64 estimateMemory(uint32, uint64, bool)’: meryl/estimate.C:77:13: warning: unused variable ‘N’ [-Wunused-variable] 77 | uint64 N = logBaseTwo64(numMers); // Width of the bucket pointer table | ^ meryl/estimate.C:73:11: warning: variable ‘tMin’ set but not used [-Wunused-but-set-variable] 73 | uint64 tMin = tMax; | ^~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/merge.o -c meryl/merge.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/meryl.H:4, from meryl/merge.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/merge.C:14:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 14 | fprintf(stderr, "ERROR - must have at least two databases (you gave "uint32FMT")!\n", args->mergeFilesLen); | ^ meryl/merge.C: In function ‘void multipleOperations(merylArgs*)’: meryl/merge.C:237:10: warning: ‘void operator delete(void*)’ called on pointer returned from a mismatched allocation function [-Wmismatched-new-delete] 237 | delete R; | ^ meryl/merge.C:37:71: note: returned from ‘void* operator new [](std::size_t)’ 37 | merylStreamReader **R = new merylStreamReader* [args->mergeFilesLen]; | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/unaryOp.o -c meryl/unaryOp.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/meryl.H:4, from meryl/unaryOp.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ rm -f meryl/libmerylguts.a && ar ruvs meryl/libmerylguts.a meryl/args.o meryl/binaryOp.o meryl/build.o meryl/build-threads.o meryl/dump.o meryl/estimate.o meryl/merge.o meryl/unaryOp.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating meryl/libmerylguts.a a - meryl/args.o a - meryl/binaryOp.o a - meryl/build.o a - meryl/build-threads.o a - meryl/dump.o a - meryl/estimate.o a - meryl/merge.o a - meryl/unaryOp.o g++ -Wl,-z,relro -Wl,-z,now -o meryl/meryl meryl/meryl.o meryl/libmerylguts.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/simple.o -c meryl/simple.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/simple.C:8: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/simple.C:98:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 98 | fprintf(stderr, "Guessing "uint64FMT" mers in input '%s'\n", numMers, inName); | ^ meryl/simple.C:99:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 99 | fprintf(stderr, "Allocating "uint64FMT"MB for mer storage.\n", numMers * 8 >> 20); | ^ meryl/simple.C:129:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "Found "uint64FMT" mers in input '%s'\n", theMersLen, inName); | ^ g++ -Wl,-z,relro -Wl,-z,now -o meryl/simple meryl/simple.o /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/mapMers.o -c meryl/mapMers.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/mapMers.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/mapMers.C:135:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 135 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:135:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 135 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:136:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 136 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t" | ^ meryl/mapMers.C:137:24: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:137:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:137:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:137:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:137:76: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:137:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:137:102: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 137 | uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:165:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 165 | fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg); | ^ meryl/mapMers.C:165:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 165 | fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg); | ^ meryl/mapMers.C:165:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 165 | fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg); | ^ meryl/mapMers.C:171:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stdout, "%s\t"uint64FMT"\tuncovered\n", S->header(), MS->thePositionInSequence()); | ^ meryl/mapMers.C:176:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 176 | fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg); | ^ meryl/mapMers.C:176:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 176 | fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg); | ^ meryl/mapMers.C:176:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 176 | fprintf(stdout, "%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", S->header(), beg, end+merSize, end+merSize - beg); | ^ meryl/mapMers.C:178:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 178 | fprintf(stderr, "numCovReg: "uint64FMT"\n", numCovReg); | ^ meryl/mapMers.C:179:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 179 | fprintf(stderr, "lenCovReg: "uint64FMT"\n", lenCovReg); | ^ meryl/mapMers.C:193:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:193:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:193:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:193:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C:193:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 193 | fprintf(stdout, "%s\t%s\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\t"uint64FMT"\n", | ^ meryl/mapMers.C: In function ‘int main(int, char**)’: meryl/mapMers.C:21:13: warning: variable ‘beVerbose’ set but not used [-Wunused-but-set-variable] 21 | bool beVerbose = false; | ^~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o meryl/mapMers meryl/mapMers.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/mapMers-depth.o -c meryl/mapMers-depth.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from meryl/mapMers-depth.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o meryl/mapMers-depth meryl/mapMers-depth.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o meryl/kmer-mask.o -c meryl/kmer-mask.C In file included from /<>/libutil/util++.H:4, from meryl/kmer-mask.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ meryl/kmer-mask.C:754:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 754 | fprintf(stderr, "aClean "FW"\n", g->thresholdCounts[0][0]); | ^ meryl/kmer-mask.C:755:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 755 | fprintf(stderr, "aMurky "FW"\n", g->thresholdCounts[1][0]); | ^ meryl/kmer-mask.C:756:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 756 | fprintf(stderr, "aMatch "FW"\n", g->thresholdCounts[2][0]); | ^ meryl/kmer-mask.C:757:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 757 | fprintf(stderr, "aMixed "FW"\n", g->thresholdCounts[3][0]); | ^ meryl/kmer-mask.C:760:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 760 | fprintf(stderr, "aClean "FW" "FW" "FW" "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]); | ^ meryl/kmer-mask.C:760:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 760 | fprintf(stderr, "aClean "FW" "FW" "FW" "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]); | ^ meryl/kmer-mask.C:760:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 760 | fprintf(stderr, "aClean "FW" "FW" "FW" "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]); | ^ meryl/kmer-mask.C:760:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 760 | fprintf(stderr, "aClean "FW" "FW" "FW" "FW"\n", g->thresholdCounts[0][0], g->thresholdCounts[0][1], g->thresholdCounts[0][2], g->thresholdCounts[0][3]); | ^ meryl/kmer-mask.C:761:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 761 | fprintf(stderr, "aMurky "FW" "FW" "FW" "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]); | ^ meryl/kmer-mask.C:761:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 761 | fprintf(stderr, "aMurky "FW" "FW" "FW" "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]); | ^ meryl/kmer-mask.C:761:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 761 | fprintf(stderr, "aMurky "FW" "FW" "FW" "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]); | ^ meryl/kmer-mask.C:761:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 761 | fprintf(stderr, "aMurky "FW" "FW" "FW" "FW"\n", g->thresholdCounts[1][0], g->thresholdCounts[1][1], g->thresholdCounts[1][2], g->thresholdCounts[1][3]); | ^ meryl/kmer-mask.C:762:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 762 | fprintf(stderr, "aMatch "FW" "FW" "FW" "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]); | ^ meryl/kmer-mask.C:762:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 762 | fprintf(stderr, "aMatch "FW" "FW" "FW" "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]); | ^ meryl/kmer-mask.C:762:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 762 | fprintf(stderr, "aMatch "FW" "FW" "FW" "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]); | ^ meryl/kmer-mask.C:762:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 762 | fprintf(stderr, "aMatch "FW" "FW" "FW" "FW"\n", g->thresholdCounts[2][0], g->thresholdCounts[2][1], g->thresholdCounts[2][2], g->thresholdCounts[2][3]); | ^ meryl/kmer-mask.C:763:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 763 | fprintf(stderr, "aMixed "FW" "FW" "FW" "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]); | ^ meryl/kmer-mask.C:763:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 763 | fprintf(stderr, "aMixed "FW" "FW" "FW" "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]); | ^ meryl/kmer-mask.C:763:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 763 | fprintf(stderr, "aMixed "FW" "FW" "FW" "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]); | ^ meryl/kmer-mask.C:763:46: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 763 | fprintf(stderr, "aMixed "FW" "FW" "FW" "FW"\n", g->thresholdCounts[3][0], g->thresholdCounts[3][1], g->thresholdCounts[3][2], g->thresholdCounts[3][3]); | ^ meryl/kmer-mask.C: In member function ‘bool fastqRecord::load(FILE*, FILE*)’: meryl/kmer-mask.C:69:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 69 | fgets(a1, 1024, FASTQ1); chomp(a1); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:70:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 70 | fgets(a2, maxLength, FASTQ1); chomp(a2); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:71:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 71 | fgets(a3, 1024, FASTQ1); chomp(a3); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:72:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 72 | fgets(a4, maxLength, FASTQ1); chomp(a4); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:83:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 83 | fgets(b1, 1024, FASTQ2); chomp(b1); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:84:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 84 | fgets(b2, maxLength, FASTQ2); chomp(b2); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:85:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 85 | fgets(b3, 1024, FASTQ2); chomp(b3); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ meryl/kmer-mask.C:86:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 86 | fgets(b4, maxLength, FASTQ2); chomp(b4); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o meryl/kmer-mask meryl/kmer-mask.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitMatrix.o -c seagen/hitMatrix.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/hitMatrix.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.C:642:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.C:642:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.C:642:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.C:642:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.C:642:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.C:642:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.C:642:107: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 642 | sprintf(line, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/searchGENOME.o -c seagen/searchGENOME.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/searchGENOME.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/configuration.o -c seagen/configuration.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/configuration.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/configuration.C:84:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 84 | fprintf(stderr, "\n"uint32FMTW(7)" sequences in %5.2f seconds, %8.3f per second.\n", nq, tm, nq/tm); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/encodedQuery.o -c seagen/encodedQuery.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seagen/encodedQuery.H:6, from seagen/encodedQuery.C:3: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ seagen/encodedQuery.C:142:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 142 | fprintf(stderr, "encodedQuery::test()-- mersAvail incorrect: Recomputed:"uint32FMT" Real:"uint32FMT"\n", _mersAvail, _r_mersAvail); | ^ seagen/encodedQuery.C:142:88: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 142 | fprintf(stderr, "encodedQuery::test()-- mersAvail incorrect: Recomputed:"uint32FMT" Real:"uint32FMT"\n", _mersAvail, _r_mersAvail); | ^ seagen/encodedQuery.C:152:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 152 | fprintf(stderr, "encodedQuery::test()-- skip["uint32FMTW(4)"] incorrect: Acc:%d Real:%d\n", i, getSkip(i, true), _r_skip[i]); | ^ seagen/encodedQuery.C:160:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | fprintf(stderr, "encodedQuery::test()-- mers["uint32FMTW(4)"] incorrect: Acc:"uint64HEX" %s Real:"uint64HEX" %s\n", | ^ seagen/encodedQuery.C:160:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | fprintf(stderr, "encodedQuery::test()-- mers["uint32FMTW(4)"] incorrect: Acc:"uint64HEX" %s Real:"uint64HEX" %s\n", | ^ seagen/encodedQuery.C:160:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | fprintf(stderr, "encodedQuery::test()-- mers["uint32FMTW(4)"] incorrect: Acc:"uint64HEX" %s Real:"uint64HEX" %s\n", | ^ seagen/encodedQuery.C:209:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 209 | fprintf(stderr, "encodedQuery::addOutput()-- from "uint32FMT" to "uint32FMT" bytes.\n", | ^ seagen/encodedQuery.C:209:67: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 209 | fprintf(stderr, "encodedQuery::addOutput()-- from "uint32FMT" to "uint32FMT" bytes.\n", | ^ seagen/encodedQuery.C: In member function ‘void encodedQuery::addOutput(void*, uint32)’: seagen/encodedQuery.C:207:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 207 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-deadlock.o -c seagen/thr-deadlock.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/thr-deadlock.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-loader.o -c seagen/thr-loader.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/thr-loader.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ seagen/thr-loader.C: In function ‘void* loaderThread(void*)’: seagen/thr-loader.C:14:17: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 14 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-search.o -c seagen/thr-search.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/thr-search.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/thr-output.o -c seagen/thr-output.C In file included from /<>/libutil/util++.H:4, from seagen/searchGENOME.H:20, from seagen/thr-output.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/searchGENOME.H:22: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ In file included from seagen/searchGENOME.H:25: seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ seagen/thr-output.C: In function ‘void* writerThread(void*, void*)’: seagen/thr-output.C:48:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 48 | write(config._outputFile, query->theOutput(), query->theOutputLength()); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ seagen/thr-output.C:62:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 62 | write(config._matchCountsFile, str, strlen(str)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitMatrix-sort.o -c seagen/hitMatrix-sort.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from seagen/hitMatrix.H:8, from seagen/hitMatrix-sort.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/hitMatrix.H:9: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ seagen/hitMatrix.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H:128:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ seagen/hitMatrix.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64)’: seagen/hitMatrix.H:126:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 126 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/aHit.o -c seagen/aHit.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/aHit.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ seagen/aHit.C:20:14: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C:20:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C:20:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C:20:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C:20:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C:20:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C:20:98: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 20 | fprintf(F, "-%c -e "uint32FMT" -D "uint32FMT" "uint32FMT" "uint32FMT" -M "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/aHit.C: In function ‘void ahit_readBinary(aHit*, FILE*)’: seagen/aHit.C:12:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 12 | fread(a, sizeof(aHit), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o seagen/seagen seagen/hitMatrix.o seagen/searchGENOME.o seagen/configuration.o seagen/encodedQuery.o seagen/thr-deadlock.o seagen/thr-loader.o seagen/thr-search.o seagen/thr-output.o seagen/hitMatrix-sort.o seagen/aHit.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitConverter.o -c seagen/hitConverter.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/hitConverter.C:3: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ seagen/hitConverter.C: In function ‘void asc2bin(FILE*, FILE*)’: seagen/hitConverter.C:39:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 39 | fgets(b, 1024, I); | ~~~~~^~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o seagen/hitConverter seagen/hitConverter.o seagen/aHit.o /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterEST.o -c seagen/filterEST.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/filterEST.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/filterEST.C:7: seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/filterEST.C:76:11: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 76 | " hits saved:"uint32FMTW(8)"/"uint32FMTW(8)" = %6.3f%%\r", | ^ seagen/filterEST.C:76:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 76 | " hits saved:"uint32FMTW(8)"/"uint32FMTW(8)" = %6.3f%%\r", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterEST-complicated.o -c seagen/filterEST-complicated.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/filterEST-complicated.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/filterEST-complicated.C:7: seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/filterEST-complicated.C:67:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | fprintf(logFile, uint32FMT"] unique: aggressively filtered to "uint32FMT" hits out of "uint32FMT" hits.\n", | ^ seagen/filterEST-complicated.C:67:79: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 67 | fprintf(logFile, uint32FMT"] unique: aggressively filtered to "uint32FMT" hits out of "uint32FMT" hits.\n", | ^ seagen/filterEST-complicated.C:115:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 115 | fprintf(logFile, uint32FMT"] knee: filtered "uint32FMT" hits down to "uint32FMT" hits using threshold %f\n", | ^ seagen/filterEST-complicated.C:115:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 115 | fprintf(logFile, uint32FMT"] knee: filtered "uint32FMT" hits down to "uint32FMT" hits using threshold %f\n", | ^ seagen/filterEST-complicated.C:139:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 139 | fprintf(logFile, uint32FMT"] uniform: uniform signal strength, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f\n", | ^ seagen/filterEST-complicated.C:139:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 139 | fprintf(logFile, uint32FMT"] uniform: uniform signal strength, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f\n", | ^ seagen/filterEST-complicated.C:174:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 174 | fprintf(logFile, uint32FMT"] diff: has no clear signal knee, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f, largestdiff=%f\n", | ^ seagen/filterEST-complicated.C:174:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 174 | fprintf(logFile, uint32FMT"] diff: has no clear signal knee, saving the first "uint32FMT" hits out of "uint32FMT" hits, best=%f, worst=%f, largestdiff=%f\n", | ^ seagen/filterEST-complicated.C:228:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 228 | fprintf(logFile, uint32FMT"] spike: at "uint32FMT", "uint32FMT" hits saved: thresh=%f, "uint32FMT" hits, best=%f, worst=%f\n", | ^ seagen/filterEST-complicated.C:228:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 228 | fprintf(logFile, uint32FMT"] spike: at "uint32FMT", "uint32FMT" hits saved: thresh=%f, "uint32FMT" hits, best=%f, worst=%f\n", | ^ seagen/filterEST-complicated.C:228:69: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 228 | fprintf(logFile, uint32FMT"] spike: at "uint32FMT", "uint32FMT" hits saved: thresh=%f, "uint32FMT" hits, best=%f, worst=%f\n", | ^ seagen/filterEST-complicated.C:277:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 277 | fprintf(logFile, uint32FMT"] is an unclassified signal, "uint32FMT" hits saved out of "uint32FMT" hits, best=%f, worst=%f\n", | ^ seagen/filterEST-complicated.C:277:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 277 | fprintf(logFile, uint32FMT"] is an unclassified signal, "uint32FMT" hits saved out of "uint32FMT" hits, best=%f, worst=%f\n", | ^ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/hitReader.o -c seagen/hitReader.C In file included from /<>/libbio/bio.h:4, from seagen/hitReader.H:7, from seagen/hitReader.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5, from seagen/hitReader.H:8: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterEST seagen/filterEST.o seagen/filterEST-complicated.o seagen/hitReader.o seagen/aHit.o /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterMRNA.o -c seagen/filterMRNA.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/filterMRNA.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/filterMRNA.C:7: seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/filterMRNA.C:53:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 53 | fprintf(stderr, " scores at least %4.2f AND at least "uint32FMT" bases covered are always output\n", MC, ML); | ^ g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterMRNA seagen/filterMRNA.o seagen/hitReader.o seagen/aHit.o /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterNULL.o -c seagen/filterNULL.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/filterNULL.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/filterNULL.C:2: seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterNULL seagen/filterNULL.o seagen/hitReader.o seagen/aHit.o /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filtertest.o -c seagen/filtertest.C In file included from /<>/libbio/bio.h:4, from seagen/filtertest.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ seagen/filtertest.C:180:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 180 | fprintf(stderr, "reading hits "uint32FMT"\r", hitsLen); | ^ seagen/filtertest.C:186:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 186 | fprintf(stderr, "reading hits "uint32FMT"\n", hitsLen); | ^ seagen/filtertest.C:308:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, "%f %f %f %6.4f %6.4f "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/filtertest.C:308:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, "%f %f %f %6.4f %6.4f "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/filtertest.C:308:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, "%f %f %f %6.4f %6.4f "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/filtertest.C:308:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, "%f %f %f %6.4f %6.4f "uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"\n", | ^ seagen/filtertest.C: In function ‘void ahit_readBinary(aHit*, FILE*)’: seagen/filtertest.C:39:8: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 39 | fread(a, sizeof(aHit), 1, F); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ seagen/filtertest.C: In function ‘int main(int, char**)’: seagen/filtertest.C:162:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 162 | fgets(hitLine, 1024, stdin); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o seagen/filtertest seagen/filtertest.o -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/sortHits.o -c seagen/sortHits.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/sortHits.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ seagen/sortHits.C: In member function ‘bool aHitReader::readHit(aHit&)’: seagen/sortHits.C:52:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 52 | fgets(buffer, 1024, theFile); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~ seagen/sortHits.C: In member function ‘void aHitTemporary::nextHit()’: seagen/sortHits.C:119:12: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 119 | fread(&hit, sizeof(aHit), 1, theFile); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o seagen/sortHits seagen/sortHits.o seagen/aHit.o /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libkmer/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o seagen/filterESTsimple.o -c seagen/filterESTsimple.C In file included from /<>/libbio/bio.h:4, from seagen/aHit.H:4, from seagen/filterESTsimple.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from seagen/aHit.H:5: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from seagen/filterESTsimple.C:12: seagen/hitReader.H:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ seagen/hitReader.H:62:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "hitReader::operator[]()-- ERROR: asked for hit "uint32FMT" out of "uint32FMT".\n", x, _listLen); | ^ g++ -Wl,-z,relro -Wl,-z,now -o seagen/filterESTsimple seagen/filterESTsimple.o seagen/hitReader.o seagen/aHit.o /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/cleanPolishes.o -c sim4dbutils/cleanPolishes.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/cleanPolishes.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/cleanPolishes.C:178:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 178 | fprintf(stderr, "A big intron is one that is at least "uint32FMT"bp long.\n", intronLimit); | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/cleanPolishes sim4dbutils/cleanPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/fixPolishesIID.o -c sim4dbutils/fixPolishesIID.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/fixPolishesIID.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/fixPolishesIID.C:7: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/fixPolishesIID sim4dbutils/fixPolishesIID.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/comparePolishes.o -c sim4dbutils/comparePolishes.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/comparePolishes.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/comparePolishes.C:308:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:118: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:145: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:308:158: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 308 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"OLAPTFMT"\t%f\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%8.3f\t%8.3f\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/comparePolishes.C:452:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 452 | fprintf(stderr, "ERROR! inA="uint32FMT" inB="uint32FMT"\n", inA, inB); | ^ sim4dbutils/comparePolishes.C:452:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 452 | fprintf(stderr, "ERROR! inA="uint32FMT" inB="uint32FMT"\n", inA, inB); | ^ sim4dbutils/comparePolishes.C:484:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:484:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:484:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:484:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:484:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:484:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:484:156: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 484 | fprintf(stderr, "IID:"uint32FMTW(8)" good:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\r", | ^ sim4dbutils/comparePolishes.C:520:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n", | ^ sim4dbutils/comparePolishes.C:520:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n", | ^ sim4dbutils/comparePolishes.C:520:64: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n", | ^ sim4dbutils/comparePolishes.C:520:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n", | ^ sim4dbutils/comparePolishes.C:520:110: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n", | ^ sim4dbutils/comparePolishes.C:520:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 520 | fprintf(stderr, "\ngood:"uint32FMTW(4)" Anovel:"uint32FMTW(4)" Amulti:"uint32FMTW(4)" Bnovel:"uint32FMTW(4)" Bmulti:"uint32FMTW(4)" hairy:"uint32FMTW(4)"\n", | ^ sim4dbutils/comparePolishes.C: In function ‘int main(int, char**)’: sim4dbutils/comparePolishes.C:74:20: warning: variable ‘doGFF3’ set but not used [-Wunused-but-set-variable] 74 | bool doGFF3; | ^~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/s4p_overlap.o -c sim4dbutils/s4p_overlap.C In file included from /<>/libutil/util++.H:4, from sim4dbutils/s4p_overlap.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/comparePolishes sim4dbutils/comparePolishes.o sim4dbutils/s4p_overlap.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/convertToAtac.o -c sim4dbutils/convertToAtac.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/convertToAtac.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/convertToAtac.C:279:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:122: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:279:134: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:31: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:122: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:286:134: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 286 | fprintf(stdout, "M u dupr"uint32FMT" dupp"uint32FMT" %s:"uint32FMT" "uint32FMT" "uint32FMT" 1 %s:"uint32FMT" "uint32FMT" "uint32FMT" %s\n", | ^ sim4dbutils/convertToAtac.C:330:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 330 | fprintf(stderr, "Fixed "uint32FMT" indel/mismatches.\n", totalFixed); | ^ sim4dbutils/convertToAtac.C: In function ‘int main(int, char**)’: sim4dbutils/convertToAtac.C:241:12: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else] 241 | if (e->_estAlignment[aPos] != '-') | ^ sim4dbutils/convertToAtac.C:310:16: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else] 310 | if (e->_estAlignment[aPos] != '-') | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/convertToAtac sim4dbutils/convertToAtac.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/convertToExtent.o -c sim4dbutils/convertToExtent.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/convertToExtent.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/convertToExtent.C:43:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:88: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:43:118: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 43 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:50:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 50 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:50:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 50 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:50:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 50 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:50:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 50 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:50:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 50 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C:50:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 50 | fprintf(stdout, "%s\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t%s\t"uint32FMT"\t"uint32FMT"\t%6.3f\t%6.3f\n", | ^ sim4dbutils/convertToExtent.C: In function ‘int main(int, char**)’: sim4dbutils/convertToExtent.C:59:8: warning: variable ‘beVerbose’ set but not used [-Wunused-but-set-variable] 59 | bool beVerbose = false; | ^~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/convertToExtent sim4dbutils/convertToExtent.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/convertPolishes.o -c sim4dbutils/convertPolishes.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/convertPolishes.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/convertPolishes.C:8: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/convertPolishes sim4dbutils/convertPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/detectChimera.o -c sim4dbutils/detectChimera.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/detectChimera.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/detectChimera.C:129:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stdout, uint32FMTW(3)"-"uint32FMTW(3)" %s%s ("uint32FMT","uint32FMT")\n", | ^ sim4dbutils/detectChimera.C:129:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stdout, uint32FMTW(3)"-"uint32FMTW(3)" %s%s ("uint32FMT","uint32FMT")\n", | ^ sim4dbutils/detectChimera.C:129:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stdout, uint32FMTW(3)"-"uint32FMTW(3)" %s%s ("uint32FMT","uint32FMT")\n", | ^ sim4dbutils/detectChimera.C:153:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 153 | fprintf(stdout, "first "uint32FMT" alignments.\n", maxPts); | ^ sim4dbutils/detectChimera.C: In function ‘int main(int, char**)’: sim4dbutils/detectChimera.C:19:10: warning: variable ‘beVerbose’ set but not used [-Wunused-but-set-variable] 19 | bool beVerbose = false; | ^~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/detectChimera sim4dbutils/detectChimera.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/depthOfPolishes.o -c sim4dbutils/depthOfPolishes.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/depthOfPolishes.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/depthOfPolishes.C:103:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 103 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\t%.2f\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/depthOfPolishes sim4dbutils/depthOfPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/filterPolishes.o -c sim4dbutils/filterPolishes.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/filterPolishes.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/filterPolishes.C:8: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/filterPolishes.C:178:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 178 | fprintf(stderr, "Filtering at "uint32FMT"%% coverage and "uint32FMT"%% identity and "uint32FMT"bp.\n", minC, minI, minL); | ^ sim4dbutils/filterPolishes.C:178:45: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 178 | fprintf(stderr, "Filtering at "uint32FMT"%% coverage and "uint32FMT"%% identity and "uint32FMT"bp.\n", minC, minI, minL); | ^ sim4dbutils/filterPolishes.C:178:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 178 | fprintf(stderr, "Filtering at "uint32FMT"%% coverage and "uint32FMT"%% identity and "uint32FMT"bp.\n", minC, minI, minL); | ^ sim4dbutils/filterPolishes.C:181:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | fprintf(stderr, "Filtering for cDNA idx "uint32FMT" and genomic idx "uint32FMT"\n", cdna, geno); | ^ sim4dbutils/filterPolishes.C:181:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 181 | fprintf(stderr, "Filtering for cDNA idx "uint32FMT" and genomic idx "uint32FMT"\n", cdna, geno); | ^ sim4dbutils/filterPolishes.C:183:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 183 | fprintf(stderr, "Filtering for cDNA idx "uint32FMT".\n", cdna); | ^ sim4dbutils/filterPolishes.C:185:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 185 | fprintf(stderr, "Filtering for genomic idx "uint32FMT".\n", geno); | ^ sim4dbutils/filterPolishes.C:259:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 259 | fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\r", | ^ sim4dbutils/filterPolishes.C:259:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 259 | fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\r", | ^ sim4dbutils/filterPolishes.C:264:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 264 | fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed)\r", | ^ sim4dbutils/filterPolishes.C:274:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 274 | fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\n", | ^ sim4dbutils/filterPolishes.C:274:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 274 | fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed) ("uint64FMT" failed/intractable)\n", | ^ sim4dbutils/filterPolishes.C:279:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 279 | fprintf(stderr, " Filter: %6.2f%% ("uint64FMT" matches processed)\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/filterPolishes sim4dbutils/filterPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/headPolishes.o -c sim4dbutils/headPolishes.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/headPolishes.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/headPolishes sim4dbutils/headPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/mappedCoverage.o -c sim4dbutils/mappedCoverage.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/mappedCoverage.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/mappedCoverage.C:7: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/mappedCoverage.C:94:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 94 | fprintf(stderr, "Found "uint32FMT" sequences in the input file.\n", covMax); | ^ sim4dbutils/mappedCoverage.C:130:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "ERROR: Found iid "uint32FMT", but only allocated "uint32FMT" places!\n", | ^ sim4dbutils/mappedCoverage.C:130:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "ERROR: Found iid "uint32FMT", but only allocated "uint32FMT" places!\n", | ^ sim4dbutils/mappedCoverage.C:153:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 153 | fprintf(stderr, "ERROR: Found iid "uint32FMT", but only allocated "uint32FMT" places!\n", | ^ sim4dbutils/mappedCoverage.C:153:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 153 | fprintf(stderr, "ERROR: Found iid "uint32FMT", but only allocated "uint32FMT" places!\n", | ^ sim4dbutils/mappedCoverage.C:219:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 219 | fprintf(stderr, "ERROR: range "uint32FMT"-"uint32FMT" out of bounds (seqLen = "uint32FMT")\n", | ^ sim4dbutils/mappedCoverage.C:219:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 219 | fprintf(stderr, "ERROR: range "uint32FMT"-"uint32FMT" out of bounds (seqLen = "uint32FMT")\n", | ^ sim4dbutils/mappedCoverage.C:219:66: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 219 | fprintf(stderr, "ERROR: range "uint32FMT"-"uint32FMT" out of bounds (seqLen = "uint32FMT")\n", | ^ sim4dbutils/mappedCoverage.C:242:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 242 | fprintf(C, uint32FMT"\t"uint32FMT"\t%5.3f\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/mappedCoverage.C:242:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 242 | fprintf(C, uint32FMT"\t"uint32FMT"\t%5.3f\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/mappedCoverage.C:242:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 242 | fprintf(C, uint32FMT"\t"uint32FMT"\t%5.3f\t"uint32FMT"\t"uint32FMT"\n", | ^ sim4dbutils/mappedCoverage.C: In function ‘int main(int, char**)’: sim4dbutils/mappedCoverage.C:106:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 106 | fgets(inLine, 1024, stdin); | ~~~~~^~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/mappedCoverage sim4dbutils/mappedCoverage.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/mergePolishes.o -c sim4dbutils/mergePolishes.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/mergePolishes.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/mergePolishes.C: In function ‘int main(int, char**)’: sim4dbutils/mergePolishes.C:139:10: warning: ‘void operator delete(void*)’ called on pointer returned from a mismatched allocation function [-Wmismatched-new-delete] 139 | delete inMatch; | ^~~~~~~ sim4dbutils/mergePolishes.C:28:62: note: returned from ‘void* operator new [](std::size_t)’ 28 | sim4polishReader **inMatch = new sim4polishReader * [argc]; | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/mergePolishes sim4dbutils/mergePolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/parseSNP.o -c sim4dbutils/parseSNP.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/parseSNP.C:9: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/parseSNP.C:10: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/parseSNP.C:229:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:229:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:229:63: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:229:75: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:229:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:229:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:229:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 229 | fprintf(F, "%s %s "uint32FMT" %c/%c %s global["uint32FMT" "uint32FMT"] exon["uint32FMT" "uint32FMT" "uint32FMT" "uint32FMT"]\n", | ^ sim4dbutils/parseSNP.C:269:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:98: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:113: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:269:143: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 269 | fprintf(F, "%s %s "uint32FMT" sa=%c ga=%c mo=%c pi="uint32FMT" pc="uint32FMT" nb="uint32FMT" bl="uint32FMT" bp="uint32FMT" bi="uint32FMT" bc="uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:538:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 538 | fprintf(stderr, "ERROR: Polishes not sorted by SNP idx! this="uint32FMT", looking for "uint32FMT"\n", | ^ sim4dbutils/parseSNP.C:538:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 538 | fprintf(stderr, "ERROR: Polishes not sorted by SNP idx! this="uint32FMT", looking for "uint32FMT"\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/parseSNP sim4dbutils/parseSNP.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/pickBestPolish.o -c sim4dbutils/pickBestPolish.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/pickBestPolish.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/pickBestPolish.C:6: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/pickBestPolish.C:35:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 35 | fprintf(O, uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(4)" "uint32FMTW(4), | ^ sim4dbutils/pickBestPolish.C:35:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 35 | fprintf(O, uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(4)" "uint32FMTW(4), | ^ sim4dbutils/pickBestPolish.C:35:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 35 | fprintf(O, uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(4)" "uint32FMTW(4), | ^ sim4dbutils/pickBestPolish.C:39:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 39 | fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")", | ^ sim4dbutils/pickBestPolish.C:39:33: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 39 | fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")", | ^ sim4dbutils/pickBestPolish.C:39:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 39 | fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")", | ^ sim4dbutils/pickBestPolish.C:39:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 39 | fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")", | ^ sim4dbutils/pickBestPolish.C:39:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 39 | fprintf(O, " ("uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(6)"/"uint32FMTW(6)" "uint32FMTW(3)")", | ^ sim4dbutils/pickBestPolish.C:69:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 69 | fprintf(stderr, "Picking Best for estID="uint32FMT" with %5d choices.\r", p[0]->_estID, pNum); | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/pickBestPolish sim4dbutils/pickBestPolish.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/pickBestPair.o -c sim4dbutils/pickBestPair.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/pickBestPair.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/pickBestPair.C:6: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/pickBestPair.C:546:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:546:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 546 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:52: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:80: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:569:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 569 | fprintf(LOG, "%c "uint32FMT" "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s ("uint32FMT","uint32FMT") "uint32FMT" %s\n", | ^ sim4dbutils/pickBestPair.C:584:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 584 | fprintf(STA, "alignments: "uint32FMT" "uint32FMT"\n", mr1END, mr2END); | ^ sim4dbutils/pickBestPair.C:584:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 584 | fprintf(STA, "alignments: "uint32FMT" "uint32FMT"\n", mr1END, mr2END); | ^ sim4dbutils/pickBestPair.C: In function ‘int main(int, char**)’: sim4dbutils/pickBestPair.C:266:19: warning: variable ‘minIdent’ set but not used [-Wunused-but-set-variable] 266 | double minIdent = 0; | ^~~~~~~~ sim4dbutils/pickBestPair.C:267:19: warning: variable ‘minLength’ set but not used [-Wunused-but-set-variable] 267 | double minLength = 0; | ^~~~~~~~~ sim4dbutils/pickBestPair.C:268:19: warning: variable ‘minCoverage’ set but not used [-Wunused-but-set-variable] 268 | double minCoverage = 0; | ^~~~~~~~~~~ sim4dbutils/pickBestPair.C: In function ‘bool readMR(FILE*, mapResult&)’: sim4dbutils/pickBestPair.C:54:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 54 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:57:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 57 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C: In function ‘bool readMRcoords(FILE*, mapResult&)’: sim4dbutils/pickBestPair.C:123:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 123 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:124:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 124 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:125:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 125 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:126:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 126 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:129:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 129 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C: In function ‘bool readMRcoords(FILE*, mapResult&, bool&)’: sim4dbutils/pickBestPair.C:189:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 189 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:190:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 190 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:191:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 191 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:192:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 192 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:195:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 195 | fgets(line, 1024, in); | ~~~~~^~~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C: In function ‘int main(int, char**)’: sim4dbutils/pickBestPair.C:354:12: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 354 | fgets(LL, 10240, IN); | ~~~~~^~~~~~~~~~~~~~~ sim4dbutils/pickBestPair.C:365:14: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 365 | fgets(LL, 10240, IN); | ~~~~~^~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/pickBestPair sim4dbutils/pickBestPair.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/pickUniquePolish.o -c sim4dbutils/pickUniquePolish.C In file included from /<>/libbio/bio.h:4, from sim4dbutils/pickUniquePolish.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/pickUniquePolish.C:7: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/pickUniquePolish sim4dbutils/pickUniquePolish.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/plotCoverageVsIdentity.o -c sim4dbutils/plotCoverageVsIdentity.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/plotCoverageVsIdentity.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/plotCoverageVsIdentity.C:32:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(S, uint32FMT" "uint32FMT"\n", p->_percentIdentity, p->_querySeqIdentity); | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/plotCoverageVsIdentity sim4dbutils/plotCoverageVsIdentity.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/removeDuplicate.o -c sim4dbutils/removeDuplicate.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/removeDuplicate.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/removeDuplicate sim4dbutils/removeDuplicate.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/sortPolishes.o -c sim4dbutils/sortPolishes.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/sortPolishes.C:7: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/sortPolishes.C:87:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r", | ^ sim4dbutils/sortPolishes.C:87:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r", | ^ sim4dbutils/sortPolishes.C:87:70: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r", | ^ sim4dbutils/sortPolishes.C:87:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r", | ^ sim4dbutils/sortPolishes.C:87:125: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 87 | fprintf(stderr, "Read: "uint32FMTW(8)" polishes -- "uint32FMTW(5)" temporary files -- "uint64FMTW(5)"MB / "uint64FMTW(5)"MB -- "uint64FMTW(5)" bytes/polish\r", | ^ sim4dbutils/sortPolishes.C: In function ‘sim4polish* savePolish(sim4polish*, uint64*)’: sim4dbutils/sortPolishes.C:39:9: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polish’; use copy-assignment or copy-initialization instead [-Wclass-memaccess] 39 | memcpy(r, q, sizeof(sim4polish)); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polish.H:99:7: note: ‘class sim4polish’ declared here 99 | class sim4polish { | ^~~~~~~~~~ sim4dbutils/sortPolishes.C:59:9: warning: ‘void* memcpy(void*, const void*, size_t)’ writing to an object of non-trivially copyable type ‘class sim4polishExon’; use copy-assignment or copy-initialization instead [-Wclass-memaccess] 59 | memcpy(r->_exons, q->_exons, sizeof(sim4polishExon) * q->_numExons); | ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libsim4/sim4polish/sim4polish.H:49:7: note: ‘class sim4polishExon’ declared here 49 | class sim4polishExon { | ^~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/sortPolishes sim4dbutils/sortPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/summarizePolishes.o -c sim4dbutils/summarizePolishes.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/summarizePolishes.C:4: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/summarizePolishes.C:167:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 167 | fprintf(stderr, "numSeqs: "uint32FMT"\n", numSeqs); | ^ sim4dbutils/summarizePolishes.C:169:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 169 | fprintf(stderr, "ids: "uint32FMT" -- ", idLen); | ^ sim4dbutils/summarizePolishes.C:171:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 171 | fprintf(stderr, " "uint32FMT"", id[i]); | ^ sim4dbutils/summarizePolishes.C:173:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 173 | fprintf(stderr, "cvs: "uint32FMT" -- ", cvLen); | ^ sim4dbutils/summarizePolishes.C:175:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 175 | fprintf(stderr, " "uint32FMT"", cv[i]); | ^ sim4dbutils/summarizePolishes.C:244:34: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 244 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:244:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 244 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:244:60: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 244 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:244:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 244 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:244:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 244 | fprintf(stdout, uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:247:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 247 | fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)" est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:247:54: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 247 | fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)" est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:247:78: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 247 | fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)" est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:247:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 247 | fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)" est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ sim4dbutils/summarizePolishes.C:247:125: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 247 | fprintf(stdout, uint32FMTW(3)" "uint32FMTW(3)": mapped="uint32FMTW(8)" notmapped="uint32FMTW(8)" est="uint32FMTW(8)" gen="uint32FMTW(8)"\n", id[i], cv[c], mapped, notmapped, uniqest, uniqgen); | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/summarizePolishes sim4dbutils/summarizePolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/uniqPolishes.o -c sim4dbutils/uniqPolishes.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/uniqPolishes.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/uniqPolishes sim4dbutils/uniqPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/vennPolishes.o -c sim4dbutils/vennPolishes.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/vennPolishes.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/vennPolishes.C:115:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 115 | fprintf(stderr, "WARNING: You gave me "uint32FMT" files! That's pretty big. I don't know\n", numFiles); | ^ sim4dbutils/vennPolishes.C:175:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 175 | fprintf(stdout, " "uint32FMTW(8)" ", counts[index]); | ^ sim4dbutils/vennPolishes.C:183:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 183 | fprintf(stdout, "%c = ("uint32FMTW(8)" total) %s\n", 'A' + (char)i, sizes[i], argv[i+numArgs]); | ^ sim4dbutils/vennPolishes.C:189:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 189 | fprintf(stdout, "] "uint32FMT"\n", counts[index]); | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/vennPolishes sim4dbutils/vennPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/realignPolishes.o -c sim4dbutils/realignPolishes.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/realignPolishes.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/realignPolishes.C:160:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4) | ^ sim4dbutils/realignPolishes.C:160:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4) | ^ sim4dbutils/realignPolishes.C:160:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4) | ^ sim4dbutils/realignPolishes.C:160:89: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 160 | "MERGE: "uint32FMTW(4)"-"uint32FMTW(4)" (%6.2f,%6.2f) "uint32FMTW(4)"-"uint32FMTW(4) | ^ sim4dbutils/realignPolishes.C:161:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 161 | " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n", | ^ sim4dbutils/realignPolishes.C:161:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 161 | " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n", | ^ sim4dbutils/realignPolishes.C:161:57: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 161 | " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n", | ^ sim4dbutils/realignPolishes.C:161:87: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 161 | " and "uint32FMTW(8)"-"uint32FMTW(8)" (%6.2f,%6.2f) "uint32FMTW(8)"-"uint32FMTW(8)"\n", | ^ sim4dbutils/realignPolishes.C:243:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 243 | fprintf(stdout, "WARNING: CHANGED! "uint32FMT" -> "uint32FMT"\n", nm, p->_numMatches); | ^ sim4dbutils/realignPolishes.C:243:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 243 | fprintf(stdout, "WARNING: CHANGED! "uint32FMT" -> "uint32FMT"\n", nm, p->_numMatches); | ^ sim4dbutils/realignPolishes.C:248:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(mergeLog, "MERGED\tEST\t"uint32FMT"\tfrom\t%8.3f\t%8.3f\tto\t%8.3f\t%8.3f\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/realignPolishes sim4dbutils/realignPolishes.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/removeRedundant.o -c sim4dbutils/removeRedundant.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4dbutils/removeRedundant.C:5: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/removeRedundant.C:107:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "IID="uint32FMTW(8)" -- overlap:"uint32FMT" noOverlap:"uint32FMT"\r", | ^ sim4dbutils/removeRedundant.C:107:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "IID="uint32FMTW(8)" -- overlap:"uint32FMT" noOverlap:"uint32FMT"\r", | ^ sim4dbutils/removeRedundant.C:107:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 107 | fprintf(stderr, "IID="uint32FMTW(8)" -- overlap:"uint32FMT" noOverlap:"uint32FMT"\r", | ^ sim4dbutils/removeRedundant.C:212:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "\nNOT A PERFECT CLIQUE! Found "uint32FMT" overlaps, wanted "uint32FMT" in the clique.\n", | ^ sim4dbutils/removeRedundant.C:212:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 212 | fprintf(stderr, "\nNOT A PERFECT CLIQUE! Found "uint32FMT" overlaps, wanted "uint32FMT" in the clique.\n", | ^ sim4dbutils/removeRedundant.C:260:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 260 | fprintf(stderr, "\nmatches withOvl:"uint32FMT" withoutOvl:"uint32FMT"\n", | ^ sim4dbutils/removeRedundant.C:260:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 260 | fprintf(stderr, "\nmatches withOvl:"uint32FMT" withoutOvl:"uint32FMT"\n", | ^ sim4dbutils/removeRedundant.C:262:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 262 | fprintf(stderr, "not perfect clique:"uint32FMT"\n", notPerfectClique); | ^ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/removeRedundant sim4dbutils/removeRedundant.o sim4dbutils/s4p_overlap.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4dbutils/reportAlignmentDifferences.o -c sim4dbutils/reportAlignmentDifferences.C In file included from /<>/libutil/util++.H:4, from /<>/libsim4/sim4polish/sim4polish.H:11, from /<>/libsim4/sim4.H:1, from sim4dbutils/reportAlignmentDifferences.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4dbutils/reportAlignmentDifferences.C: In function ‘int main(int, char**)’: sim4dbutils/reportAlignmentDifferences.C:155:12: warning: suggest explicit braces to avoid ambiguous ‘else’ [-Wdangling-else] 155 | if (e->_estAlignment[aPos] != '-') | ^ sim4dbutils/reportAlignmentDifferences.C:201:9: warning: ignoring return value of ‘int system(const char*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 201 | system(gnuCmd); | ~~~~~~^~~~~~~~ sim4dbutils/reportAlignmentDifferences.C:200:30: warning: ‘%s’ directive writing up to 4095 bytes into a region of size 4086 [-Wformat-overflow=] 200 | sprintf(gnuCmd, "gnuplot < %s", gnuName); | ^~ ~~~~~~~ In file included from /usr/include/stdio.h:970, from sim4dbutils/reportAlignmentDifferences.C:1: In function ‘int sprintf(char*, const char*, ...)’, inlined from ‘int main(int, char**)’ at sim4dbutils/reportAlignmentDifferences.C:200:10: /usr/include/x86_64-linux-gnu/bits/stdio2.h:30:34: note: ‘__builtin___sprintf_chk’ output between 11 and 4106 bytes into a destination of size 4096 30 | return __builtin___sprintf_chk (__s, __USE_FORTIFY_LEVEL - 1, | ~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 31 | __glibc_objsize (__s), __fmt, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 32 | __va_arg_pack ()); | ~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4dbutils/reportAlignmentDifferences sim4dbutils/reportAlignmentDifferences.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libsim4/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o sim4db/sim4th.o -c sim4db/sim4th.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from sim4db/sim4th.C:34: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ sim4db/sim4th.C:327:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 327 | sprintf(str, "%s -Y "uint32FMT" "uint32FMT"\n", | ^ sim4db/sim4th.C:327:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 327 | sprintf(str, "%s -Y "uint32FMT" "uint32FMT"\n", | ^ sim4db/sim4th.C: In function ‘void writer(void*, void*)’: sim4db/sim4th.C:316:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 316 | write(fOutput, o, strlen(o) * sizeof(char)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ sim4db/sim4th.C:332:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 332 | write(fYesNo, str, strlen(str) * sizeof(char)); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o sim4db/sim4db sim4db/sim4th.o /<>/libsim4/libsim4.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/snapper2.o -c snapper/snapper2.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/snapper2.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.C:59:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 59 | fprintf(F, "%6.4f %6.4f %6.4f %6.4f %6.4f "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n", | ^ snapper/snapper2.C:59:65: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 59 | fprintf(F, "%6.4f %6.4f %6.4f %6.4f %6.4f "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n", | ^ snapper/snapper2.C:59:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 59 | fprintf(F, "%6.4f %6.4f %6.4f %6.4f %6.4f "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n", | ^ snapper/snapper2.C:59:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 59 | fprintf(F, "%6.4f %6.4f %6.4f %6.4f %6.4f "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)" "uint32FMTW(8)"\n", | ^ snapper/snapper2.C:248:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stderr, "WARNING: Found "uint32FMT" queries shorter than minimum reportable size (-discardexonlength = "uint32FMT")\n", | ^ snapper/snapper2.C:248:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 248 | fprintf(stderr, "WARNING: Found "uint32FMT" queries shorter than minimum reportable size (-discardexonlength = "uint32FMT")\n", | ^ snapper/snapper2.C:254:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 254 | fprintf(stderr, "WARNING: Found "uint32FMT" queries longer than maximum size ("uint32FMT")\n", | ^ snapper/snapper2.C:254:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 254 | fprintf(stderr, "WARNING: Found "uint32FMT" queries longer than maximum size ("uint32FMT")\n", | ^ snapper/snapper2.C:295:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 295 | fprintf(stderr, "Created "uint32FMT" filters (out of "uint32FMT" available) to test/validate.\n", | ^ snapper/snapper2.C:295:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 295 | fprintf(stderr, "Created "uint32FMT" filters (out of "uint32FMT" available) to test/validate.\n", | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ snapper/snapper2.C: In function ‘void writerThread(void*, void*)’: snapper/snapper2.C:155:10: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 155 | write(resultFILE, qry->theOutput, sizeof(char) * qry->theOutputLen); | ~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /<>/libutil/logMsg.H: In member function ‘void logMsg::write(int, const char*)’: /<>/libutil/logMsg.H:85:12: warning: ignoring return value of ‘ssize_t write(int, const void*, size_t)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 85 | ::write(file, _log, sizeof(char) * _logLen); | ~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/configuration.o -c snapper/configuration.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/configuration.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/configuration.C:205:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 205 | fprintf(stderr, "ERROR: Invalid afLength "uint32FMT", should be < 64.\n", _afLength), err++; | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-search.o -c snapper/thr-search.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/thr-search.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-filter.o -c snapper/thr-filter.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/thr-filter.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-polish.o -c snapper/thr-polish.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/thr-polish.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/thr-polish.C:311:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 311 | fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID); | ^ snapper/thr-polish.C:311:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 311 | fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID); | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/thr-polish-dp.o -c snapper/thr-polish-dp.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/thr-polish-dp.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/thr-polish-dp.C:89:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 89 | fprintf(stderr, "dpMatrix-- reallocate to "uint32FMT" x "uint32FMT"\n", aMax, bMax); | ^ snapper/thr-polish-dp.C:89:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 89 | fprintf(stderr, "dpMatrix-- reallocate to "uint32FMT" x "uint32FMT"\n", aMax, bMax); | ^ snapper/thr-polish-dp.C:441:29: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 441 | fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID); | ^ snapper/thr-polish-dp.C:441:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 441 | fprintf(stderr, "doPolish()-- Can't reallocate space for the output string ("uint32FMT" bytes) in thread "uint64FMT"\n", qry->theOutputMax, state->threadID); | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/hitMatrix.o -c snapper/hitMatrix.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/hitMatrix.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/hitMatrix.C:385:27: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 385 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT".\n", theHitsPos, theHitsMax); | ^ snapper/hitMatrix.C:385:95: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 385 | fprintf(stderr, "hitMatrix::filter()-- tried to extend output string from "uint32FMT" to "uint32FMT".\n", theHitsPos, theHitsMax); | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ snapper/hitMatrix.C: In member function ‘void hitMatrix::filter(char, double, uint32, aHit*&, uint32&, uint32&)’: snapper/hitMatrix.C:383:23: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 383 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o snapper/hitMatrix-sort.o -c snapper/hitMatrix-sort.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from snapper/snapper2.H:18, from snapper/hitMatrix-sort.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from snapper/snapper2.H:20: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ snapper/snapper2.H:421:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H:421:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 421 | fprintf(stderr, "hitMatrix::addHits()-- have "uint32FMT" hits, tried to add "uint64FMT" more\n", _hitsLen, cn); | ^ snapper/snapper2.H: In member function ‘void hitMatrix::addHits(uint32, uint64*, uint64, uint64)’: snapper/snapper2.H:419:19: warning: catching polymorphic type ‘class std::bad_alloc’ by value [-Wcatch-value=] 419 | } catch (std::bad_alloc) { | ^~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o snapper/snapper2 snapper/snapper2.o snapper/configuration.o snapper/thr-search.o snapper/thr-filter.o snapper/thr-polish.o snapper/thr-polish-dp.o snapper/hitMatrix.o snapper/hitMatrix-sort.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tagger.o -c tapper/tagger.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from tapper/tapperTag.H:1, from tapper/tagger.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stderr, "tapperTagFile()-- ERROR! Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n", | ^ In file included from tapper/tagger.C:2: tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp] 116 | #warning do not know real tag length | ^~~~~~~ tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ In file included from tapper/tagger.C:4: tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tagger.C:151:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 151 | fprintf(stdout, "%s\tlength\t"uint32FMT"\n", tagfile, TF->metaData()->tagSize()); | ^ tapper/tagger.C:152:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 152 | fprintf(stdout, "%s\tnumMates\t"uint64FMT"\n", tagfile, TF->numberOfMatePairs()); | ^ tapper/tagger.C:153:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 153 | fprintf(stdout, "%s\tmean\t"uint32FMT"\n", tagfile, TF->metaData()->mean()); | ^ tapper/tagger.C:154:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 154 | fprintf(stdout, "%s\tstddev\t"uint32FMT"\n", tagfile, TF->metaData()->stddev()); | ^ tapper/tagger.C:157:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 157 | fprintf(stdout, "%s\tlength\t"uint32FMT"\n", tagfile, TF->metaData()->tagSize()); | ^ tapper/tagger.C:158:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 158 | fprintf(stdout, "%s\tnumTags\t"uint64FMT"\n", tagfile, TF->numberOfFragmentTags()); | ^ tapper/tagger.C:182:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:92: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:104: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:182:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 182 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\t>"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:191:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 191 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:191:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 191 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:191:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 191 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:191:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 191 | fprintf(stdout, ">"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t%s/%s\n", | ^ tapper/tagger.C:362:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 362 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n", | ^ tapper/tagger.C:362:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 362 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n", | ^ tapper/tagger.C:362:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 362 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n", | ^ tapper/tagger.C:362:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 362 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n", | ^ tapper/tagger.C:362:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 362 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t0\t"uint32FMT"\t%c\t%s%s\t%s\n", | ^ tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’: tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~ | | | int tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’: tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~~~~~ | | | int tapper/tagger.C: In function ‘bool readTag(uint32, FILE*, FILE*, tapperTag*)’: tapper/tagger.C:52:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 52 | fgets(seqhdr, 1024, seq); | ~~~~~^~~~~~~~~~~~~~~~~~~ tapper/tagger.C:54:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 54 | fgets(seqhdr, 1024, seq); | ~~~~~^~~~~~~~~~~~~~~~~~~ tapper/tagger.C:55:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 55 | fgets(seqseq, 1024, seq); | ~~~~~^~~~~~~~~~~~~~~~~~~ tapper/tagger.C:57:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 57 | fgets(qlthdr, 1024, qlt); | ~~~~~^~~~~~~~~~~~~~~~~~~ tapper/tagger.C:59:10: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 59 | fgets(qlthdr, 1024, qlt); | ~~~~~^~~~~~~~~~~~~~~~~~~ tapper/tagger.C:60:8: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’ declared with attribute ‘warn_unused_result’ [-Wunused-result] 60 | fgets(qltseq, 1024, qlt); | ~~~~~^~~~~~~~~~~~~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o tapper/tagger tapper/tagger.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tapper.o -c tapper/tapper.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from tapper/tapperTag.H:1, from tapper/tapper.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stderr, "tapperTagFile()-- ERROR! Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n", | ^ In file included from tapper/tapper.C:2: tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp] 116 | #warning do not know real tag length | ^~~~~~~ tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ In file included from tapper/tapper.C:4: tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ In file included from tapper/tapperGlobalData.H:1, from tapper/tapper.C:5: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapper.C:633:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 633 | fprintf(stderr, "Reallocate t->numHappiesMax to "uint32FMT"\n", t->numHappiesMax); | ^ tapper/tapper.C:1048:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1048 | fprintf(stderr, "sizeof(tapperResultIndex) -- "sizetFMT"\n", sizeof(tapperResultIndex)); | ^ tapper/tapper.C:1049:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1049 | fprintf(stderr, "sizeof(tapperResultQV) -- "sizetFMT"\n", sizeof(tapperResultQV)); | ^ tapper/tapper.C:1050:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1050 | fprintf(stderr, "sizeof(tapperResultFragment) -- "sizetFMT"\n", sizeof(tapperResultFragment)); | ^ tapper/tapper.C:1051:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1051 | fprintf(stderr, "sizeof(tapperResultMated) -- "sizetFMT"\n", sizeof(tapperResultMated)); | ^ tapper/tapper.C:1052:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1052 | fprintf(stderr, "sizeof(tapperResultTangled) -- "sizetFMT"\n", sizeof(tapperResultTangled)); | ^ tapper/tapper.C:1053:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1053 | fprintf(stderr, "sizeof(tapperHit) -- "sizetFMT"\n", sizeof(tapperHit)); | ^ tapper/tapper.C:1054:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1054 | fprintf(stderr, "sizeof(tapperTag) -- "sizetFMT"\n", sizeof(tapperTag)); | ^ tapper/tapper.C:1124:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 1124 | fprintf(stderr, " all alignments. The default is "uint32FMT".\n", g->repeatThreshold); | ^ tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’: tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~ | | | int tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’: tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~~~~~ | | | int tapper/tapper.C: In member function ‘bool tapperHit::alignToReference(tapperGlobalData*, uint32, uint32, char*, uint32)’: tapper/tapper.C:399:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘uint32’ {aka ‘unsigned int’} [-Wsign-compare] 399 | if (_colorMismatch + _colorInconsistent > g->maxColorError) | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~ tapper/tapper.C:415:23: warning: comparison of integer expressions of different signedness: ‘uint32’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare] 415 | for (uint32 ti=0; ti<_len-1; ti++) { | ~~^~~~~~~ In file included from /<>/libutil/recordFile.H:6, from /<>/libutil/util++.H:39: tapper/tapper.C:468:13: warning: comparison of integer expressions of different signedness: ‘uint32’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare] 468 | assert(nn == _colorMismatch + _colorInconsistent); | ~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from tapper/tapper.C:7: tapper/tapperComputation.H: In constructor ‘tapperComputation::tapperComputation(tapperTag*, tapperTag*)’: tapper/tapperComputation.H:51:28: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 51 | tag1rseq[tag1size-1] = complementSymbol[tag1rseq[tag1size-1]]; | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ tapper/tapperComputation.H:186:38: note: at offset 4294967295 into destination object ‘tapperComputation::tag1rseq’ of size 32 186 | char tag1fseq[TAG_LEN_MAX], tag1rseq[TAG_LEN_MAX]; | ^~~~~~~~ tapper/tapperComputation.H:75:28: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 75 | tag2rseq[tag2size-1] = complementSymbol[tag2rseq[tag2size-1]]; | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ tapper/tapperComputation.H:187:38: note: at offset 4294967295 into destination object ‘tapperComputation::tag2rseq’ of size 32 187 | char tag2fseq[TAG_LEN_MAX], tag2rseq[TAG_LEN_MAX]; | ^~~~~~~~ In constructor ‘tapperComputation::tapperComputation(tapperTag*, tapperTag*)’, inlined from ‘void* tapperReader(void*)’ at tapper/tapper.C:28:39: tapper/tapperComputation.H:51:28: warning: writing 1 byte into a region of size 0 [-Wstringop-overflow=] 51 | tag1rseq[tag1size-1] = complementSymbol[tag1rseq[tag1size-1]]; | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ tapper/tapperComputation.H: In function ‘void* tapperReader(void*)’: tapper/tapperComputation.H:186:38: note: at offset 4294967295 into destination object ‘tapperComputation::tag1rseq’ of size 32 186 | char tag1fseq[TAG_LEN_MAX], tag1rseq[TAG_LEN_MAX]; | ^~~~~~~~ g++ -Wl,-z,relro -Wl,-z,now -o tapper/tapper tapper/tapper.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tapperconvert.o -c tapper/tapperconvert.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from tapper/tapperTag.H:1, from tapper/tapperconvert.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stderr, "tapperTagFile()-- ERROR! Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n", | ^ In file included from tapper/tapperconvert.C:2: tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp] 116 | #warning do not know real tag length | ^~~~~~~ tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ In file included from tapper/tapperconvert.C:4: tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ In file included from tapper/tapperGlobalData.H:1, from tapper/tapperconvert.C:5: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’: tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~ | | | int tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’: tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~~~~~ | | | int g++ -Wl,-z,relro -Wl,-z,now -o tapper/tapperconvert tapper/tapperconvert.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tappermerge.o -c tapper/tappermerge.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from tapper/tapperTag.H:1, from tapper/tappermerge.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stderr, "tapperTagFile()-- ERROR! Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n", | ^ In file included from tapper/tappermerge.C:2: tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp] 116 | #warning do not know real tag length | ^~~~~~~ tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ In file included from tapper/tappermerge.C:4: tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ In file included from tapper/tapperGlobalData.H:1, from tapper/tappermerge.C:5: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’: tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~ | | | int tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’: tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~~~~~ | | | int g++ -Wl,-z,relro -Wl,-z,now -o tapper/tappermerge tapper/tappermerge.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tappersort.o -c tapper/tappersort.C In file included from /<>/libutil/util++.H:4, from tapper/tappersort.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from tapper/tappersort.C:3: tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stderr, "tapperTagFile()-- ERROR! Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n", | ^ In file included from tapper/tappersort.C:4: tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp] 116 | #warning do not know real tag length | ^~~~~~~ tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ In file included from tapper/tappersort.C:6: tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ In file included from tapper/tapperGlobalData.H:1, from tapper/tappersort.C:7: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tappersort.C:148:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | sprintf(filename, "%s."uint32FMTW(03)".tapperAlignment", outputName, outputIndex); | ^ tapper/tappersort.C:150:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 150 | fprintf(stderr, "Writing "uint32FMT" sorted alignments to '%s'\n", aliLen, filename); | ^ tapper/tappersort.C:202:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 202 | fprintf(stderr, "Can fit "uint32FMT" alignments into "uint64FMT" bytes memory; "uint32FMT" bytes each.\n", | ^ tapper/tappersort.C:202:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 202 | fprintf(stderr, "Can fit "uint32FMT" alignments into "uint64FMT" bytes memory; "uint32FMT" bytes each.\n", | ^ tapper/tappersort.C:202:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 202 | fprintf(stderr, "Can fit "uint32FMT" alignments into "uint64FMT" bytes memory; "uint32FMT" bytes each.\n", | ^ tapper/tappersort.C:257:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 257 | sprintf(filename, "%s."uint32FMTW(03)".tapperAlignment", outputName, x); | ^ tapper/tappersort.C:299:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 299 | sprintf(filename, "%s."uint32FMTW(03)".tapperAlignment", outputName, x); | ^ tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’: tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~ | | | int tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’: tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~~~~~ | | | int g++ -Wl,-z,relro -Wl,-z,now -o tapper/tappersort tapper/tappersort.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libutil/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libmeryl/ -I/<>/libkmer/ -I/<>/libsim4/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o tapper/tappererrorcorrect.o -c tapper/tappererrorcorrect.C In file included from /<>/libutil/util++.H:4, from tapper/tappererrorcorrect.C:1: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from tapper/tappererrorcorrect.C:3: tapper/tapperTag.H:204:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 204 | fprintf(stderr, "tapperTagFile()-- ERROR! Tag file was built with TAPPER_TAG_WORDS="uint32FMT", but code has %d.\n", | ^ In file included from tapper/tappererrorcorrect.C:4: tapper/tapperResult.H:41:18: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:32: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:44: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:56: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:68: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:81: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:93: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:105: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:117: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:130: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:142: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:155: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:168: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:183: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:198: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:41:228: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^ tapper/tapperResult.H:116:2: warning: #warning do not know real tag length [-Wcpp] 116 | #warning do not know real tag length | ^~~~~~~ tapper/tapperResult.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:132:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:37: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:73: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:86: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:99: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:116: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:155:128: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 155 | fprintf(stdout, "F\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t'%s'\n", | ^ tapper/tapperResult.H:187:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:114: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:126: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:138: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:151: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:163: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:175: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:187: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:200: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:213: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:230: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:187:242: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 187 | fprintf(stdout, "M\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t%c\t"uint32FMT"/"uint32FMT"/"uint32FMT"\n", | ^ tapper/tapperResult.H:224:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:47: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:59: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:84: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:109: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:121: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:133: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:146: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:159: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ tapper/tapperResult.H:224:172: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 224 | fprintf(stdout, "T\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\t"uint32FMT"\n", | ^ In file included from tapper/tappererrorcorrect.C:6: tapper/tapperHit.H:17:17: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:30: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:43: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:55: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ tapper/tapperHit.H:17:83: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, | ^ In file included from tapper/tapperGlobalData.H:1, from tapper/tappererrorcorrect.C:7: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ tapper/tapperGlobalData.H:109:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:109:61: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 109 | fprintf(stderr, "ERROR: invalid partition n="uint32FMT" m="uint32FMT".\n", thisPartition, numPartitions); | ^ tapper/tapperGlobalData.H:120:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:50: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:71: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:120:97: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 120 | fprintf(stderr, "Set partition for "uint64FMT" frags or "uint64FMT" mates: -begin "uint32FMT" -end "uint32FMT"\n", | ^ tapper/tapperGlobalData.H:144:20: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tapperGlobalData.H:144:36: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 144 | sprintf(colName, "%s.ms"uint32FMT".ce"uint32FMT".posDB", genName, tagSize, maxColorError); | ^ tapper/tappererrorcorrect.C:25:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 25 | fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", i, alignsLen[i]); | ^ tapper/tappererrorcorrect.C:25:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 25 | fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", i, alignsLen[i]); | ^ tapper/tappererrorcorrect.C:49:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 49 | fprintf(stderr, "block[0] - seq "uint32FMT" pos "uint32FMT"\n", | ^ tapper/tappererrorcorrect.C:49:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 49 | fprintf(stderr, "block[0] - seq "uint32FMT" pos "uint32FMT"\n", | ^ tapper/tappererrorcorrect.C:62:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", alignsMax-1, alignsLen[alignsMax-1]); | ^ tapper/tappererrorcorrect.C:62:40: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 62 | fprintf(stderr, "block "uint32FMT" has "uint32FMT" things.\n", alignsMax-1, alignsLen[alignsMax-1]); | ^ tapper/tappererrorcorrect.C:160:2: warning: #warning need the real read size here [-Wcpp] 160 | #warning need the real read size here | ^~~~~~~ tapper/tappererrorcorrect.C:213:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 213 | fprintf(stdout, "\nALIGN "uint32FMT"-"uint32FMT"\n", winLo, winHi); | ^ tapper/tappererrorcorrect.C:213:42: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 213 | fprintf(stdout, "\nALIGN "uint32FMT"-"uint32FMT"\n", winLo, winHi); | ^ tapper/tapperResult.H: In member function ‘void tapperResultIndex::print(FILE*)’: tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 11 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 12 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 44 | _maxColrMismatchMapped, _maxBaseMismatchMapped, | ~~~~~~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 13 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 14 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 45 | _mean, _stddev, | ~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 15 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 16 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 17 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 18 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~ | | | int tapper/tapperResult.H:41:18: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 19 has type ‘int’ [-Wformat=] 41 | fprintf(out, "R\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint16FMT"_"uint16FMT"_"uint16FMT"_"uint16FMT"\t"uint64FMT"/"uint64FMT"\t"uint64FMT"+-"uint64FMT"\tf:"uint64FMT"\td:"uint64FMT"\ts:"uint64FMT"\tm:"uint64FMT"\tt:"uint64FMT"\n", | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ...... 46 | _numFrag, _numFragDiscarded, _numFragSingleton, _numMated, _numTangled); | ~~~~~~~~~~~ | | | int tapper/tapperHit.H: In member function ‘char* tapperHit::printHit(char*, uint64)’: tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 7 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 8 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~ | | | int tapper/tapperHit.H:17:17: warning: format ‘%lu’ expects argument of type ‘long unsigned int’, but argument 9 has type ‘int’ [-Wformat=] 17 | sprintf(OS, "0x"uint64FMT"\t"uint32FMT":"uint32FMT":%c\t"uint64FMT","uint64FMT","uint64FMT, ...... 20 | _basesMismatch, _colorMismatch, _colorInconsistent); | ~~~~~~~~~~~~~~~~~~ | | | int tapper/tappererrorcorrect.C: In function ‘int main(int, char**)’: tapper/tappererrorcorrect.C:102:13: warning: variable ‘memoryLimit’ set but not used [-Wunused-but-set-variable] 102 | uint64 memoryLimit = 1024 * 1024 * 1024; | ^~~~~~~~~~~ tapper/tappererrorcorrect.C:141:21: warning: unused variable ‘id’ [-Wunused-variable] 141 | uint16 id[4]; | ^~ g++ -Wl,-z,relro -Wl,-z,now -o tapper/tappererrorcorrect tapper/tappererrorcorrect.o /<>/libsim4/libsim4.a /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/driver-existDB.o -c /<>/libkmer/driver-existDB.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/driver-existDB.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ /<>/libkmer/driver-existDB.C:53:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 53 | fprintf(stderr, "mer "uint64HEX" not found : e=%d f=%d g=%d\n", m, ee, ef, eg); | ^ /<>/libkmer/driver-existDB.C:56:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | fprintf(stderr, "mer "uint64HEX" count differs : e=%u f=%u g=%u (exists=%d)\n", m, ce, cf, cg, ee); | ^ /<>/libkmer/driver-existDB.C:65:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | fprintf(stderr, "mer "uint64HEX" : e=%u f=%u g=%u (exists=%d)\n", m, ce, cf, cg, ee); | ^ /<>/libkmer/driver-existDB.C:96:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 96 | fprintf(stderr, "Tried "uint64FMT", didn't find "uint64FMT" merStream mers in the existDB.\n", tried, lost); | ^ /<>/libkmer/driver-existDB.C:96:38: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 96 | fprintf(stderr, "Tried "uint64FMT", didn't find "uint64FMT" merStream mers in the existDB.\n", tried, lost); | ^ /<>/libkmer/driver-existDB.C:128:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "Found "uint64FMT" mers in the meryl database.\n", expected); | ^ /<>/libkmer/driver-existDB.C:148:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "Expected to find "uint64FMT" mers, but found "uint64FMT" instead.\n", | ^ /<>/libkmer/driver-existDB.C:148:49: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 148 | fprintf(stderr, "Expected to find "uint64FMT" mers, but found "uint64FMT" instead.\n", | ^ g++ -Wl,-z,relro -Wl,-z,now -o /<>/libkmer/existDB /<>/libkmer/driver-existDB.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=c++03 -I/<>/libmeryl/ -I/<>/libbio/ -I/<>/libseq/ -I/<>/libutil/ -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libkmer/driver-posDB.o -c /<>/libkmer/driver-posDB.C In file included from /<>/libbio/bio.h:4, from /<>/libbio/bio++.H:14, from /<>/libkmer/driver-posDB.C:6: /<>/libutil/util.h:55:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 55 | #define uint64FMT "%"PRIu64 | ^ /<>/libutil/util.h:56:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 56 | #define uint64HEX "0x%016"PRIx64 | ^ /<>/libutil/util.h:58:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 58 | #define int64FMT "%"PRId64 | ^ /<>/libutil/util.h:65:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 65 | #define uint32FMT "%"PRIu32 | ^ /<>/libutil/util.h:66:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 66 | #define uint32HEX "0x%08"PRIx32 | ^ /<>/libutil/util.h:68:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | #define int32FMT "%"PRId32 | ^ /<>/libutil/util.h:75:26: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | #define uint16FMT "%"PRIu16 | ^ In file included from /<>/libutil/util++.H:37, from /<>/libbio/bio++.H:15: /<>/libutil/bitPackedArray.H:222:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ /<>/libutil/bitPackedArray.H:222:39: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 222 | fprintf(stderr, "HEAP["uint32FMT"]="uint64FMT"\n", i, _array->get(i)); | ^ In file included from /<>/libutil/util++.H:38: /<>/libutil/bitPackedFile.H:32:16: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ /<>/libutil/bitPackedFile.H:32:35: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 32 | fprintf(f, "inside: "uint64FMT" outside: "uint64FMT"\n", stat_seekInside, stat_seekOutside); | ^ In file included from /<>/libutil/util++.H:43: /<>/libutil/logMsg.H:75:15: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 75 | "logMsg::add()-- HEY! I wrote "uint32FMT" bytes beyond the end of the buffer!\n" | ^ In file included from /<>/libkmer/driver-posDB.C:8: /<>/libkmer/positionDB.H:127:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 127 | fprintf(stderr, "shift1 = "uint32FMT"\n", _shift1); | ^ /<>/libkmer/positionDB.H:128:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 128 | fprintf(stderr, "shift2 = "uint32FMT"\n", _shift2); | ^ /<>/libkmer/positionDB.H:129:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 129 | fprintf(stderr, "M = "uint64HEX"\n", m); | ^ /<>/libkmer/positionDB.H:130:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 130 | fprintf(stderr, "H = "uint64HEX"\n", h); | ^ /<>/libkmer/positionDB.H:131:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 131 | fprintf(stderr, "C = "uint64HEX"\n", c); | ^ /<>/libkmer/positionDB.H:132:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 132 | fprintf(stderr, "R = "uint64HEX"\n", r); | ^ /<>/libkmer/driver-posDB.C:54:25: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (", | ^ /<>/libkmer/driver-posDB.C:54:41: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (", | ^ /<>/libkmer/driver-posDB.C:54:53: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (", | ^ /<>/libkmer/driver-posDB.C:54:72: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 54 | fprintf(stdout, "%s @ "uint64FMT"/"uint64FMT": Found "uint64FMT" table entries, and "uint32FMT" matching positions (", | ^ /<>/libkmer/driver-posDB.C:68:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 68 | fprintf(stdout, "Found no matches for mer=%s at pos="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:101:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 101 | fprintf(stdout, "Got a F match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:101:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 101 | fprintf(stdout, "Got a F match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:101:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 101 | fprintf(stdout, "Got a F match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:110:23: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "Got a R match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:110:62: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "Got a R match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:110:74: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 110 | fprintf(stdout, "Got a R match for mer=%s at "uint64FMT"/"uint64FMT" (in mers), numMatches="uint64FMT"\n", | ^ /<>/libkmer/driver-posDB.C:255:21: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 255 | fprintf(stderr, "ERROR: merbegin="uint64FMT" and merend="uint64FMT" are incompatible.\n", | ^ /<>/libkmer/driver-posDB.C:255:48: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 255 | fprintf(stderr, "ERROR: merbegin="uint64FMT" and merend="uint64FMT" are incompatible.\n", | ^ /<>/libkmer/driver-posDB.C:275:19: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 275 | fprintf(stderr, "Building table with merSize "uint32FMT", merSkip "uint32FMT"\n", mersize, merskip); | ^ /<>/libkmer/driver-posDB.C:275:58: warning: C++11 requires a space between string literal and macro [-Wc++11-compat] 275 | fprintf(stderr, "Building table with merSize "uint32FMT", merSkip "uint32FMT"\n", mersize, merskip); | ^ g++ -Wl,-z,relro -Wl,-z,now -o /<>/libkmer/positionDB /<>/libkmer/driver-posDB.o /<>/libkmer/libkmer.a /<>/libmeryl/libmeryl.a /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wl,-z,relro -Wl,-z,now -o /<>/libseq/test-seqCache /<>/libseq/test-seqCache.o /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wl,-z,relro -Wl,-z,now -o /<>/libseq/test-seqStream /<>/libseq/test-seqStream.o /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm g++ -Wl,-z,relro -Wl,-z,now -o /<>/libseq/test-merStream /<>/libseq/test-merStream.o /<>/libseq/libseq.a /<>/libbio/libbio.a /<>/libutil/libutil.a -pthread -ldl -lm gcc -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer -o /<>/libutil/mt19937ar/test.o -c /<>/libutil/mt19937ar/test.c rm -f /<>/libutil/mt19937ar/libmt19937ar.a && ar ruvs /<>/libutil/mt19937ar/libmt19937ar.a /<>/libutil/mt19937ar/mt19937ar.o /<>/libutil/mt19937ar/test.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libutil/mt19937ar/libmt19937ar.a a - /<>/libutil/mt19937ar/mt19937ar.o a - /<>/libutil/mt19937ar/test.o rm -f /<>/libutil/kazlib/libkaz.a && ar ruvs /<>/libutil/kazlib/libkaz.a /<>/libutil/kazlib/dict.o /<>/libutil/kazlib/except.o /<>/libutil/kazlib/hash.o /<>/libutil/kazlib/list.o /<>/libutil/kazlib/sfx.o ar: `u' modifier ignored since `D' is the default (see `U') ar: creating /<>/libutil/kazlib/libkaz.a a - /<>/libutil/kazlib/dict.o a - /<>/libutil/kazlib/except.o a - /<>/libutil/kazlib/hash.o a - /<>/libutil/kazlib/list.o a - /<>/libutil/kazlib/sfx.o make[2]: Leaving directory '/<>' mv installdir/bin/atac.pl installdir/bin/atac mv -v installdir/lib/halignmodule.so installdir/lib/halign.so renamed 'installdir/lib/halignmodule.so' -> 'installdir/lib/halign.so' mv -v installdir/lib/localAlignerInterfacemodule.so installdir/lib/localAlignerInterface.so renamed 'installdir/lib/localAlignerInterfacemodule.so' -> 'installdir/lib/localAlignerInterface.so' make[1]: Leaving directory '/<>' dh_auto_test create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j2 install DESTDIR=/<>/kmer-0\~20150903\+r2013/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/<>' make[1]: Leaving directory '/<>' dh_install debian/rules execute_after_dh_install make[1]: Entering directory '/<>' for perlscript in `grep -l '#!/usr/bin/env \+perl' debian/*/usr/bin/*` `grep -l '#!/usr/bin/env \+perl' debian/*/usr/lib/atac/bin/*` ; do \ sed -i '1s+#!/usr/bin/env perl+#!/usr/bin/perl+' ${perlscript} ; \ done make[1]: Leaving directory '/<>' dh_installdocs dh_installchangelogs dh_installman debian/rules override_dh_python3 make[1]: Entering directory '/<>' dh_python3 --no-ext-rename make[1]: Leaving directory '/<>' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dpkg-gencontrol: warning: Depends field of package libkmer-dev: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package libmeryl-dev: substitution variable ${shlibs:Depends} used, but is not defined dh_md5sums dh_builddeb dpkg-deb: building package 'kmer' in '../kmer_0~20150903+r2013-9_all.deb'. dpkg-deb: building package 'leaff-dbgsym' in '../leaff-dbgsym_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'libkmer-dev' in '../libkmer-dev_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'sim4db' in '../sim4db_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'meryl' in '../meryl_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'meryl-dbgsym' in '../meryl-dbgsym_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'sim4db-dbgsym' in '../sim4db-dbgsym_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'libmeryl-dev' in '../libmeryl-dev_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'leaff' in '../leaff_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'atac' in '../atac_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'atac-dbgsym' in '../atac-dbgsym_0~20150903+r2013-9_amd64.deb'. dpkg-deb: building package 'kmer-examples' in '../kmer-examples_0~20150903+r2013-9_all.deb'. dpkg-genbuildinfo -O../kmer_0~20150903+r2013-9_amd64.buildinfo dpkg-genchanges -O../kmer_0~20150903+r2013-9_amd64.changes dpkg-genchanges: info: not including original source code in upload dpkg-source -Zxz --after-build . dpkg-buildpackage: info: binary and diff upload (original source NOT included) -------------------------------------------------------------------------------- Build finished at 2024-09-10T16:04:41Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ kmer_0~20150903+r2013-9_amd64.changes: -------------------------------------- Format: 1.8 Date: Tue, 10 Sep 2024 10:35:03 +0200 Source: kmer Binary: atac atac-dbgsym kmer kmer-examples leaff leaff-dbgsym libkmer-dev libmeryl-dev meryl meryl-dbgsym sim4db sim4db-dbgsym Architecture: source amd64 all Version: 0~20150903+r2013-9 Distribution: perl-5.40-throwaway Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Michael R. Crusoe Description: atac - genome assembly-to-assembly comparison kmer - suite of tools for DNA sequence analysis kmer-examples - sample data for kmer suite of tools for DNA sequence analysis leaff - biological sequence library utilities and applications libkmer-dev - suite of tools for DNA sequence analysis (development lib) libmeryl-dev - in- and out-of-core kmer counting and utilities (development lib) meryl - in- and out-of-core kmer counting and utilities sim4db - batch spliced alignment of cDNA sequences to a target genome Closes: 1080608 Changes: kmer (0~20150903+r2013-9) unstable; urgency=medium . * Team upload. * Added patch to replace distutils with stdlib usage. Closes: #1080608 * Standards-Version: 4.6.2 (routine-update) * debhelper-compat 13 (routine-update) * Build-Depends: s/dh-python/dh-sequence-python3/ (routine-update) * No tab in license text (routine-update) * Add missing build dependency on dh-python | dh-sequence-python3 for command dh_python3. * d/rules: set -std=c++03 to reduce warnings Checksums-Sha1: 634bca5314754ce9a661d1affba07071d7bb4288 1488 kmer_0~20150903+r2013-9.dsc bff8b0b6f815807795d55bf9adb33c18dee8cf94 2380056 kmer_0~20150903+r2013-9.debian.tar.xz ce8f1b028ca1dda6d395941c958e7180397d581a 2686844 atac-dbgsym_0~20150903+r2013-9_amd64.deb 3bb0421740327a78243f6f3365ed64619d2bb828 386504 atac_0~20150903+r2013-9_amd64.deb d6599cd20af73ece16f926b3d408f8305e856f2f 2352256 kmer-examples_0~20150903+r2013-9_all.deb e3bd8210e4572e5c9870136d178f46d0e181edaf 4956 kmer_0~20150903+r2013-9_all.deb 40875d6036450b77142aeb250b2f939d51098356 9655 kmer_0~20150903+r2013-9_amd64.buildinfo c1a28156b4bd3bfd6b2ee125c0385fd1f439c4a4 177688 leaff-dbgsym_0~20150903+r2013-9_amd64.deb 8d703861d7f477b38301ef31dcd567cab0f6affb 70332 leaff_0~20150903+r2013-9_amd64.deb ff6c491202a683d31893d8c999fd3fa524fbe97a 199228 libkmer-dev_0~20150903+r2013-9_amd64.deb 78518790fbf4e0e39bee28501879397c5895ca08 52900 libmeryl-dev_0~20150903+r2013-9_amd64.deb 8a08d24ecf15edc720c34b680c3a3764cd521ee3 1473532 meryl-dbgsym_0~20150903+r2013-9_amd64.deb 882e88ee51f67ceaa317425248a747ac713d639f 199204 meryl_0~20150903+r2013-9_amd64.deb 3236307c5bf19c91881a718fb252708b6f7d2d7d 2081468 sim4db-dbgsym_0~20150903+r2013-9_amd64.deb d82bb8c39d3ed4fc4c1e1b470e200482c26cd256 443932 sim4db_0~20150903+r2013-9_amd64.deb Checksums-Sha256: 62c8de881b8006e83ab69bcec345a8553f73d743552bd870cb912c153dd3870d 1488 kmer_0~20150903+r2013-9.dsc 27e69d0ec3c9f716d2a81a0aedd9c0d48c9807abf17815db0327f0f8901a0758 2380056 kmer_0~20150903+r2013-9.debian.tar.xz 9d5cfc220f1786d60b0b6d001766fb517746d9f4f4330606246d75fa640b2604 2686844 atac-dbgsym_0~20150903+r2013-9_amd64.deb 64f17deb386b5a117edb1bb79ef29bd84434e3676d9ab3f3c95a0babc0fafe60 386504 atac_0~20150903+r2013-9_amd64.deb dc44c95ea3ab9f2af8ed156e3406a8a4d9836d78cf4b92bd74350dd130ed7d2b 2352256 kmer-examples_0~20150903+r2013-9_all.deb c18f3bd97d22ff1ca4acb6ebd36fce334120b57660b66c06f377e52bf15e2849 4956 kmer_0~20150903+r2013-9_all.deb 26d0e09c684bbaa6a9cc9e328d7802cbf59226f65aada1c57fa15e8757c9c69b 9655 kmer_0~20150903+r2013-9_amd64.buildinfo 1ac6b9c4cc9aab45f6eeefc5786d73ec67c212ec27762123c7916f4fbc2bdeb6 177688 leaff-dbgsym_0~20150903+r2013-9_amd64.deb 39846f51adb2eb0ae39135841f483ff3d5eccdce46b7cfa1b7a6ae0f93ec7c7a 70332 leaff_0~20150903+r2013-9_amd64.deb 0fcfa8a84e977a995fb8b7fd51e73cfc832c6a98665f0361c8f51d8dd9a16923 199228 libkmer-dev_0~20150903+r2013-9_amd64.deb e1d748e50cb37291c9f70e5b3a9fa1696aa0f66150e377d85c45b4631ea00165 52900 libmeryl-dev_0~20150903+r2013-9_amd64.deb 56719e2224ae43f11630d06222c6313c456b616954733bdbbf3915add5c2a861 1473532 meryl-dbgsym_0~20150903+r2013-9_amd64.deb b52bef9ceef99a755b31969f6c8690a649e8fee7b86d10519015a4ff9d090af6 199204 meryl_0~20150903+r2013-9_amd64.deb 54b2dd62c1f0b640f81325beb746bb23dedb40db99f9a8b47c334ba84484c813 2081468 sim4db-dbgsym_0~20150903+r2013-9_amd64.deb 8351fe928e78e1065f44158e67ff2c422228f778dfa319e9bdc610d51d4d9949 443932 sim4db_0~20150903+r2013-9_amd64.deb Files: a7956db198c83b15ce1c01aba2cf64b0 1488 science optional kmer_0~20150903+r2013-9.dsc 5fb535fd2ba7759f38b418f0008eb2d5 2380056 science optional kmer_0~20150903+r2013-9.debian.tar.xz d901c148de4112eea49c1f6ad63244e5 2686844 debug optional atac-dbgsym_0~20150903+r2013-9_amd64.deb ebfc7bc4daecfd9cb8124e24f5cb8077 386504 science optional atac_0~20150903+r2013-9_amd64.deb f6bc134c89ee377dfcc7b06c933bdd4e 2352256 science optional kmer-examples_0~20150903+r2013-9_all.deb 43e796fca49a5fa103fa0cdbe1a15968 4956 science optional kmer_0~20150903+r2013-9_all.deb 3430fa23e9d967b4e051f88ade6311f3 9655 science optional kmer_0~20150903+r2013-9_amd64.buildinfo 0a678c8a23fd8e373d25ba9d3f6ae691 177688 debug optional leaff-dbgsym_0~20150903+r2013-9_amd64.deb d694531d9b686a20f5772f7a83591cd0 70332 science optional leaff_0~20150903+r2013-9_amd64.deb 86cd550ffa29abce68c5cd09d29255f6 199228 libdevel optional libkmer-dev_0~20150903+r2013-9_amd64.deb 2bfe877f2c952fa0dfaf17c8fe4fbac2 52900 libdevel optional libmeryl-dev_0~20150903+r2013-9_amd64.deb b5d707a5e6f2fc8b5cff527de280cc20 1473532 debug optional meryl-dbgsym_0~20150903+r2013-9_amd64.deb c3f5b2a1e102e15990c23fa58f423ac2 199204 science optional meryl_0~20150903+r2013-9_amd64.deb 22176a1a6e5c0856efb2ac8c76b7c34d 2081468 debug optional sim4db-dbgsym_0~20150903+r2013-9_amd64.deb 4d1895f437860ffd400684961e7478f1 443932 science optional sim4db_0~20150903+r2013-9_amd64.deb +------------------------------------------------------------------------------+ | Buildinfo | +------------------------------------------------------------------------------+ Format: 1.0 Source: kmer Binary: atac atac-dbgsym kmer kmer-examples leaff leaff-dbgsym libkmer-dev libmeryl-dev meryl meryl-dbgsym sim4db sim4db-dbgsym Architecture: all amd64 source Version: 0~20150903+r2013-9 Checksums-Md5: a7956db198c83b15ce1c01aba2cf64b0 1488 kmer_0~20150903+r2013-9.dsc d901c148de4112eea49c1f6ad63244e5 2686844 atac-dbgsym_0~20150903+r2013-9_amd64.deb ebfc7bc4daecfd9cb8124e24f5cb8077 386504 atac_0~20150903+r2013-9_amd64.deb f6bc134c89ee377dfcc7b06c933bdd4e 2352256 kmer-examples_0~20150903+r2013-9_all.deb 43e796fca49a5fa103fa0cdbe1a15968 4956 kmer_0~20150903+r2013-9_all.deb 0a678c8a23fd8e373d25ba9d3f6ae691 177688 leaff-dbgsym_0~20150903+r2013-9_amd64.deb d694531d9b686a20f5772f7a83591cd0 70332 leaff_0~20150903+r2013-9_amd64.deb 86cd550ffa29abce68c5cd09d29255f6 199228 libkmer-dev_0~20150903+r2013-9_amd64.deb 2bfe877f2c952fa0dfaf17c8fe4fbac2 52900 libmeryl-dev_0~20150903+r2013-9_amd64.deb b5d707a5e6f2fc8b5cff527de280cc20 1473532 meryl-dbgsym_0~20150903+r2013-9_amd64.deb c3f5b2a1e102e15990c23fa58f423ac2 199204 meryl_0~20150903+r2013-9_amd64.deb 22176a1a6e5c0856efb2ac8c76b7c34d 2081468 sim4db-dbgsym_0~20150903+r2013-9_amd64.deb 4d1895f437860ffd400684961e7478f1 443932 sim4db_0~20150903+r2013-9_amd64.deb Checksums-Sha1: 634bca5314754ce9a661d1affba07071d7bb4288 1488 kmer_0~20150903+r2013-9.dsc ce8f1b028ca1dda6d395941c958e7180397d581a 2686844 atac-dbgsym_0~20150903+r2013-9_amd64.deb 3bb0421740327a78243f6f3365ed64619d2bb828 386504 atac_0~20150903+r2013-9_amd64.deb d6599cd20af73ece16f926b3d408f8305e856f2f 2352256 kmer-examples_0~20150903+r2013-9_all.deb e3bd8210e4572e5c9870136d178f46d0e181edaf 4956 kmer_0~20150903+r2013-9_all.deb c1a28156b4bd3bfd6b2ee125c0385fd1f439c4a4 177688 leaff-dbgsym_0~20150903+r2013-9_amd64.deb 8d703861d7f477b38301ef31dcd567cab0f6affb 70332 leaff_0~20150903+r2013-9_amd64.deb ff6c491202a683d31893d8c999fd3fa524fbe97a 199228 libkmer-dev_0~20150903+r2013-9_amd64.deb 78518790fbf4e0e39bee28501879397c5895ca08 52900 libmeryl-dev_0~20150903+r2013-9_amd64.deb 8a08d24ecf15edc720c34b680c3a3764cd521ee3 1473532 meryl-dbgsym_0~20150903+r2013-9_amd64.deb 882e88ee51f67ceaa317425248a747ac713d639f 199204 meryl_0~20150903+r2013-9_amd64.deb 3236307c5bf19c91881a718fb252708b6f7d2d7d 2081468 sim4db-dbgsym_0~20150903+r2013-9_amd64.deb d82bb8c39d3ed4fc4c1e1b470e200482c26cd256 443932 sim4db_0~20150903+r2013-9_amd64.deb Checksums-Sha256: 62c8de881b8006e83ab69bcec345a8553f73d743552bd870cb912c153dd3870d 1488 kmer_0~20150903+r2013-9.dsc 9d5cfc220f1786d60b0b6d001766fb517746d9f4f4330606246d75fa640b2604 2686844 atac-dbgsym_0~20150903+r2013-9_amd64.deb 64f17deb386b5a117edb1bb79ef29bd84434e3676d9ab3f3c95a0babc0fafe60 386504 atac_0~20150903+r2013-9_amd64.deb dc44c95ea3ab9f2af8ed156e3406a8a4d9836d78cf4b92bd74350dd130ed7d2b 2352256 kmer-examples_0~20150903+r2013-9_all.deb c18f3bd97d22ff1ca4acb6ebd36fce334120b57660b66c06f377e52bf15e2849 4956 kmer_0~20150903+r2013-9_all.deb 1ac6b9c4cc9aab45f6eeefc5786d73ec67c212ec27762123c7916f4fbc2bdeb6 177688 leaff-dbgsym_0~20150903+r2013-9_amd64.deb 39846f51adb2eb0ae39135841f483ff3d5eccdce46b7cfa1b7a6ae0f93ec7c7a 70332 leaff_0~20150903+r2013-9_amd64.deb 0fcfa8a84e977a995fb8b7fd51e73cfc832c6a98665f0361c8f51d8dd9a16923 199228 libkmer-dev_0~20150903+r2013-9_amd64.deb e1d748e50cb37291c9f70e5b3a9fa1696aa0f66150e377d85c45b4631ea00165 52900 libmeryl-dev_0~20150903+r2013-9_amd64.deb 56719e2224ae43f11630d06222c6313c456b616954733bdbbf3915add5c2a861 1473532 meryl-dbgsym_0~20150903+r2013-9_amd64.deb b52bef9ceef99a755b31969f6c8690a649e8fee7b86d10519015a4ff9d090af6 199204 meryl_0~20150903+r2013-9_amd64.deb 54b2dd62c1f0b640f81325beb746bb23dedb40db99f9a8b47c334ba84484c813 2081468 sim4db-dbgsym_0~20150903+r2013-9_amd64.deb 8351fe928e78e1065f44158e67ff2c422228f778dfa319e9bdc610d51d4d9949 443932 sim4db_0~20150903+r2013-9_amd64.deb Build-Origin: Debian Build-Architecture: amd64 Build-Date: Tue, 10 Sep 2024 16:04:40 +0000 Build-Path: /<> Build-Tainted-By: merged-usr-via-aliased-dirs usr-local-has-programs Installed-Build-Depends: autoconf (= 2.72-3), automake (= 1:1.16.5-1.3), autopoint (= 0.22.5-2), autotools-dev (= 20220109.1), base-files (= 13.5), base-passwd (= 3.6.4), bash (= 5.2.32-1), binutils (= 2.43.1-3), binutils-common (= 2.43.1-3), binutils-x86-64-linux-gnu (= 2.43.1-3), bsdextrautils (= 2.40.2-8), bsdutils (= 1:2.40.2-8), build-essential (= 12.10), bzip2 (= 1.0.8-6), coreutils (= 9.4-3.1), cpp (= 4:14.1.0-2), cpp-13 (= 13.3.0-6), cpp-13-x86-64-linux-gnu (= 13.3.0-6), cpp-14 (= 14.2.0-4), cpp-14-x86-64-linux-gnu (= 14.2.0-4), cpp-x86-64-linux-gnu (= 4:14.1.0-2), dash (= 0.5.12-9), debconf (= 1.5.87), debhelper (= 13.20), debianutils (= 5.20), dh-autoreconf (= 20), dh-exec (= 0.30), dh-python (= 6.20240824), dh-strip-nondeterminism (= 1.14.0-1), diffutils (= 1:3.10-1), dpkg (= 1.22.11), dpkg-dev (= 1.22.11), dwz (= 0.15-1+b1), file (= 1:5.45-3), findutils (= 4.10.0-3), g++ (= 4:14.1.0-2), g++-14 (= 14.2.0-4), g++-14-x86-64-linux-gnu (= 14.2.0-4), g++-x86-64-linux-gnu (= 4:14.1.0-2), gcc (= 4:14.1.0-2), gcc-13 (= 13.3.0-6), gcc-13-base (= 13.3.0-6), gcc-13-x86-64-linux-gnu (= 13.3.0-6), gcc-14 (= 14.2.0-4), gcc-14-base (= 14.2.0-4), gcc-14-x86-64-linux-gnu (= 14.2.0-4), gcc-x86-64-linux-gnu (= 4:14.1.0-2), gettext (= 0.22.5-2), gettext-base (= 0.22.5-2), grep (= 3.11-4), groff-base (= 1.23.0-5), gzip (= 1.12-1.1), hostname (= 3.23+nmu2), init-system-helpers (= 1.66), intltool-debian (= 0.35.0+20060710.6), libacl1 (= 2.3.2-2), libarchive-zip-perl (= 1.68-1), libasan8 (= 14.2.0-4), libatomic1 (= 14.2.0-4), libattr1 (= 1:2.5.2-1), libaudit-common (= 1:4.0.1-1), libaudit1 (= 1:4.0.1-1), libbinutils (= 2.43.1-3), libblkid1 (= 2.40.2-8), libbz2-1.0 (= 1.0.8-6), libc-bin (= 2.40-2), libc-dev-bin (= 2.40-2), libc6 (= 2.40-2), libc6-dev (= 2.40-2), libcap-ng0 (= 0.8.5-2), libcap2 (= 1:2.66-5), libcc1-0 (= 14.2.0-4), libcom-err2 (= 1.47.1-1), libcrypt-dev (= 1:4.4.36-5), libcrypt1 (= 1:4.4.36-5), libctf-nobfd0 (= 2.43.1-3), libctf0 (= 2.43.1-3), libdb5.3t64 (= 5.3.28+dfsg2-7), libdebconfclient0 (= 0.272), libdebhelper-perl (= 13.20), libdpkg-perl (= 1.22.11), libelf1t64 (= 0.191-2), libexpat1 (= 2.6.3-1), libexpat1-dev (= 2.6.3-1), libffi8 (= 3.4.6-1), libfile-stripnondeterminism-perl (= 1.14.0-1), libgcc-13-dev (= 13.3.0-6), libgcc-14-dev (= 14.2.0-4), libgcc-s1 (= 14.2.0-4), libgdbm-compat4t64 (= 1.24-2), libgdbm6t64 (= 1.24-2), libgmp10 (= 2:6.3.0+dfsg-2+b1), libgomp1 (= 14.2.0-4), libgprofng0 (= 2.43.1-3), libgssapi-krb5-2 (= 1.21.3-3), libhwasan0 (= 14.2.0-4), libicu72 (= 72.1-5), libisl23 (= 0.27-1), libitm1 (= 14.2.0-4), libjansson4 (= 2.14-2+b2), libjs-jquery (= 3.6.1+dfsg+~3.5.14-1), libjs-sphinxdoc (= 7.4.7-3), libjs-underscore (= 1.13.4~dfsg+~1.11.4-3), libk5crypto3 (= 1.21.3-3), libkeyutils1 (= 1.6.3-3), libkrb5-3 (= 1.21.3-3), libkrb5support0 (= 1.21.3-3), liblsan0 (= 14.2.0-4), liblzma5 (= 5.6.2-2), libmagic-mgc (= 1:5.45-3), libmagic1t64 (= 1:5.45-3), libmd0 (= 1.1.0-2), libmount1 (= 2.40.2-8), libmpc3 (= 1.3.1-1+b2), libmpfr6 (= 4.2.1-1+b1), libncursesw6 (= 6.5-2), libnsl2 (= 1.3.0-3+b2), libpam-modules (= 1.5.3-7), libpam-modules-bin (= 1.5.3-7), libpam-runtime (= 1.5.3-7), libpam0g (= 1.5.3-7), libpcre2-8-0 (= 10.42-4+b1), libperl5.40 (= 5.40.0-4), libpipeline1 (= 1.5.8-1), libpython3-dev (= 3.12.5-1), libpython3-stdlib (= 3.12.5-1), libpython3.12-dev (= 3.12.6-1), libpython3.12-minimal (= 3.12.6-1), libpython3.12-stdlib (= 3.12.6-1), libpython3.12t64 (= 3.12.6-1), libquadmath0 (= 14.2.0-4), libreadline8t64 (= 8.2-5), libseccomp2 (= 2.5.5-1+b1), libselinux1 (= 3.7-3), libsframe1 (= 2.43.1-3), libsmartcols1 (= 2.40.2-8), libsqlite3-0 (= 3.46.1-1), libssl3t64 (= 3.3.2-1), libstdc++-14-dev (= 14.2.0-4), libstdc++6 (= 14.2.0-4), libsystemd0 (= 256.5-2), libtinfo6 (= 6.5-2), libtirpc-common (= 1.3.4+ds-1.3), libtirpc3t64 (= 1.3.4+ds-1.3), libtool (= 2.4.7-7), libtsan2 (= 14.2.0-4), libubsan1 (= 14.2.0-4), libuchardet0 (= 0.0.8-1+b1), libudev1 (= 256.5-2), libunistring5 (= 1.2-1), libuuid1 (= 2.40.2-8), libxml2 (= 2.12.7+dfsg-3+b1), libzstd1 (= 1.5.6+dfsg-1), linux-libc-dev (= 6.10.9-1), m4 (= 1.4.19-4), make (= 4.3-4.1), man-db (= 2.13.0-1), mawk (= 1.3.4.20240819-3), media-types (= 10.1.0), ncurses-base (= 6.5-2), ncurses-bin (= 6.5-2), netbase (= 6.4), openssl-provider-legacy (= 3.3.2-1), patch (= 2.7.6-7), perl (= 5.40.0-4), perl-base (= 5.40.0-4), perl-modules-5.40 (= 5.40.0-4), po-debconf (= 1.0.21+nmu1), python3 (= 3.12.5-1), python3-autocommand (= 2.2.2-3), python3-dev (= 3.12.5-1), python3-inflect (= 7.3.1-1), python3-jaraco.context (= 6.0.0-1), python3-jaraco.functools (= 4.0.2-1), python3-minimal (= 3.12.5-1), python3-more-itertools (= 10.4.0-1), python3-pkg-resources (= 74.1.2-2), python3-setuptools (= 74.1.2-2), python3-typeguard (= 4.3.0-1), python3-typing-extensions (= 4.12.2-2), python3-zipp (= 3.20.1-1), python3.12 (= 3.12.6-1), python3.12-dev (= 3.12.6-1), python3.12-minimal (= 3.12.6-1), readline-common (= 8.2-5), rpcsvc-proto (= 1.4.3-1), sed (= 4.9-2), sensible-utils (= 0.0.24), sysvinit-utils (= 3.10-1), tar (= 1.35+dfsg-3), tzdata (= 2024a-4), usr-is-merged (= 39), util-linux (= 2.40.2-8), xz-utils (= 5.6.2-2), zlib1g (= 1:1.3.dfsg+really1.3.1-1), zlib1g-dev (= 1:1.3.dfsg+really1.3.1-1) Environment: DEB_BUILD_OPTIONS="parallel=2" LANG="C.UTF-8" LC_COLLATE="C.UTF-8" LC_CTYPE="C.UTF-8" LD_LIBRARY_PATH="/usr/lib/libeatmydata" SOURCE_DATE_EPOCH="1725957303" +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ atac-dbgsym_0~20150903+r2013-9_amd64.deb ---------------------------------------- new Debian package, version 2.0. size 2686844 bytes: control archive=1608 bytes. 1242 bytes, 12 lines control 2413 bytes, 23 lines md5sums Package: atac-dbgsym Source: kmer Version: 0~20150903+r2013-9 Auto-Built-Package: debug-symbols Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 3060 Depends: atac (= 0~20150903+r2013-9) Section: debug Priority: optional Description: debug symbols for atac Build-Ids: 010bad34d910b66b3f74a628f40df3513b12e405 04899972aa5a8c5aaa7f913c79b45b69813d9688 18515cc47f3845ddb679a73d0ee65db18629e29f 27502c0ee8591e2c8c122e8fe6d956a5af09686b 516b74ab5e328519ec4c8373c457d96ce296e06f 59a3814bf951c7d58b01f9e0428fab51e742c249 5b8392c722ec9a3d05a6f3ad003df69fc6b5b4dd 6b2196bea0fce5276867c3a0ad7ccae2344d82ad 77be1be8d6d64f8a06acd519bb46b4f0d136664b 833f7889c3def8fe6d752d85028ab5b42f829964 85eff3f2afdc6070c7e9f18c9ca8b07fa0aacd2f 959c760e58d25343b1bd403a1121f93a7290a265 9b2ec18b2a680bb724ff09c47b080004c0ad5c7b c245486cd5b02a58f2fc4a7e1453b26a4fa777a0 c557d53a9ab8a1c835663435993dc3dbf88fce70 c95df7d0697c897a700d26d2b8b22f6ea0fb744b c9c9fdacc4463daab0d600d77ead399c42c49e28 d4b3a00dd5104ac09dbe13cdb121c613403b147a d9c6af1b1e9451fe20a7cd5bc46814344db89e55 e5bb1ba0aa7cbd45c9b436dbe3b2472ae6687c92 ef910f04126fc48f420f48cb43afa3cfa7867e0f f9c44eeb52be4fe6ee8380358733533be126abc5 drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/01/ -rw-r--r-- root/root 212920 2024-09-10 08:35 ./usr/lib/debug/.build-id/01/0bad34d910b66b3f74a628f40df3513b12e405.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/04/ -rw-r--r-- root/root 11192 2024-09-10 08:35 ./usr/lib/debug/.build-id/04/899972aa5a8c5aaa7f913c79b45b69813d9688.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/18/ -rw-r--r-- root/root 222344 2024-09-10 08:35 ./usr/lib/debug/.build-id/18/515cc47f3845ddb679a73d0ee65db18629e29f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/27/ -rw-r--r-- root/root 156520 2024-09-10 08:35 ./usr/lib/debug/.build-id/27/502c0ee8591e2c8c122e8fe6d956a5af09686b.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/51/ -rw-r--r-- root/root 11528 2024-09-10 08:35 ./usr/lib/debug/.build-id/51/6b74ab5e328519ec4c8373c457d96ce296e06f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/59/ -rw-r--r-- root/root 17800 2024-09-10 08:35 ./usr/lib/debug/.build-id/59/a3814bf951c7d58b01f9e0428fab51e742c249.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/5b/ -rw-r--r-- root/root 155592 2024-09-10 08:35 ./usr/lib/debug/.build-id/5b/8392c722ec9a3d05a6f3ad003df69fc6b5b4dd.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/6b/ -rw-r--r-- root/root 154776 2024-09-10 08:35 ./usr/lib/debug/.build-id/6b/2196bea0fce5276867c3a0ad7ccae2344d82ad.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/77/ -rw-r--r-- root/root 170008 2024-09-10 08:35 ./usr/lib/debug/.build-id/77/be1be8d6d64f8a06acd519bb46b4f0d136664b.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/83/ -rw-r--r-- root/root 158416 2024-09-10 08:35 ./usr/lib/debug/.build-id/83/3f7889c3def8fe6d752d85028ab5b42f829964.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/85/ -rw-r--r-- root/root 51512 2024-09-10 08:35 ./usr/lib/debug/.build-id/85/eff3f2afdc6070c7e9f18c9ca8b07fa0aacd2f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/95/ -rw-r--r-- root/root 160792 2024-09-10 08:35 ./usr/lib/debug/.build-id/95/9c760e58d25343b1bd403a1121f93a7290a265.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/9b/ -rw-r--r-- root/root 75464 2024-09-10 08:35 ./usr/lib/debug/.build-id/9b/2ec18b2a680bb724ff09c47b080004c0ad5c7b.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/c2/ -rw-r--r-- root/root 47256 2024-09-10 08:35 ./usr/lib/debug/.build-id/c2/45486cd5b02a58f2fc4a7e1453b26a4fa777a0.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/c5/ -rw-r--r-- root/root 206240 2024-09-10 08:35 ./usr/lib/debug/.build-id/c5/57d53a9ab8a1c835663435993dc3dbf88fce70.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/c9/ -rw-r--r-- root/root 179240 2024-09-10 08:35 ./usr/lib/debug/.build-id/c9/5df7d0697c897a700d26d2b8b22f6ea0fb744b.debug -rw-r--r-- root/root 154072 2024-09-10 08:35 ./usr/lib/debug/.build-id/c9/c9fdacc4463daab0d600d77ead399c42c49e28.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/d4/ -rw-r--r-- root/root 50008 2024-09-10 08:35 ./usr/lib/debug/.build-id/d4/b3a00dd5104ac09dbe13cdb121c613403b147a.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/d9/ -rw-r--r-- root/root 330312 2024-09-10 08:35 ./usr/lib/debug/.build-id/d9/c6af1b1e9451fe20a7cd5bc46814344db89e55.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/e5/ -rw-r--r-- root/root 160416 2024-09-10 08:35 ./usr/lib/debug/.build-id/e5/bb1ba0aa7cbd45c9b436dbe3b2472ae6687c92.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/ef/ -rw-r--r-- root/root 152800 2024-09-10 08:35 ./usr/lib/debug/.build-id/ef/910f04126fc48f420f48cb43afa3cfa7867e0f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/f9/ -rw-r--r-- root/root 188920 2024-09-10 08:35 ./usr/lib/debug/.build-id/f9/c44eeb52be4fe6ee8380358733533be126abc5.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.dwz/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.dwz/x86_64-linux-gnu/ -rw-r--r-- root/root 59616 2024-09-10 08:35 ./usr/lib/debug/.dwz/x86_64-linux-gnu/atac.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ lrwxrwxrwx root/root 0 2024-09-10 08:35 ./usr/share/doc/atac-dbgsym -> atac atac_0~20150903+r2013-9_amd64.deb --------------------------------- new Debian package, version 2.0. size 386504 bytes: control archive=2640 bytes. 1347 bytes, 27 lines control 2937 bytes, 45 lines md5sums 297 bytes, 12 lines * postinst #!/bin/sh 368 bytes, 12 lines * prerm #!/bin/sh Package: atac Source: kmer Version: 0~20150903+r2013-9 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 2788 Depends: libc6 (>= 2.38), libgcc-s1 (>= 3.0), libstdc++6 (>= 5.2), python3 (<< 3.13), python3 (>= 3.12~), python3.12, python3:any, perl:any, libfile-which-perl, leaff, meryl, gnuplot Recommends: kmer-examples Section: science Priority: optional Homepage: http://kmer.sourceforge.net Description: genome assembly-to-assembly comparison atac computes a one-to-one pairwise alignment of large DNA sequences. It first finds the unique k-mers in each sequence, chains them to larger blocks, and fills in spaces between blocks. It was written primarily to transfer annotations between different assemblies of the human genome. . The output is a set of ungapped 'matches', and a set of gapped 'runs' formed from the matches. Each match or run associates one sequence with the other sequence. The association is 'unique', in that there is no other (sizeable) associations for either sequence. Thus, large repeats and duplications are not present in the output - they appear as unmapped regions. . Though the output is always pairwise, atac can cache intermediate results to speed a comparisons of multiple sequences. . This package is part of the Kmer suite. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/bin/ -rwxr-xr-x root/root 32718 2024-09-10 08:35 ./usr/bin/atac drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/atac/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/atac/bin/ -rwxr-xr-x root/root 22722 2024-09-10 08:35 ./usr/lib/atac/bin/AtacDriver.py -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/cleanAtac -rwxr-xr-x root/root 143696 2024-09-10 08:35 ./usr/lib/atac/bin/clumpMaker -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/coalesceMatches -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/correctGaps -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/extractSequence -rwxr-xr-x root/root 151888 2024-09-10 08:35 ./usr/lib/atac/bin/extractUnmapped -rwxr-xr-x root/root 155984 2024-09-10 08:35 ./usr/lib/atac/bin/gapShifter -rwxr-xr-x root/root 31240 2024-09-10 08:35 ./usr/lib/atac/bin/happy-clones-span-clumps -rwxr-xr-x root/root 35136 2024-09-10 08:35 ./usr/lib/atac/bin/heavychains -rwxr-xr-x root/root 14656 2024-09-10 08:35 ./usr/lib/atac/bin/lengthFilter -rwxr-xr-x root/root 10582 2024-09-10 08:35 ./usr/lib/atac/bin/makeplot.pl -rwxr-xr-x root/root 156016 2024-09-10 08:35 ./usr/lib/atac/bin/matchExtender -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/mismatchCounter -rwxr-xr-x root/root 172368 2024-09-10 08:35 ./usr/lib/atac/bin/overlap -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/projectFeatures -rwxr-xr-x root/root 279696 2024-09-10 08:35 ./usr/lib/atac/bin/seatac -rwxr-xr-x root/root 188752 2024-09-10 08:35 ./usr/lib/atac/bin/statsGenerator -rwxr-xr-x root/root 139600 2024-09-10 08:35 ./usr/lib/atac/bin/testAtac -rwxr-xr-x root/root 160112 2024-09-10 08:35 ./usr/lib/atac/bin/uniqueFilter drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/atac/lib/ -rwxr-xr-x root/root 22722 2024-09-10 08:35 ./usr/lib/atac/lib/AtacDriver.py -rwxr-xr-x root/root 2912 2024-09-10 08:35 ./usr/lib/atac/lib/AtacFile.py -rw-r--r-- root/root 2140 2005-02-28 22:49 ./usr/lib/atac/lib/DNA.py -rw-r--r-- root/root 6434 2024-09-10 08:35 ./usr/lib/atac/lib/IdxStore.py -rw-r--r-- root/root 7832 2024-09-10 08:35 ./usr/lib/atac/lib/MatchRecord.py -rwxr-xr-x root/root 2964 2024-09-10 08:35 ./usr/lib/atac/lib/MyFile.py -rwxr-xr-x root/root 9068 2024-09-10 08:35 ./usr/lib/atac/lib/PerfectRuns.py -rw-r--r-- root/root 11165 2024-09-10 08:35 ./usr/lib/atac/lib/TrimMatchOverlaps.py -rwxr-xr-x root/root 11012 2024-09-10 08:35 ./usr/lib/atac/lib/UniqueFilter.py -rwxr-xr-x root/root 4821 2024-09-10 08:35 ./usr/lib/atac/lib/dedashMatches.py -rw-r--r-- root/root 15642 2024-09-10 08:35 ./usr/lib/atac/lib/fillIntraRunGaps.py -rw-r--r-- root/root 34896 2024-09-10 08:35 ./usr/lib/atac/lib/filter-heavychains.so -rw-r--r-- root/root 14416 2024-09-10 08:35 ./usr/lib/atac/lib/filter-nop.so -rw-r--r-- root/root 22760 2024-09-10 08:35 ./usr/lib/atac/lib/halign.so -rw-r--r-- root/root 72072 2024-09-10 08:35 ./usr/lib/atac/lib/localAlignerInterface.so -rwxr-xr-x root/root 2681 2024-09-10 08:35 ./usr/lib/atac/lib/mkstats.py -rw-r--r-- root/root 21269 2024-09-10 08:35 ./usr/lib/atac/lib/squeezeIntraRunGaps.py drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/atac/ -rw-r--r-- root/root 3178 2024-09-10 08:35 ./usr/share/doc/atac/README.atac -rw-r--r-- root/root 244 2024-09-10 08:19 ./usr/share/doc/atac/README.test -rw-r--r-- root/root 792 2024-09-10 08:19 ./usr/share/doc/atac/atac-unit-test -rw-r--r-- root/root 997 2024-09-10 08:35 ./usr/share/doc/atac/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/atac/copyright drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/man1/ -rw-r--r-- root/root 704 2024-09-10 08:35 ./usr/share/man/man1/atac.1.gz drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/python3/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/python3/runtime.d/ -rwxr-xr-x root/root 124 2024-09-10 08:35 ./usr/share/python3/runtime.d/atac.rtupdate kmer-examples_0~20150903+r2013-9_all.deb ---------------------------------------- new Debian package, version 2.0. size 2352256 bytes: control archive=816 bytes. 707 bytes, 18 lines control 309 bytes, 4 lines md5sums Package: kmer-examples Source: kmer Version: 0~20150903+r2013-9 Architecture: all Maintainer: Debian Med Packaging Team Installed-Size: 2307 Enhances: atac, sim4db Section: science Priority: optional Homepage: http://kmer.sourceforge.net Description: sample data for kmer suite of tools for DNA sequence analysis The kmer package is a suite of tools for DNA sequence analysis. It provides tools for searching (ESTs, mRNAs, sequencing reads); aligning (ESTs, mRNAs, whole genomes); and a variety of analyses based on kmers. . This package contains a test data set as well as sample scripts running some test suite provided by Debian also as autopkgtest. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/kmer-examples/ -rw-r--r-- root/root 275 2024-09-10 08:19 ./usr/share/doc/kmer-examples/README.Debian -rw-r--r-- root/root 997 2024-09-10 08:35 ./usr/share/doc/kmer-examples/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/kmer-examples/copyright -rw-r--r-- root/root 2345682 2024-09-10 08:35 ./usr/share/doc/kmer-examples/test_data.tar.gz kmer_0~20150903+r2013-9_all.deb ------------------------------- new Debian package, version 2.0. size 4956 bytes: control archive=716 bytes. 626 bytes, 16 lines control 136 bytes, 2 lines md5sums Package: kmer Version: 0~20150903+r2013-9 Architecture: all Maintainer: Debian Med Packaging Team Installed-Size: 15 Depends: meryl, leaff, sim4db, atac Section: science Priority: optional Homepage: http://kmer.sourceforge.net Description: suite of tools for DNA sequence analysis The kmer package is a suite of tools for DNA sequence analysis. It provides tools for searching (ESTs, mRNAs, sequencing reads); aligning (ESTs, mRNAs, whole genomes); and a variety of analyses based on kmers. . This is a metapackage depending on the executable components of the kmer suite. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/kmer/ -rw-r--r-- root/root 996 2024-09-10 08:35 ./usr/share/doc/kmer/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/kmer/copyright leaff-dbgsym_0~20150903+r2013-9_amd64.deb ----------------------------------------- new Debian package, version 2.0. size 177688 bytes: control archive=548 bytes. 383 bytes, 12 lines control 106 bytes, 1 lines md5sums Package: leaff-dbgsym Source: kmer Version: 0~20150903+r2013-9 Auto-Built-Package: debug-symbols Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 198 Depends: leaff (= 0~20150903+r2013-9) Section: debug Priority: optional Description: debug symbols for leaff Build-Ids: 196988353a438e5df4be06efe563dc04727a4bc4 drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/19/ -rw-r--r-- root/root 191752 2024-09-10 08:35 ./usr/lib/debug/.build-id/19/6988353a438e5df4be06efe563dc04727a4bc4.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ lrwxrwxrwx root/root 0 2024-09-10 08:35 ./usr/share/doc/leaff-dbgsym -> leaff leaff_0~20150903+r2013-9_amd64.deb ---------------------------------- new Debian package, version 2.0. size 70332 bytes: control archive=868 bytes. 635 bytes, 16 lines control 320 bytes, 5 lines md5sums Package: leaff Source: kmer Version: 0~20150903+r2013-9 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 202 Depends: libc6 (>= 2.38), libgcc-s1 (>= 3.0), libstdc++6 (>= 4.1.1) Section: science Priority: optional Homepage: http://kmer.sourceforge.net Description: biological sequence library utilities and applications LEAFF (Let's Extract Anything From Fasta) is a utility program for working with multi-fasta files. In addition to providing random access to the base level, it includes several analysis functions. . This package is part of the Kmer suite. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/bin/ -rwxr-xr-x root/root 180512 2024-09-10 08:35 ./usr/bin/leaff drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/leaff/ -rw-r--r-- root/root 3373 2011-01-20 03:32 ./usr/share/doc/leaff/README.leaff.gz -rw-r--r-- root/root 998 2024-09-10 08:35 ./usr/share/doc/leaff/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/leaff/copyright drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/man1/ -rw-r--r-- root/root 2732 2024-09-10 08:35 ./usr/share/man/man1/leaff.1.gz libkmer-dev_0~20150903+r2013-9_amd64.deb ---------------------------------------- new Debian package, version 2.0. size 199228 bytes: control archive=2168 bytes. 635 bytes, 17 lines control 3725 bytes, 54 lines md5sums Package: libkmer-dev Source: kmer Version: 0~20150903+r2013-9 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 856 Depends: libmeryl-dev Section: libdevel Priority: optional Homepage: http://kmer.sourceforge.net Description: suite of tools for DNA sequence analysis (development lib) The kmer package is a suite of tools for DNA sequence analysis. It provides tools for searching (ESTs, mRNAs, sequencing reads); aligning (ESTs, mRNAs, whole genomes); and a variety of analyses based on kmers. . This package contains headers and static libraries for kmer. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/kmer/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/kmer/bio/ -rw-r--r-- root/root 647 2008-07-28 21:43 ./usr/include/kmer/bio/alphabet.h -rw-r--r-- root/root 381 2008-09-09 23:55 ./usr/include/kmer/bio/bio++.H -rw-r--r-- root/root 766 2014-04-11 20:17 ./usr/include/kmer/bio/bio.h -rw-r--r-- root/root 5588 2014-04-11 20:17 ./usr/include/kmer/bio/kmer.H -rw-r--r-- root/root 10979 2014-04-11 20:17 ./usr/include/kmer/bio/kmerhuge.H -rw-r--r-- root/root 2715 2014-04-11 20:17 ./usr/include/kmer/bio/kmeriface.H -rw-r--r-- root/root 3402 2014-04-11 20:17 ./usr/include/kmer/bio/kmertiny.H -rw-r--r-- root/root 7314 2014-04-11 20:17 ./usr/include/kmer/bio/merCovering.H -rw-r--r-- root/root 2024 2014-04-11 20:17 ./usr/include/kmer/bio/merList.H -rw-r--r-- root/root 1395 2014-04-11 20:17 ./usr/include/kmer/bio/mers.h drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/kmer/kmer/ -rw-r--r-- root/root 4358 2014-04-11 20:17 ./usr/include/kmer/kmer/existDB.H -rw-r--r-- root/root 2098 2014-04-11 20:17 ./usr/include/kmer/kmer/merTable.H -rw-r--r-- root/root 6987 2014-04-11 20:17 ./usr/include/kmer/kmer/positionDB.H drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/kmer/seq/ -rw-r--r-- root/root 1797 2014-04-11 20:17 ./usr/include/kmer/seq/fastaFile.H -rw-r--r-- root/root 1323 2014-08-23 02:01 ./usr/include/kmer/seq/fastaStdin.H -rw-r--r-- root/root 1797 2014-04-11 20:17 ./usr/include/kmer/seq/fastqFile.H -rw-r--r-- root/root 1423 2014-08-23 02:01 ./usr/include/kmer/seq/fastqStdin.H -rw-r--r-- root/root 3129 2014-04-11 20:17 ./usr/include/kmer/seq/merStream.H -rw-r--r-- root/root 2941 2014-08-23 02:01 ./usr/include/kmer/seq/seqCache.H -rw-r--r-- root/root 563 2014-04-11 20:17 ./usr/include/kmer/seq/seqFactory.H -rw-r--r-- root/root 1516 2014-08-23 02:01 ./usr/include/kmer/seq/seqFile.H -rw-r--r-- root/root 3046 2014-04-11 20:17 ./usr/include/kmer/seq/seqStore.H -rw-r--r-- root/root 3705 2014-04-11 20:17 ./usr/include/kmer/seq/seqStream.H -rw-r--r-- root/root 2591 2014-04-11 20:17 ./usr/include/kmer/seq/sffFile.H -rw-r--r-- root/root 3714 2014-04-11 20:17 ./usr/include/kmer/seq/test-correctSequence.H drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/kmer/util/ -rw-r--r-- root/root 4720 2014-04-11 20:17 ./usr/include/kmer/util/bigQueue.H -rw-r--r-- root/root 4475 2014-04-11 20:17 ./usr/include/kmer/util/bitOperations.h -rw-r--r-- root/root 7072 2014-04-11 20:17 ./usr/include/kmer/util/bitPackedArray.H -rw-r--r-- root/root 2734 2014-04-11 20:17 ./usr/include/kmer/util/bitPackedFile.H -rw-r--r-- root/root 13015 2014-04-11 20:17 ./usr/include/kmer/util/bitPacking.h -rw-r--r-- root/root 1395 2014-04-11 20:17 ./usr/include/kmer/util/bzipBuffer.H -rw-r--r-- root/root 737 2014-04-11 20:17 ./usr/include/kmer/util/eliasDeltaEncoding.h -rw-r--r-- root/root 702 2014-04-11 20:17 ./usr/include/kmer/util/eliasGammaEncoding.h -rw-r--r-- root/root 1365 2014-04-11 20:17 ./usr/include/kmer/util/endianess.H -rw-r--r-- root/root 3558 2014-04-11 20:17 ./usr/include/kmer/util/fibonacciEncoding.h -rw-r--r-- root/root 3234 2014-04-11 20:17 ./usr/include/kmer/util/generalizedUnaryEncoding.h -rw-r--r-- root/root 16331 2015-04-22 22:49 ./usr/include/kmer/util/intervalList.H -rw-r--r-- root/root 2599 2014-04-11 20:17 ./usr/include/kmer/util/logMsg.H -rw-r--r-- root/root 1829 2014-04-11 20:17 ./usr/include/kmer/util/readBuffer.H -rw-r--r-- root/root 1614 2014-04-11 20:17 ./usr/include/kmer/util/recordFile.H -rw-r--r-- root/root 2012 2014-04-11 20:17 ./usr/include/kmer/util/speedCounter.H -rw-r--r-- root/root 2758 2014-04-11 20:17 ./usr/include/kmer/util/splitToWords.H -rw-r--r-- root/root 2654 2014-04-11 20:17 ./usr/include/kmer/util/sweatShop.H -rw-r--r-- root/root 1004 2014-04-11 20:17 ./usr/include/kmer/util/uint32List.H -rw-r--r-- root/root 1489 2014-04-11 20:17 ./usr/include/kmer/util/unaryEncoding.h -rw-r--r-- root/root 1024 2014-04-11 20:17 ./usr/include/kmer/util/util++.H -rw-r--r-- root/root 9288 2014-04-11 20:17 ./usr/include/kmer/util/util.h drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/kmer/ -rw-r--r-- root/root 4936 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/kmer/libmt19937ar.a -rw-r--r-- root/root 214858 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/kmer/libutil.a -rw-r--r-- root/root 68754 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/libbio.a -rw-r--r-- root/root 153992 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/libkmer.a -rw-r--r-- root/root 224642 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/libseq.a drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/libkmer-dev/ -rw-r--r-- root/root 1002 2024-09-10 08:35 ./usr/share/doc/libkmer-dev/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/libkmer-dev/copyright libmeryl-dev_0~20150903+r2013-9_amd64.deb ----------------------------------------- new Debian package, version 2.0. size 52900 bytes: control archive=996 bytes. 910 bytes, 21 lines control 413 bytes, 6 lines md5sums Package: libmeryl-dev Source: kmer Version: 0~20150903+r2013-9 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 200 Section: libdevel Priority: optional Homepage: http://kmer.sourceforge.net Description: in- and out-of-core kmer counting and utilities (development lib) meryl computes the kmer content of genomic sequences. Kmer content is represented as a list of kmers and the number of times each occurs in the input sequences. The kmer can be restricted to only the forward kmer, only the reverse kmer, or the canonical kmer (lexicographically smaller of the forward and reverse kmer at each location). Meryl can report the histogram of counts, the list of kmers and their counts, or can perform mathematical and set operations on the processed data files. . This package contains the static libraries and header files. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/include/ -rw-r--r-- root/root 5822 2014-04-11 20:17 ./usr/include/libmeryl.H -rw-r--r-- root/root 3420 2015-05-29 12:35 ./usr/include/meryl.H drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/ -rw-r--r-- root/root 44340 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/libmeryl.a drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/meryl/ -rw-r--r-- root/root 130004 2024-09-10 08:35 ./usr/lib/x86_64-linux-gnu/meryl/libmerylguts.a drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/libmeryl-dev/ -rw-r--r-- root/root 1004 2024-09-10 08:35 ./usr/share/doc/libmeryl-dev/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/libmeryl-dev/copyright meryl-dbgsym_0~20150903+r2013-9_amd64.deb ----------------------------------------- new Debian package, version 2.0. size 1473532 bytes: control archive=912 bytes. 630 bytes, 12 lines control 824 bytes, 8 lines md5sums Package: meryl-dbgsym Source: kmer Version: 0~20150903+r2013-9 Auto-Built-Package: debug-symbols Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 1602 Depends: meryl (= 0~20150903+r2013-9) Section: debug Priority: optional Description: debug symbols for meryl Build-Ids: 18aeee8312f99ddbf230effcf0552315b74b0e71 1e47e2aa3356aae1c32daad9c2eae0d109772740 200d4f8d5b297c86c23a635d4c22e3243617fd46 4c6023f72e3160112f93104b04b2a14a17b51cf5 8267592e2dc52d0fb220aec1fd8833bfefbb7a1b c5e8161516f3fb58bdc3cd242c3c9be8a9f85125 cd924d79bd7322cd01fc51191733691da4650be6 drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/18/ -rw-r--r-- root/root 231960 2024-09-10 08:35 ./usr/lib/debug/.build-id/18/aeee8312f99ddbf230effcf0552315b74b0e71.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/1e/ -rw-r--r-- root/root 211784 2024-09-10 08:35 ./usr/lib/debug/.build-id/1e/47e2aa3356aae1c32daad9c2eae0d109772740.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/20/ -rw-r--r-- root/root 292808 2024-09-10 08:35 ./usr/lib/debug/.build-id/20/0d4f8d5b297c86c23a635d4c22e3243617fd46.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/4c/ -rw-r--r-- root/root 180088 2024-09-10 08:35 ./usr/lib/debug/.build-id/4c/6023f72e3160112f93104b04b2a14a17b51cf5.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/82/ -rw-r--r-- root/root 209576 2024-09-10 08:35 ./usr/lib/debug/.build-id/82/67592e2dc52d0fb220aec1fd8833bfefbb7a1b.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/c5/ -rw-r--r-- root/root 210576 2024-09-10 08:35 ./usr/lib/debug/.build-id/c5/e8161516f3fb58bdc3cd242c3c9be8a9f85125.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/cd/ -rw-r--r-- root/root 249704 2024-09-10 08:35 ./usr/lib/debug/.build-id/cd/924d79bd7322cd01fc51191733691da4650be6.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.dwz/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.dwz/x86_64-linux-gnu/ -rw-r--r-- root/root 33656 2024-09-10 08:35 ./usr/lib/debug/.dwz/x86_64-linux-gnu/meryl.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ lrwxrwxrwx root/root 0 2024-09-10 08:35 ./usr/share/doc/meryl-dbgsym -> meryl meryl_0~20150903+r2013-9_amd64.deb ---------------------------------- new Debian package, version 2.0. size 199204 bytes: control archive=1316 bytes. 960 bytes, 23 lines control 1036 bytes, 17 lines md5sums Package: meryl Source: kmer Version: 0~20150903+r2013-9 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 1457 Depends: libc6 (>= 2.38), libgcc-s1 (>= 3.0), libstdc++6 (>= 4.1.1) Suggests: gridengine-client Section: science Priority: optional Homepage: http://kmer.sourceforge.net Description: in- and out-of-core kmer counting and utilities meryl computes the kmer content of genomic sequences. Kmer content is represented as a list of kmers and the number of times each occurs in the input sequences. The kmer can be restricted to only the forward kmer, only the reverse kmer, or the canonical kmer (lexicographically smaller of the forward and reverse kmer at each location). Meryl can report the histogram of counts, the list of kmers and their counts, or can perform mathematical and set operations on the processed data files. . This package is part of the Kmer suite. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/bin/ -rwxr-xr-x root/root 197720 2024-09-10 08:35 ./usr/bin/existDB -rwxr-xr-x root/root 214104 2024-09-10 08:35 ./usr/bin/kmer-mask -rwxr-xr-x root/root 193624 2024-09-10 08:35 ./usr/bin/mapMers -rwxr-xr-x root/root 193624 2024-09-10 08:35 ./usr/bin/mapMers-depth -rwxr-xr-x root/root 222296 2024-09-10 08:35 ./usr/bin/meryl -rwxr-xr-x root/root 263320 2024-09-10 08:35 ./usr/bin/positionDB -rwxr-xr-x root/root 169048 2024-09-10 08:35 ./usr/bin/simple drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/meryl/ -rw-r--r-- root/root 2684 2015-05-20 07:56 ./usr/share/doc/meryl/README.meryl.gz -rw-r--r-- root/root 998 2024-09-10 08:35 ./usr/share/doc/meryl/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/meryl/copyright drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/man1/ -rw-r--r-- root/root 634 2024-09-10 08:35 ./usr/share/man/man1/existDB.1.gz -rw-r--r-- root/root 1069 2024-09-10 08:35 ./usr/share/man/man1/kmer-mask.1.gz -rw-r--r-- root/root 484 2024-09-10 08:35 ./usr/share/man/man1/mapMers-depth.1.gz -rw-r--r-- root/root 388 2024-09-10 08:35 ./usr/share/man/man1/mapMers.1.gz -rw-r--r-- root/root 2669 2024-09-10 08:35 ./usr/share/man/man1/meryl.1.gz -rw-r--r-- root/root 672 2024-09-10 08:35 ./usr/share/man/man1/positionDB.1.gz -rw-r--r-- root/root 511 2024-09-10 08:35 ./usr/share/man/man1/simple.1.gz sim4db-dbgsym_0~20150903+r2013-9_amd64.deb ------------------------------------------ new Debian package, version 2.0. size 2081468 bytes: control archive=1700 bytes. 1330 bytes, 12 lines control 2627 bytes, 25 lines md5sums Package: sim4db-dbgsym Source: kmer Version: 0~20150903+r2013-9 Auto-Built-Package: debug-symbols Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 2429 Depends: sim4db (= 0~20150903+r2013-9) Section: debug Priority: optional Description: debug symbols for sim4db Build-Ids: 093c34538133e026e724af2b4c8d029696385739 0eafcaed5bbf072c07e43dcbba801e7488ce2033 1243b29a9c607c529072670f4d6518f01dc8c559 1c60e5dba82b09e096b9f585980feb2fe0d0c84b 268ad5b4b2d07db83c1c32fa4e2564206d67c1f4 27ce3275ce26d10f3a39fe0fb2e4362f5047a976 2b6d0e22b1cf8318cdacd5b365cb8dbdc52c48b0 3668aa344aeb103387ee8bcffa5a763291913231 3d401a65c454aaa57d66901e205d3a49700f420f 457e242c9a116a8d58d927d365e4076440957792 49fbc6790d14b51edfa335419ccdde5d1c9ecf6f 643260090ac2556d94b177a20e8e1f85142c48fa 645ee3115523c1a9963d40d8b312403f3c1943f2 70ab5dcaefd898d60fb5b57023014ee8d30bb341 76f1f9e7969c086ab9611ba75bf332a2be51c172 7de28a87815fac14ead267e37d206d9bcc1c9024 a0982f6a55f5138e68d9361e5f6b15deaa2a8585 b3bbc3ff7d877c7c8245b30eed626a8738d76c71 b88397da9d8db307022ce54aabd5f2d50412ec2f c7c2fa235c86b5dc6934d73ac6b4ce6b9b72608c c8787367b9d5127190e386baa007f8982a4496db e9d69ede09ef820bc9dc9fee495e90da810bb9fa f9a8b952aa7cd26eac85e26035ecb1da9d15a621 fa3ccd1490472bc49533980710d3aa85b18f57fd drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/09/ -rw-r--r-- root/root 409592 2024-09-10 08:35 ./usr/lib/debug/.build-id/09/3c34538133e026e724af2b4c8d029696385739.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/0e/ -rw-r--r-- root/root 61176 2024-09-10 08:35 ./usr/lib/debug/.build-id/0e/afcaed5bbf072c07e43dcbba801e7488ce2033.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/12/ -rw-r--r-- root/root 75264 2024-09-10 08:35 ./usr/lib/debug/.build-id/12/43b29a9c607c529072670f4d6518f01dc8c559.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/1c/ -rw-r--r-- root/root 60464 2024-09-10 08:35 ./usr/lib/debug/.build-id/1c/60e5dba82b09e096b9f585980feb2fe0d0c84b.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/26/ -rw-r--r-- root/root 65016 2024-09-10 08:35 ./usr/lib/debug/.build-id/26/8ad5b4b2d07db83c1c32fa4e2564206d67c1f4.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/27/ -rw-r--r-- root/root 78416 2024-09-10 08:35 ./usr/lib/debug/.build-id/27/ce3275ce26d10f3a39fe0fb2e4362f5047a976.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/2b/ -rw-r--r-- root/root 76744 2024-09-10 08:35 ./usr/lib/debug/.build-id/2b/6d0e22b1cf8318cdacd5b365cb8dbdc52c48b0.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/36/ -rw-r--r-- root/root 68760 2024-09-10 08:35 ./usr/lib/debug/.build-id/36/68aa344aeb103387ee8bcffa5a763291913231.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/3d/ -rw-r--r-- root/root 63000 2024-09-10 08:35 ./usr/lib/debug/.build-id/3d/401a65c454aaa57d66901e205d3a49700f420f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/45/ -rw-r--r-- root/root 145376 2024-09-10 08:35 ./usr/lib/debug/.build-id/45/7e242c9a116a8d58d927d365e4076440957792.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/49/ -rw-r--r-- root/root 60696 2024-09-10 08:35 ./usr/lib/debug/.build-id/49/fbc6790d14b51edfa335419ccdde5d1c9ecf6f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/64/ -rw-r--r-- root/root 67600 2024-09-10 08:35 ./usr/lib/debug/.build-id/64/3260090ac2556d94b177a20e8e1f85142c48fa.debug -rw-r--r-- root/root 76296 2024-09-10 08:35 ./usr/lib/debug/.build-id/64/5ee3115523c1a9963d40d8b312403f3c1943f2.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/70/ -rw-r--r-- root/root 63504 2024-09-10 08:35 ./usr/lib/debug/.build-id/70/ab5dcaefd898d60fb5b57023014ee8d30bb341.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/76/ -rw-r--r-- root/root 156120 2024-09-10 08:35 ./usr/lib/debug/.build-id/76/f1f9e7969c086ab9611ba75bf332a2be51c172.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/7d/ -rw-r--r-- root/root 62496 2024-09-10 08:35 ./usr/lib/debug/.build-id/7d/e28a87815fac14ead267e37d206d9bcc1c9024.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/a0/ -rw-r--r-- root/root 156464 2024-09-10 08:35 ./usr/lib/debug/.build-id/a0/982f6a55f5138e68d9361e5f6b15deaa2a8585.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/b3/ -rw-r--r-- root/root 188664 2024-09-10 08:35 ./usr/lib/debug/.build-id/b3/bbc3ff7d877c7c8245b30eed626a8738d76c71.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/b8/ -rw-r--r-- root/root 75528 2024-09-10 08:35 ./usr/lib/debug/.build-id/b8/8397da9d8db307022ce54aabd5f2d50412ec2f.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/c7/ -rw-r--r-- root/root 114168 2024-09-10 08:35 ./usr/lib/debug/.build-id/c7/c2fa235c86b5dc6934d73ac6b4ce6b9b72608c.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/c8/ -rw-r--r-- root/root 64072 2024-09-10 08:35 ./usr/lib/debug/.build-id/c8/787367b9d5127190e386baa007f8982a4496db.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/e9/ -rw-r--r-- root/root 72200 2024-09-10 08:35 ./usr/lib/debug/.build-id/e9/d69ede09ef820bc9dc9fee495e90da810bb9fa.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/f9/ -rw-r--r-- root/root 67408 2024-09-10 08:35 ./usr/lib/debug/.build-id/f9/a8b952aa7cd26eac85e26035ecb1da9d15a621.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.build-id/fa/ -rw-r--r-- root/root 76136 2024-09-10 08:35 ./usr/lib/debug/.build-id/fa/3ccd1490472bc49533980710d3aa85b18f57fd.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.dwz/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/lib/debug/.dwz/x86_64-linux-gnu/ -rw-r--r-- root/root 34144 2024-09-10 08:35 ./usr/lib/debug/.dwz/x86_64-linux-gnu/sim4db.debug drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ lrwxrwxrwx root/root 0 2024-09-10 08:35 ./usr/share/doc/sim4db-dbgsym -> sim4db sim4db_0~20150903+r2013-9_amd64.deb ----------------------------------- new Debian package, version 2.0. size 443932 bytes: control archive=2136 bytes. 1551 bytes, 30 lines control 3551 bytes, 54 lines md5sums Package: sim4db Source: kmer Version: 0~20150903+r2013-9 Architecture: amd64 Maintainer: Debian Med Packaging Team Installed-Size: 3359 Depends: libc6 (>= 2.38), libgcc-s1 (>= 3.0), libstdc++6 (>= 5.2) Recommends: leaff, kmer-examples Section: science Priority: optional Homepage: http://kmer.sourceforge.net Description: batch spliced alignment of cDNA sequences to a target genome Sim4db performs fast batch alignment of large cDNA (EST, mRNA) sequence sets to a set of eukaryotic genomic regions. It uses the sim4 and sim4cc algorithms to determine the alignments, but incorporates a fast sequence indexing and retrieval mechanism, implemented in the sister package 'leaff', to speedily process large volumes of sequences. . While sim4db produces alignments in the same way as sim4 or sim4cc, it has additional features to make it more amenable for use with whole-genome annotation pipelines. A script file can be used to group pairings between cDNAs and their corresponding genomic regions, to be aligned as one run and using the same set of parameters. Sim4db also optionally reports more than one alignment for the same cDNA within a genomic region, as long as they meet user-defined criteria such as minimum length, percentage sequence identity or coverage. This feature is instrumental in finding all alignments of a gene family at one locus. Lastly, the output is presented either as custom sim4db alignments or as GFF3 gene features. . This package is part of the Kmer suite. drwxr-xr-x root/root 0 2024-09-10 08:35 ./ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/bin/ -rwxr-xr-x root/root 102600 2024-09-10 08:35 ./usr/bin/cleanPolishes -rwxr-xr-x root/root 123080 2024-09-10 08:35 ./usr/bin/comparePolishes -rwxr-xr-x root/root 90312 2024-09-10 08:35 ./usr/bin/convertPolishes -rwxr-xr-x root/root 94408 2024-09-10 08:35 ./usr/bin/convertToAtac -rwxr-xr-x root/root 94408 2024-09-10 08:35 ./usr/bin/convertToExtent -rwxr-xr-x root/root 94408 2024-09-10 08:35 ./usr/bin/depthOfPolishes -rwxr-xr-x root/root 98504 2024-09-10 08:35 ./usr/bin/detectChimera -rwxr-xr-x root/root 98504 2024-09-10 08:35 ./usr/bin/filterPolishes -rwxr-xr-x root/root 152024 2024-09-10 08:35 ./usr/bin/fixPolishesIID -rwxr-xr-x root/root 90312 2024-09-10 08:35 ./usr/bin/headPolishes -rwxr-xr-x root/root 156120 2024-09-10 08:35 ./usr/bin/mappedCoverage -rwxr-xr-x root/root 156120 2024-09-10 08:35 ./usr/bin/mergePolishes -rwxr-xr-x root/root 102632 2024-09-10 08:35 ./usr/bin/parseSNP -rwxr-xr-x root/root 110824 2024-09-10 08:35 ./usr/bin/pickBestPolish -rwxr-xr-x root/root 98536 2024-09-10 08:35 ./usr/bin/pickUniquePolish -rwxr-xr-x root/root 90312 2024-09-10 08:35 ./usr/bin/plotCoverageVsIdentity -rwxr-xr-x root/root 168440 2024-09-10 08:35 ./usr/bin/realignPolishes -rwxr-xr-x root/root 90312 2024-09-10 08:35 ./usr/bin/removeDuplicate -rwxr-xr-x root/root 94408 2024-09-10 08:35 ./usr/bin/reportAlignmentDifferences -rwxr-xr-x root/root 855768 2024-09-10 08:35 ./usr/bin/sim4db -rwxr-xr-x root/root 102632 2024-09-10 08:35 ./usr/bin/sortPolishes -rwxr-xr-x root/root 94408 2024-09-10 08:35 ./usr/bin/summarizePolishes -rwxr-xr-x root/root 90312 2024-09-10 08:35 ./usr/bin/uniqPolishes -rwxr-xr-x root/root 94440 2024-09-10 08:35 ./usr/bin/vennPolishes drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/doc/sim4db/ -rw-r--r-- root/root 4962 2011-01-20 03:32 ./usr/share/doc/sim4db/README.sim4db.gz -rw-r--r-- root/root 244 2024-09-10 08:19 ./usr/share/doc/sim4db/README.test -rw-r--r-- root/root 999 2024-09-10 08:35 ./usr/share/doc/sim4db/changelog.Debian.gz -rw-r--r-- root/root 7520 2024-09-10 08:35 ./usr/share/doc/sim4db/copyright -rw-r--r-- root/root 1008 2024-09-10 08:19 ./usr/share/doc/sim4db/sim4db-unit-test drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/ drwxr-xr-x root/root 0 2024-09-10 08:35 ./usr/share/man/man1/ -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/cleanPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/comparePolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/convertPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/convertToAtac.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/convertToExtent.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/depthOfPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/detectChimera.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/filterPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/fixPolishesIID.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/headPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/mappedCoverage.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/mergePolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/parseSNP.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/pickBestPolish.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/pickUniquePolish.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/plotCoverageVsIdentity.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/realignPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/removeDuplicate.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/reportAlignmentDifferences.1.gz -rw-r--r-- root/root 2206 2024-09-10 08:35 ./usr/share/man/man1/sim4db.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/sim4dbutils.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/sortPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/summarizePolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/uniqPolishes.1.gz -rw-r--r-- root/root 1058 2024-09-10 08:35 ./usr/share/man/man1/vennPolishes.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not cleaning session: cloned chroot in use +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: amd64 Build Type: full Build-Space: 171988 Build-Time: 126 Distribution: perl-5.40-throwaway Host Architecture: amd64 Install-Time: 10 Job: /srv/debomatic/incoming/kmer_0~20150903+r2013-9.dsc Machine Architecture: amd64 Package: kmer Package-Time: 140 Source-Version: 0~20150903+r2013-9 Space: 171988 Status: successful Version: 0~20150903+r2013-9 -------------------------------------------------------------------------------- Finished at 2024-09-10T16:04:41Z Build needed 00:02:20, 171988k disk space