sbuild (Debian sbuild) 0.85.9 (29 May 2024) on carme.larted.org.uk

+==============================================================================+
| bioperl 1.7.8-1 (amd64)                      Sun, 02 Jun 2024 23:58:57 +0000 |
+==============================================================================+

Package: bioperl
Version: 1.7.8-1
Source Version: 1.7.8-1
Distribution: perl-5.40-throwaway
Machine Architecture: amd64
Host Architecture: amd64
Build Architecture: amd64
Build Type: full

I: NOTICE: Log filtering will replace 'var/run/schroot/mount/perl-5.40-amd64-debomatic-637bf3ad-8da0-4220-8de3-7588abb50148' with '<<CHROOT>>'

+------------------------------------------------------------------------------+
| Chroot Setup Commands                                                        |
+------------------------------------------------------------------------------+


/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup bioperl_1.7.8-1 perl-5.40-throwaway amd64
----------------------------------------------------------------------------------------------------------------


I: Finished running '/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup bioperl_1.7.8-1 perl-5.40-throwaway amd64'.

Finished processing commands.
--------------------------------------------------------------------------------
I: NOTICE: Log filtering will replace 'build/bioperl-Gvv4P6/resolver-k34dHN' with '<<RESOLVERDIR>>'

+------------------------------------------------------------------------------+
| Update chroot                                                                |
+------------------------------------------------------------------------------+

Get:1 file:/srv/reprepro perl-5.40 InRelease [3039 B]
Hit:2 http://localhost:3142/debian unstable InRelease
Hit:3 http://localhost:3142/debian sid InRelease
Get:1 file:/srv/reprepro perl-5.40 InRelease [3039 B]
Get:4 file:/srv/reprepro perl-5.40/main amd64 Packages [598 kB]
Reading package lists...
Reading package lists...
Building dependency tree...
Reading state information...
Calculating upgrade...
0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.

+------------------------------------------------------------------------------+
| Fetch source files                                                           |
+------------------------------------------------------------------------------+


Local sources
-------------

/srv/debomatic/incoming/bioperl_1.7.8-1.dsc exists in /srv/debomatic/incoming; copying to chroot
I: NOTICE: Log filtering will replace 'build/bioperl-Gvv4P6/bioperl-1.7.8' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/bioperl-Gvv4P6' with '<<BUILDDIR>>'

+------------------------------------------------------------------------------+
| Install package build dependencies                                           |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: debhelper-compat (= 13), libmodule-build-perl, build-essential, fakeroot, perl, rename, libio-string-perl, libdata-stag-perl, libtest-most-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libbio-samtools-perl, libclass-unload-perl, libcgi-pm-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgd-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpath-class-perl, libperlio-eol-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, libtest-memory-cycle-perl, libtest-pod-perl, libtest-weaken-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-twig-perl, libxml-simple-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl, libyaml-perl, libtest-requiresinternet-perl, libxml-sax-expatxs-perl
Filtered Build-Depends: debhelper-compat (= 13), libmodule-build-perl, build-essential, fakeroot, perl, rename, libio-string-perl, libdata-stag-perl, libtest-most-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libbio-samtools-perl, libclass-unload-perl, libcgi-pm-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgd-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpath-class-perl, libperlio-eol-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, libtest-memory-cycle-perl, libtest-pod-perl, libtest-weaken-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-twig-perl, libxml-simple-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl, libyaml-perl, libtest-requiresinternet-perl, libxml-sax-expatxs-perl
dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<<RESOLVERDIR>>/apt_archive/sbuild-build-depends-main-dummy.deb'.
Ign:1 copy:/<<RESOLVERDIR>>/apt_archive ./ InRelease
Get:2 copy:/<<RESOLVERDIR>>/apt_archive ./ Release [615 B]
Ign:3 copy:/<<RESOLVERDIR>>/apt_archive ./ Release.gpg
Get:4 copy:/<<RESOLVERDIR>>/apt_archive ./ Sources [1660 B]
Get:5 copy:/<<RESOLVERDIR>>/apt_archive ./ Packages [1670 B]
Fetched 3945 B in 0s (0 B/s)
Reading package lists...
Reading package lists...

Install main build dependencies (apt-based resolver)
----------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
  autoconf automake autopoint autotools-dev bsdextrautils ca-certificates
  debhelper dh-autoreconf dh-strip-nondeterminism dwz fakeroot file fontconfig
  fontconfig-config fonts-dejavu-core fonts-dejavu-mono gettext gettext-base
  graphviz groff-base intltool-debian libabsl20230802 libace-perl
  libalgorithm-diff-perl libalgorithm-munkres-perl libann0 libaom3
  libarchive-zip-perl libarray-compare-perl libavif16 libb-hooks-op-check-perl
  libbio-asn1-entrezgene-perl libbio-cluster-perl libbio-perl-perl
  libbio-samtools-perl libbio-variation-perl libbrotli1 libbsd0
  libcache-cache-perl libcairo2 libcapture-tiny-perl libcdt5 libcgi-pm-perl
  libcgraph6 libclass-data-inheritable-perl libclass-inspector-perl
  libclass-method-modifiers-perl libclass-unload-perl libclass-xsaccessor-perl
  libclone-perl libcom-err2 libconvert-binary-c-perl libconvert-binhex-perl
  libcrypt-rc4-perl libdata-stag-perl libdatrie1 libdav1d7 libdbd-mysql-perl
  libdbd-pg-perl libdbd-sqlite3-perl libdbi-perl libde265-0 libdebhelper-perl
  libdeflate0 libdevel-callchecker-perl libdevel-cycle-perl
  libdevel-stacktrace-perl libdigest-perl-md5-perl
  libdynaloader-functions-perl libelf1t64 libencode-locale-perl liberror-perl
  libexception-class-perl libexpat1 libexporter-tiny-perl libfakeroot
  libfcgi-perl libfcgi0t64 libfile-listing-perl libfile-slurp-tiny-perl
  libfile-stripnondeterminism-perl libfontconfig1 libfreetype6 libfribidi0
  libgav1-1 libgd-perl libgd3 libglib2.0-0t64 libgraph-perl libgraphite2-3
  libgraphviz-perl libgssapi-krb5-2 libgts-0.7-5t64 libgvc6 libgvpr2
  libharfbuzz0b libheap-perl libheif-plugin-dav1d libheif-plugin-libde265
  libheif1 libhtml-parser-perl libhtml-tableextract-perl libhtml-tagset-perl
  libhtml-tree-perl libhttp-cookies-perl libhttp-daemon-perl libhttp-date-perl
  libhttp-message-perl libhttp-negotiate-perl libice6 libicu72
  libimport-into-perl libio-html-perl libio-pty-perl libio-sessiondata-perl
  libio-socket-ssl-perl libio-string-perl libio-stringy-perl libipc-run-perl
  libipc-sharelite-perl libjbig0 libjcode-pm-perl libjpeg62-turbo libk5crypto3
  libkeyutils1 libkrb5-3 libkrb5support0 liblab-gamut1 liblerc4
  liblist-moreutils-perl liblist-moreutils-xs-perl libltdl7
  liblwp-mediatypes-perl liblwp-protocol-https-perl libmagic-mgc libmagic1t64
  libmailtools-perl libmariadb3 libmath-derivative-perl libmath-spline-perl
  libmime-tools-perl libmodule-build-perl libmodule-runtime-perl libmoo-perl
  libnet-http-perl libnet-smtp-ssl-perl libnet-ssleay-perl
  libole-storage-lite-perl libpadwalker-perl libpango-1.0-0
  libpangocairo-1.0-0 libpangoft2-1.0-0 libparams-classify-perl
  libparse-recdescent-perl libpath-class-perl libpathplan4 libperlio-eol-perl
  libpipeline1 libpixman-1-0 libpng16-16t64 libpostscript-perl libpq5
  librav1e0 librole-tiny-perl libset-object-perl libset-scalar-perl
  libsharpyuv0 libsm6 libsoap-lite-perl libsort-naturally-perl
  libspreadsheet-parseexcel-perl libspreadsheet-writeexcel-perl
  libstatistics-descriptive-perl libsub-quote-perl libsub-uplevel-perl
  libsvg-graph-perl libsvg-perl libsvtav1enc1d1 libtask-weaken-perl
  libtest-deep-perl libtest-differences-perl libtest-exception-perl
  libtest-memory-cycle-perl libtest-most-perl libtest-pod-perl
  libtest-requiresinternet-perl libtest-warn-perl libtest-weaken-perl
  libtext-diff-perl libthai-data libthai0 libtiff6 libtimedate-perl libtool
  libtree-dagnode-perl libtry-tiny-perl libtype-tiny-perl libuchardet0
  libunicode-map-perl liburi-perl libwebp7 libwww-perl libwww-robotrules-perl
  libx11-6 libx11-data libxau6 libxaw7 libxcb-render0 libxcb-shm0 libxcb1
  libxdmcp6 libxext6 libxml-dom-perl libxml-dom-xpath-perl
  libxml-filter-buffertext-perl libxml-libxml-perl
  libxml-namespacesupport-perl libxml-parser-perl libxml-perl
  libxml-regexp-perl libxml-sax-base-perl libxml-sax-expatxs-perl
  libxml-sax-perl libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl
  libxml-writer-perl libxml-xpath-perl libxml-xpathengine-perl libxml2 libxmu6
  libxpm4 libxrender1 libxt6t64 libyaml-perl libyuv0 m4 man-db mariadb-common
  mysql-common netbase openssl perl-openssl-defaults po-debconf rename
  sensible-utils ucf x11-common
Suggested packages:
  autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc
  libasprintf-dev libgettextpo-dev gsfonts graphviz-doc groff bioperl
  libmldbm-perl libnet-daemon-perl libsql-statement-perl libgd-tools
  low-memory-monitor krb5-doc krb5-user libheif-plugin-ffmpegdec
  libheif-plugin-jpegdec libheif-plugin-jpegenc libheif-plugin-j2kdec
  libheif-plugin-j2kenc libheif-plugin-rav1e libheif-plugin-svtenc
  libdata-dump-perl libhtml-element-extended-perl libcrypt-ssleay-perl
  libscalar-number-perl libapache2-mod-perl2 libmime-lite-perl
  libnet-jabber-perl libtool-doc gfortran | fortran95-compiler gcj-jdk
  libsub-name-perl libdevel-lexalias-perl libbusiness-isbn-perl
  libregexp-ipv6-perl libauthen-ntlm-perl libunicode-map8-perl
  libunicode-string-perl xml-twig-tools libyaml-shell-perl m4-doc apparmor
  less www-browser libmail-box-perl
Recommended packages:
  curl | wget | lynx fonts-liberation2 libalgorithm-diff-xs-perl bioperl-run
  | libbio-perl-run-perl libcgi-fast-perl libtie-hash-indexed-perl
  | libtie-ixhash-perl perl-tk libxml-libxslt-perl libmldbm-perl libfcgi-bin
  libarchive-cpio-perl libglib2.0-data shared-mime-info xdg-user-dirs
  libgts-bin libheif-plugin-aomenc libheif-plugin-x265 libhtml-format-perl
  libio-compress-brotli-perl krb5-locales libmodule-signature-perl
  libpod-readme-perl libsoftware-license-perl libnamespace-clean-perl
  libauthen-sasl-perl ghostscript libxmlrpc-lite-perl libdate-calc-perl
  libdate-manip-perl libxstring-perl libltdl-dev libref-util-perl
  libtype-tiny-xs-perl libdata-dump-perl libhtml-form-perl
  libxml-sax-expat-perl libtext-iconv-perl libtie-ixhash-perl
  libyaml-libyaml-perl | libyaml-syck-perl libmail-sendmail-perl
The following NEW packages will be installed:
  autoconf automake autopoint autotools-dev bsdextrautils ca-certificates
  debhelper dh-autoreconf dh-strip-nondeterminism dwz fakeroot file fontconfig
  fontconfig-config fonts-dejavu-core fonts-dejavu-mono gettext gettext-base
  graphviz groff-base intltool-debian libabsl20230802 libace-perl
  libalgorithm-diff-perl libalgorithm-munkres-perl libann0 libaom3
  libarchive-zip-perl libarray-compare-perl libavif16 libb-hooks-op-check-perl
  libbio-asn1-entrezgene-perl libbio-cluster-perl libbio-perl-perl
  libbio-samtools-perl libbio-variation-perl libbrotli1 libbsd0
  libcache-cache-perl libcairo2 libcapture-tiny-perl libcdt5 libcgi-pm-perl
  libcgraph6 libclass-data-inheritable-perl libclass-inspector-perl
  libclass-method-modifiers-perl libclass-unload-perl libclass-xsaccessor-perl
  libclone-perl libcom-err2 libconvert-binary-c-perl libconvert-binhex-perl
  libcrypt-rc4-perl libdata-stag-perl libdatrie1 libdav1d7 libdbd-mysql-perl
  libdbd-pg-perl libdbd-sqlite3-perl libdbi-perl libde265-0 libdebhelper-perl
  libdeflate0 libdevel-callchecker-perl libdevel-cycle-perl
  libdevel-stacktrace-perl libdigest-perl-md5-perl
  libdynaloader-functions-perl libelf1t64 libencode-locale-perl liberror-perl
  libexception-class-perl libexpat1 libexporter-tiny-perl libfakeroot
  libfcgi-perl libfcgi0t64 libfile-listing-perl libfile-slurp-tiny-perl
  libfile-stripnondeterminism-perl libfontconfig1 libfreetype6 libfribidi0
  libgav1-1 libgd-perl libgd3 libglib2.0-0t64 libgraph-perl libgraphite2-3
  libgraphviz-perl libgssapi-krb5-2 libgts-0.7-5t64 libgvc6 libgvpr2
  libharfbuzz0b libheap-perl libheif-plugin-dav1d libheif-plugin-libde265
  libheif1 libhtml-parser-perl libhtml-tableextract-perl libhtml-tagset-perl
  libhtml-tree-perl libhttp-cookies-perl libhttp-daemon-perl libhttp-date-perl
  libhttp-message-perl libhttp-negotiate-perl libice6 libicu72
  libimport-into-perl libio-html-perl libio-pty-perl libio-sessiondata-perl
  libio-socket-ssl-perl libio-string-perl libio-stringy-perl libipc-run-perl
  libipc-sharelite-perl libjbig0 libjcode-pm-perl libjpeg62-turbo libk5crypto3
  libkeyutils1 libkrb5-3 libkrb5support0 liblab-gamut1 liblerc4
  liblist-moreutils-perl liblist-moreutils-xs-perl libltdl7
  liblwp-mediatypes-perl liblwp-protocol-https-perl libmagic-mgc libmagic1t64
  libmailtools-perl libmariadb3 libmath-derivative-perl libmath-spline-perl
  libmime-tools-perl libmodule-build-perl libmodule-runtime-perl libmoo-perl
  libnet-http-perl libnet-smtp-ssl-perl libnet-ssleay-perl
  libole-storage-lite-perl libpadwalker-perl libpango-1.0-0
  libpangocairo-1.0-0 libpangoft2-1.0-0 libparams-classify-perl
  libparse-recdescent-perl libpath-class-perl libpathplan4 libperlio-eol-perl
  libpipeline1 libpixman-1-0 libpng16-16t64 libpostscript-perl libpq5
  librav1e0 librole-tiny-perl libset-object-perl libset-scalar-perl
  libsharpyuv0 libsm6 libsoap-lite-perl libsort-naturally-perl
  libspreadsheet-parseexcel-perl libspreadsheet-writeexcel-perl
  libstatistics-descriptive-perl libsub-quote-perl libsub-uplevel-perl
  libsvg-graph-perl libsvg-perl libsvtav1enc1d1 libtask-weaken-perl
  libtest-deep-perl libtest-differences-perl libtest-exception-perl
  libtest-memory-cycle-perl libtest-most-perl libtest-pod-perl
  libtest-requiresinternet-perl libtest-warn-perl libtest-weaken-perl
  libtext-diff-perl libthai-data libthai0 libtiff6 libtimedate-perl libtool
  libtree-dagnode-perl libtry-tiny-perl libtype-tiny-perl libuchardet0
  libunicode-map-perl liburi-perl libwebp7 libwww-perl libwww-robotrules-perl
  libx11-6 libx11-data libxau6 libxaw7 libxcb-render0 libxcb-shm0 libxcb1
  libxdmcp6 libxext6 libxml-dom-perl libxml-dom-xpath-perl
  libxml-filter-buffertext-perl libxml-libxml-perl
  libxml-namespacesupport-perl libxml-parser-perl libxml-perl
  libxml-regexp-perl libxml-sax-base-perl libxml-sax-expatxs-perl
  libxml-sax-perl libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl
  libxml-writer-perl libxml-xpath-perl libxml-xpathengine-perl libxml2 libxmu6
  libxpm4 libxrender1 libxt6t64 libyaml-perl libyuv0 m4 man-db mariadb-common
  mysql-common netbase openssl perl-openssl-defaults po-debconf rename
  sbuild-build-depends-main-dummy sensible-utils ucf x11-common
0 upgraded, 249 newly installed, 0 to remove and 0 not upgraded.
Need to get 51.2 MB/56.9 MB of archives.
After this operation, 183 MB of additional disk space will be used.
Get:1 file:/srv/reprepro perl-5.40/main amd64 libcdt5 amd64 2.42.2-9+b2 [39.8 kB]
Get:2 copy:/<<RESOLVERDIR>>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [1228 B]
Get:3 http://localhost:3142/debian unstable/main amd64 netbase all 6.4 [12.8 kB]
Get:4 http://localhost:3142/debian unstable/main amd64 sensible-utils all 0.0.22 [22.4 kB]
Get:5 http://localhost:3142/debian unstable/main amd64 openssl amd64 3.2.1-3 [1360 kB]
Get:6 http://localhost:3142/debian unstable/main amd64 ca-certificates all 20240203 [158 kB]
Get:7 http://localhost:3142/debian unstable/main amd64 libmagic-mgc amd64 1:5.45-3 [314 kB]
Get:8 http://localhost:3142/debian unstable/main amd64 libmagic1t64 amd64 1:5.45-3 [105 kB]
Get:9 file:/srv/reprepro perl-5.40/main amd64 libcgraph6 amd64 2.42.2-9+b2 [63.6 kB]
Get:10 http://localhost:3142/debian unstable/main amd64 file amd64 1:5.45-3 [42.9 kB]
Get:11 file:/srv/reprepro perl-5.40/main amd64 libpathplan4 amd64 2.42.2-9+b2 [42.2 kB]
Get:12 http://localhost:3142/debian unstable/main amd64 gettext-base amd64 0.21-14+b1 [161 kB]
Get:13 http://localhost:3142/debian unstable/main amd64 libuchardet0 amd64 0.0.8-1+b1 [68.8 kB]
Get:14 file:/srv/reprepro perl-5.40/main amd64 libgvc6 amd64 2.42.2-9+b2 [682 kB]
Get:15 file:/srv/reprepro perl-5.40/main amd64 libgvpr2 amd64 2.42.2-9+b2 [190 kB]
Get:16 file:/srv/reprepro perl-5.40/main amd64 liblab-gamut1 amd64 2.42.2-9+b2 [198 kB]
Get:17 http://localhost:3142/debian unstable/main amd64 groff-base amd64 1.23.0-4 [1180 kB]
Get:18 http://localhost:3142/debian unstable/main amd64 bsdextrautils amd64 2.40.1-7 [95.9 kB]
Get:19 http://localhost:3142/debian unstable/main amd64 libpipeline1 amd64 1.5.7-2 [38.0 kB]
Get:20 http://localhost:3142/debian unstable/main amd64 man-db amd64 2.12.1-1 [1411 kB]
Get:21 file:/srv/reprepro perl-5.40/main amd64 graphviz amd64 2.42.2-9+b2 [615 kB]
Get:22 file:/srv/reprepro perl-5.40/main amd64 libipc-sharelite-perl amd64 0.17-5+b3 [23.1 kB]
Get:23 file:/srv/reprepro perl-5.40/main amd64 libace-perl amd64 1.92-11+b5 [273 kB]
Get:24 file:/srv/reprepro perl-5.40/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b4 [36.3 kB]
Get:25 file:/srv/reprepro perl-5.40/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b2 [10.6 kB]
Get:26 file:/srv/reprepro perl-5.40/main amd64 libdevel-callchecker-perl amd64 0.009-1+b1 [16.1 kB]
Get:27 file:/srv/reprepro perl-5.40/main amd64 libparams-classify-perl amd64 0.015-2+b4 [22.4 kB]
Get:28 file:/srv/reprepro perl-5.40/main amd64 libhtml-parser-perl amd64 3.82-1+b1 [99.2 kB]
Get:29 file:/srv/reprepro perl-5.40/main amd64 libclone-perl amd64 0.46-1+b3 [13.7 kB]
Get:30 file:/srv/reprepro perl-5.40/main amd64 libnet-ssleay-perl amd64 1.94-1+b2 [339 kB]
Get:31 file:/srv/reprepro perl-5.40/main amd64 libxml-parser-perl amd64 2.47-1+b3 [199 kB]
Get:32 file:/srv/reprepro perl-5.40/main amd64 libbio-samtools-perl amd64 1.43-5+b1 [182 kB]
Get:33 file:/srv/reprepro perl-5.40/main amd64 libconvert-binary-c-perl amd64 0.84-1+b5 [272 kB]
Get:34 file:/srv/reprepro perl-5.40/main amd64 libdbi-perl amd64 1.643-4+b3 [755 kB]
Get:35 http://localhost:3142/debian unstable/main amd64 ucf all 3.0043+nmu1 [55.2 kB]
Get:36 http://localhost:3142/debian unstable/main amd64 m4 amd64 1.4.19-4 [287 kB]
Get:37 http://localhost:3142/debian unstable/main amd64 autoconf all 2.71-3 [332 kB]
Get:38 file:/srv/reprepro perl-5.40/main amd64 libdbd-mysql-perl amd64 4.052-1+b3 [114 kB]
Get:39 http://localhost:3142/debian unstable/main amd64 autotools-dev all 20220109.1 [51.6 kB]
Get:40 file:/srv/reprepro perl-5.40/main amd64 libpq5 amd64 16.3-1+b1 [219 kB]
Get:41 file:/srv/reprepro perl-5.40/main amd64 libdbd-pg-perl amd64 3.18.0-1+b3 [211 kB]
Get:42 http://localhost:3142/debian unstable/main amd64 automake all 1:1.16.5-1.3 [823 kB]
Get:43 file:/srv/reprepro perl-5.40/main amd64 libdbd-sqlite3-perl amd64 1.74-1+b3 [175 kB]
Get:44 file:/srv/reprepro perl-5.40/main amd64 libfcgi-perl amd64 0.82+ds-3+b2 [25.4 kB]
Get:45 file:/srv/reprepro perl-5.40/main amd64 libgd-perl amd64 2.78-1+b3 [131 kB]
Get:46 file:/srv/reprepro perl-5.40/main amd64 libset-object-perl amd64 1.42-1+b5 [37.5 kB]
Get:47 file:/srv/reprepro perl-5.40/main amd64 libio-pty-perl amd64 1:1.20-1+b2 [34.3 kB]
Get:48 file:/srv/reprepro perl-5.40/main amd64 liblist-moreutils-xs-perl amd64 0.430-4+b2 [41.7 kB]
Get:49 file:/srv/reprepro perl-5.40/main amd64 libpadwalker-perl amd64 2.5-1+b6 [18.6 kB]
Get:50 file:/srv/reprepro perl-5.40/main amd64 libperlio-eol-perl amd64 0.19-1+b3 [15.4 kB]
Get:51 http://localhost:3142/debian unstable/main amd64 autopoint all 0.21-14 [496 kB]
Get:52 http://localhost:3142/debian unstable/main amd64 libdebhelper-perl all 13.15.3 [88.0 kB]
Get:53 file:/srv/reprepro perl-5.40/main amd64 libunicode-map-perl amd64 0.112-13+b4 [145 kB]
Get:54 file:/srv/reprepro perl-5.40/main amd64 libxml-libxml-perl amd64 2.0207+dfsg+really+2.0134-3+b1 [313 kB]
Get:55 http://localhost:3142/debian unstable/main amd64 libtool all 2.4.7-7 [517 kB]
Get:56 file:/srv/reprepro perl-5.40/main amd64 libxml-sax-expatxs-perl amd64 1.33-3+b4 [115 kB]
Get:57 http://localhost:3142/debian unstable/main amd64 dh-autoreconf all 20 [17.1 kB]
Get:58 http://localhost:3142/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB]
Get:59 http://localhost:3142/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB]
Get:60 http://localhost:3142/debian unstable/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B]
Get:61 http://localhost:3142/debian unstable/main amd64 libelf1t64 amd64 0.191-1+b1 [189 kB]
Get:62 http://localhost:3142/debian unstable/main amd64 dwz amd64 0.15-1+b1 [110 kB]
Get:63 http://localhost:3142/debian unstable/main amd64 libicu72 amd64 72.1-4+b1 [9395 kB]
Get:64 http://localhost:3142/debian unstable/main amd64 libxml2 amd64 2.12.7+dfsg-2 [670 kB]
Get:65 http://localhost:3142/debian unstable/main amd64 gettext amd64 0.21-14+b1 [1301 kB]
Get:66 http://localhost:3142/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB]
Get:67 http://localhost:3142/debian unstable/main amd64 po-debconf all 1.0.21+nmu1 [248 kB]
Get:68 http://localhost:3142/debian unstable/main amd64 debhelper all 13.15.3 [901 kB]
Get:69 http://localhost:3142/debian unstable/main amd64 libfakeroot amd64 1.34-1 [28.9 kB]
Get:70 http://localhost:3142/debian unstable/main amd64 fakeroot amd64 1.34-1 [74.0 kB]
Get:71 http://localhost:3142/debian unstable/main amd64 libexpat1 amd64 2.6.2-1 [103 kB]
Get:72 http://localhost:3142/debian unstable/main amd64 libbrotli1 amd64 1.1.0-2+b3 [305 kB]
Get:73 http://localhost:3142/debian unstable/main amd64 libpng16-16t64 amd64 1.6.43-5 [278 kB]
Get:74 http://localhost:3142/debian unstable/main amd64 libfreetype6 amd64 2.13.2+dfsg-1+b4 [439 kB]
Get:75 http://localhost:3142/debian unstable/main amd64 fonts-dejavu-mono all 2.37-8 [489 kB]
Get:76 http://localhost:3142/debian unstable/main amd64 fonts-dejavu-core all 2.37-8 [840 kB]
Get:77 http://localhost:3142/debian unstable/main amd64 fontconfig-config amd64 2.15.0-1.1 [317 kB]
Get:78 http://localhost:3142/debian unstable/main amd64 libfontconfig1 amd64 2.15.0-1.1 [388 kB]
Get:79 http://localhost:3142/debian unstable/main amd64 fontconfig amd64 2.15.0-1.1 [463 kB]
Get:80 http://localhost:3142/debian unstable/main amd64 libann0 amd64 1.1.2+doc-9+b1 [25.1 kB]
Get:81 http://localhost:3142/debian unstable/main amd64 libaom3 amd64 3.8.2-2 [1869 kB]
Get:82 http://localhost:3142/debian unstable/main amd64 libdav1d7 amd64 1.4.2-1 [551 kB]
Get:83 http://localhost:3142/debian unstable/main amd64 libabsl20230802 amd64 20230802.1-4 [464 kB]
Get:84 http://localhost:3142/debian unstable/main amd64 libgav1-1 amd64 0.19.0-2+b1 [351 kB]
Get:85 http://localhost:3142/debian unstable/main amd64 librav1e0 amd64 0.7.1-2 [900 kB]
Get:86 http://localhost:3142/debian unstable/main amd64 libsharpyuv0 amd64 1.4.0-0.1 [113 kB]
Get:87 http://localhost:3142/debian unstable/main amd64 libsvtav1enc1d1 amd64 1.7.0+dfsg-2+b1 [2169 kB]
Get:88 http://localhost:3142/debian unstable/main amd64 libjpeg62-turbo amd64 1:2.1.5-3 [167 kB]
Get:89 http://localhost:3142/debian unstable/main amd64 libyuv0 amd64 0.0.1888.20240509-4 [170 kB]
Get:90 http://localhost:3142/debian unstable/main amd64 libavif16 amd64 1.0.4-3 [106 kB]
Get:91 http://localhost:3142/debian unstable/main amd64 libheif-plugin-dav1d amd64 1.17.6-1+b2 [9856 B]
Get:92 http://localhost:3142/debian unstable/main amd64 libde265-0 amd64 1.0.15-1+b1 [187 kB]
Get:93 http://localhost:3142/debian unstable/main amd64 libheif-plugin-libde265 amd64 1.17.6-1+b2 [13.1 kB]
Get:94 http://localhost:3142/debian unstable/main amd64 libheif1 amd64 1.17.6-1+b2 [284 kB]
Get:95 http://localhost:3142/debian unstable/main amd64 libdeflate0 amd64 1.20-1 [46.0 kB]
Get:96 http://localhost:3142/debian unstable/main amd64 libjbig0 amd64 2.1-6.1+b1 [32.0 kB]
Get:97 http://localhost:3142/debian unstable/main amd64 liblerc4 amd64 4.0.0+ds-4+b1 [171 kB]
Get:98 http://localhost:3142/debian unstable/main amd64 libwebp7 amd64 1.4.0-0.1 [311 kB]
Get:99 http://localhost:3142/debian unstable/main amd64 libtiff6 amd64 4.5.1+git230720-4 [322 kB]
Get:100 http://localhost:3142/debian unstable/main amd64 libxau6 amd64 1:1.0.9-1+b1 [18.1 kB]
Get:101 http://localhost:3142/debian unstable/main amd64 libbsd0 amd64 0.12.2-1 [131 kB]
Get:102 http://localhost:3142/debian unstable/main amd64 libxdmcp6 amd64 1:1.1.2-3+b1 [24.3 kB]
Get:103 http://localhost:3142/debian unstable/main amd64 libxcb1 amd64 1.17.0-2 [144 kB]
Get:104 http://localhost:3142/debian unstable/main amd64 libx11-data all 2:1.8.7-1 [328 kB]
Get:105 http://localhost:3142/debian unstable/main amd64 libx11-6 amd64 2:1.8.7-1+b1 [799 kB]
Get:106 http://localhost:3142/debian unstable/main amd64 libxpm4 amd64 1:3.5.17-1+b1 [56.1 kB]
Get:107 http://localhost:3142/debian unstable/main amd64 libgd3 amd64 2.3.3-9+b3 [125 kB]
Get:108 http://localhost:3142/debian unstable/main amd64 libglib2.0-0t64 amd64 2.80.2-2 [1485 kB]
Get:109 http://localhost:3142/debian unstable/main amd64 libgts-0.7-5t64 amd64 0.7.6+darcs121130-5.2 [157 kB]
Get:110 http://localhost:3142/debian unstable/main amd64 libpixman-1-0 amd64 0.42.2-1+b1 [556 kB]
Get:111 http://localhost:3142/debian unstable/main amd64 libxcb-render0 amd64 1.17.0-2 [115 kB]
Get:112 http://localhost:3142/debian unstable/main amd64 libxcb-shm0 amd64 1.17.0-2 [105 kB]
Get:113 http://localhost:3142/debian unstable/main amd64 libxext6 amd64 2:1.3.4-1+b1 [52.9 kB]
Get:114 http://localhost:3142/debian unstable/main amd64 libxrender1 amd64 1:0.9.10-1.1+b1 [27.9 kB]
Get:115 http://localhost:3142/debian unstable/main amd64 libcairo2 amd64 1.18.0-3+b1 [531 kB]
Get:116 http://localhost:3142/debian unstable/main amd64 libltdl7 amd64 2.4.7-7+b1 [393 kB]
Get:117 http://localhost:3142/debian unstable/main amd64 libfribidi0 amd64 1.0.13-3+b1 [71.4 kB]
Get:118 http://localhost:3142/debian unstable/main amd64 libgraphite2-3 amd64 1.3.14-2 [74.9 kB]
Get:119 http://localhost:3142/debian unstable/main amd64 libharfbuzz0b amd64 8.3.0-2+b1 [2214 kB]
Get:120 http://localhost:3142/debian unstable/main amd64 libthai-data all 0.1.29-2 [168 kB]
Get:121 http://localhost:3142/debian unstable/main amd64 libdatrie1 amd64 0.2.13-3 [37.7 kB]
Get:122 http://localhost:3142/debian unstable/main amd64 libthai0 amd64 0.1.29-2 [49.1 kB]
Get:123 http://localhost:3142/debian unstable/main amd64 libpango-1.0-0 amd64 1.52.2+ds-1 [218 kB]
Get:124 http://localhost:3142/debian unstable/main amd64 libpangoft2-1.0-0 amd64 1.52.2+ds-1 [48.1 kB]
Get:125 http://localhost:3142/debian unstable/main amd64 libpangocairo-1.0-0 amd64 1.52.2+ds-1 [35.0 kB]
Get:126 http://localhost:3142/debian unstable/main amd64 x11-common all 1:7.7+23 [252 kB]
Get:127 http://localhost:3142/debian unstable/main amd64 libice6 amd64 2:1.0.10-1+b1 [56.7 kB]
Get:128 http://localhost:3142/debian unstable/main amd64 libsm6 amd64 2:1.2.3-1+b1 [33.6 kB]
Get:129 http://localhost:3142/debian unstable/main amd64 libxt6t64 amd64 1:1.2.1-1.2 [187 kB]
Get:130 http://localhost:3142/debian unstable/main amd64 libxmu6 amd64 2:1.1.3-3+b2 [58.7 kB]
Get:131 http://localhost:3142/debian unstable/main amd64 libxaw7 amd64 2:1.0.14-1+b2 [199 kB]
Get:132 http://localhost:3142/debian unstable/main amd64 liberror-perl all 0.17029-2 [29.0 kB]
Get:133 http://localhost:3142/debian unstable/main amd64 libcache-cache-perl all 1.08-3 [63.4 kB]
Get:134 http://localhost:3142/debian unstable/main amd64 libalgorithm-diff-perl all 1.201-1 [43.3 kB]
Get:135 http://localhost:3142/debian unstable/main amd64 libalgorithm-munkres-perl all 0.08-5 [11.3 kB]
Get:136 http://localhost:3142/debian unstable/main amd64 libclass-method-modifiers-perl all 2.15-1 [18.0 kB]
Get:137 http://localhost:3142/debian unstable/main amd64 libdynaloader-functions-perl all 0.003-3 [12.7 kB]
Get:138 http://localhost:3142/debian unstable/main amd64 libmodule-runtime-perl all 0.016-2 [19.6 kB]
Get:139 http://localhost:3142/debian unstable/main amd64 libimport-into-perl all 1.002005-2 [11.3 kB]
Get:140 http://localhost:3142/debian unstable/main amd64 librole-tiny-perl all 2.002004-1 [21.4 kB]
Get:141 http://localhost:3142/debian unstable/main amd64 libsub-quote-perl all 2.006008-1 [21.8 kB]
Get:142 http://localhost:3142/debian unstable/main amd64 libmoo-perl all 2.005005-1 [58.0 kB]
Get:143 http://localhost:3142/debian unstable/main amd64 libexporter-tiny-perl all 1.006002-1 [38.7 kB]
Get:144 http://localhost:3142/debian unstable/main amd64 libtype-tiny-perl all 2.004000-1 [357 kB]
Get:145 http://localhost:3142/debian unstable/main amd64 libarray-compare-perl all 3.0.8-1 [14.9 kB]
Get:146 http://localhost:3142/debian unstable/main amd64 libio-string-perl all 1.08-4 [12.1 kB]
Get:147 http://localhost:3142/debian unstable/main amd64 libdata-stag-perl all 0.14-3 [448 kB]
Get:148 http://localhost:3142/debian unstable/main amd64 libbio-perl-perl all 1.7.8-1 [2603 kB]
Get:149 http://localhost:3142/debian unstable/main amd64 liburi-perl all 5.28-1 [98.6 kB]
Get:150 http://localhost:3142/debian unstable/main amd64 libencode-locale-perl all 1.05-3 [12.9 kB]
Get:151 http://localhost:3142/debian unstable/main amd64 libtimedate-perl all 2.3300-2 [39.3 kB]
Get:152 http://localhost:3142/debian unstable/main amd64 libhttp-date-perl all 6.06-1 [10.7 kB]
Get:153 http://localhost:3142/debian unstable/main amd64 libfile-listing-perl all 6.16-1 [12.4 kB]
Get:154 http://localhost:3142/debian unstable/main amd64 libhtml-tagset-perl all 3.24-1 [14.7 kB]
Get:155 http://localhost:3142/debian unstable/main amd64 libhtml-tree-perl all 5.07-3 [211 kB]
Get:156 http://localhost:3142/debian unstable/main amd64 libio-html-perl all 1.004-3 [16.2 kB]
Get:157 http://localhost:3142/debian unstable/main amd64 liblwp-mediatypes-perl all 6.04-2 [20.2 kB]
Get:158 http://localhost:3142/debian unstable/main amd64 libhttp-message-perl all 6.46-1 [79.7 kB]
Get:159 http://localhost:3142/debian unstable/main amd64 libhttp-cookies-perl all 6.11-1 [19.1 kB]
Get:160 http://localhost:3142/debian unstable/main amd64 libhttp-negotiate-perl all 6.01-2 [13.1 kB]
Get:161 http://localhost:3142/debian unstable/main amd64 perl-openssl-defaults amd64 7+b2 [6724 B]
Get:162 http://localhost:3142/debian unstable/main amd64 libio-socket-ssl-perl all 2.085-1 [218 kB]
Get:163 http://localhost:3142/debian unstable/main amd64 libnet-http-perl all 6.23-1 [23.9 kB]
Get:164 http://localhost:3142/debian unstable/main amd64 liblwp-protocol-https-perl all 6.14-1 [10.8 kB]
Get:165 http://localhost:3142/debian unstable/main amd64 libtry-tiny-perl all 0.31-2 [22.6 kB]
Get:166 http://localhost:3142/debian unstable/main amd64 libwww-robotrules-perl all 6.02-1 [12.9 kB]
Get:167 http://localhost:3142/debian unstable/main amd64 libwww-perl all 6.77-1 [183 kB]
Get:168 http://localhost:3142/debian unstable/main amd64 libxml-twig-perl all 1:3.52-3 [177 kB]
Get:169 http://localhost:3142/debian unstable/main amd64 libxml-writer-perl all 0.900-2 [26.8 kB]
Get:170 http://localhost:3142/debian unstable/main amd64 libbio-variation-perl all 1.7.5-3 [72.6 kB]
Get:171 http://localhost:3142/debian unstable/main amd64 libxml-namespacesupport-perl all 1.12-2 [15.1 kB]
Get:172 http://localhost:3142/debian unstable/main amd64 libxml-sax-base-perl all 1.09-3 [20.6 kB]
Get:173 http://localhost:3142/debian unstable/main amd64 libxml-sax-perl all 1.02+dfsg-3 [59.4 kB]
Get:174 http://localhost:3142/debian unstable/main amd64 libbio-cluster-perl all 1.7.3-6 [53.3 kB]
Get:175 http://localhost:3142/debian unstable/main amd64 libbio-asn1-entrezgene-perl all 1.730-3 [46.3 kB]
Get:176 http://localhost:3142/debian unstable/main amd64 libcapture-tiny-perl all 0.48-2 [24.6 kB]
Get:177 http://localhost:3142/debian unstable/main amd64 libcgi-pm-perl all 4.64-1 [217 kB]
Get:178 http://localhost:3142/debian unstable/main amd64 libclass-data-inheritable-perl all 0.08-3 [8588 B]
Get:179 http://localhost:3142/debian unstable/main amd64 libclass-inspector-perl all 1.36-3 [17.5 kB]
Get:180 http://localhost:3142/debian unstable/main amd64 libclass-unload-perl all 0.11-3 [5656 B]
Get:181 http://localhost:3142/debian unstable/main amd64 libcom-err2 amd64 1.47.1-1 [22.9 kB]
Get:182 http://localhost:3142/debian unstable/main amd64 libconvert-binhex-perl all 1.125-3 [27.4 kB]
Get:183 http://localhost:3142/debian unstable/main amd64 libcrypt-rc4-perl all 2.02-5 [7480 B]
Get:184 http://localhost:3142/debian unstable/main amd64 mysql-common all 5.8+1.1.0 [6636 B]
Get:185 http://localhost:3142/debian unstable/main amd64 mariadb-common all 1:10.11.8-1 [26.4 kB]
Get:186 http://localhost:3142/debian unstable/main amd64 libmariadb3 amd64 1:10.11.8-1 [176 kB]
Get:187 http://localhost:3142/debian unstable/main amd64 libkrb5support0 amd64 1.20.1-6+b1 [33.3 kB]
Get:188 http://localhost:3142/debian unstable/main amd64 libk5crypto3 amd64 1.20.1-6+b1 [79.8 kB]
Get:189 http://localhost:3142/debian unstable/main amd64 libkeyutils1 amd64 1.6.3-3 [8952 B]
Get:190 http://localhost:3142/debian unstable/main amd64 libkrb5-3 amd64 1.20.1-6+b1 [333 kB]
Get:191 http://localhost:3142/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.20.1-6+b1 [135 kB]
Get:192 http://localhost:3142/debian unstable/main amd64 libdevel-cycle-perl all 1.12-2 [11.9 kB]
Get:193 http://localhost:3142/debian unstable/main amd64 libdevel-stacktrace-perl all 2.0500-1 [26.4 kB]
Get:194 http://localhost:3142/debian unstable/main amd64 libdigest-perl-md5-perl all 1.9-5 [11.7 kB]
Get:195 http://localhost:3142/debian unstable/main amd64 libexception-class-perl all 1.45-1 [34.6 kB]
Get:196 http://localhost:3142/debian unstable/main amd64 libfcgi0t64 amd64 2.4.2-2.1 [24.6 kB]
Get:197 http://localhost:3142/debian unstable/main amd64 libfile-slurp-tiny-perl all 0.004-2 [7592 B]
Get:198 http://localhost:3142/debian unstable/main amd64 libheap-perl all 0.80-5 [34.3 kB]
Get:199 http://localhost:3142/debian unstable/main amd64 libgraph-perl all 1:0.9727-1 [111 kB]
Get:200 http://localhost:3142/debian unstable/main amd64 libipc-run-perl all 20231003.0-2 [101 kB]
Get:201 http://localhost:3142/debian unstable/main amd64 libparse-recdescent-perl all 1.967015+dfsg-4 [147 kB]
Get:202 http://localhost:3142/debian unstable/main amd64 libxml-xpath-perl all 1.48-1 [71.0 kB]
Get:203 http://localhost:3142/debian unstable/main amd64 libgraphviz-perl all 2.24-1 [92.7 kB]
Get:204 http://localhost:3142/debian unstable/main amd64 libhtml-tableextract-perl all 2.15-2 [30.6 kB]
Get:205 http://localhost:3142/debian unstable/main amd64 libhttp-daemon-perl all 6.16-1 [23.5 kB]
Get:206 http://localhost:3142/debian unstable/main amd64 libio-sessiondata-perl all 1.03-3 [6316 B]
Get:207 http://localhost:3142/debian unstable/main amd64 libio-stringy-perl all 2.111-3 [56.5 kB]
Get:208 http://localhost:3142/debian unstable/main amd64 libjcode-pm-perl amd64 2.06-1.1 [30.0 kB]
Get:209 http://localhost:3142/debian unstable/main amd64 liblist-moreutils-perl all 0.430-2 [46.9 kB]
Get:210 http://localhost:3142/debian unstable/main amd64 libnet-smtp-ssl-perl all 1.04-2 [6548 B]
Get:211 http://localhost:3142/debian unstable/main amd64 libmailtools-perl all 2.21-3 [88.6 kB]
Get:212 http://localhost:3142/debian unstable/main amd64 libmath-derivative-perl all 1.01-3 [8060 B]
Get:213 http://localhost:3142/debian unstable/main amd64 libmath-spline-perl all 0.02-4 [6808 B]
Get:214 http://localhost:3142/debian unstable/main amd64 libmime-tools-perl all 5.515-1 [203 kB]
Get:215 http://localhost:3142/debian unstable/main amd64 libmodule-build-perl all 0.423400-2 [252 kB]
Get:216 http://localhost:3142/debian unstable/main amd64 libole-storage-lite-perl all 0.22-1 [22.8 kB]
Get:217 http://localhost:3142/debian unstable/main amd64 libpath-class-perl all 0.37-4 [42.7 kB]
Get:218 http://localhost:3142/debian unstable/main amd64 libpostscript-perl all 0.06-3.1 [26.0 kB]
Get:219 http://localhost:3142/debian unstable/main amd64 libset-scalar-perl all 1.29-3 [32.1 kB]
Get:220 http://localhost:3142/debian unstable/main amd64 libtask-weaken-perl all 1.06-2 [9364 B]
Get:221 http://localhost:3142/debian unstable/main amd64 libsoap-lite-perl all 1.27-3 [239 kB]
Get:222 http://localhost:3142/debian unstable/main amd64 libsort-naturally-perl all 1.03-4 [13.1 kB]
Get:223 http://localhost:3142/debian unstable/main amd64 libspreadsheet-writeexcel-perl all 2.40-4 [503 kB]
Get:224 http://localhost:3142/debian unstable/main amd64 libspreadsheet-parseexcel-perl all 0.6600-1 [126 kB]
Get:225 http://localhost:3142/debian unstable/main amd64 libstatistics-descriptive-perl all 3.0801-1 [62.8 kB]
Get:226 http://localhost:3142/debian unstable/main amd64 libsub-uplevel-perl all 0.2800-3 [14.0 kB]
Get:227 http://localhost:3142/debian unstable/main amd64 libsvg-perl all 2.87-1 [64.3 kB]
Get:228 http://localhost:3142/debian unstable/main amd64 libtree-dagnode-perl all 1.32-1 [61.7 kB]
Get:229 http://localhost:3142/debian unstable/main amd64 libsvg-graph-perl all 0.02-4 [105 kB]
Get:230 http://localhost:3142/debian unstable/main amd64 libtest-deep-perl all 1.204-1 [52.9 kB]
Get:231 http://localhost:3142/debian unstable/main amd64 libtext-diff-perl all 1.45-2 [27.2 kB]
Get:232 http://localhost:3142/debian unstable/main amd64 libtest-differences-perl all 0.71-1 [17.9 kB]
Get:233 http://localhost:3142/debian unstable/main amd64 libtest-exception-perl all 0.43-3 [16.9 kB]
Get:234 http://localhost:3142/debian unstable/main amd64 libtest-memory-cycle-perl all 1.06-2 [11.4 kB]
Get:235 http://localhost:3142/debian unstable/main amd64 libtest-warn-perl all 0.37-2 [14.5 kB]
Get:236 http://localhost:3142/debian unstable/main amd64 libtest-most-perl all 0.38-1 [25.1 kB]
Get:237 http://localhost:3142/debian unstable/main amd64 libtest-pod-perl all 1.52-3 [12.6 kB]
Get:238 http://localhost:3142/debian unstable/main amd64 libtest-requiresinternet-perl all 0.05-4 [6864 B]
Get:239 http://localhost:3142/debian unstable/main amd64 libtest-weaken-perl all 3.022000-1.1 [35.6 kB]
Get:240 http://localhost:3142/debian unstable/main amd64 libxml-perl all 0.08-4 [93.0 kB]
Get:241 http://localhost:3142/debian unstable/main amd64 libxml-regexp-perl all 0.04-1.1 [7500 B]
Get:242 http://localhost:3142/debian unstable/main amd64 libxml-dom-perl all 1.46-2 [152 kB]
Get:243 http://localhost:3142/debian unstable/main amd64 libxml-xpathengine-perl all 0.14-2 [33.5 kB]
Get:244 http://localhost:3142/debian unstable/main amd64 libxml-dom-xpath-perl all 0.14-4 [9352 B]
Get:245 http://localhost:3142/debian unstable/main amd64 libxml-filter-buffertext-perl all 1.01-7 [7136 B]
Get:246 http://localhost:3142/debian unstable/main amd64 libxml-sax-writer-perl all 0.57-3 [19.6 kB]
Get:247 http://localhost:3142/debian unstable/main amd64 libxml-simple-perl all 2.25-2 [69.8 kB]
Get:248 http://localhost:3142/debian unstable/main amd64 libyaml-perl all 1.31-1 [64.8 kB]
Get:249 http://localhost:3142/debian unstable/main amd64 rename all 2.02-1 [21.8 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 51.2 MB in 2s (33.6 MB/s)
Selecting previously unselected package netbase.
(Reading database ... 21779 files and directories currently installed.)
Preparing to unpack .../000-netbase_6.4_all.deb ...
Unpacking netbase (6.4) ...
Selecting previously unselected package sensible-utils.
Preparing to unpack .../001-sensible-utils_0.0.22_all.deb ...
Unpacking sensible-utils (0.0.22) ...
Selecting previously unselected package openssl.
Preparing to unpack .../002-openssl_3.2.1-3_amd64.deb ...
Unpacking openssl (3.2.1-3) ...
Selecting previously unselected package ca-certificates.
Preparing to unpack .../003-ca-certificates_20240203_all.deb ...
Unpacking ca-certificates (20240203) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../004-libmagic-mgc_1%3a5.45-3_amd64.deb ...
Unpacking libmagic-mgc (1:5.45-3) ...
Selecting previously unselected package libmagic1t64:amd64.
Preparing to unpack .../005-libmagic1t64_1%3a5.45-3_amd64.deb ...
Unpacking libmagic1t64:amd64 (1:5.45-3) ...
Selecting previously unselected package file.
Preparing to unpack .../006-file_1%3a5.45-3_amd64.deb ...
Unpacking file (1:5.45-3) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../007-gettext-base_0.21-14+b1_amd64.deb ...
Unpacking gettext-base (0.21-14+b1) ...
Selecting previously unselected package libuchardet0:amd64.
Preparing to unpack .../008-libuchardet0_0.0.8-1+b1_amd64.deb ...
Unpacking libuchardet0:amd64 (0.0.8-1+b1) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../009-groff-base_1.23.0-4_amd64.deb ...
Unpacking groff-base (1.23.0-4) ...
Selecting previously unselected package bsdextrautils.
Preparing to unpack .../010-bsdextrautils_2.40.1-7_amd64.deb ...
Unpacking bsdextrautils (2.40.1-7) ...
Selecting previously unselected package libpipeline1:amd64.
Preparing to unpack .../011-libpipeline1_1.5.7-2_amd64.deb ...
Unpacking libpipeline1:amd64 (1.5.7-2) ...
Selecting previously unselected package man-db.
Preparing to unpack .../012-man-db_2.12.1-1_amd64.deb ...
Unpacking man-db (2.12.1-1) ...
Selecting previously unselected package ucf.
Preparing to unpack .../013-ucf_3.0043+nmu1_all.deb ...
Moving old data out of the way
Unpacking ucf (3.0043+nmu1) ...
Selecting previously unselected package m4.
Preparing to unpack .../014-m4_1.4.19-4_amd64.deb ...
Unpacking m4 (1.4.19-4) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../015-autoconf_2.71-3_all.deb ...
Unpacking autoconf (2.71-3) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../016-autotools-dev_20220109.1_all.deb ...
Unpacking autotools-dev (20220109.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../017-automake_1%3a1.16.5-1.3_all.deb ...
Unpacking automake (1:1.16.5-1.3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../018-autopoint_0.21-14_all.deb ...
Unpacking autopoint (0.21-14) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../019-libdebhelper-perl_13.15.3_all.deb ...
Unpacking libdebhelper-perl (13.15.3) ...
Selecting previously unselected package libtool.
Preparing to unpack .../020-libtool_2.4.7-7_all.deb ...
Unpacking libtool (2.4.7-7) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../021-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../022-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../023-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../024-dh-strip-nondeterminism_1.14.0-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.14.0-1) ...
Selecting previously unselected package libelf1t64:amd64.
Preparing to unpack .../025-libelf1t64_0.191-1+b1_amd64.deb ...
Unpacking libelf1t64:amd64 (0.191-1+b1) ...
Selecting previously unselected package dwz.
Preparing to unpack .../026-dwz_0.15-1+b1_amd64.deb ...
Unpacking dwz (0.15-1+b1) ...
Selecting previously unselected package libicu72:amd64.
Preparing to unpack .../027-libicu72_72.1-4+b1_amd64.deb ...
Unpacking libicu72:amd64 (72.1-4+b1) ...
Selecting previously unselected package libxml2:amd64.
Preparing to unpack .../028-libxml2_2.12.7+dfsg-2_amd64.deb ...
Unpacking libxml2:amd64 (2.12.7+dfsg-2) ...
Selecting previously unselected package gettext.
Preparing to unpack .../029-gettext_0.21-14+b1_amd64.deb ...
Unpacking gettext (0.21-14+b1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../030-intltool-debian_0.35.0+20060710.6_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.6) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../031-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../032-debhelper_13.15.3_all.deb ...
Unpacking debhelper (13.15.3) ...
Selecting previously unselected package libfakeroot:amd64.
Preparing to unpack .../033-libfakeroot_1.34-1_amd64.deb ...
Unpacking libfakeroot:amd64 (1.34-1) ...
Selecting previously unselected package fakeroot.
Preparing to unpack .../034-fakeroot_1.34-1_amd64.deb ...
Unpacking fakeroot (1.34-1) ...
Selecting previously unselected package libexpat1:amd64.
Preparing to unpack .../035-libexpat1_2.6.2-1_amd64.deb ...
Unpacking libexpat1:amd64 (2.6.2-1) ...
Selecting previously unselected package libbrotli1:amd64.
Preparing to unpack .../036-libbrotli1_1.1.0-2+b3_amd64.deb ...
Unpacking libbrotli1:amd64 (1.1.0-2+b3) ...
Selecting previously unselected package libpng16-16t64:amd64.
Preparing to unpack .../037-libpng16-16t64_1.6.43-5_amd64.deb ...
Unpacking libpng16-16t64:amd64 (1.6.43-5) ...
Selecting previously unselected package libfreetype6:amd64.
Preparing to unpack .../038-libfreetype6_2.13.2+dfsg-1+b4_amd64.deb ...
Unpacking libfreetype6:amd64 (2.13.2+dfsg-1+b4) ...
Selecting previously unselected package fonts-dejavu-mono.
Preparing to unpack .../039-fonts-dejavu-mono_2.37-8_all.deb ...
Unpacking fonts-dejavu-mono (2.37-8) ...
Selecting previously unselected package fonts-dejavu-core.
Preparing to unpack .../040-fonts-dejavu-core_2.37-8_all.deb ...
Unpacking fonts-dejavu-core (2.37-8) ...
Selecting previously unselected package fontconfig-config.
Preparing to unpack .../041-fontconfig-config_2.15.0-1.1_amd64.deb ...
Unpacking fontconfig-config (2.15.0-1.1) ...
Selecting previously unselected package libfontconfig1:amd64.
Preparing to unpack .../042-libfontconfig1_2.15.0-1.1_amd64.deb ...
Unpacking libfontconfig1:amd64 (2.15.0-1.1) ...
Selecting previously unselected package fontconfig.
Preparing to unpack .../043-fontconfig_2.15.0-1.1_amd64.deb ...
Unpacking fontconfig (2.15.0-1.1) ...
Selecting previously unselected package libann0.
Preparing to unpack .../044-libann0_1.1.2+doc-9+b1_amd64.deb ...
Unpacking libann0 (1.1.2+doc-9+b1) ...
Selecting previously unselected package libcdt5:amd64.
Preparing to unpack .../045-libcdt5_2.42.2-9+b2_amd64.deb ...
Unpacking libcdt5:amd64 (2.42.2-9+b2) ...
Selecting previously unselected package libcgraph6:amd64.
Preparing to unpack .../046-libcgraph6_2.42.2-9+b2_amd64.deb ...
Unpacking libcgraph6:amd64 (2.42.2-9+b2) ...
Selecting previously unselected package libaom3:amd64.
Preparing to unpack .../047-libaom3_3.8.2-2_amd64.deb ...
Unpacking libaom3:amd64 (3.8.2-2) ...
Selecting previously unselected package libdav1d7:amd64.
Preparing to unpack .../048-libdav1d7_1.4.2-1_amd64.deb ...
Unpacking libdav1d7:amd64 (1.4.2-1) ...
Selecting previously unselected package libabsl20230802:amd64.
Preparing to unpack .../049-libabsl20230802_20230802.1-4_amd64.deb ...
Unpacking libabsl20230802:amd64 (20230802.1-4) ...
Selecting previously unselected package libgav1-1:amd64.
Preparing to unpack .../050-libgav1-1_0.19.0-2+b1_amd64.deb ...
Unpacking libgav1-1:amd64 (0.19.0-2+b1) ...
Selecting previously unselected package librav1e0:amd64.
Preparing to unpack .../051-librav1e0_0.7.1-2_amd64.deb ...
Unpacking librav1e0:amd64 (0.7.1-2) ...
Selecting previously unselected package libsharpyuv0:amd64.
Preparing to unpack .../052-libsharpyuv0_1.4.0-0.1_amd64.deb ...
Unpacking libsharpyuv0:amd64 (1.4.0-0.1) ...
Selecting previously unselected package libsvtav1enc1d1:amd64.
Preparing to unpack .../053-libsvtav1enc1d1_1.7.0+dfsg-2+b1_amd64.deb ...
Unpacking libsvtav1enc1d1:amd64 (1.7.0+dfsg-2+b1) ...
Selecting previously unselected package libjpeg62-turbo:amd64.
Preparing to unpack .../054-libjpeg62-turbo_1%3a2.1.5-3_amd64.deb ...
Unpacking libjpeg62-turbo:amd64 (1:2.1.5-3) ...
Selecting previously unselected package libyuv0:amd64.
Preparing to unpack .../055-libyuv0_0.0.1888.20240509-4_amd64.deb ...
Unpacking libyuv0:amd64 (0.0.1888.20240509-4) ...
Selecting previously unselected package libavif16:amd64.
Preparing to unpack .../056-libavif16_1.0.4-3_amd64.deb ...
Unpacking libavif16:amd64 (1.0.4-3) ...
Selecting previously unselected package libheif-plugin-dav1d:amd64.
Preparing to unpack .../057-libheif-plugin-dav1d_1.17.6-1+b2_amd64.deb ...
Unpacking libheif-plugin-dav1d:amd64 (1.17.6-1+b2) ...
Selecting previously unselected package libde265-0:amd64.
Preparing to unpack .../058-libde265-0_1.0.15-1+b1_amd64.deb ...
Unpacking libde265-0:amd64 (1.0.15-1+b1) ...
Selecting previously unselected package libheif-plugin-libde265:amd64.
Preparing to unpack .../059-libheif-plugin-libde265_1.17.6-1+b2_amd64.deb ...
Unpacking libheif-plugin-libde265:amd64 (1.17.6-1+b2) ...
Selecting previously unselected package libheif1:amd64.
Preparing to unpack .../060-libheif1_1.17.6-1+b2_amd64.deb ...
Unpacking libheif1:amd64 (1.17.6-1+b2) ...
Selecting previously unselected package libdeflate0:amd64.
Preparing to unpack .../061-libdeflate0_1.20-1_amd64.deb ...
Unpacking libdeflate0:amd64 (1.20-1) ...
Selecting previously unselected package libjbig0:amd64.
Preparing to unpack .../062-libjbig0_2.1-6.1+b1_amd64.deb ...
Unpacking libjbig0:amd64 (2.1-6.1+b1) ...
Selecting previously unselected package liblerc4:amd64.
Preparing to unpack .../063-liblerc4_4.0.0+ds-4+b1_amd64.deb ...
Unpacking liblerc4:amd64 (4.0.0+ds-4+b1) ...
Selecting previously unselected package libwebp7:amd64.
Preparing to unpack .../064-libwebp7_1.4.0-0.1_amd64.deb ...
Unpacking libwebp7:amd64 (1.4.0-0.1) ...
Selecting previously unselected package libtiff6:amd64.
Preparing to unpack .../065-libtiff6_4.5.1+git230720-4_amd64.deb ...
Unpacking libtiff6:amd64 (4.5.1+git230720-4) ...
Selecting previously unselected package libxau6:amd64.
Preparing to unpack .../066-libxau6_1%3a1.0.9-1+b1_amd64.deb ...
Unpacking libxau6:amd64 (1:1.0.9-1+b1) ...
Selecting previously unselected package libbsd0:amd64.
Preparing to unpack .../067-libbsd0_0.12.2-1_amd64.deb ...
Unpacking libbsd0:amd64 (0.12.2-1) ...
Selecting previously unselected package libxdmcp6:amd64.
Preparing to unpack .../068-libxdmcp6_1%3a1.1.2-3+b1_amd64.deb ...
Unpacking libxdmcp6:amd64 (1:1.1.2-3+b1) ...
Selecting previously unselected package libxcb1:amd64.
Preparing to unpack .../069-libxcb1_1.17.0-2_amd64.deb ...
Unpacking libxcb1:amd64 (1.17.0-2) ...
Selecting previously unselected package libx11-data.
Preparing to unpack .../070-libx11-data_2%3a1.8.7-1_all.deb ...
Unpacking libx11-data (2:1.8.7-1) ...
Selecting previously unselected package libx11-6:amd64.
Preparing to unpack .../071-libx11-6_2%3a1.8.7-1+b1_amd64.deb ...
Unpacking libx11-6:amd64 (2:1.8.7-1+b1) ...
Selecting previously unselected package libxpm4:amd64.
Preparing to unpack .../072-libxpm4_1%3a3.5.17-1+b1_amd64.deb ...
Unpacking libxpm4:amd64 (1:3.5.17-1+b1) ...
Selecting previously unselected package libgd3:amd64.
Preparing to unpack .../073-libgd3_2.3.3-9+b3_amd64.deb ...
Unpacking libgd3:amd64 (2.3.3-9+b3) ...
Selecting previously unselected package libglib2.0-0t64:amd64.
Preparing to unpack .../074-libglib2.0-0t64_2.80.2-2_amd64.deb ...
Unpacking libglib2.0-0t64:amd64 (2.80.2-2) ...
Selecting previously unselected package libgts-0.7-5t64:amd64.
Preparing to unpack .../075-libgts-0.7-5t64_0.7.6+darcs121130-5.2_amd64.deb ...
Unpacking libgts-0.7-5t64:amd64 (0.7.6+darcs121130-5.2) ...
Selecting previously unselected package libpixman-1-0:amd64.
Preparing to unpack .../076-libpixman-1-0_0.42.2-1+b1_amd64.deb ...
Unpacking libpixman-1-0:amd64 (0.42.2-1+b1) ...
Selecting previously unselected package libxcb-render0:amd64.
Preparing to unpack .../077-libxcb-render0_1.17.0-2_amd64.deb ...
Unpacking libxcb-render0:amd64 (1.17.0-2) ...
Selecting previously unselected package libxcb-shm0:amd64.
Preparing to unpack .../078-libxcb-shm0_1.17.0-2_amd64.deb ...
Unpacking libxcb-shm0:amd64 (1.17.0-2) ...
Selecting previously unselected package libxext6:amd64.
Preparing to unpack .../079-libxext6_2%3a1.3.4-1+b1_amd64.deb ...
Unpacking libxext6:amd64 (2:1.3.4-1+b1) ...
Selecting previously unselected package libxrender1:amd64.
Preparing to unpack .../080-libxrender1_1%3a0.9.10-1.1+b1_amd64.deb ...
Unpacking libxrender1:amd64 (1:0.9.10-1.1+b1) ...
Selecting previously unselected package libcairo2:amd64.
Preparing to unpack .../081-libcairo2_1.18.0-3+b1_amd64.deb ...
Unpacking libcairo2:amd64 (1.18.0-3+b1) ...
Selecting previously unselected package libltdl7:amd64.
Preparing to unpack .../082-libltdl7_2.4.7-7+b1_amd64.deb ...
Unpacking libltdl7:amd64 (2.4.7-7+b1) ...
Selecting previously unselected package libfribidi0:amd64.
Preparing to unpack .../083-libfribidi0_1.0.13-3+b1_amd64.deb ...
Unpacking libfribidi0:amd64 (1.0.13-3+b1) ...
Selecting previously unselected package libgraphite2-3:amd64.
Preparing to unpack .../084-libgraphite2-3_1.3.14-2_amd64.deb ...
Unpacking libgraphite2-3:amd64 (1.3.14-2) ...
Selecting previously unselected package libharfbuzz0b:amd64.
Preparing to unpack .../085-libharfbuzz0b_8.3.0-2+b1_amd64.deb ...
Unpacking libharfbuzz0b:amd64 (8.3.0-2+b1) ...
Selecting previously unselected package libthai-data.
Preparing to unpack .../086-libthai-data_0.1.29-2_all.deb ...
Unpacking libthai-data (0.1.29-2) ...
Selecting previously unselected package libdatrie1:amd64.
Preparing to unpack .../087-libdatrie1_0.2.13-3_amd64.deb ...
Unpacking libdatrie1:amd64 (0.2.13-3) ...
Selecting previously unselected package libthai0:amd64.
Preparing to unpack .../088-libthai0_0.1.29-2_amd64.deb ...
Unpacking libthai0:amd64 (0.1.29-2) ...
Selecting previously unselected package libpango-1.0-0:amd64.
Preparing to unpack .../089-libpango-1.0-0_1.52.2+ds-1_amd64.deb ...
Unpacking libpango-1.0-0:amd64 (1.52.2+ds-1) ...
Selecting previously unselected package libpangoft2-1.0-0:amd64.
Preparing to unpack .../090-libpangoft2-1.0-0_1.52.2+ds-1_amd64.deb ...
Unpacking libpangoft2-1.0-0:amd64 (1.52.2+ds-1) ...
Selecting previously unselected package libpangocairo-1.0-0:amd64.
Preparing to unpack .../091-libpangocairo-1.0-0_1.52.2+ds-1_amd64.deb ...
Unpacking libpangocairo-1.0-0:amd64 (1.52.2+ds-1) ...
Selecting previously unselected package libpathplan4:amd64.
Preparing to unpack .../092-libpathplan4_2.42.2-9+b2_amd64.deb ...
Unpacking libpathplan4:amd64 (2.42.2-9+b2) ...
Selecting previously unselected package libgvc6.
Preparing to unpack .../093-libgvc6_2.42.2-9+b2_amd64.deb ...
Unpacking libgvc6 (2.42.2-9+b2) ...
Selecting previously unselected package libgvpr2:amd64.
Preparing to unpack .../094-libgvpr2_2.42.2-9+b2_amd64.deb ...
Unpacking libgvpr2:amd64 (2.42.2-9+b2) ...
Selecting previously unselected package liblab-gamut1:amd64.
Preparing to unpack .../095-liblab-gamut1_2.42.2-9+b2_amd64.deb ...
Unpacking liblab-gamut1:amd64 (2.42.2-9+b2) ...
Selecting previously unselected package x11-common.
Preparing to unpack .../096-x11-common_1%3a7.7+23_all.deb ...
Unpacking x11-common (1:7.7+23) ...
Selecting previously unselected package libice6:amd64.
Preparing to unpack .../097-libice6_2%3a1.0.10-1+b1_amd64.deb ...
Unpacking libice6:amd64 (2:1.0.10-1+b1) ...
Selecting previously unselected package libsm6:amd64.
Preparing to unpack .../098-libsm6_2%3a1.2.3-1+b1_amd64.deb ...
Unpacking libsm6:amd64 (2:1.2.3-1+b1) ...
Selecting previously unselected package libxt6t64:amd64.
Preparing to unpack .../099-libxt6t64_1%3a1.2.1-1.2_amd64.deb ...
Unpacking libxt6t64:amd64 (1:1.2.1-1.2) ...
Selecting previously unselected package libxmu6:amd64.
Preparing to unpack .../100-libxmu6_2%3a1.1.3-3+b2_amd64.deb ...
Unpacking libxmu6:amd64 (2:1.1.3-3+b2) ...
Selecting previously unselected package libxaw7:amd64.
Preparing to unpack .../101-libxaw7_2%3a1.0.14-1+b2_amd64.deb ...
Unpacking libxaw7:amd64 (2:1.0.14-1+b2) ...
Selecting previously unselected package graphviz.
Preparing to unpack .../102-graphviz_2.42.2-9+b2_amd64.deb ...
Unpacking graphviz (2.42.2-9+b2) ...
Selecting previously unselected package liberror-perl.
Preparing to unpack .../103-liberror-perl_0.17029-2_all.deb ...
Unpacking liberror-perl (0.17029-2) ...
Selecting previously unselected package libipc-sharelite-perl.
Preparing to unpack .../104-libipc-sharelite-perl_0.17-5+b3_amd64.deb ...
Unpacking libipc-sharelite-perl (0.17-5+b3) ...
Selecting previously unselected package libcache-cache-perl.
Preparing to unpack .../105-libcache-cache-perl_1.08-3_all.deb ...
Unpacking libcache-cache-perl (1.08-3) ...
Selecting previously unselected package libace-perl.
Preparing to unpack .../106-libace-perl_1.92-11+b5_amd64.deb ...
Unpacking libace-perl (1.92-11+b5) ...
Selecting previously unselected package libalgorithm-diff-perl.
Preparing to unpack .../107-libalgorithm-diff-perl_1.201-1_all.deb ...
Unpacking libalgorithm-diff-perl (1.201-1) ...
Selecting previously unselected package libalgorithm-munkres-perl.
Preparing to unpack .../108-libalgorithm-munkres-perl_0.08-5_all.deb ...
Unpacking libalgorithm-munkres-perl (0.08-5) ...
Selecting previously unselected package libclass-method-modifiers-perl.
Preparing to unpack .../109-libclass-method-modifiers-perl_2.15-1_all.deb ...
Unpacking libclass-method-modifiers-perl (2.15-1) ...
Selecting previously unselected package libclass-xsaccessor-perl.
Preparing to unpack .../110-libclass-xsaccessor-perl_1.19-4+b4_amd64.deb ...
Unpacking libclass-xsaccessor-perl (1.19-4+b4) ...
Selecting previously unselected package libb-hooks-op-check-perl:amd64.
Preparing to unpack .../111-libb-hooks-op-check-perl_0.22-3+b2_amd64.deb ...
Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b2) ...
Selecting previously unselected package libdynaloader-functions-perl.
Preparing to unpack .../112-libdynaloader-functions-perl_0.003-3_all.deb ...
Unpacking libdynaloader-functions-perl (0.003-3) ...
Selecting previously unselected package libdevel-callchecker-perl:amd64.
Preparing to unpack .../113-libdevel-callchecker-perl_0.009-1+b1_amd64.deb ...
Unpacking libdevel-callchecker-perl:amd64 (0.009-1+b1) ...
Selecting previously unselected package libparams-classify-perl:amd64.
Preparing to unpack .../114-libparams-classify-perl_0.015-2+b4_amd64.deb ...
Unpacking libparams-classify-perl:amd64 (0.015-2+b4) ...
Selecting previously unselected package libmodule-runtime-perl.
Preparing to unpack .../115-libmodule-runtime-perl_0.016-2_all.deb ...
Unpacking libmodule-runtime-perl (0.016-2) ...
Selecting previously unselected package libimport-into-perl.
Preparing to unpack .../116-libimport-into-perl_1.002005-2_all.deb ...
Unpacking libimport-into-perl (1.002005-2) ...
Selecting previously unselected package librole-tiny-perl.
Preparing to unpack .../117-librole-tiny-perl_2.002004-1_all.deb ...
Unpacking librole-tiny-perl (2.002004-1) ...
Selecting previously unselected package libsub-quote-perl.
Preparing to unpack .../118-libsub-quote-perl_2.006008-1_all.deb ...
Unpacking libsub-quote-perl (2.006008-1) ...
Selecting previously unselected package libmoo-perl.
Preparing to unpack .../119-libmoo-perl_2.005005-1_all.deb ...
Unpacking libmoo-perl (2.005005-1) ...
Selecting previously unselected package libexporter-tiny-perl.
Preparing to unpack .../120-libexporter-tiny-perl_1.006002-1_all.deb ...
Unpacking libexporter-tiny-perl (1.006002-1) ...
Selecting previously unselected package libtype-tiny-perl.
Preparing to unpack .../121-libtype-tiny-perl_2.004000-1_all.deb ...
Unpacking libtype-tiny-perl (2.004000-1) ...
Selecting previously unselected package libarray-compare-perl.
Preparing to unpack .../122-libarray-compare-perl_3.0.8-1_all.deb ...
Unpacking libarray-compare-perl (3.0.8-1) ...
Selecting previously unselected package libio-string-perl.
Preparing to unpack .../123-libio-string-perl_1.08-4_all.deb ...
Unpacking libio-string-perl (1.08-4) ...
Selecting previously unselected package libdata-stag-perl.
Preparing to unpack .../124-libdata-stag-perl_0.14-3_all.deb ...
Unpacking libdata-stag-perl (0.14-3) ...
Selecting previously unselected package libbio-perl-perl.
Preparing to unpack .../125-libbio-perl-perl_1.7.8-1_all.deb ...
Unpacking libbio-perl-perl (1.7.8-1) ...
Selecting previously unselected package liburi-perl.
Preparing to unpack .../126-liburi-perl_5.28-1_all.deb ...
Unpacking liburi-perl (5.28-1) ...
Selecting previously unselected package libencode-locale-perl.
Preparing to unpack .../127-libencode-locale-perl_1.05-3_all.deb ...
Unpacking libencode-locale-perl (1.05-3) ...
Selecting previously unselected package libtimedate-perl.
Preparing to unpack .../128-libtimedate-perl_2.3300-2_all.deb ...
Unpacking libtimedate-perl (2.3300-2) ...
Selecting previously unselected package libhttp-date-perl.
Preparing to unpack .../129-libhttp-date-perl_6.06-1_all.deb ...
Unpacking libhttp-date-perl (6.06-1) ...
Selecting previously unselected package libfile-listing-perl.
Preparing to unpack .../130-libfile-listing-perl_6.16-1_all.deb ...
Unpacking libfile-listing-perl (6.16-1) ...
Selecting previously unselected package libhtml-tagset-perl.
Preparing to unpack .../131-libhtml-tagset-perl_3.24-1_all.deb ...
Unpacking libhtml-tagset-perl (3.24-1) ...
Selecting previously unselected package libhtml-parser-perl:amd64.
Preparing to unpack .../132-libhtml-parser-perl_3.82-1+b1_amd64.deb ...
Unpacking libhtml-parser-perl:amd64 (3.82-1+b1) ...
Selecting previously unselected package libhtml-tree-perl.
Preparing to unpack .../133-libhtml-tree-perl_5.07-3_all.deb ...
Unpacking libhtml-tree-perl (5.07-3) ...
Selecting previously unselected package libclone-perl:amd64.
Preparing to unpack .../134-libclone-perl_0.46-1+b3_amd64.deb ...
Unpacking libclone-perl:amd64 (0.46-1+b3) ...
Selecting previously unselected package libio-html-perl.
Preparing to unpack .../135-libio-html-perl_1.004-3_all.deb ...
Unpacking libio-html-perl (1.004-3) ...
Selecting previously unselected package liblwp-mediatypes-perl.
Preparing to unpack .../136-liblwp-mediatypes-perl_6.04-2_all.deb ...
Unpacking liblwp-mediatypes-perl (6.04-2) ...
Selecting previously unselected package libhttp-message-perl.
Preparing to unpack .../137-libhttp-message-perl_6.46-1_all.deb ...
Unpacking libhttp-message-perl (6.46-1) ...
Selecting previously unselected package libhttp-cookies-perl.
Preparing to unpack .../138-libhttp-cookies-perl_6.11-1_all.deb ...
Unpacking libhttp-cookies-perl (6.11-1) ...
Selecting previously unselected package libhttp-negotiate-perl.
Preparing to unpack .../139-libhttp-negotiate-perl_6.01-2_all.deb ...
Unpacking libhttp-negotiate-perl (6.01-2) ...
Selecting previously unselected package perl-openssl-defaults:amd64.
Preparing to unpack .../140-perl-openssl-defaults_7+b2_amd64.deb ...
Unpacking perl-openssl-defaults:amd64 (7+b2) ...
Selecting previously unselected package libnet-ssleay-perl:amd64.
Preparing to unpack .../141-libnet-ssleay-perl_1.94-1+b2_amd64.deb ...
Unpacking libnet-ssleay-perl:amd64 (1.94-1+b2) ...
Selecting previously unselected package libio-socket-ssl-perl.
Preparing to unpack .../142-libio-socket-ssl-perl_2.085-1_all.deb ...
Unpacking libio-socket-ssl-perl (2.085-1) ...
Selecting previously unselected package libnet-http-perl.
Preparing to unpack .../143-libnet-http-perl_6.23-1_all.deb ...
Unpacking libnet-http-perl (6.23-1) ...
Selecting previously unselected package liblwp-protocol-https-perl.
Preparing to unpack .../144-liblwp-protocol-https-perl_6.14-1_all.deb ...
Unpacking liblwp-protocol-https-perl (6.14-1) ...
Selecting previously unselected package libtry-tiny-perl.
Preparing to unpack .../145-libtry-tiny-perl_0.31-2_all.deb ...
Unpacking libtry-tiny-perl (0.31-2) ...
Selecting previously unselected package libwww-robotrules-perl.
Preparing to unpack .../146-libwww-robotrules-perl_6.02-1_all.deb ...
Unpacking libwww-robotrules-perl (6.02-1) ...
Selecting previously unselected package libwww-perl.
Preparing to unpack .../147-libwww-perl_6.77-1_all.deb ...
Unpacking libwww-perl (6.77-1) ...
Selecting previously unselected package libxml-parser-perl.
Preparing to unpack .../148-libxml-parser-perl_2.47-1+b3_amd64.deb ...
Unpacking libxml-parser-perl (2.47-1+b3) ...
Selecting previously unselected package libxml-twig-perl.
Preparing to unpack .../149-libxml-twig-perl_1%3a3.52-3_all.deb ...
Unpacking libxml-twig-perl (1:3.52-3) ...
Selecting previously unselected package libxml-writer-perl.
Preparing to unpack .../150-libxml-writer-perl_0.900-2_all.deb ...
Unpacking libxml-writer-perl (0.900-2) ...
Selecting previously unselected package libbio-variation-perl.
Preparing to unpack .../151-libbio-variation-perl_1.7.5-3_all.deb ...
Unpacking libbio-variation-perl (1.7.5-3) ...
Selecting previously unselected package libxml-namespacesupport-perl.
Preparing to unpack .../152-libxml-namespacesupport-perl_1.12-2_all.deb ...
Unpacking libxml-namespacesupport-perl (1.12-2) ...
Selecting previously unselected package libxml-sax-base-perl.
Preparing to unpack .../153-libxml-sax-base-perl_1.09-3_all.deb ...
Unpacking libxml-sax-base-perl (1.09-3) ...
Selecting previously unselected package libxml-sax-perl.
Preparing to unpack .../154-libxml-sax-perl_1.02+dfsg-3_all.deb ...
Unpacking libxml-sax-perl (1.02+dfsg-3) ...
Selecting previously unselected package libbio-cluster-perl.
Preparing to unpack .../155-libbio-cluster-perl_1.7.3-6_all.deb ...
Unpacking libbio-cluster-perl (1.7.3-6) ...
Selecting previously unselected package libbio-asn1-entrezgene-perl.
Preparing to unpack .../156-libbio-asn1-entrezgene-perl_1.730-3_all.deb ...
Unpacking libbio-asn1-entrezgene-perl (1.730-3) ...
Selecting previously unselected package libbio-samtools-perl.
Preparing to unpack .../157-libbio-samtools-perl_1.43-5+b1_amd64.deb ...
Unpacking libbio-samtools-perl (1.43-5+b1) ...
Selecting previously unselected package libcapture-tiny-perl.
Preparing to unpack .../158-libcapture-tiny-perl_0.48-2_all.deb ...
Unpacking libcapture-tiny-perl (0.48-2) ...
Selecting previously unselected package libcgi-pm-perl.
Preparing to unpack .../159-libcgi-pm-perl_4.64-1_all.deb ...
Unpacking libcgi-pm-perl (4.64-1) ...
Selecting previously unselected package libclass-data-inheritable-perl.
Preparing to unpack .../160-libclass-data-inheritable-perl_0.08-3_all.deb ...
Unpacking libclass-data-inheritable-perl (0.08-3) ...
Selecting previously unselected package libclass-inspector-perl.
Preparing to unpack .../161-libclass-inspector-perl_1.36-3_all.deb ...
Unpacking libclass-inspector-perl (1.36-3) ...
Selecting previously unselected package libclass-unload-perl.
Preparing to unpack .../162-libclass-unload-perl_0.11-3_all.deb ...
Unpacking libclass-unload-perl (0.11-3) ...
Selecting previously unselected package libcom-err2:amd64.
Preparing to unpack .../163-libcom-err2_1.47.1-1_amd64.deb ...
Unpacking libcom-err2:amd64 (1.47.1-1) ...
Selecting previously unselected package libconvert-binary-c-perl.
Preparing to unpack .../164-libconvert-binary-c-perl_0.84-1+b5_amd64.deb ...
Unpacking libconvert-binary-c-perl (0.84-1+b5) ...
Selecting previously unselected package libconvert-binhex-perl.
Preparing to unpack .../165-libconvert-binhex-perl_1.125-3_all.deb ...
Unpacking libconvert-binhex-perl (1.125-3) ...
Selecting previously unselected package libcrypt-rc4-perl.
Preparing to unpack .../166-libcrypt-rc4-perl_2.02-5_all.deb ...
Unpacking libcrypt-rc4-perl (2.02-5) ...
Selecting previously unselected package libdbi-perl:amd64.
Preparing to unpack .../167-libdbi-perl_1.643-4+b3_amd64.deb ...
Unpacking libdbi-perl:amd64 (1.643-4+b3) ...
Selecting previously unselected package mysql-common.
Preparing to unpack .../168-mysql-common_5.8+1.1.0_all.deb ...
Unpacking mysql-common (5.8+1.1.0) ...
Selecting previously unselected package mariadb-common.
Preparing to unpack .../169-mariadb-common_1%3a10.11.8-1_all.deb ...
Unpacking mariadb-common (1:10.11.8-1) ...
Selecting previously unselected package libmariadb3:amd64.
Preparing to unpack .../170-libmariadb3_1%3a10.11.8-1_amd64.deb ...
Unpacking libmariadb3:amd64 (1:10.11.8-1) ...
Selecting previously unselected package libdbd-mysql-perl:amd64.
Preparing to unpack .../171-libdbd-mysql-perl_4.052-1+b3_amd64.deb ...
Unpacking libdbd-mysql-perl:amd64 (4.052-1+b3) ...
Selecting previously unselected package libkrb5support0:amd64.
Preparing to unpack .../172-libkrb5support0_1.20.1-6+b1_amd64.deb ...
Unpacking libkrb5support0:amd64 (1.20.1-6+b1) ...
Selecting previously unselected package libk5crypto3:amd64.
Preparing to unpack .../173-libk5crypto3_1.20.1-6+b1_amd64.deb ...
Unpacking libk5crypto3:amd64 (1.20.1-6+b1) ...
Selecting previously unselected package libkeyutils1:amd64.
Preparing to unpack .../174-libkeyutils1_1.6.3-3_amd64.deb ...
Unpacking libkeyutils1:amd64 (1.6.3-3) ...
Selecting previously unselected package libkrb5-3:amd64.
Preparing to unpack .../175-libkrb5-3_1.20.1-6+b1_amd64.deb ...
Unpacking libkrb5-3:amd64 (1.20.1-6+b1) ...
Selecting previously unselected package libgssapi-krb5-2:amd64.
Preparing to unpack .../176-libgssapi-krb5-2_1.20.1-6+b1_amd64.deb ...
Unpacking libgssapi-krb5-2:amd64 (1.20.1-6+b1) ...
Selecting previously unselected package libpq5:amd64.
Preparing to unpack .../177-libpq5_16.3-1+b1_amd64.deb ...
Unpacking libpq5:amd64 (16.3-1+b1) ...
Selecting previously unselected package libdbd-pg-perl.
Preparing to unpack .../178-libdbd-pg-perl_3.18.0-1+b3_amd64.deb ...
Unpacking libdbd-pg-perl (3.18.0-1+b3) ...
Selecting previously unselected package libdbd-sqlite3-perl:amd64.
Preparing to unpack .../179-libdbd-sqlite3-perl_1.74-1+b3_amd64.deb ...
Unpacking libdbd-sqlite3-perl:amd64 (1.74-1+b3) ...
Selecting previously unselected package libdevel-cycle-perl.
Preparing to unpack .../180-libdevel-cycle-perl_1.12-2_all.deb ...
Unpacking libdevel-cycle-perl (1.12-2) ...
Selecting previously unselected package libdevel-stacktrace-perl.
Preparing to unpack .../181-libdevel-stacktrace-perl_2.0500-1_all.deb ...
Unpacking libdevel-stacktrace-perl (2.0500-1) ...
Selecting previously unselected package libdigest-perl-md5-perl.
Preparing to unpack .../182-libdigest-perl-md5-perl_1.9-5_all.deb ...
Unpacking libdigest-perl-md5-perl (1.9-5) ...
Selecting previously unselected package libexception-class-perl.
Preparing to unpack .../183-libexception-class-perl_1.45-1_all.deb ...
Unpacking libexception-class-perl (1.45-1) ...
Selecting previously unselected package libfcgi0t64:amd64.
Preparing to unpack .../184-libfcgi0t64_2.4.2-2.1_amd64.deb ...
Unpacking libfcgi0t64:amd64 (2.4.2-2.1) ...
Selecting previously unselected package libfcgi-perl.
Preparing to unpack .../185-libfcgi-perl_0.82+ds-3+b2_amd64.deb ...
Unpacking libfcgi-perl (0.82+ds-3+b2) ...
Selecting previously unselected package libfile-slurp-tiny-perl.
Preparing to unpack .../186-libfile-slurp-tiny-perl_0.004-2_all.deb ...
Unpacking libfile-slurp-tiny-perl (0.004-2) ...
Selecting previously unselected package libgd-perl.
Preparing to unpack .../187-libgd-perl_2.78-1+b3_amd64.deb ...
Unpacking libgd-perl (2.78-1+b3) ...
Selecting previously unselected package libheap-perl.
Preparing to unpack .../188-libheap-perl_0.80-5_all.deb ...
Unpacking libheap-perl (0.80-5) ...
Selecting previously unselected package libset-object-perl.
Preparing to unpack .../189-libset-object-perl_1.42-1+b5_amd64.deb ...
Unpacking libset-object-perl (1.42-1+b5) ...
Selecting previously unselected package libgraph-perl.
Preparing to unpack .../190-libgraph-perl_1%3a0.9727-1_all.deb ...
Unpacking libgraph-perl (1:0.9727-1) ...
Selecting previously unselected package libio-pty-perl.
Preparing to unpack .../191-libio-pty-perl_1.20-1+b2_amd64.deb ...
Unpacking libio-pty-perl (1:1.20-1+b2) ...
Selecting previously unselected package libipc-run-perl.
Preparing to unpack .../192-libipc-run-perl_20231003.0-2_all.deb ...
Unpacking libipc-run-perl (20231003.0-2) ...
Selecting previously unselected package libparse-recdescent-perl.
Preparing to unpack .../193-libparse-recdescent-perl_1.967015+dfsg-4_all.deb ...
Unpacking libparse-recdescent-perl (1.967015+dfsg-4) ...
Selecting previously unselected package libxml-xpath-perl.
Preparing to unpack .../194-libxml-xpath-perl_1.48-1_all.deb ...
Unpacking libxml-xpath-perl (1.48-1) ...
Selecting previously unselected package libgraphviz-perl.
Preparing to unpack .../195-libgraphviz-perl_2.24-1_all.deb ...
Unpacking libgraphviz-perl (2.24-1) ...
Selecting previously unselected package libhtml-tableextract-perl.
Preparing to unpack .../196-libhtml-tableextract-perl_2.15-2_all.deb ...
Unpacking libhtml-tableextract-perl (2.15-2) ...
Selecting previously unselected package libhttp-daemon-perl.
Preparing to unpack .../197-libhttp-daemon-perl_6.16-1_all.deb ...
Unpacking libhttp-daemon-perl (6.16-1) ...
Selecting previously unselected package libio-sessiondata-perl.
Preparing to unpack .../198-libio-sessiondata-perl_1.03-3_all.deb ...
Unpacking libio-sessiondata-perl (1.03-3) ...
Selecting previously unselected package libio-stringy-perl.
Preparing to unpack .../199-libio-stringy-perl_2.111-3_all.deb ...
Unpacking libio-stringy-perl (2.111-3) ...
Selecting previously unselected package libjcode-pm-perl.
Preparing to unpack .../200-libjcode-pm-perl_2.06-1.1_amd64.deb ...
Unpacking libjcode-pm-perl (2.06-1.1) ...
Selecting previously unselected package liblist-moreutils-xs-perl.
Preparing to unpack .../201-liblist-moreutils-xs-perl_0.430-4+b2_amd64.deb ...
Unpacking liblist-moreutils-xs-perl (0.430-4+b2) ...
Selecting previously unselected package liblist-moreutils-perl.
Preparing to unpack .../202-liblist-moreutils-perl_0.430-2_all.deb ...
Unpacking liblist-moreutils-perl (0.430-2) ...
Selecting previously unselected package libnet-smtp-ssl-perl.
Preparing to unpack .../203-libnet-smtp-ssl-perl_1.04-2_all.deb ...
Unpacking libnet-smtp-ssl-perl (1.04-2) ...
Selecting previously unselected package libmailtools-perl.
Preparing to unpack .../204-libmailtools-perl_2.21-3_all.deb ...
Unpacking libmailtools-perl (2.21-3) ...
Selecting previously unselected package libmath-derivative-perl.
Preparing to unpack .../205-libmath-derivative-perl_1.01-3_all.deb ...
Unpacking libmath-derivative-perl (1.01-3) ...
Selecting previously unselected package libmath-spline-perl.
Preparing to unpack .../206-libmath-spline-perl_0.02-4_all.deb ...
Unpacking libmath-spline-perl (0.02-4) ...
Selecting previously unselected package libmime-tools-perl.
Preparing to unpack .../207-libmime-tools-perl_5.515-1_all.deb ...
Unpacking libmime-tools-perl (5.515-1) ...
Selecting previously unselected package libmodule-build-perl.
Preparing to unpack .../208-libmodule-build-perl_0.423400-2_all.deb ...
Adding 'diversion of /usr/bin/config_data to /usr/bin/config_data.diverted by libmodule-build-perl'
Adding 'diversion of /usr/share/man/man1/config_data.1.gz to /usr/share/man/man1/config_data.diverted.1.gz by libmodule-build-perl'
Unpacking libmodule-build-perl (0.423400-2) ...
Selecting previously unselected package libole-storage-lite-perl.
Preparing to unpack .../209-libole-storage-lite-perl_0.22-1_all.deb ...
Unpacking libole-storage-lite-perl (0.22-1) ...
Selecting previously unselected package libpadwalker-perl.
Preparing to unpack .../210-libpadwalker-perl_2.5-1+b6_amd64.deb ...
Unpacking libpadwalker-perl (2.5-1+b6) ...
Selecting previously unselected package libpath-class-perl.
Preparing to unpack .../211-libpath-class-perl_0.37-4_all.deb ...
Unpacking libpath-class-perl (0.37-4) ...
Selecting previously unselected package libperlio-eol-perl.
Preparing to unpack .../212-libperlio-eol-perl_0.19-1+b3_amd64.deb ...
Unpacking libperlio-eol-perl (0.19-1+b3) ...
Selecting previously unselected package libpostscript-perl.
Preparing to unpack .../213-libpostscript-perl_0.06-3.1_all.deb ...
Unpacking libpostscript-perl (0.06-3.1) ...
Selecting previously unselected package libset-scalar-perl.
Preparing to unpack .../214-libset-scalar-perl_1.29-3_all.deb ...
Unpacking libset-scalar-perl (1.29-3) ...
Selecting previously unselected package libtask-weaken-perl.
Preparing to unpack .../215-libtask-weaken-perl_1.06-2_all.deb ...
Unpacking libtask-weaken-perl (1.06-2) ...
Selecting previously unselected package libsoap-lite-perl.
Preparing to unpack .../216-libsoap-lite-perl_1.27-3_all.deb ...
Unpacking libsoap-lite-perl (1.27-3) ...
Selecting previously unselected package libsort-naturally-perl.
Preparing to unpack .../217-libsort-naturally-perl_1.03-4_all.deb ...
Unpacking libsort-naturally-perl (1.03-4) ...
Selecting previously unselected package libspreadsheet-writeexcel-perl.
Preparing to unpack .../218-libspreadsheet-writeexcel-perl_2.40-4_all.deb ...
Unpacking libspreadsheet-writeexcel-perl (2.40-4) ...
Selecting previously unselected package libunicode-map-perl.
Preparing to unpack .../219-libunicode-map-perl_0.112-13+b4_amd64.deb ...
Unpacking libunicode-map-perl (0.112-13+b4) ...
Selecting previously unselected package libspreadsheet-parseexcel-perl.
Preparing to unpack .../220-libspreadsheet-parseexcel-perl_0.6600-1_all.deb ...
Unpacking libspreadsheet-parseexcel-perl (0.6600-1) ...
Selecting previously unselected package libstatistics-descriptive-perl.
Preparing to unpack .../221-libstatistics-descriptive-perl_3.0801-1_all.deb ...
Unpacking libstatistics-descriptive-perl (3.0801-1) ...
Selecting previously unselected package libsub-uplevel-perl.
Preparing to unpack .../222-libsub-uplevel-perl_0.2800-3_all.deb ...
Unpacking libsub-uplevel-perl (0.2800-3) ...
Selecting previously unselected package libsvg-perl.
Preparing to unpack .../223-libsvg-perl_2.87-1_all.deb ...
Unpacking libsvg-perl (2.87-1) ...
Selecting previously unselected package libtree-dagnode-perl.
Preparing to unpack .../224-libtree-dagnode-perl_1.32-1_all.deb ...
Unpacking libtree-dagnode-perl (1.32-1) ...
Selecting previously unselected package libsvg-graph-perl.
Preparing to unpack .../225-libsvg-graph-perl_0.02-4_all.deb ...
Unpacking libsvg-graph-perl (0.02-4) ...
Selecting previously unselected package libtest-deep-perl.
Preparing to unpack .../226-libtest-deep-perl_1.204-1_all.deb ...
Unpacking libtest-deep-perl (1.204-1) ...
Selecting previously unselected package libtext-diff-perl.
Preparing to unpack .../227-libtext-diff-perl_1.45-2_all.deb ...
Unpacking libtext-diff-perl (1.45-2) ...
Selecting previously unselected package libtest-differences-perl.
Preparing to unpack .../228-libtest-differences-perl_0.71-1_all.deb ...
Unpacking libtest-differences-perl (0.71-1) ...
Selecting previously unselected package libtest-exception-perl.
Preparing to unpack .../229-libtest-exception-perl_0.43-3_all.deb ...
Unpacking libtest-exception-perl (0.43-3) ...
Selecting previously unselected package libtest-memory-cycle-perl.
Preparing to unpack .../230-libtest-memory-cycle-perl_1.06-2_all.deb ...
Unpacking libtest-memory-cycle-perl (1.06-2) ...
Selecting previously unselected package libtest-warn-perl.
Preparing to unpack .../231-libtest-warn-perl_0.37-2_all.deb ...
Unpacking libtest-warn-perl (0.37-2) ...
Selecting previously unselected package libtest-most-perl.
Preparing to unpack .../232-libtest-most-perl_0.38-1_all.deb ...
Unpacking libtest-most-perl (0.38-1) ...
Selecting previously unselected package libtest-pod-perl.
Preparing to unpack .../233-libtest-pod-perl_1.52-3_all.deb ...
Unpacking libtest-pod-perl (1.52-3) ...
Selecting previously unselected package libtest-requiresinternet-perl.
Preparing to unpack .../234-libtest-requiresinternet-perl_0.05-4_all.deb ...
Unpacking libtest-requiresinternet-perl (0.05-4) ...
Selecting previously unselected package libtest-weaken-perl.
Preparing to unpack .../235-libtest-weaken-perl_3.022000-1.1_all.deb ...
Unpacking libtest-weaken-perl (3.022000-1.1) ...
Selecting previously unselected package libxml-perl.
Preparing to unpack .../236-libxml-perl_0.08-4_all.deb ...
Unpacking libxml-perl (0.08-4) ...
Selecting previously unselected package libxml-regexp-perl.
Preparing to unpack .../237-libxml-regexp-perl_0.04-1.1_all.deb ...
Unpacking libxml-regexp-perl (0.04-1.1) ...
Selecting previously unselected package libxml-dom-perl.
Preparing to unpack .../238-libxml-dom-perl_1.46-2_all.deb ...
Unpacking libxml-dom-perl (1.46-2) ...
Selecting previously unselected package libxml-xpathengine-perl.
Preparing to unpack .../239-libxml-xpathengine-perl_0.14-2_all.deb ...
Unpacking libxml-xpathengine-perl (0.14-2) ...
Selecting previously unselected package libxml-dom-xpath-perl.
Preparing to unpack .../240-libxml-dom-xpath-perl_0.14-4_all.deb ...
Unpacking libxml-dom-xpath-perl (0.14-4) ...
Selecting previously unselected package libxml-filter-buffertext-perl.
Preparing to unpack .../241-libxml-filter-buffertext-perl_1.01-7_all.deb ...
Unpacking libxml-filter-buffertext-perl (1.01-7) ...
Selecting previously unselected package libxml-libxml-perl.
Preparing to unpack .../242-libxml-libxml-perl_2.0207+dfsg+really+2.0134-3+b1_amd64.deb ...
Unpacking libxml-libxml-perl (2.0207+dfsg+really+2.0134-3+b1) ...
Selecting previously unselected package libxml-sax-expatxs-perl.
Preparing to unpack .../243-libxml-sax-expatxs-perl_1.33-3+b4_amd64.deb ...
Unpacking libxml-sax-expatxs-perl (1.33-3+b4) ...
Selecting previously unselected package libxml-sax-writer-perl.
Preparing to unpack .../244-libxml-sax-writer-perl_0.57-3_all.deb ...
Unpacking libxml-sax-writer-perl (0.57-3) ...
Selecting previously unselected package libxml-simple-perl.
Preparing to unpack .../245-libxml-simple-perl_2.25-2_all.deb ...
Unpacking libxml-simple-perl (2.25-2) ...
Selecting previously unselected package libyaml-perl.
Preparing to unpack .../246-libyaml-perl_1.31-1_all.deb ...
Unpacking libyaml-perl (1.31-1) ...
Selecting previously unselected package rename.
Preparing to unpack .../247-rename_2.02-1_all.deb ...
Unpacking rename (2.02-1) ...
Selecting previously unselected package sbuild-build-depends-main-dummy.
Preparing to unpack .../248-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ...
Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ...
Setting up libexpat1:amd64 (2.6.2-1) ...
Setting up libjcode-pm-perl (2.06-1.1) ...
Setting up libpipeline1:amd64 (1.5.7-2) ...
Setting up libio-sessiondata-perl (1.03-3) ...
Setting up libgraphite2-3:amd64 (1.3.14-2) ...
Setting up libpixman-1-0:amd64 (0.42.2-1+b1) ...
Setting up libperlio-eol-perl (0.19-1+b3) ...
Setting up libsharpyuv0:amd64 (1.4.0-0.1) ...
Setting up libdevel-cycle-perl (1.12-2) ...
Setting up libaom3:amd64 (3.8.2-2) ...
Setting up mysql-common (5.8+1.1.0) ...
update-alternatives: using /etc/mysql/my.cnf.fallback to provide /etc/mysql/my.cnf (my.cnf) in auto mode
Setting up libxau6:amd64 (1:1.0.9-1+b1) ...
Setting up libkeyutils1:amd64 (1.6.3-3) ...
Setting up libtask-weaken-perl (1.06-2) ...
Setting up libicu72:amd64 (72.1-4+b1) ...
Setting up liblerc4:amd64 (4.0.0+ds-4+b1) ...
Setting up bsdextrautils (2.40.1-7) ...
Setting up libconvert-binary-c-perl (0.84-1+b5) ...
Setting up libclass-inspector-perl (1.36-3) ...
Setting up libdynaloader-functions-perl (0.003-3) ...
Setting up libdatrie1:amd64 (0.2.13-3) ...
Setting up libtest-deep-perl (1.204-1) ...
Setting up libclass-method-modifiers-perl (2.15-1) ...
Setting up libxml-regexp-perl (0.04-1.1) ...
Setting up libalgorithm-munkres-perl (0.08-5) ...
Setting up libio-pty-perl (1:1.20-1+b2) ...
Setting up libmagic-mgc (1:5.45-3) ...
Setting up libpath-class-perl (0.37-4) ...
Setting up libclone-perl:amd64 (0.46-1+b3) ...
Setting up libalgorithm-diff-perl (1.201-1) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up libfcgi0t64:amd64 (2.4.2-2.1) ...
Setting up libio-stringy-perl (2.111-3) ...
Setting up libhtml-tagset-perl (3.24-1) ...
Setting up libdebhelper-perl (13.15.3) ...
Setting up libbrotli1:amd64 (1.1.0-2+b3) ...
Setting up libfile-slurp-tiny-perl (0.004-2) ...
Setting up libipc-sharelite-perl (0.17-5+b3) ...
Setting up libconvert-binhex-perl (1.125-3) ...
Setting up libheap-perl (0.80-5) ...
Setting up liblwp-mediatypes-perl (6.04-2) ...
Setting up liblab-gamut1:amd64 (2.42.2-9+b2) ...
Setting up libmagic1t64:amd64 (1:5.45-3) ...
Setting up libtest-weaken-perl (3.022000-1.1) ...
Setting up libclass-unload-perl (0.11-3) ...
Setting up x11-common (1:7.7+23) ...
invoke-rc.d: could not determine current runlevel
invoke-rc.d: WARNING: No init system and policy-rc.d missing! Defaulting to block.
Setting up libtest-pod-perl (1.52-3) ...
Setting up libtry-tiny-perl (0.31-2) ...
Setting up libdeflate0:amd64 (1.20-1) ...
Setting up perl-openssl-defaults:amd64 (7+b2) ...
Setting up libxml-namespacesupport-perl (1.12-2) ...
Setting up libsvg-perl (2.87-1) ...
Setting up gettext-base (0.21-14+b1) ...
Setting up m4 (1.4.19-4) ...
Setting up libpadwalker-perl (2.5-1+b6) ...
Setting up libencode-locale-perl (1.05-3) ...
Setting up rename (2.02-1) ...
update-alternatives: using /usr/bin/file-rename to provide /usr/bin/rename (rename) in auto mode
Setting up libsvtav1enc1d1:amd64 (1.7.0+dfsg-2+b1) ...
Setting up libcom-err2:amd64 (1.47.1-1) ...
Setting up file (1:5.45-3) ...
Setting up libyaml-perl (1.31-1) ...
Setting up libjbig0:amd64 (2.1-6.1+b1) ...
Setting up librav1e0:amd64 (0.7.1-2) ...
Setting up libfakeroot:amd64 (1.34-1) ...
Setting up libelf1t64:amd64 (0.191-1+b1) ...
Setting up libmodule-build-perl (0.423400-2) ...
Setting up libkrb5support0:amd64 (1.20.1-6+b1) ...
Setting up fakeroot (1.34-1) ...
update-alternatives: using /usr/bin/fakeroot-sysv to provide /usr/bin/fakeroot (fakeroot) in auto mode
Setting up liberror-perl (0.17029-2) ...
Setting up mariadb-common (1:10.11.8-1) ...
update-alternatives: using /etc/mysql/mariadb.cnf to provide /etc/mysql/my.cnf (my.cnf) in auto mode
Setting up libdigest-perl-md5-perl (1.9-5) ...
Setting up libxml-sax-base-perl (1.09-3) ...
Setting up libio-string-perl (1.08-4) ...
Setting up libunicode-map-perl (0.112-13+b4) ...
Setting up libtest-memory-cycle-perl (1.06-2) ...
Setting up autotools-dev (20220109.1) ...
Setting up libglib2.0-0t64:amd64 (2.80.2-2) ...
No schema files found: doing nothing.
Setting up libclass-data-inheritable-perl (0.08-3) ...
Setting up libset-object-perl (1.42-1+b5) ...
Setting up libjpeg62-turbo:amd64 (1:2.1.5-3) ...
Setting up libx11-data (2:1.8.7-1) ...
Setting up libtext-diff-perl (1.45-2) ...
Setting up libxml-xpathengine-perl (0.14-2) ...
Setting up libpathplan4:amd64 (2.42.2-9+b2) ...
Setting up libxml-writer-perl (0.900-2) ...
Setting up libann0 (1.1.2+doc-9+b1) ...
Setting up libfribidi0:amd64 (1.0.13-3+b1) ...
Setting up libcrypt-rc4-perl (2.02-5) ...
Setting up fonts-dejavu-mono (2.37-8) ...
Setting up libpng16-16t64:amd64 (1.6.43-5) ...
Setting up libio-html-perl (1.004-3) ...
Setting up autopoint (0.21-14) ...
Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b2) ...
Setting up libmariadb3:amd64 (1:10.11.8-1) ...
Setting up fonts-dejavu-core (2.37-8) ...
Setting up libipc-run-perl (20231003.0-2) ...
Setting up liblist-moreutils-xs-perl (0.430-4+b2) ...
Setting up libmath-derivative-perl (1.01-3) ...
Setting up libk5crypto3:amd64 (1.20.1-6+b1) ...
Setting up libltdl7:amd64 (2.4.7-7+b1) ...
Setting up autoconf (2.71-3) ...
Setting up libwebp7:amd64 (1.4.0-0.1) ...
Setting up libcapture-tiny-perl (0.48-2) ...
Setting up libtimedate-perl (2.3300-2) ...
Setting up libset-scalar-perl (1.29-3) ...
Setting up libole-storage-lite-perl (0.22-1) ...
Setting up libtree-dagnode-perl (1.32-1) ...
Setting up dwz (0.15-1+b1) ...
Setting up libdata-stag-perl (0.14-3) ...
Setting up libparse-recdescent-perl (1.967015+dfsg-4) ...
Setting up libdav1d7:amd64 (1.4.2-1) ...
Setting up sensible-utils (0.0.22) ...
Setting up libtiff6:amd64 (4.5.1+git230720-4) ...
Setting up libuchardet0:amd64 (0.0.8-1+b1) ...
Setting up librole-tiny-perl (2.002004-1) ...
Setting up libfcgi-perl (0.82+ds-3+b2) ...
Setting up libsub-uplevel-perl (0.2800-3) ...
Setting up libthai-data (0.1.29-2) ...
Setting up netbase (6.4) ...

Configuration file '/etc/protocols'
 ==> File on system created by you or by a script.
 ==> File also in package provided by package maintainer.
 ==> Using current old file as you requested.

Configuration file '/etc/services'
 ==> File on system created by you or by a script.
 ==> File also in package provided by package maintainer.
 ==> Using current old file as you requested.
Setting up libabsl20230802:amd64 (20230802.1-4) ...
Setting up libgts-0.7-5t64:amd64 (0.7.6+darcs121130-5.2) ...
Setting up libsub-quote-perl (2.006008-1) ...
Setting up libdevel-stacktrace-perl (2.0500-1) ...
Setting up libclass-xsaccessor-perl (1.19-4+b4) ...
Setting up libcdt5:amd64 (2.42.2-9+b2) ...
Setting up libkrb5-3:amd64 (1.20.1-6+b1) ...
Setting up libcgraph6:amd64 (2.42.2-9+b2) ...
Setting up libbio-perl-perl (1.7.8-1) ...
Setting up libexporter-tiny-perl (1.006002-1) ...
Setting up libde265-0:amd64 (1.0.15-1+b1) ...
Setting up openssl (3.2.1-3) ...
Setting up libbsd0:amd64 (0.12.2-1) ...
Setting up libyuv0:amd64 (0.0.1888.20240509-4) ...
Setting up libpostscript-perl (0.06-3.1) ...
Setting up libxml2:amd64 (2.12.7+dfsg-2) ...
Setting up libsort-naturally-perl (1.03-4) ...
Setting up liburi-perl (5.28-1) ...
Setting up libdbi-perl:amd64 (1.643-4+b3) ...
Setting up libnet-ssleay-perl:amd64 (1.94-1+b2) ...
Setting up libmath-spline-perl (0.02-4) ...
Setting up automake (1:1.16.5-1.3) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up libfile-stripnondeterminism-perl (1.14.0-1) ...
Setting up libice6:amd64 (2:1.0.10-1+b1) ...
Setting up libhttp-date-perl (6.06-1) ...
Setting up libxdmcp6:amd64 (1:1.1.2-3+b1) ...
Setting up libxcb1:amd64 (1.17.0-2) ...
Setting up gettext (0.21-14+b1) ...
Setting up libfile-listing-perl (6.16-1) ...
Setting up libtest-requiresinternet-perl (0.05-4) ...
Setting up libcache-cache-perl (1.08-3) ...
Setting up libtool (2.4.7-7) ...
Setting up libxcb-render0:amd64 (1.17.0-2) ...
Setting up fontconfig-config (2.15.0-1.1) ...
Setting up liblist-moreutils-perl (0.430-2) ...
Setting up libtest-warn-perl (0.37-2) ...
Setting up libtype-tiny-perl (2.004000-1) ...
Setting up libtest-differences-perl (0.71-1) ...
Setting up libnet-http-perl (6.23-1) ...
Setting up libxcb-shm0:amd64 (1.17.0-2) ...
Setting up libexception-class-perl (1.45-1) ...
Setting up libgraph-perl (1:0.9727-1) ...
Setting up libdevel-callchecker-perl:amd64 (0.009-1+b1) ...
Setting up libspreadsheet-writeexcel-perl (2.40-4) ...
Setting up intltool-debian (0.35.0+20060710.6) ...
Setting up dh-autoreconf (20) ...
Setting up libthai0:amd64 (0.1.29-2) ...
Setting up ca-certificates (20240203) ...
Updating certificates in /etc/ssl/certs...
146 added, 0 removed; done.
Setting up libtest-exception-perl (0.43-3) ...
Setting up libbio-samtools-perl (1.43-5+b1) ...
Setting up libfreetype6:amd64 (2.13.2+dfsg-1+b4) ...
Setting up libgssapi-krb5-2:amd64 (1.20.1-6+b1) ...
Setting up libdbd-mysql-perl:amd64 (4.052-1+b3) ...
Setting up libace-perl (1.92-11+b5) ...
Setting up libgav1-1:amd64 (0.19.0-2+b1) ...
Setting up ucf (3.0043+nmu1) ...
Setting up libspreadsheet-parseexcel-perl (0.6600-1) ...
Setting up dh-strip-nondeterminism (1.14.0-1) ...
Setting up libwww-robotrules-perl (6.02-1) ...
Setting up libgvpr2:amd64 (2.42.2-9+b2) ...
Setting up groff-base (1.23.0-4) ...
Setting up libhtml-parser-perl:amd64 (3.82-1+b1) ...
Setting up libx11-6:amd64 (2:1.8.7-1+b1) ...
Setting up libharfbuzz0b:amd64 (8.3.0-2+b1) ...
Setting up libdbd-sqlite3-perl:amd64 (1.74-1+b3) ...
Setting up libfontconfig1:amd64 (2.15.0-1.1) ...
Setting up libsm6:amd64 (2:1.2.3-1+b1) ...
Setting up libio-socket-ssl-perl (2.085-1) ...
Setting up libhttp-message-perl (6.46-1) ...
Setting up libhttp-negotiate-perl (6.01-2) ...
Setting up fontconfig (2.15.0-1.1) ...
Regenerating fonts cache... done.
Setting up libavif16:amd64 (1.0.4-3) ...
Setting up libstatistics-descriptive-perl (3.0801-1) ...
Setting up libxpm4:amd64 (1:3.5.17-1+b1) ...
Setting up libxrender1:amd64 (1:0.9.10-1.1+b1) ...
Setting up libhttp-cookies-perl (6.11-1) ...
Setting up libtest-most-perl (0.38-1) ...
Setting up po-debconf (1.0.21+nmu1) ...
Setting up libhtml-tree-perl (5.07-3) ...
Setting up libparams-classify-perl:amd64 (0.015-2+b4) ...
Setting up libpango-1.0-0:amd64 (1.52.2+ds-1) ...
Setting up libcgi-pm-perl (4.64-1) ...
Setting up libpq5:amd64 (16.3-1+b1) ...
Setting up libxext6:amd64 (2:1.3.4-1+b1) ...
Setting up libdbd-pg-perl (3.18.0-1+b3) ...
Setting up man-db (2.12.1-1) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libxml-sax-perl (1.02+dfsg-3) ...
update-perl-sax-parsers: Registering Perl SAX parser XML::SAX::PurePerl with priority 10...
update-perl-sax-parsers: Updating overall Perl SAX parser modules info file...

Creating config file /etc/perl/XML/SAX/ParserDetails.ini with new version
Setting up libcairo2:amd64 (1.18.0-3+b1) ...
Setting up libnet-smtp-ssl-perl (1.04-2) ...
Setting up libmodule-runtime-perl (0.016-2) ...
Setting up libmailtools-perl (2.21-3) ...
Setting up libxt6t64:amd64 (1:1.2.1-1.2) ...
Setting up libxml-filter-buffertext-perl (1.01-7) ...
Setting up libxml-libxml-perl (2.0207+dfsg+really+2.0134-3+b1) ...
update-perl-sax-parsers: Registering Perl SAX parser XML::LibXML::SAX::Parser with priority 50...
update-perl-sax-parsers: Registering Perl SAX parser XML::LibXML::SAX with priority 50...
update-perl-sax-parsers: Updating overall Perl SAX parser modules info file...
Replacing config file /etc/perl/XML/SAX/ParserDetails.ini with new version
Setting up libhtml-tableextract-perl (2.15-2) ...
Setting up libhttp-daemon-perl (6.16-1) ...
Setting up libpangoft2-1.0-0:amd64 (1.52.2+ds-1) ...
Setting up libpangocairo-1.0-0:amd64 (1.52.2+ds-1) ...
Setting up libxml-sax-writer-perl (0.57-3) ...
Setting up libsvg-graph-perl (0.02-4) ...
Setting up libxmu6:amd64 (2:1.1.3-3+b2) ...
Setting up libxml-sax-expatxs-perl (1.33-3+b4) ...
update-perl-sax-parsers: Registering Perl SAX parser XML::SAX::ExpatXS with priority 50...
update-perl-sax-parsers: Updating overall Perl SAX parser modules info file...
Replacing config file /etc/perl/XML/SAX/ParserDetails.ini with new version
Setting up libimport-into-perl (1.002005-2) ...
Setting up libmoo-perl (2.005005-1) ...
Setting up debhelper (13.15.3) ...
Setting up libxaw7:amd64 (2:1.0.14-1+b2) ...
Setting up libmime-tools-perl (5.515-1) ...
Setting up libarray-compare-perl (3.0.8-1) ...
Setting up libxml-simple-perl (2.25-2) ...
Setting up libheif-plugin-libde265:amd64 (1.17.6-1+b2) ...
Setting up libwww-perl (6.77-1) ...
Setting up libheif1:amd64 (1.17.6-1+b2) ...
Setting up libgd3:amd64 (2.3.3-9+b3) ...
Setting up libgvc6 (2.42.2-9+b2) ...
Setting up libheif-plugin-dav1d:amd64 (1.17.6-1+b2) ...
Setting up liblwp-protocol-https-perl (6.14-1) ...
Setting up graphviz (2.42.2-9+b2) ...
Setting up libxml-parser-perl (2.47-1+b3) ...
Setting up libxml-twig-perl (1:3.52-3) ...
Setting up libxml-xpath-perl (1.48-1) ...
Setting up libbio-variation-perl (1.7.5-3) ...
Setting up libgd-perl (2.78-1+b3) ...
Setting up libxml-perl (0.08-4) ...
Setting up libsoap-lite-perl (1.27-3) ...
Setting up libgraphviz-perl (2.24-1) ...
Setting up libbio-cluster-perl (1.7.3-6) ...
Setting up libxml-dom-perl (1.46-2) ...
Setting up libbio-asn1-entrezgene-perl (1.730-3) ...
Setting up libxml-dom-xpath-perl (0.14-4) ...
Setting up sbuild-build-depends-main-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.38-12) ...
Processing triggers for ca-certificates (20240203) ...
Updating certificates in /etc/ssl/certs...
0 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...
done.

+------------------------------------------------------------------------------+
| Check architectures                                                          |
+------------------------------------------------------------------------------+

Arch check ok (amd64 included in all)

+------------------------------------------------------------------------------+
| Build environment                                                            |
+------------------------------------------------------------------------------+

Kernel: Linux 6.1.0-21-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.90-1 (2024-05-03) amd64 (x86_64)
Toolchain package versions: binutils_2.42-4 dpkg-dev_1.22.6 g++-13_13.2.0-25 gcc-13_13.2.0-25 libc6-dev_2.38-12 libstdc++-13-dev_13.2.0-25 libstdc++6_14.1.0-1 linux-libc-dev_6.8.12-1
Package versions: adduser_3.137 apt_2.9.4 autoconf_2.71-3 automake_1:1.16.5-1.3 autopoint_0.21-14 autotools-dev_20220109.1 base-files_13.2 base-passwd_3.6.3 bash_5.2.21-2+b1 binutils_2.42-4 binutils-common_2.42-4 binutils-x86-64-linux-gnu_2.42-4 bsdextrautils_2.40.1-7 bsdutils_1:2.40.1-7 build-essential_12.10 bzip2_1.0.8-5.1 ca-certificates_20240203 coreutils_9.4-3.1 cpp_4:13.2.0-7 cpp-13_13.2.0-25 cpp-13-x86-64-linux-gnu_13.2.0-25 cpp-x86-64-linux-gnu_4:13.2.0-7 dash_0.5.12-8 debconf_1.5.86 debhelper_13.15.3 debian-archive-keyring_2023.4 debianutils_5.17 dh-autoreconf_20 dh-strip-nondeterminism_1.14.0-1 diffutils_1:3.10-1 dirmngr_2.2.43-7 dpkg_1.22.6 dpkg-dev_1.22.6 dwz_0.15-1+b1 eatmydata_131-2 fakeroot_1.34-1 file_1:5.45-3 findutils_4.9.0-6 fontconfig_2.15.0-1.1 fontconfig-config_2.15.0-1.1 fonts-dejavu-core_2.37-8 fonts-dejavu-mono_2.37-8 g++_4:13.2.0-7 g++-13_13.2.0-25 g++-13-x86-64-linux-gnu_13.2.0-25 g++-x86-64-linux-gnu_4:13.2.0-7 gcc_4:13.2.0-7 gcc-13_13.2.0-25 gcc-13-base_13.2.0-25 gcc-13-x86-64-linux-gnu_13.2.0-25 gcc-14-base_14.1.0-1 gcc-x86-64-linux-gnu_4:13.2.0-7 gettext_0.21-14+b1 gettext-base_0.21-14+b1 gnupg_2.2.43-7 gnupg-l10n_2.2.43-7 gnupg-utils_2.2.43-7 gpg_2.2.43-7 gpg-agent_2.2.43-7 gpg-wks-client_2.2.43-7 gpgconf_2.2.43-7 gpgsm_2.2.43-7 gpgv_2.2.43-7 graphviz_2.42.2-9+b2 grep_3.11-4 groff-base_1.23.0-4 gzip_1.12-1.1 hostname_3.23+nmu2 init-system-helpers_1.66 intltool-debian_0.35.0+20060710.6 libabsl20230802_20230802.1-4 libace-perl_1.92-11+b5 libacl1_2.3.2-2 libalgorithm-diff-perl_1.201-1 libalgorithm-munkres-perl_0.08-5 libann0_1.1.2+doc-9+b1 libaom3_3.8.2-2 libapt-pkg6.0t64_2.9.4 libarchive-zip-perl_1.68-1 libarray-compare-perl_3.0.8-1 libasan8_14.1.0-1 libassuan0_2.5.6-1+b1 libatomic1_14.1.0-1 libattr1_1:2.5.2-1 libaudit-common_1:3.1.2-2.1 libaudit1_1:3.1.2-2.1 libavif16_1.0.4-3 libb-hooks-op-check-perl_0.22-3+b2 libbinutils_2.42-4 libbio-asn1-entrezgene-perl_1.730-3 libbio-cluster-perl_1.7.3-6 libbio-perl-perl_1.7.8-1 libbio-samtools-perl_1.43-5+b1 libbio-variation-perl_1.7.5-3 libblkid1_2.40.1-7 libbrotli1_1.1.0-2+b3 libbsd0_0.12.2-1 libbz2-1.0_1.0.8-5.1 libc-bin_2.38-12 libc-dev-bin_2.38-12 libc-l10n_2.38-12 libc6_2.38-12 libc6-dev_2.38-12 libcache-cache-perl_1.08-3 libcairo2_1.18.0-3+b1 libcap-ng0_0.8.5-1 libcap2_1:2.66-5 libcapture-tiny-perl_0.48-2 libcc1-0_14.1.0-1 libcdt5_2.42.2-9+b2 libcgi-pm-perl_4.64-1 libcgraph6_2.42.2-9+b2 libclass-data-inheritable-perl_0.08-3 libclass-inspector-perl_1.36-3 libclass-method-modifiers-perl_2.15-1 libclass-unload-perl_0.11-3 libclass-xsaccessor-perl_1.19-4+b4 libclone-perl_0.46-1+b3 libcom-err2_1.47.1-1 libconvert-binary-c-perl_0.84-1+b5 libconvert-binhex-perl_1.125-3 libcrypt-dev_1:4.4.36-4 libcrypt-rc4-perl_2.02-5 libcrypt1_1:4.4.36-4 libctf-nobfd0_2.42-4 libctf0_2.42-4 libdata-stag-perl_0.14-3 libdatrie1_0.2.13-3 libdav1d7_1.4.2-1 libdb5.3t64_5.3.28+dfsg2-7 libdbd-mysql-perl_4.052-1+b3 libdbd-pg-perl_3.18.0-1+b3 libdbd-sqlite3-perl_1.74-1+b3 libdbi-perl_1.643-4+b3 libde265-0_1.0.15-1+b1 libdebconfclient0_0.272 libdebhelper-perl_13.15.3 libdeflate0_1.20-1 libdevel-callchecker-perl_0.009-1+b1 libdevel-cycle-perl_1.12-2 libdevel-stacktrace-perl_2.0500-1 libdigest-perl-md5-perl_1.9-5 libdpkg-perl_1.22.6 libdynaloader-functions-perl_0.003-3 libeatmydata1_131-2 libelf1t64_0.191-1+b1 libencode-locale-perl_1.05-3 liberror-perl_0.17029-2 libexception-class-perl_1.45-1 libexpat1_2.6.2-1 libexporter-tiny-perl_1.006002-1 libfakeroot_1.34-1 libfcgi-perl_0.82+ds-3+b2 libfcgi0t64_2.4.2-2.1 libffi8_3.4.6-1 libfile-listing-perl_6.16-1 libfile-slurp-tiny-perl_0.004-2 libfile-stripnondeterminism-perl_1.14.0-1 libfontconfig1_2.15.0-1.1 libfreetype6_2.13.2+dfsg-1+b4 libfribidi0_1.0.13-3+b1 libgav1-1_0.19.0-2+b1 libgcc-13-dev_13.2.0-25 libgcc-s1_14.1.0-1 libgcrypt20_1.10.3-3 libgd-perl_2.78-1+b3 libgd3_2.3.3-9+b3 libgdbm-compat4t64_1.23-5.1+b1 libgdbm6t64_1.23-5.1+b1 libglib2.0-0t64_2.80.2-2 libgmp10_2:6.3.0+dfsg-2+b1 libgnutls30t64_3.8.5-4 libgomp1_14.1.0-1 libgpg-error0_1.49-2 libgprofng0_2.42-4 libgraph-perl_1:0.9727-1 libgraphite2-3_1.3.14-2 libgraphviz-perl_2.24-1 libgssapi-krb5-2_1.20.1-6+b1 libgts-0.7-5t64_0.7.6+darcs121130-5.2 libgvc6_2.42.2-9+b2 libgvpr2_2.42.2-9+b2 libharfbuzz0b_8.3.0-2+b1 libheap-perl_0.80-5 libheif-plugin-dav1d_1.17.6-1+b2 libheif-plugin-libde265_1.17.6-1+b2 libheif1_1.17.6-1+b2 libhogweed6t64_3.9.1-2.2 libhtml-parser-perl_3.82-1+b1 libhtml-tableextract-perl_2.15-2 libhtml-tagset-perl_3.24-1 libhtml-tree-perl_5.07-3 libhttp-cookies-perl_6.11-1 libhttp-daemon-perl_6.16-1 libhttp-date-perl_6.06-1 libhttp-message-perl_6.46-1 libhttp-negotiate-perl_6.01-2 libhwasan0_14.1.0-1 libice6_2:1.0.10-1+b1 libicu72_72.1-4+b1 libidn2-0_2.3.7-2 libimport-into-perl_1.002005-2 libio-html-perl_1.004-3 libio-pty-perl_1:1.20-1+b2 libio-sessiondata-perl_1.03-3 libio-socket-ssl-perl_2.085-1 libio-string-perl_1.08-4 libio-stringy-perl_2.111-3 libipc-run-perl_20231003.0-2 libipc-sharelite-perl_0.17-5+b3 libisl23_0.26-3+b2 libitm1_14.1.0-1 libjansson4_2.14-2+b2 libjbig0_2.1-6.1+b1 libjcode-pm-perl_2.06-1.1 libjpeg62-turbo_1:2.1.5-3 libk5crypto3_1.20.1-6+b1 libkeyutils1_1.6.3-3 libkrb5-3_1.20.1-6+b1 libkrb5support0_1.20.1-6+b1 libksba8_1.6.6-1 liblab-gamut1_2.42.2-9+b2 libldap-2.5-0_2.5.17+dfsg-1+b1 liblerc4_4.0.0+ds-4+b1 liblist-moreutils-perl_0.430-2 liblist-moreutils-xs-perl_0.430-4+b2 liblsan0_14.1.0-1 libltdl7_2.4.7-7+b1 liblwp-mediatypes-perl_6.04-2 liblwp-protocol-https-perl_6.14-1 liblz4-1_1.9.4-2 liblzma5_5.6.1+really5.4.5-1 libmagic-mgc_1:5.45-3 libmagic1t64_1:5.45-3 libmailtools-perl_2.21-3 libmariadb3_1:10.11.8-1 libmath-derivative-perl_1.01-3 libmath-spline-perl_0.02-4 libmd0_1.1.0-2 libmime-tools-perl_5.515-1 libmodule-build-perl_0.423400-2 libmodule-runtime-perl_0.016-2 libmoo-perl_2.005005-1 libmount1_2.40.1-7 libmpc3_1.3.1-1+b2 libmpfr6_4.2.1-1+b1 libncursesw6_6.5-2 libnet-http-perl_6.23-1 libnet-smtp-ssl-perl_1.04-2 libnet-ssleay-perl_1.94-1+b2 libnettle8t64_3.9.1-2.2 libnpth0t64_1.6-3.1 libole-storage-lite-perl_0.22-1 libp11-kit0_0.25.3-5 libpadwalker-perl_2.5-1+b6 libpam-modules_1.5.3-7 libpam-modules-bin_1.5.3-7 libpam-runtime_1.5.3-7 libpam0g_1.5.3-7 libpango-1.0-0_1.52.2+ds-1 libpangocairo-1.0-0_1.52.2+ds-1 libpangoft2-1.0-0_1.52.2+ds-1 libparams-classify-perl_0.015-2+b4 libparse-recdescent-perl_1.967015+dfsg-4 libpath-class-perl_0.37-4 libpathplan4_2.42.2-9+b2 libpcre2-8-0_10.42-4+b1 libperl5.38t64_5.38.2-5 libperl5.40_5.40.0~rc1-1 libperlio-eol-perl_0.19-1+b3 libpipeline1_1.5.7-2 libpixman-1-0_0.42.2-1+b1 libpng16-16t64_1.6.43-5 libpostscript-perl_0.06-3.1 libpq5_16.3-1+b1 libquadmath0_14.1.0-1 librav1e0_0.7.1-2 libreadline8t64_8.2-4 librole-tiny-perl_2.002004-1 libsasl2-2_2.1.28+dfsg1-6 libsasl2-modules-db_2.1.28+dfsg1-6 libseccomp2_2.5.5-1 libselinux1_3.5-2+b2 libsemanage-common_3.5-1 libsemanage2_3.5-1+b3 libsepol2_3.5-2+b1 libset-object-perl_1.42-1+b5 libset-scalar-perl_1.29-3 libsframe1_2.42-4 libsharpyuv0_1.4.0-0.1 libsm6_2:1.2.3-1+b1 libsmartcols1_2.40.1-7 libsoap-lite-perl_1.27-3 libsort-naturally-perl_1.03-4 libspreadsheet-parseexcel-perl_0.6600-1 libspreadsheet-writeexcel-perl_2.40-4 libsqlite3-0_3.46.0-1 libssl3t64_3.2.1-3 libstatistics-descriptive-perl_3.0801-1 libstdc++-13-dev_13.2.0-25 libstdc++6_14.1.0-1 libsub-quote-perl_2.006008-1 libsub-uplevel-perl_0.2800-3 libsvg-graph-perl_0.02-4 libsvg-perl_2.87-1 libsvtav1enc1d1_1.7.0+dfsg-2+b1 libsystemd0_256~rc3-7 libtask-weaken-perl_1.06-2 libtasn1-6_4.19.0-3+b2 libtest-deep-perl_1.204-1 libtest-differences-perl_0.71-1 libtest-exception-perl_0.43-3 libtest-memory-cycle-perl_1.06-2 libtest-most-perl_0.38-1 libtest-pod-perl_1.52-3 libtest-requiresinternet-perl_0.05-4 libtest-warn-perl_0.37-2 libtest-weaken-perl_3.022000-1.1 libtext-diff-perl_1.45-2 libthai-data_0.1.29-2 libthai0_0.1.29-2 libtiff6_4.5.1+git230720-4 libtimedate-perl_2.3300-2 libtinfo6_6.5-2 libtool_2.4.7-7 libtree-dagnode-perl_1.32-1 libtry-tiny-perl_0.31-2 libtsan2_14.1.0-1 libtype-tiny-perl_2.004000-1 libubsan1_14.1.0-1 libuchardet0_0.0.8-1+b1 libudev1_256~rc3-7 libunicode-map-perl_0.112-13+b4 libunistring5_1.2-1 liburi-perl_5.28-1 libuuid1_2.40.1-7 libwebp7_1.4.0-0.1 libwww-perl_6.77-1 libwww-robotrules-perl_6.02-1 libx11-6_2:1.8.7-1+b1 libx11-data_2:1.8.7-1 libxau6_1:1.0.9-1+b1 libxaw7_2:1.0.14-1+b2 libxcb-render0_1.17.0-2 libxcb-shm0_1.17.0-2 libxcb1_1.17.0-2 libxdmcp6_1:1.1.2-3+b1 libxext6_2:1.3.4-1+b1 libxml-dom-perl_1.46-2 libxml-dom-xpath-perl_0.14-4 libxml-filter-buffertext-perl_1.01-7 libxml-libxml-perl_2.0207+dfsg+really+2.0134-3+b1 libxml-namespacesupport-perl_1.12-2 libxml-parser-perl_2.47-1+b3 libxml-perl_0.08-4 libxml-regexp-perl_0.04-1.1 libxml-sax-base-perl_1.09-3 libxml-sax-expatxs-perl_1.33-3+b4 libxml-sax-perl_1.02+dfsg-3 libxml-sax-writer-perl_0.57-3 libxml-simple-perl_2.25-2 libxml-twig-perl_1:3.52-3 libxml-writer-perl_0.900-2 libxml-xpath-perl_1.48-1 libxml-xpathengine-perl_0.14-2 libxml2_2.12.7+dfsg-2 libxmu6_2:1.1.3-3+b2 libxpm4_1:3.5.17-1+b1 libxrender1_1:0.9.10-1.1+b1 libxt6t64_1:1.2.1-1.2 libxxhash0_0.8.2-2+b1 libyaml-perl_1.31-1 libyuv0_0.0.1888.20240509-4 libzstd1_1.5.5+dfsg2-2 linux-libc-dev_6.8.12-1 locales-all_2.38-12 login_1:4.13+dfsg1-4 m4_1.4.19-4 make_4.3-4.1 man-db_2.12.1-1 mariadb-common_1:10.11.8-1 mawk_1.3.4.20240123-1 mysql-common_5.8+1.1.0 ncurses-base_6.5-2 ncurses-bin_6.5-2 netbase_6.4 openssl_3.2.1-3 passwd_1:4.13+dfsg1-4 patch_2.7.6-7 perl_5.40.0~rc1-1 perl-base_5.40.0~rc1-1 perl-modules-5.38_5.38.2-5 perl-modules-5.40_5.40.0~rc1-1 perl-openssl-defaults_7+b2 pinentry-curses_1.2.1-3+b2 po-debconf_1.0.21+nmu1 readline-common_8.2-4 rename_2.02-1 rpcsvc-proto_1.4.3-1 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2 sensible-utils_0.0.22 sysvinit-utils_3.09-1 tar_1.35+dfsg-3 ucf_3.0043+nmu1 usr-is-merged_39 util-linux_2.40.1-7 x11-common_1:7.7+23 xz-utils_5.6.1+really5.4.5-1 zlib1g_1:1.3.dfsg+really1.3.1-1

+------------------------------------------------------------------------------+
| Build                                                                        |
+------------------------------------------------------------------------------+


Unpack source
-------------

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA512

Format: 3.0 (quilt)
Source: bioperl
Binary: bioperl, libbio-perl-perl
Architecture: all
Version: 1.7.8-1
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Uploaders: Charles Plessy <plessy@debian.org>, Steffen Moeller <moeller@debian.org>, Andreas Tille <tille@debian.org>, Olivier Sallou <osallou@debian.org>
Homepage: http://www.bioperl.org/
Standards-Version: 4.5.1
Vcs-Browser: https://salsa.debian.org/med-team/bioperl
Vcs-Git: https://salsa.debian.org/med-team/bioperl.git
Testsuite: autopkgtest-pkg-perl
Build-Depends: debhelper-compat (= 13), libmodule-build-perl
Build-Depends-Indep: perl, rename, libio-string-perl, libdata-stag-perl, libtest-most-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libbio-samtools-perl, libclass-unload-perl, libcgi-pm-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgd-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpath-class-perl, libperlio-eol-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, libtest-memory-cycle-perl, libtest-pod-perl, libtest-weaken-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-twig-perl, libxml-simple-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl, libyaml-perl, libtest-requiresinternet-perl, libxml-sax-expatxs-perl
Package-List:
 bioperl deb science optional arch=all
 libbio-perl-perl deb perl optional arch=all
Checksums-Sha1:
 f8997b7a920c1dbb58936e63ba994b62b8794114 7527658 bioperl_1.7.8.orig.tar.gz
 51c3b0588068a3361850138c2e160381edc646d5 11872 bioperl_1.7.8-1.debian.tar.xz
Checksums-Sha256:
 c490a3be7715ea6e4305efd9710e5edab82dabc55fd786b6505b550a30d71738 7527658 bioperl_1.7.8.orig.tar.gz
 525b3b78609430a79317f74c1967eff18404cb680171920acf98eb4bb98b2640 11872 bioperl_1.7.8-1.debian.tar.xz
Files:
 8164ac52f37bc6355ec1b69633ac795f 7527658 bioperl_1.7.8.orig.tar.gz
 71bbadb297af9f85e1928b5f7c69783f 11872 bioperl_1.7.8-1.debian.tar.xz

-----BEGIN PGP SIGNATURE-----

iQJIBAEBCgAyFiEEPpmlJvXcwMu/HO6mALrnSzQzafEFAmEZEE8UHG5wYXRyYTk3
NEBnbWFpbC5jb20ACgkQALrnSzQzafFZfw/+Iq19Wp3hTbJk7TRmAqAw0Na46zoE
TiIQIDNbxb0aRAkM0dVR07j4jRF2W6yb8+bdZoyCfo8VVrbnxXz1rZPSt6QhTxjm
DJlEEUO/uXoDN0YnxinZCJu5bF41PHty2k5CNGng9MEs9jPK21Mfa3onScrPBLGg
W5KcTWtOwqgf45QJqqXBb/MtYKkf/ggUXa0YCbNel60UOS4cobEVnokg6tzgE4c5
ZCkg+3KvVt/tJdh3RAALfvZZ7KTuw3f+gm/MoWEluKHPF0P+uD8C13I92IQX+J2P
i3dscwt/Qbw3UByPQop8xajUyqviVUvVWG7GHKDeeg/Ds3x6fH4bklKJclFTkY8d
b951O/ZXggHlRm0V7QjyaxD/L6hgpb4asHHtf+BpL7me6HULjxV4QOQzloyzeC/Z
ZY7CDNNjb54v6TBkjTn2b6PiSQ+6PmJs/VdZdxet5t7gMTm0cj4ArTuXmo+gc1Pj
2stvBpPeON+GvRfss8i7Gauac4r2QufQGP/6J6L2miCHQofYb0DbAyH8u7aLFKDO
mDr17uN+Shj3jU9TRmMkbW+a3OvAnHB5PW+z2vOHSPiFZ/nxriWsrcDY9dQqJoxB
ej/oYa8b3QmLVUpwTqQhOOzqXAA8yPCQD7Una1ccdW44DjFA4fvkzXjNax+zu/zv
6+I8G7QRT6jrCZs=
=osza
-----END PGP SIGNATURE-----

gpgv: Signature made Sun Aug 15 13:02:07 2021 UTC
gpgv:                using RSA key 3E99A526F5DCC0CBBF1CEEA600BAE74B343369F1
gpgv:                issuer "npatra974@gmail.com"
gpgv: Can't check signature: No public key
dpkg-source: warning: cannot verify inline signature for ./bioperl_1.7.8-1.dsc: no acceptable signature found
dpkg-source: info: extracting bioperl in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking bioperl_1.7.8.orig.tar.gz
dpkg-source: info: unpacking bioperl_1.7.8-1.debian.tar.xz

Check disk space
----------------

Sufficient free space for build

+------------------------------------------------------------------------------+
| Starting Timed Build Commands                                                |
+------------------------------------------------------------------------------+


/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network bioperl_1.7.8-1 perl-5.40-throwaway amd64
----------------------------------------------------------------------------------------------------------------


I: Finished running '/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network bioperl_1.7.8-1 perl-5.40-throwaway amd64'.

Finished processing commands.
--------------------------------------------------------------------------------

User Environment
----------------

APT_CONFIG=/var/lib/sbuild/apt.conf
HOME=/sbuild-nonexistent
LANG=en_GB.UTF-8
LANGUAGE=en_GB:en
LC_ALL=C.UTF-8
LD_LIBRARY_PATH=/usr/lib/libeatmydata
LD_PRELOAD=libeatmydata.so
LOGNAME=debomatic
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
PWD=/<<PKGBUILDDIR>>
SCHROOT_ALIAS_NAME=perl-5.40-throwaway-amd64-debomatic
SCHROOT_CHROOT_NAME=perl-5.40-amd64-debomatic
SCHROOT_COMMAND=env
SCHROOT_GID=110
SCHROOT_GROUP=sbuild
SCHROOT_SESSION_ID=perl-5.40-amd64-debomatic-637bf3ad-8da0-4220-8de3-7588abb50148
SCHROOT_UID=1002
SCHROOT_USER=debomatic
SHELL=/bin/sh
USER=debomatic

dpkg-buildpackage
-----------------

Command: dpkg-buildpackage --sanitize-env -us -uc -rfakeroot -Zxz
dpkg-buildpackage: info: source package bioperl
dpkg-buildpackage: info: source version 1.7.8-1
dpkg-buildpackage: info: source distribution unstable
dpkg-buildpackage: info: source changed by Nilesh Patra <nilesh@debian.org>
 dpkg-source -Zxz --before-build .
dpkg-buildpackage: info: host architecture amd64
 debian/rules clean
dh clean
   debian/rules override_dh_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_clean build-stamp install-stamp bioperl.conf biodatabases.pod \
biodesign.pod bioperl.pod bioscripts.pod
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
 dpkg-source -Zxz -b .
dpkg-source: info: using source format '3.0 (quilt)'
dpkg-source: info: building bioperl using existing ./bioperl_1.7.8.orig.tar.gz
dpkg-source: info: building bioperl in bioperl_1.7.8-1.debian.tar.xz
dpkg-source: info: building bioperl in bioperl_1.7.8-1.dsc
 debian/rules binary
dh binary
   dh_update_autotools_config
   dh_autoreconf
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_configure -- 
	/usr/bin/perl Makefile.PL INSTALLDIRS=vendor "OPTIMIZE=-g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2" "LD=x86_64-linux-gnu-gcc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wl,-z,relro"
Checking if your kit is complete...
Looks good
Generating a Unix-style Makefile
Writing Makefile for BioPerl
Writing MYMETA.yml and MYMETA.json
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_auto_build
	make -j2
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp lib/Bio/AlignIO/clustalw.pm blib/lib/Bio/AlignIO/clustalw.pm
cp lib/Bio/AlignIO/po.pm blib/lib/Bio/AlignIO/po.pm
cp lib/Bio/AlignIO/maf.pm blib/lib/Bio/AlignIO/maf.pm
cp lib/Bio/AlignIO/xmfa.pm blib/lib/Bio/AlignIO/xmfa.pm
cp lib/Bio/Align/AlignI.pm blib/lib/Bio/Align/AlignI.pm
cp lib/Bio/AnnotatableI.pm blib/lib/Bio/AnnotatableI.pm
cp lib/Bio/AlignIO/proda.pm blib/lib/Bio/AlignIO/proda.pm
cp lib/Bio/AlignIO/metafasta.pm blib/lib/Bio/AlignIO/metafasta.pm
cp lib/Bio/AlignIO/phylip.pm blib/lib/Bio/AlignIO/phylip.pm
cp lib/Bio/Align/Utilities.pm blib/lib/Bio/Align/Utilities.pm
cp lib/Bio/Annotation/DBLink.pm blib/lib/Bio/Annotation/DBLink.pm
cp lib/Bio/Annotation/AnnotationFactory.pm blib/lib/Bio/Annotation/AnnotationFactory.pm
cp lib/Bio/AlignIO/Handler/GenericAlignHandler.pm blib/lib/Bio/AlignIO/Handler/GenericAlignHandler.pm
cp lib/Bio/AlignIO/pfam.pm blib/lib/Bio/AlignIO/pfam.pm
cp lib/Bio/AlignIO/bl2seq.pm blib/lib/Bio/AlignIO/bl2seq.pm
cp lib/Bio/AlignIO/meme.pm blib/lib/Bio/AlignIO/meme.pm
cp lib/Bio/AlignIO/fasta.pm blib/lib/Bio/AlignIO/fasta.pm
cp lib/Bio/AlignIO/arp.pm blib/lib/Bio/AlignIO/arp.pm
cp lib/Bio/Align/PairwiseStatistics.pm blib/lib/Bio/Align/PairwiseStatistics.pm
cp lib/Bio/AlignIO/psi.pm blib/lib/Bio/AlignIO/psi.pm
cp lib/Bio/AlignIO/nexus.pm blib/lib/Bio/AlignIO/nexus.pm
cp lib/Bio/AlignIO/selex.pm blib/lib/Bio/AlignIO/selex.pm
cp lib/Bio/AlignIO/largemultifasta.pm blib/lib/Bio/AlignIO/largemultifasta.pm
cp lib/Bio/Align/DNAStatistics.pm blib/lib/Bio/Align/DNAStatistics.pm
cp lib/Bio/Annotation/Relation.pm blib/lib/Bio/Annotation/Relation.pm
cp lib/Bio/AlignIO/prodom.pm blib/lib/Bio/AlignIO/prodom.pm
cp lib/Bio/Annotation/Reference.pm blib/lib/Bio/Annotation/Reference.pm
cp lib/Bio/Annotation/OntologyTerm.pm blib/lib/Bio/Annotation/OntologyTerm.pm
cp lib/Bio/AnalysisI.pm blib/lib/Bio/AnalysisI.pm
cp lib/Bio/AnalysisParserI.pm blib/lib/Bio/AnalysisParserI.pm
cp lib/Bio/AlignIO/emboss.pm blib/lib/Bio/AlignIO/emboss.pm
cp lib/Bio/Align/StatisticsI.pm blib/lib/Bio/Align/StatisticsI.pm
cp lib/Bio/Align/ProteinStatistics.pm blib/lib/Bio/Align/ProteinStatistics.pm
cp lib/Bio/Annotation/Collection.pm blib/lib/Bio/Annotation/Collection.pm
cp lib/Bio/AlignIO/mega.pm blib/lib/Bio/AlignIO/mega.pm
cp lib/Bio/AnalysisResultI.pm blib/lib/Bio/AnalysisResultI.pm
cp lib/Bio/AlignIO/msf.pm blib/lib/Bio/AlignIO/msf.pm
cp lib/Bio/Annotation/Comment.pm blib/lib/Bio/Annotation/Comment.pm
cp lib/Bio/AlignIO/mase.pm blib/lib/Bio/AlignIO/mase.pm
cp lib/Bio/AlignIO.pm blib/lib/Bio/AlignIO.pm
cp lib/Bio/DB/Flat/BDB/swiss.pm blib/lib/Bio/DB/Flat/BDB/swiss.pm
cp lib/Bio/DB/GenericWebAgent.pm blib/lib/Bio/DB/GenericWebAgent.pm
cp lib/Bio/AnnotationI.pm blib/lib/Bio/AnnotationI.pm
cp lib/Bio/DB/SeqI.pm blib/lib/Bio/DB/SeqI.pm
cp lib/Bio/DB/Query/WebQuery.pm blib/lib/Bio/DB/Query/WebQuery.pm
cp lib/Bio/DB/ReferenceI.pm blib/lib/Bio/DB/ReferenceI.pm
cp lib/Bio/DB/Flat/BinarySearch.pm blib/lib/Bio/DB/Flat/BinarySearch.pm
cp lib/Bio/Annotation/TagTree.pm blib/lib/Bio/Annotation/TagTree.pm
cp lib/Bio/DB/Taxonomy/silva.pm blib/lib/Bio/DB/Taxonomy/silva.pm
cp lib/Bio/DB/QueryI.pm blib/lib/Bio/DB/QueryI.pm
cp lib/Bio/DB/Flat/BDB/fasta.pm blib/lib/Bio/DB/Flat/BDB/fasta.pm
cp lib/Bio/DB/RandomAccessI.pm blib/lib/Bio/DB/RandomAccessI.pm
cp lib/Bio/AnnotationCollectionI.pm blib/lib/Bio/AnnotationCollectionI.pm
cp lib/Bio/DB/Taxonomy/list.pm blib/lib/Bio/DB/Taxonomy/list.pm
cp lib/Bio/DB/LocationI.pm blib/lib/Bio/DB/LocationI.pm
cp lib/Bio/DB/Taxonomy.pm blib/lib/Bio/DB/Taxonomy.pm
cp lib/Bio/DB/Taxonomy/flatfile.pm blib/lib/Bio/DB/Taxonomy/flatfile.pm
cp lib/Bio/DB/Fasta.pm blib/lib/Bio/DB/Fasta.pm
cp lib/Bio/CodonUsage/IO.pm blib/lib/Bio/CodonUsage/IO.pm
cp lib/Bio/Annotation/SimpleValue.pm blib/lib/Bio/Annotation/SimpleValue.pm
cp lib/Bio/Annotation/Tree.pm blib/lib/Bio/Annotation/Tree.pm
cp lib/Bio/CodonUsage/Table.pm blib/lib/Bio/CodonUsage/Table.pm
cp lib/Bio/DB/Taxonomy/greengenes.pm blib/lib/Bio/DB/Taxonomy/greengenes.pm
cp lib/Bio/Annotation/TypeManager.pm blib/lib/Bio/Annotation/TypeManager.pm
cp lib/Bio/DB/Qual.pm blib/lib/Bio/DB/Qual.pm
cp lib/Bio/DB/Registry.pm blib/lib/Bio/DB/Registry.pm
cp lib/Bio/Annotation/Target.pm blib/lib/Bio/Annotation/Target.pm
cp lib/Bio/DB/Failover.pm blib/lib/Bio/DB/Failover.pm
cp lib/Bio/DB/Flat/BDB.pm blib/lib/Bio/DB/Flat/BDB.pm
cp lib/Bio/DB/GFF/Util/Binning.pm blib/lib/Bio/DB/GFF/Util/Binning.pm
cp lib/Bio/DB/UpdateableSeqI.pm blib/lib/Bio/DB/UpdateableSeqI.pm
cp lib/Bio/DB/FileCache.pm blib/lib/Bio/DB/FileCache.pm
cp lib/Bio/Annotation/StructuredValue.pm blib/lib/Bio/Annotation/StructuredValue.pm
cp lib/Bio/DB/IndexedBase.pm blib/lib/Bio/DB/IndexedBase.pm
cp lib/Bio/DB/InMemoryCache.pm blib/lib/Bio/DB/InMemoryCache.pm
cp lib/Bio/DB/Flat/BDB/genbank.pm blib/lib/Bio/DB/Flat/BDB/genbank.pm
cp lib/Bio/DB/DBFetch.pm blib/lib/Bio/DB/DBFetch.pm
cp lib/Bio/DB/Flat.pm blib/lib/Bio/DB/Flat.pm
cp lib/Bio/DB/GFF/Util/Rearrange.pm blib/lib/Bio/DB/GFF/Util/Rearrange.pm
cp lib/Bio/DB/Flat/BDB/embl.pm blib/lib/Bio/DB/Flat/BDB/embl.pm
cp lib/Bio/HandlerBaseI.pm blib/lib/Bio/HandlerBaseI.pm
cp lib/Bio/Factory/ObjectBuilderI.pm blib/lib/Bio/Factory/ObjectBuilderI.pm
cp lib/Bio/Factory/AnalysisI.pm blib/lib/Bio/Factory/AnalysisI.pm
cp lib/Bio/Factory/LocationFactoryI.pm blib/lib/Bio/Factory/LocationFactoryI.pm
cp lib/Bio/Factory/ApplicationFactoryI.pm blib/lib/Bio/Factory/ApplicationFactoryI.pm
cp lib/Bio/Event/EventGeneratorI.pm blib/lib/Bio/Event/EventGeneratorI.pm
cp lib/Bio/Factory/SequenceProcessorI.pm blib/lib/Bio/Factory/SequenceProcessorI.pm
cp lib/Bio/Factory/DriverFactory.pm blib/lib/Bio/Factory/DriverFactory.pm
cp lib/Bio/Event/EventHandlerI.pm blib/lib/Bio/Event/EventHandlerI.pm
cp lib/Bio/Factory/ObjectFactoryI.pm blib/lib/Bio/Factory/ObjectFactoryI.pm
cp lib/Bio/Index/BlastTable.pm blib/lib/Bio/Index/BlastTable.pm
cp lib/Bio/Index/Fastq.pm blib/lib/Bio/Index/Fastq.pm
cp lib/Bio/Index/EMBL.pm blib/lib/Bio/Index/EMBL.pm
cp lib/Bio/Index/AbstractSeq.pm blib/lib/Bio/Index/AbstractSeq.pm
cp lib/Bio/Factory/SeqAnalysisParserFactoryI.pm blib/lib/Bio/Factory/SeqAnalysisParserFactoryI.pm
cp lib/Bio/DasI.pm blib/lib/Bio/DasI.pm
cp lib/Bio/DB/WebDBSeqI.pm blib/lib/Bio/DB/WebDBSeqI.pm
cp lib/Bio/Index/Abstract.pm blib/lib/Bio/Index/Abstract.pm
cp lib/Bio/Index/Swissprot.pm blib/lib/Bio/Index/Swissprot.pm
cp lib/Bio/Index/Qual.pm blib/lib/Bio/Index/Qual.pm
cp lib/Bio/Factory/TreeFactoryI.pm blib/lib/Bio/Factory/TreeFactoryI.pm
cp lib/Bio/LocatableSeq.pm blib/lib/Bio/LocatableSeq.pm
cp lib/Bio/IdentifiableI.pm blib/lib/Bio/IdentifiableI.pm
cp lib/Bio/Index/GenBank.pm blib/lib/Bio/Index/GenBank.pm
cp lib/Bio/Factory/ObjectFactory.pm blib/lib/Bio/Factory/ObjectFactory.pm
cp lib/Bio/IdCollectionI.pm blib/lib/Bio/IdCollectionI.pm
cp lib/Bio/Das/FeatureTypeI.pm blib/lib/Bio/Das/FeatureTypeI.pm
cp lib/Bio/DBLinkContainerI.pm blib/lib/Bio/DBLinkContainerI.pm
cp lib/Bio/Factory/FTLocationFactory.pm blib/lib/Bio/Factory/FTLocationFactory.pm
cp lib/Bio/Factory/SequenceFactoryI.pm blib/lib/Bio/Factory/SequenceFactoryI.pm
cp lib/Bio/Index/SwissPfam.pm blib/lib/Bio/Index/SwissPfam.pm
cp lib/Bio/Factory/SeqAnalysisParserFactory.pm blib/lib/Bio/Factory/SeqAnalysisParserFactory.pm
cp lib/Bio/Das/SegmentI.pm blib/lib/Bio/Das/SegmentI.pm
cp lib/Bio/Index/Fasta.pm blib/lib/Bio/Index/Fasta.pm
cp lib/Bio/Factory/SequenceStreamI.pm blib/lib/Bio/Factory/SequenceStreamI.pm
cp lib/Bio/DescribableI.pm blib/lib/Bio/DescribableI.pm
cp lib/Bio/FeatureHolderI.pm blib/lib/Bio/FeatureHolderI.pm
cp lib/Bio/Index/Blast.pm blib/lib/Bio/Index/Blast.pm
cp lib/Bio/Ontology/DocumentRegistry.pm blib/lib/Bio/Ontology/DocumentRegistry.pm
cp lib/Bio/Location/WidestCoordPolicy.pm blib/lib/Bio/Location/WidestCoordPolicy.pm
cp lib/Bio/Location/Atomic.pm blib/lib/Bio/Location/Atomic.pm
cp lib/Bio/Matrix/PSM/IO/masta.pm blib/lib/Bio/Matrix/PSM/IO/masta.pm
cp lib/Bio/Matrix/PSM/ProtPsm.pm blib/lib/Bio/Matrix/PSM/ProtPsm.pm
cp lib/Bio/Matrix/PSM/PsmHeaderI.pm blib/lib/Bio/Matrix/PSM/PsmHeaderI.pm
cp lib/Bio/Matrix/IO/mlagan.pm blib/lib/Bio/Matrix/IO/mlagan.pm
cp lib/Bio/Matrix/PSM/SiteMatrix.pm blib/lib/Bio/Matrix/PSM/SiteMatrix.pm
cp lib/Bio/Location/Fuzzy.pm blib/lib/Bio/Location/Fuzzy.pm
cp lib/Bio/Location/Simple.pm blib/lib/Bio/Location/Simple.pm
cp lib/Bio/Matrix/Generic.pm blib/lib/Bio/Matrix/Generic.pm
cp lib/Bio/Matrix/IO.pm blib/lib/Bio/Matrix/IO.pm
cp lib/Bio/Matrix/Scoring.pm blib/lib/Bio/Matrix/Scoring.pm
cp lib/Bio/Matrix/PSM/Psm.pm blib/lib/Bio/Matrix/PSM/Psm.pm
cp lib/Bio/Matrix/MatrixI.pm blib/lib/Bio/Matrix/MatrixI.pm
cp lib/Bio/Matrix/Mlagan.pm blib/lib/Bio/Matrix/Mlagan.pm
cp lib/Bio/Matrix/PSM/InstanceSiteI.pm blib/lib/Bio/Matrix/PSM/InstanceSiteI.pm
cp lib/Bio/Location/FuzzyLocationI.pm blib/lib/Bio/Location/FuzzyLocationI.pm
cp lib/Bio/Matrix/PSM/IO/meme.pm blib/lib/Bio/Matrix/PSM/IO/meme.pm
cp lib/Bio/Matrix/PSM/ProtMatrix.pm blib/lib/Bio/Matrix/PSM/ProtMatrix.pm
cp lib/Bio/LocationI.pm blib/lib/Bio/LocationI.pm
cp lib/Bio/Matrix/PSM/PsmHeader.pm blib/lib/Bio/Matrix/PSM/PsmHeader.pm
cp lib/Bio/Matrix/PSM/IO/mast.pm blib/lib/Bio/Matrix/PSM/IO/mast.pm
cp lib/Bio/Location/NarrowestCoordPolicy.pm blib/lib/Bio/Location/NarrowestCoordPolicy.pm
cp lib/Bio/Matrix/PhylipDist.pm blib/lib/Bio/Matrix/PhylipDist.pm
cp lib/Bio/Matrix/PSM/SiteMatrixI.pm blib/lib/Bio/Matrix/PSM/SiteMatrixI.pm
cp lib/Bio/Matrix/PSM/PsmI.pm blib/lib/Bio/Matrix/PSM/PsmI.pm
cp lib/Bio/Matrix/PSM/IO.pm blib/lib/Bio/Matrix/PSM/IO.pm
cp lib/Bio/Location/SplitLocationI.pm blib/lib/Bio/Location/SplitLocationI.pm
cp lib/Bio/Matrix/PSM/InstanceSite.pm blib/lib/Bio/Matrix/PSM/InstanceSite.pm
cp lib/Bio/Matrix/IO/scoring.pm blib/lib/Bio/Matrix/IO/scoring.pm
cp lib/Bio/Location/AvWithinCoordPolicy.pm blib/lib/Bio/Location/AvWithinCoordPolicy.pm
cp lib/Bio/Location/CoordinatePolicyI.pm blib/lib/Bio/Location/CoordinatePolicyI.pm
cp lib/Bio/Location/Split.pm blib/lib/Bio/Location/Split.pm
cp lib/Bio/Matrix/PSM/IO/psiblast.pm blib/lib/Bio/Matrix/PSM/IO/psiblast.pm
cp lib/Bio/Matrix/PSM/IO/transfac.pm blib/lib/Bio/Matrix/PSM/IO/transfac.pm
cp lib/Bio/Matrix/IO/phylip.pm blib/lib/Bio/Matrix/IO/phylip.pm
cp lib/Bio/OntologyIO.pm blib/lib/Bio/OntologyIO.pm
cp lib/Bio/Ontology/OBOEngine.pm blib/lib/Bio/Ontology/OBOEngine.pm
cp lib/Bio/Ontology/PathI.pm blib/lib/Bio/Ontology/PathI.pm
cp lib/Bio/Ontology/Relationship.pm blib/lib/Bio/Ontology/Relationship.pm
cp lib/Bio/OntologyIO/InterProParser.pm blib/lib/Bio/OntologyIO/InterProParser.pm
cp lib/Bio/Ontology/GOterm.pm blib/lib/Bio/Ontology/GOterm.pm
cp lib/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm blib/lib/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
cp lib/Bio/PullParserI.pm blib/lib/Bio/PullParserI.pm
cp lib/Bio/Ontology/RelationshipI.pm blib/lib/Bio/Ontology/RelationshipI.pm
cp lib/Bio/Ontology/Ontology.pm blib/lib/Bio/Ontology/Ontology.pm
cp lib/Bio/OntologyIO/Handlers/BaseSAXHandler.pm blib/lib/Bio/OntologyIO/Handlers/BaseSAXHandler.pm
cp lib/Bio/PrimarySeqI.pm blib/lib/Bio/PrimarySeqI.pm
cp lib/Bio/Ontology/TermI.pm blib/lib/Bio/Ontology/TermI.pm
cp lib/Bio/OntologyIO/goflat.pm blib/lib/Bio/OntologyIO/goflat.pm
cp lib/Bio/Ontology/SimpleOntologyEngine.pm blib/lib/Bio/Ontology/SimpleOntologyEngine.pm
cp lib/Bio/Range.pm blib/lib/Bio/Range.pm
cp lib/Bio/Ontology/InterProTerm.pm blib/lib/Bio/Ontology/InterProTerm.pm
cp lib/Bio/Ontology/Term.pm blib/lib/Bio/Ontology/Term.pm
cp lib/Bio/Ontology/OBOterm.pm blib/lib/Bio/Ontology/OBOterm.pm
cp lib/Bio/Ontology/Path.pm blib/lib/Bio/Ontology/Path.pm
cp lib/Bio/Ontology/TermFactory.pm blib/lib/Bio/Ontology/TermFactory.pm
cp lib/Bio/OntologyIO/Handlers/InterProHandler.pm blib/lib/Bio/OntologyIO/Handlers/InterProHandler.pm
cp lib/Bio/Ontology/OntologyEngineI.pm blib/lib/Bio/Ontology/OntologyEngineI.pm
cp lib/Bio/Root/Exception.pm blib/lib/Bio/Root/Exception.pm
cp lib/Bio/PrimarySeq.pm blib/lib/Bio/PrimarySeq.pm
cp lib/Bio/RangeI.pm blib/lib/Bio/RangeI.pm
cp lib/Bio/OntologyIO/dagflat.pm blib/lib/Bio/OntologyIO/dagflat.pm
cp lib/Bio/OntologyIO/soflat.pm blib/lib/Bio/OntologyIO/soflat.pm
cp lib/Bio/Ontology/OntologyStore.pm blib/lib/Bio/Ontology/OntologyStore.pm
cp lib/Bio/ParameterBaseI.pm blib/lib/Bio/ParameterBaseI.pm
cp lib/Bio/Ontology/RelationshipType.pm blib/lib/Bio/Ontology/RelationshipType.pm
cp lib/Bio/Ontology/RelationshipFactory.pm blib/lib/Bio/Ontology/RelationshipFactory.pm
cp lib/Bio/OntologyIO/simplehierarchy.pm blib/lib/Bio/OntologyIO/simplehierarchy.pm
cp lib/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm blib/lib/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
cp lib/Bio/Ontology/OntologyI.pm blib/lib/Bio/Ontology/OntologyI.pm
cp lib/Bio/OntologyIO/obo.pm blib/lib/Bio/OntologyIO/obo.pm
cp lib/Bio/Search/HSP/HSPI.pm blib/lib/Bio/Search/HSP/HSPI.pm
cp lib/Bio/Search/HSP/GenericHSP.pm blib/lib/Bio/Search/HSP/GenericHSP.pm
cp lib/Bio/Search/HSP/ModelHSP.pm blib/lib/Bio/Search/HSP/ModelHSP.pm
cp lib/Bio/Search/DatabaseI.pm blib/lib/Bio/Search/DatabaseI.pm
cp lib/Bio/Root/Utilities.pm blib/lib/Bio/Root/Utilities.pm
cp lib/Bio/Root/Version.pm blib/lib/Bio/Root/Version.pm
cp lib/Bio/Root/TestObject.pm blib/lib/Bio/Root/TestObject.pm
cp lib/Bio/Search/Hit/HitFactory.pm blib/lib/Bio/Search/Hit/HitFactory.pm
cp lib/Bio/Root/HTTPget.pm blib/lib/Bio/Root/HTTPget.pm
cp lib/Bio/Search/Iteration/IterationI.pm blib/lib/Bio/Search/Iteration/IterationI.pm
cp lib/Bio/Search/GenericStatistics.pm blib/lib/Bio/Search/GenericStatistics.pm
cp lib/Bio/Search/HSP/BlastHSP.pm blib/lib/Bio/Search/HSP/BlastHSP.pm
cp lib/Bio/Root/RootI.pm blib/lib/Bio/Root/RootI.pm
cp lib/Bio/Search/Hit/HitI.pm blib/lib/Bio/Search/Hit/HitI.pm
cp lib/Bio/Search/HSP/PsiBlastHSP.pm blib/lib/Bio/Search/HSP/PsiBlastHSP.pm
cp lib/Bio/Root/Test.pm blib/lib/Bio/Root/Test.pm
cp lib/Bio/Root/IO.pm blib/lib/Bio/Root/IO.pm
cp lib/Bio/Search/HSP/HSPFactory.pm blib/lib/Bio/Search/HSP/HSPFactory.pm
cp lib/Bio/Search/HSP/PullHSPI.pm blib/lib/Bio/Search/HSP/PullHSPI.pm
cp lib/Bio/Search/Iteration/GenericIteration.pm blib/lib/Bio/Search/Iteration/GenericIteration.pm
cp lib/Bio/Search/HSP/BlastPullHSP.pm blib/lib/Bio/Search/HSP/BlastPullHSP.pm
cp lib/Bio/Search/HSP/WABAHSP.pm blib/lib/Bio/Search/HSP/WABAHSP.pm
cp lib/Bio/Search/Hit/PullHitI.pm blib/lib/Bio/Search/Hit/PullHitI.pm
cp lib/Bio/Search/Processor.pm blib/lib/Bio/Search/Processor.pm
cp lib/Bio/Root/Storable.pm blib/lib/Bio/Root/Storable.pm
cp lib/Bio/Search/Hit/BlastHit.pm blib/lib/Bio/Search/Hit/BlastHit.pm
cp lib/Bio/Search/Hit/GenericHit.pm blib/lib/Bio/Search/Hit/GenericHit.pm
cp lib/Bio/Search/Hit/PsiBlastHit.pm blib/lib/Bio/Search/Hit/PsiBlastHit.pm
cp lib/Bio/Search/Hit/ModelHit.pm blib/lib/Bio/Search/Hit/ModelHit.pm
cp lib/Bio/Search/HSP/PSLHSP.pm blib/lib/Bio/Search/HSP/PSLHSP.pm
cp lib/Bio/Search/Hit/BlastPullHit.pm blib/lib/Bio/Search/Hit/BlastPullHit.pm
cp lib/Bio/Search/GenericDatabase.pm blib/lib/Bio/Search/GenericDatabase.pm
cp lib/Bio/Search/Hit/Fasta.pm blib/lib/Bio/Search/Hit/Fasta.pm
cp lib/Bio/Search/BlastUtils.pm blib/lib/Bio/Search/BlastUtils.pm
cp lib/Bio/Root/Root.pm blib/lib/Bio/Root/Root.pm
cp lib/Bio/Search/HSP/FastaHSP.pm blib/lib/Bio/Search/HSP/FastaHSP.pm
cp lib/Bio/Search/BlastStatistics.pm blib/lib/Bio/Search/BlastStatistics.pm
cp lib/Bio/SearchIO/axt.pm blib/lib/Bio/SearchIO/axt.pm
cp lib/Bio/Search/Result/GenericResult.pm blib/lib/Bio/Search/Result/GenericResult.pm
cp lib/Bio/SearchIO.pm blib/lib/Bio/SearchIO.pm
cp lib/Bio/SearchIO/FastHitEventBuilder.pm blib/lib/Bio/SearchIO/FastHitEventBuilder.pm
cp lib/Bio/SearchIO/blasttable.pm blib/lib/Bio/SearchIO/blasttable.pm
cp lib/Bio/SearchIO/Writer/HitTableWriter.pm blib/lib/Bio/SearchIO/Writer/HitTableWriter.pm
cp lib/Bio/SearchIO/EventHandlerI.pm blib/lib/Bio/SearchIO/EventHandlerI.pm
cp lib/Bio/Search/Result/PullResultI.pm blib/lib/Bio/Search/Result/PullResultI.pm
cp lib/Bio/SearchIO/IteratedSearchResultEventBuilder.pm blib/lib/Bio/SearchIO/IteratedSearchResultEventBuilder.pm
cp lib/Bio/Search/Result/ResultFactory.pm blib/lib/Bio/Search/Result/ResultFactory.pm
cp lib/Bio/SearchIO/SearchResultEventBuilder.pm blib/lib/Bio/SearchIO/SearchResultEventBuilder.pm
cp lib/Bio/Search/Result/CrossMatchResult.pm blib/lib/Bio/Search/Result/CrossMatchResult.pm
cp lib/Bio/Search/Result/BlastResult.pm blib/lib/Bio/Search/Result/BlastResult.pm
cp lib/Bio/SearchIO/blast_pull.pm blib/lib/Bio/SearchIO/blast_pull.pm
cp lib/Bio/Search/Tiling/MapTiling.pm blib/lib/Bio/Search/Tiling/MapTiling.pm
cp lib/Bio/Search/SearchUtils.pm blib/lib/Bio/Search/SearchUtils.pm
cp lib/Bio/Search/Tiling/TilingI.pm blib/lib/Bio/Search/Tiling/TilingI.pm
cp lib/Bio/SearchIO/blast.pm blib/lib/Bio/SearchIO/blast.pm
cp lib/Bio/Search/Result/BlastPullResult.pm blib/lib/Bio/Search/Result/BlastPullResult.pm
cp lib/Bio/Search/Result/WABAResult.pm blib/lib/Bio/Search/Result/WABAResult.pm
cp lib/Bio/Search/Result/INFERNALResult.pm blib/lib/Bio/Search/Result/INFERNALResult.pm
cp lib/Bio/Search/Tiling/MapTileUtils.pm blib/lib/Bio/Search/Tiling/MapTileUtils.pm
cp lib/Bio/SearchIO/Writer/HSPTableWriter.pm blib/lib/Bio/SearchIO/Writer/HSPTableWriter.pm
cp lib/Bio/Search/Result/ResultI.pm blib/lib/Bio/Search/Result/ResultI.pm
cp lib/Bio/SearchIO/erpin.pm blib/lib/Bio/SearchIO/erpin.pm
cp lib/Bio/SearchIO/SearchWriterI.pm blib/lib/Bio/SearchIO/SearchWriterI.pm
cp lib/Bio/SearchIO/Writer/ResultTableWriter.pm blib/lib/Bio/SearchIO/Writer/ResultTableWriter.pm
cp lib/Bio/Search/StatisticsI.pm blib/lib/Bio/Search/StatisticsI.pm
cp lib/Bio/SearchIO/Writer/HTMLResultWriter.pm blib/lib/Bio/SearchIO/Writer/HTMLResultWriter.pm
cp lib/Bio/SearchIO/Writer/TextResultWriter.pm blib/lib/Bio/SearchIO/Writer/TextResultWriter.pm
cp lib/Bio/SearchIO/Writer/GbrowseGFF.pm blib/lib/Bio/SearchIO/Writer/GbrowseGFF.pm
cp lib/Bio/SearchIO/cross_match.pm blib/lib/Bio/SearchIO/cross_match.pm
cp lib/Bio/Seq/BaseSeqProcessor.pm blib/lib/Bio/Seq/BaseSeqProcessor.pm
cp lib/Bio/Seq/LargeSeqI.pm blib/lib/Bio/Seq/LargeSeqI.pm
cp lib/Bio/SearchIO/rnamotif.pm blib/lib/Bio/SearchIO/rnamotif.pm
cp lib/Bio/SearchIO/infernal.pm blib/lib/Bio/SearchIO/infernal.pm
cp lib/Bio/Seq/LargePrimarySeq.pm blib/lib/Bio/Seq/LargePrimarySeq.pm
cp lib/Bio/SeqFeature/Amplicon.pm blib/lib/Bio/SeqFeature/Amplicon.pm
cp lib/Bio/Seq/RichSeqI.pm blib/lib/Bio/Seq/RichSeqI.pm
cp lib/Bio/SeqFeature/Gene/Exon.pm blib/lib/Bio/SeqFeature/Gene/Exon.pm
cp lib/Bio/SearchIO/megablast.pm blib/lib/Bio/SearchIO/megablast.pm
cp lib/Bio/Seq/Meta/Array.pm blib/lib/Bio/Seq/Meta/Array.pm
cp lib/Bio/Seq/RichSeq.pm blib/lib/Bio/Seq/RichSeq.pm
cp lib/Bio/Seq/SeqFastaSpeedFactory.pm blib/lib/Bio/Seq/SeqFastaSpeedFactory.pm
cp lib/Bio/Seq/SeqBuilder.pm blib/lib/Bio/Seq/SeqBuilder.pm
cp lib/Bio/Seq/LargeLocatableSeq.pm blib/lib/Bio/Seq/LargeLocatableSeq.pm
cp lib/Bio/Seq/PrimaryQual.pm blib/lib/Bio/Seq/PrimaryQual.pm
cp lib/Bio/SearchIO/exonerate.pm blib/lib/Bio/SearchIO/exonerate.pm
cp lib/Bio/SearchIO/wise.pm blib/lib/Bio/SearchIO/wise.pm
cp lib/Bio/SeqFeature/Computation.pm blib/lib/Bio/SeqFeature/Computation.pm
cp lib/Bio/Seq/TraceI.pm blib/lib/Bio/Seq/TraceI.pm
cp lib/Bio/SeqFeature/AnnotationAdaptor.pm blib/lib/Bio/SeqFeature/AnnotationAdaptor.pm
cp lib/Bio/Seq/MetaI.pm blib/lib/Bio/Seq/MetaI.pm
cp lib/Bio/Seq/Meta.pm blib/lib/Bio/Seq/Meta.pm
cp lib/Bio/SeqFeature/Collection.pm blib/lib/Bio/SeqFeature/Collection.pm
cp lib/Bio/SeqAnalysisParserI.pm blib/lib/Bio/SeqAnalysisParserI.pm
cp lib/Bio/Seq/SeqFactory.pm blib/lib/Bio/Seq/SeqFactory.pm
cp lib/Bio/Seq/SequenceTrace.pm blib/lib/Bio/Seq/SequenceTrace.pm
cp lib/Bio/SearchIO/gmap_f9.pm blib/lib/Bio/SearchIO/gmap_f9.pm
cp lib/Bio/Seq/LargeSeq.pm blib/lib/Bio/Seq/LargeSeq.pm
cp lib/Bio/Seq/SimulatedRead.pm blib/lib/Bio/Seq/SimulatedRead.pm
cp lib/Bio/SearchIO/psl.pm blib/lib/Bio/SearchIO/psl.pm
cp lib/Bio/SearchIO/fasta.pm blib/lib/Bio/SearchIO/fasta.pm
cp lib/Bio/Seq/PrimedSeq.pm blib/lib/Bio/Seq/PrimedSeq.pm
cp lib/Bio/SeqFeature/FeaturePair.pm blib/lib/Bio/SeqFeature/FeaturePair.pm
cp lib/Bio/Seq/Quality.pm blib/lib/Bio/Seq/Quality.pm
cp lib/Bio/Seq.pm blib/lib/Bio/Seq.pm
cp lib/Bio/Seq/EncodedSeq.pm blib/lib/Bio/Seq/EncodedSeq.pm
cp lib/Bio/SeqFeature/CollectionI.pm blib/lib/Bio/SeqFeature/CollectionI.pm
cp lib/Bio/Seq/QualI.pm blib/lib/Bio/Seq/QualI.pm
cp lib/Bio/SearchIO/waba.pm blib/lib/Bio/SearchIO/waba.pm
cp lib/Bio/SearchIO/sim4.pm blib/lib/Bio/SearchIO/sim4.pm
cp lib/Bio/SeqFeature/Lite.pm blib/lib/Bio/SeqFeature/Lite.pm
cp lib/Bio/SeqIO/fastq.pm blib/lib/Bio/SeqIO/fastq.pm
cp lib/Bio/SeqIO/Handler/GenericRichSeqHandler.pm blib/lib/Bio/SeqIO/Handler/GenericRichSeqHandler.pm
cp lib/Bio/SeqIO/ace.pm blib/lib/Bio/SeqIO/ace.pm
cp lib/Bio/SeqFeature/Gene/UTR.pm blib/lib/Bio/SeqFeature/Gene/UTR.pm
cp lib/Bio/SeqFeature/Tools/TypeMapper.pm blib/lib/Bio/SeqFeature/Tools/TypeMapper.pm
cp lib/Bio/SeqIO/bsml_sax.pm blib/lib/Bio/SeqIO/bsml_sax.pm
cp lib/Bio/SeqFeature/SubSeq.pm blib/lib/Bio/SeqFeature/SubSeq.pm
cp lib/Bio/SeqFeature/Generic.pm blib/lib/Bio/SeqFeature/Generic.pm
cp lib/Bio/SeqFeature/SimilarityPair.pm blib/lib/Bio/SeqFeature/SimilarityPair.pm
cp lib/Bio/SeqFeature/Gene/ExonI.pm blib/lib/Bio/SeqFeature/Gene/ExonI.pm
cp lib/Bio/SeqIO/fasta.pm blib/lib/Bio/SeqIO/fasta.pm
cp lib/Bio/SeqFeature/Gene/Intron.pm blib/lib/Bio/SeqFeature/Gene/Intron.pm
cp lib/Bio/SeqFeature/PositionProxy.pm blib/lib/Bio/SeqFeature/PositionProxy.pm
cp lib/Bio/SeqIO/bsml.pm blib/lib/Bio/SeqIO/bsml.pm
cp lib/Bio/SeqFeature/Gene/Promoter.pm blib/lib/Bio/SeqFeature/Gene/Promoter.pm
cp lib/Bio/SeqIO/FTHelper.pm blib/lib/Bio/SeqIO/FTHelper.pm
cp lib/Bio/SeqFeature/Similarity.pm blib/lib/Bio/SeqFeature/Similarity.pm
cp lib/Bio/SeqFeature/Gene/TranscriptI.pm blib/lib/Bio/SeqFeature/Gene/TranscriptI.pm
cp lib/Bio/SeqFeature/Tools/Unflattener.pm blib/lib/Bio/SeqFeature/Tools/Unflattener.pm
cp lib/Bio/SeqIO/MultiFile.pm blib/lib/Bio/SeqIO/MultiFile.pm
cp lib/Bio/SeqFeature/Tools/IDHandler.pm blib/lib/Bio/SeqFeature/Tools/IDHandler.pm
cp lib/Bio/SeqIO/embl.pm blib/lib/Bio/SeqIO/embl.pm
cp lib/Bio/SeqFeature/Gene/GeneStructure.pm blib/lib/Bio/SeqFeature/Gene/GeneStructure.pm
cp lib/Bio/SeqFeature/Primer.pm blib/lib/Bio/SeqFeature/Primer.pm
cp lib/Bio/SeqFeature/Tools/FeatureNamer.pm blib/lib/Bio/SeqFeature/Tools/FeatureNamer.pm
cp lib/Bio/SeqFeature/Gene/NC_Feature.pm blib/lib/Bio/SeqFeature/Gene/NC_Feature.pm
cp lib/Bio/SeqIO/asciitree.pm blib/lib/Bio/SeqIO/asciitree.pm
cp lib/Bio/SeqI.pm blib/lib/Bio/SeqI.pm
cp lib/Bio/SeqFeatureI.pm blib/lib/Bio/SeqFeatureI.pm
cp lib/Bio/SeqFeature/Gene/Transcript.pm blib/lib/Bio/SeqFeature/Gene/Transcript.pm
cp lib/Bio/SeqFeature/Gene/Poly_A_site.pm blib/lib/Bio/SeqFeature/Gene/Poly_A_site.pm
cp lib/Bio/SeqIO.pm blib/lib/Bio/SeqIO.pm
cp lib/Bio/SeqIO/embldriver.pm blib/lib/Bio/SeqIO/embldriver.pm
cp lib/Bio/SeqFeature/TypedSeqFeatureI.pm blib/lib/Bio/SeqFeature/TypedSeqFeatureI.pm
cp lib/Bio/SeqFeature/Gene/GeneStructureI.pm blib/lib/Bio/SeqFeature/Gene/GeneStructureI.pm
cp lib/Bio/Species.pm blib/lib/Bio/Species.pm
cp lib/Bio/SeqIO/game/gameSubs.pm blib/lib/Bio/SeqIO/game/gameSubs.pm
cp lib/Bio/SeqIO/tigr.pm blib/lib/Bio/SeqIO/tigr.pm
cp lib/Bio/Tools/Blat.pm blib/lib/Bio/Tools/Blat.pm
cp lib/Bio/SeqIO/table.pm blib/lib/Bio/SeqIO/table.pm
cp lib/Bio/SeqUtils.pm blib/lib/Bio/SeqUtils.pm
cp lib/Bio/SeqIO/tigrxml.pm blib/lib/Bio/SeqIO/tigrxml.pm
cp lib/Bio/Tools/AmpliconSearch.pm blib/lib/Bio/Tools/AmpliconSearch.pm
cp lib/Bio/SeqIO/scf.pm blib/lib/Bio/SeqIO/scf.pm
cp lib/Bio/SeqIO/kegg.pm blib/lib/Bio/SeqIO/kegg.pm
cp lib/Bio/SeqIO/phd.pm blib/lib/Bio/SeqIO/phd.pm
cp lib/Bio/Taxon.pm blib/lib/Bio/Taxon.pm
cp lib/Bio/SeqIO/gbdriver.pm blib/lib/Bio/SeqIO/gbdriver.pm
cp lib/Bio/SeqIO/mbsout.pm blib/lib/Bio/SeqIO/mbsout.pm
cp lib/Bio/SeqIO/largefasta.pm blib/lib/Bio/SeqIO/largefasta.pm
cp lib/Bio/SeqIO/game.pm blib/lib/Bio/SeqIO/game.pm
cp lib/Bio/SeqIO/game/featHandler.pm blib/lib/Bio/SeqIO/game/featHandler.pm
cp lib/Bio/SeqIO/swiss.pm blib/lib/Bio/SeqIO/swiss.pm
cp lib/Bio/SimpleAnalysisI.pm blib/lib/Bio/SimpleAnalysisI.pm
cp lib/Bio/Tools/Alignment/Trim.pm blib/lib/Bio/Tools/Alignment/Trim.pm
cp lib/Bio/SeqIO/game/gameHandler.pm blib/lib/Bio/SeqIO/game/gameHandler.pm
cp lib/Bio/SeqIO/seqxml.pm blib/lib/Bio/SeqIO/seqxml.pm
cp lib/Bio/SeqIO/gbxml.pm blib/lib/Bio/SeqIO/gbxml.pm
cp lib/Bio/SeqIO/genbank.pm blib/lib/Bio/SeqIO/genbank.pm
cp lib/Bio/SeqIO/raw.pm blib/lib/Bio/SeqIO/raw.pm
cp lib/Bio/SeqIO/locuslink.pm blib/lib/Bio/SeqIO/locuslink.pm
cp lib/Bio/Tools/Alignment/Consed.pm blib/lib/Bio/Tools/Alignment/Consed.pm
cp lib/Bio/Tools/Analysis/SimpleAnalysisBase.pm blib/lib/Bio/Tools/Analysis/SimpleAnalysisBase.pm
cp lib/Bio/SeqIO/game/seqHandler.pm blib/lib/Bio/SeqIO/game/seqHandler.pm
cp lib/Bio/SeqIO/qual.pm blib/lib/Bio/SeqIO/qual.pm
cp lib/Bio/SeqIO/msout.pm blib/lib/Bio/SeqIO/msout.pm
cp lib/Bio/SeqIO/gcg.pm blib/lib/Bio/SeqIO/gcg.pm
cp lib/Bio/SeqIO/pir.pm blib/lib/Bio/SeqIO/pir.pm
cp lib/Bio/SeqIO/game/gameWriter.pm blib/lib/Bio/SeqIO/game/gameWriter.pm
cp lib/Bio/SeqIO/swissdriver.pm blib/lib/Bio/SeqIO/swissdriver.pm
cp lib/Bio/SeqIO/tinyseq.pm blib/lib/Bio/SeqIO/tinyseq.pm
cp lib/Bio/SeqIO/tinyseq/tinyseqHandler.pm blib/lib/Bio/SeqIO/tinyseq/tinyseqHandler.pm
cp lib/Bio/SimpleAlign.pm blib/lib/Bio/SimpleAlign.pm
cp lib/Bio/Tools/AnalysisResult.pm blib/lib/Bio/Tools/AnalysisResult.pm
cp lib/Bio/SeqIO/metafasta.pm blib/lib/Bio/SeqIO/metafasta.pm
cp lib/Bio/SeqIO/tab.pm blib/lib/Bio/SeqIO/tab.pm
cp lib/Bio/Tools/Phylo/Molphy.pm blib/lib/Bio/Tools/Phylo/Molphy.pm
cp lib/Bio/Tools/EMBOSS/Palindrome.pm blib/lib/Bio/Tools/EMBOSS/Palindrome.pm
cp lib/Bio/Tools/Genemark.pm blib/lib/Bio/Tools/Genemark.pm
cp lib/Bio/Tools/Glimmer.pm blib/lib/Bio/Tools/Glimmer.pm
cp lib/Bio/Tools/ECnumber.pm blib/lib/Bio/Tools/ECnumber.pm
cp lib/Bio/Tools/Geneid.pm blib/lib/Bio/Tools/Geneid.pm
cp lib/Bio/Tools/Prediction/Gene.pm blib/lib/Bio/Tools/Prediction/Gene.pm
cp lib/Bio/Tools/EPCR.pm blib/lib/Bio/Tools/EPCR.pm
cp lib/Bio/Tools/CodonTable.pm blib/lib/Bio/Tools/CodonTable.pm
cp lib/Bio/Tools/Primer/Feature.pm blib/lib/Bio/Tools/Primer/Feature.pm
cp lib/Bio/Tools/Genscan.pm blib/lib/Bio/Tools/Genscan.pm
cp lib/Bio/Tools/Eponine.pm blib/lib/Bio/Tools/Eponine.pm
cp lib/Bio/Tools/MZEF.pm blib/lib/Bio/Tools/MZEF.pm
cp lib/Bio/Tools/Primer/Assessor/Base.pm blib/lib/Bio/Tools/Primer/Assessor/Base.pm
cp lib/Bio/Tools/FootPrinter.pm blib/lib/Bio/Tools/FootPrinter.pm
cp lib/Bio/Tools/Prints.pm blib/lib/Bio/Tools/Prints.pm
cp lib/Bio/Tools/Profile.pm blib/lib/Bio/Tools/Profile.pm
cp lib/Bio/Tools/Coil.pm blib/lib/Bio/Tools/Coil.pm
cp lib/Bio/Tools/Phylo/Gerp.pm blib/lib/Bio/Tools/Phylo/Gerp.pm
cp lib/Bio/Tools/Prediction/Exon.pm blib/lib/Bio/Tools/Prediction/Exon.pm
cp lib/Bio/Tools/OddCodes.pm blib/lib/Bio/Tools/OddCodes.pm
cp lib/Bio/Tools/ESTScan.pm blib/lib/Bio/Tools/ESTScan.pm
cp lib/Bio/Tools/GFF.pm blib/lib/Bio/Tools/GFF.pm
cp lib/Bio/Tools/Primer/AssessorI.pm blib/lib/Bio/Tools/Primer/AssessorI.pm
cp lib/Bio/Tools/Promoterwise.pm blib/lib/Bio/Tools/Promoterwise.pm
cp lib/Bio/Tools/Lucy.pm blib/lib/Bio/Tools/Lucy.pm
cp lib/Bio/Tools/Est2Genome.pm blib/lib/Bio/Tools/Est2Genome.pm
cp lib/Bio/Tools/Genewise.pm blib/lib/Bio/Tools/Genewise.pm
cp lib/Bio/Tools/Phylo/Molphy/Result.pm blib/lib/Bio/Tools/Phylo/Molphy/Result.pm
cp lib/Bio/Tools/GuessSeqFormat.pm blib/lib/Bio/Tools/GuessSeqFormat.pm
cp lib/Bio/Tools/Match.pm blib/lib/Bio/Tools/Match.pm
cp lib/Bio/Tools/Pseudowise.pm blib/lib/Bio/Tools/Pseudowise.pm
cp lib/Bio/Tools/Phylo/Phylip/ProtDist.pm blib/lib/Bio/Tools/Phylo/Phylip/ProtDist.pm
cp lib/Bio/Tools/Genomewise.pm blib/lib/Bio/Tools/Genomewise.pm
cp lib/Bio/Tools/IUPAC.pm blib/lib/Bio/Tools/IUPAC.pm
cp lib/Bio/Tools/PrositeScan.pm blib/lib/Bio/Tools/PrositeScan.pm
cp lib/Bio/Tools/Grail.pm blib/lib/Bio/Tools/Grail.pm
cp lib/Bio/Tools/Fgenesh.pm blib/lib/Bio/Tools/Fgenesh.pm
cp lib/Bio/Tools/Primer3.pm blib/lib/Bio/Tools/Primer3.pm
cp lib/Bio/Tools/Primer/Pair.pm blib/lib/Bio/Tools/Primer/Pair.pm
cp lib/Bio/Tree/RandomFactory.pm blib/lib/Bio/Tree/RandomFactory.pm
cp lib/Bio/Tools/tRNAscanSE.pm blib/lib/Bio/Tools/tRNAscanSE.pm
cp lib/Bio/Tools/Run/GenericParameters.pm blib/lib/Bio/Tools/Run/GenericParameters.pm
cp lib/Bio/Tools/TargetP.pm blib/lib/Bio/Tools/TargetP.pm
cp lib/Bio/Tools/SeqPattern/Backtranslate.pm blib/lib/Bio/Tools/SeqPattern/Backtranslate.pm
cp lib/Bio/Tools/RandomDistFunctions.pm blib/lib/Bio/Tools/RandomDistFunctions.pm
cp lib/Bio/Tools/isPcr.pm blib/lib/Bio/Tools/isPcr.pm
cp lib/Bio/Tools/TandemRepeatsFinder.pm blib/lib/Bio/Tools/TandemRepeatsFinder.pm
cp lib/Bio/Tools/Run/AnalysisFactory.pm blib/lib/Bio/Tools/Run/AnalysisFactory.pm
cp lib/Bio/Tools/QRNA.pm blib/lib/Bio/Tools/QRNA.pm
cp lib/Bio/Tools/Signalp/ExtendedSignalp.pm blib/lib/Bio/Tools/Signalp/ExtendedSignalp.pm
cp lib/Bio/Tree/Statistics.pm blib/lib/Bio/Tree/Statistics.pm
cp lib/Bio/Tools/Seg.pm blib/lib/Bio/Tools/Seg.pm
cp lib/Bio/Tools/SeqPattern.pm blib/lib/Bio/Tools/SeqPattern.pm
cp lib/Bio/Tools/Run/Analysis.pm blib/lib/Bio/Tools/Run/Analysis.pm
cp lib/Bio/Tools/Run/WrapperBase.pm blib/lib/Bio/Tools/Run/WrapperBase.pm
cp lib/Bio/Tree/DistanceFactory.pm blib/lib/Bio/Tree/DistanceFactory.pm
cp lib/Bio/Tree/Tree.pm blib/lib/Bio/Tree/Tree.pm
cp lib/Bio/Tools/Sim4/Exon.pm blib/lib/Bio/Tools/Sim4/Exon.pm
cp lib/Bio/Tools/Run/ParametersI.pm blib/lib/Bio/Tools/Run/ParametersI.pm
cp lib/Bio/Tools/SeqWords.pm blib/lib/Bio/Tools/SeqWords.pm
cp lib/Bio/Tools/Spidey/Exon.pm blib/lib/Bio/Tools/Spidey/Exon.pm
cp lib/Bio/Tools/pICalculator.pm blib/lib/Bio/Tools/pICalculator.pm
cp lib/Bio/Tools/Tmhmm.pm blib/lib/Bio/Tools/Tmhmm.pm
cp lib/Bio/Tools/SeqStats.pm blib/lib/Bio/Tools/SeqStats.pm
cp lib/Bio/Tools/Sim4/Results.pm blib/lib/Bio/Tools/Sim4/Results.pm
cp lib/Bio/Tree/NodeNHX.pm blib/lib/Bio/Tree/NodeNHX.pm
cp lib/Bio/Tools/RepeatMasker.pm blib/lib/Bio/Tools/RepeatMasker.pm
cp lib/Bio/Tree/Node.pm blib/lib/Bio/Tree/Node.pm
cp lib/Bio/Tools/Signalp.pm blib/lib/Bio/Tools/Signalp.pm
cp lib/Bio/Tools/ipcress.pm blib/lib/Bio/Tools/ipcress.pm
cp lib/Bio/Tools/Run/Phylo/PhyloBase.pm blib/lib/Bio/Tools/Run/Phylo/PhyloBase.pm
cp lib/Bio/Tools/Run/WrapperBase/CommandExts.pm blib/lib/Bio/Tools/Run/WrapperBase/CommandExts.pm
cp lib/Bio/Tools/Spidey/Results.pm blib/lib/Bio/Tools/Spidey/Results.pm
cp lib/Bio/Tree/AnnotatableNode.pm blib/lib/Bio/Tree/AnnotatableNode.pm
cp lib/Bio/Tree/Compatible.pm blib/lib/Bio/Tree/Compatible.pm
cp lib/Bio/Tools/Sigcleave.pm blib/lib/Bio/Tools/Sigcleave.pm
cp lib/Bio/Tree/NodeI.pm blib/lib/Bio/Tree/NodeI.pm
cp lib/Bio/WebAgent.pm blib/lib/Bio/WebAgent.pm
cp lib/Bio/TreeIO/pag.pm blib/lib/Bio/TreeIO/pag.pm
cp lib/Bio/TreeIO/tabtree.pm blib/lib/Bio/TreeIO/tabtree.pm
cp lib/Bio/Tree/TreeI.pm blib/lib/Bio/Tree/TreeI.pm
cp lib/Bio/Tree/TreeFunctionsI.pm blib/lib/Bio/Tree/TreeFunctionsI.pm
cp lib/Bio/TreeIO.pm blib/lib/Bio/TreeIO.pm
cp lib/Bio/TreeIO/phyloxml.pm blib/lib/Bio/TreeIO/phyloxml.pm
cp lib/Bio/UpdateableSeqI.pm blib/lib/Bio/UpdateableSeqI.pm
cp lib/Bio/TreeIO/NewickParser.pm blib/lib/Bio/TreeIO/NewickParser.pm
cp lib/Bio/TreeIO/cluster.pm blib/lib/Bio/TreeIO/cluster.pm
cp lib/Bio/TreeIO/lintree.pm blib/lib/Bio/TreeIO/lintree.pm
cp lib/BioPerl.pm blib/lib/BioPerl.pm
cp lib/Bio/TreeIO/nhx.pm blib/lib/Bio/TreeIO/nhx.pm
cp lib/Bio/TreeIO/TreeEventBuilder.pm blib/lib/Bio/TreeIO/TreeEventBuilder.pm
cp lib/Bio/TreeIO/nexus.pm blib/lib/Bio/TreeIO/nexus.pm
cp lib/Bio/TreeIO/newick.pm blib/lib/Bio/TreeIO/newick.pm
cp bin/bp_aacomp blib/script/bp_aacomp
cp bin/bp_bioflat_index blib/script/bp_bioflat_index
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_aacomp
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_bioflat_index
cp bin/bp_biogetseq blib/script/bp_biogetseq
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_biogetseq
cp bin/bp_dbsplit blib/script/bp_dbsplit
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_dbsplit
cp bin/bp_extract_feature_seq blib/script/bp_extract_feature_seq
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_extract_feature_seq
cp bin/bp_fastam9_to_table blib/script/bp_fastam9_to_table
cp bin/bp_fetch blib/script/bp_fetch
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_fastam9_to_table
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_fetch
cp bin/bp_filter_search blib/script/bp_filter_search
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_filter_search
cp bin/bp_find-blast-matches blib/script/bp_find-blast-matches
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_find-blast-matches
cp bin/bp_gccalc blib/script/bp_gccalc
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_gccalc
cp bin/bp_genbank2gff3 blib/script/bp_genbank2gff3
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_genbank2gff3
cp bin/bp_index blib/script/bp_index
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_index
cp bin/bp_local_taxonomydb_query blib/script/bp_local_taxonomydb_query
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_local_taxonomydb_query
cp bin/bp_make_mrna_protein blib/script/bp_make_mrna_protein
cp bin/bp_mask_by_search blib/script/bp_mask_by_search
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_make_mrna_protein
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_mask_by_search
cp bin/bp_mrtrans blib/script/bp_mrtrans
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_mrtrans
cp bin/bp_mutate blib/script/bp_mutate
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_mutate
cp bin/bp_nexus2nh blib/script/bp_nexus2nh
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_nexus2nh
cp bin/bp_nrdb blib/script/bp_nrdb
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_nrdb
cp bin/bp_oligo_count blib/script/bp_oligo_count
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_oligo_count
cp bin/bp_process_gadfly blib/script/bp_process_gadfly
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_process_gadfly
cp bin/bp_process_sgd blib/script/bp_process_sgd
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_process_sgd
cp bin/bp_revtrans-motif blib/script/bp_revtrans-motif
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_revtrans-motif
cp bin/bp_search2alnblocks blib/script/bp_search2alnblocks
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2alnblocks
cp bin/bp_search2gff blib/script/bp_search2gff
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2gff
cp bin/bp_search2table blib/script/bp_search2table
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2table
cp bin/bp_search2tribe blib/script/bp_search2tribe
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_search2tribe
cp bin/bp_seq_length blib/script/bp_seq_length
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seq_length
cp bin/bp_seqconvert blib/script/bp_seqconvert
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqconvert
cp bin/bp_seqcut blib/script/bp_seqcut
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqcut
cp bin/bp_seqpart blib/script/bp_seqpart
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqpart
cp bin/bp_seqret blib/script/bp_seqret
cp bin/bp_seqretsplit blib/script/bp_seqretsplit
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqret
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_seqretsplit
cp bin/bp_split_seq blib/script/bp_split_seq
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_split_seq
cp bin/bp_sreformat blib/script/bp_sreformat
cp bin/bp_taxid4species blib/script/bp_taxid4species
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_sreformat
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_taxid4species
cp bin/bp_taxonomy2tree blib/script/bp_taxonomy2tree
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_taxonomy2tree
cp bin/bp_translate_seq blib/script/bp_translate_seq
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_translate_seq
cp bin/bp_tree2pag blib/script/bp_tree2pag
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_tree2pag
cp bin/bp_unflatten_seq blib/script/bp_unflatten_seq
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bp_unflatten_seq
Manifying 40 pod documents
Manifying 35 pod documents
Manifying 33 pod documents
Manifying 32 pod documents
Manifying 34 pod documents
Manifying 32 pod documents
Manifying 32 pod documents
Manifying 30 pod documents
Manifying 27 pod documents
Manifying 35 pod documents
Manifying 29 pod documents
Manifying 35 pod documents
Manifying 36 pod documents
Manifying 33 pod documents
Manifying 33 pod documents
Manifying 15 pod documents
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_auto_test
	make -j2 test TEST_VERBOSE=1
make[1]: Entering directory '/<<PKGBUILDDIR>>'
PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/Align/*.t t/AlignIO/*.t t/Annotation/*.t t/LocalDB/*.t t/LocalDB/Index/*.t t/LocalDB/Taxonomy/*.t t/Matrix/*.t t/Matrix/IO/*.t t/Ontology/*.t t/Ontology/IO/*.t t/RemoteDB/*.t t/Root/*.t t/SearchIO/*.t t/SearchIO/Writer/*.t t/Seq/*.t t/SeqFeature/*.t t/SeqIO/*.t t/SeqTools/*.t t/Tools/*.t t/Tools/Alignment/*.t t/Tools/EMBOSS/*.t t/Tools/Phylo/*.t t/Tools/Phylo/Phylip/*.t t/Tools/Signalp/*.t t/Tools/Spidey/*.t t/Tree/*.t t/Tree/TreeIO/*.t
Attempt to call undefined import method with arguments ("dumpValue") via package "Dumpvalue" (Perhaps you forgot to load the package?) at /<<PKGBUILDDIR>>/blib/lib/Bio/Tools/Alignment/Consed.pm line 114.
Attempt to call undefined import method with arguments ("new") via package "Bio::SearchIO" (Perhaps you forgot to load the package?) at bin/bp_find-blast-matches line 120.Attempt to call undefined import method with arguments ("new") via package "Bio::Seq" (Perhaps you forgot to load the package?) at bin/bp_find-blast-matches line 121.Attempt to call undefined import method with arguments ("new") via package "Bio::SeqIO" (Perhaps you forgot to load the package?) at bin/bp_find-blast-matches line 122. at t/00-compile.t line 596, <GEN1916> line 4.
t/00-compile.t ...................... 
1..511
ok 1 - Bio/Align/AlignI.pm loaded ok
ok 2 - Bio/Align/DNAStatistics.pm loaded ok
ok 3 - Bio/Align/PairwiseStatistics.pm loaded ok
ok 4 - Bio/Align/ProteinStatistics.pm loaded ok
ok 5 - Bio/Align/StatisticsI.pm loaded ok
ok 6 - Bio/Align/Utilities.pm loaded ok
ok 7 - Bio/AlignIO.pm loaded ok
ok 8 - Bio/AlignIO/Handler/GenericAlignHandler.pm loaded ok
ok 9 - Bio/AlignIO/arp.pm loaded ok
ok 10 - Bio/AlignIO/bl2seq.pm loaded ok
ok 11 - Bio/AlignIO/clustalw.pm loaded ok
ok 12 - Bio/AlignIO/emboss.pm loaded ok
ok 13 - Bio/AlignIO/fasta.pm loaded ok
ok 14 - Bio/AlignIO/largemultifasta.pm loaded ok
ok 15 - Bio/AlignIO/maf.pm loaded ok
ok 16 - Bio/AlignIO/mase.pm loaded ok
ok 17 - Bio/AlignIO/mega.pm loaded ok
ok 18 - Bio/AlignIO/meme.pm loaded ok
ok 19 - Bio/AlignIO/metafasta.pm loaded ok
ok 20 - Bio/AlignIO/msf.pm loaded ok
ok 21 - Bio/AlignIO/nexus.pm loaded ok
ok 22 - Bio/AlignIO/pfam.pm loaded ok
ok 23 - Bio/AlignIO/phylip.pm loaded ok
ok 24 - Bio/AlignIO/po.pm loaded ok
ok 25 - Bio/AlignIO/proda.pm loaded ok
ok 26 - Bio/AlignIO/prodom.pm loaded ok
ok 27 - Bio/AlignIO/psi.pm loaded ok
ok 28 - Bio/AlignIO/selex.pm loaded ok
ok 29 - Bio/AlignIO/xmfa.pm loaded ok
ok 30 - Bio/AnalysisI.pm loaded ok
ok 31 - Bio/AnalysisParserI.pm loaded ok
ok 32 - Bio/AnalysisResultI.pm loaded ok
ok 33 - Bio/AnnotatableI.pm loaded ok
ok 34 - Bio/Annotation/AnnotationFactory.pm loaded ok
ok 35 - Bio/Annotation/Collection.pm loaded ok
ok 36 - Bio/Annotation/Comment.pm loaded ok
ok 37 - Bio/Annotation/DBLink.pm loaded ok
ok 38 - Bio/Annotation/OntologyTerm.pm loaded ok
ok 39 - Bio/Annotation/Reference.pm loaded ok
ok 40 - Bio/Annotation/Relation.pm loaded ok
ok 41 - Bio/Annotation/SimpleValue.pm loaded ok
ok 42 - Bio/Annotation/StructuredValue.pm loaded ok
ok 43 - Bio/Annotation/TagTree.pm loaded ok
ok 44 - Bio/Annotation/Target.pm loaded ok
ok 45 - Bio/Annotation/Tree.pm loaded ok
ok 46 - Bio/Annotation/TypeManager.pm loaded ok
ok 47 - Bio/AnnotationCollectionI.pm loaded ok
ok 48 - Bio/AnnotationI.pm loaded ok
ok 49 - Bio/CodonUsage/IO.pm loaded ok
ok 50 - Bio/CodonUsage/Table.pm loaded ok
ok 51 - Bio/DB/DBFetch.pm loaded ok
ok 52 - Bio/DB/Failover.pm loaded ok
ok 53 - Bio/DB/Fasta.pm loaded ok
ok 54 - Bio/DB/FileCache.pm loaded ok
ok 55 - Bio/DB/Flat.pm loaded ok
ok 56 - Bio/DB/Flat/BDB.pm loaded ok
ok 57 - Bio/DB/Flat/BDB/embl.pm loaded ok
ok 58 - Bio/DB/Flat/BDB/fasta.pm loaded ok
ok 59 - Bio/DB/Flat/BDB/genbank.pm loaded ok
ok 60 - Bio/DB/Flat/BDB/swiss.pm loaded ok
ok 61 - Bio/DB/Flat/BinarySearch.pm loaded ok
ok 62 - Bio/DB/GFF/Util/Binning.pm loaded ok
ok 63 - Bio/DB/GFF/Util/Rearrange.pm loaded ok
ok 64 - Bio/DB/GenericWebAgent.pm loaded ok
ok 65 - Bio/DB/InMemoryCache.pm loaded ok
ok 66 - Bio/DB/IndexedBase.pm loaded ok
ok 67 - Bio/DB/LocationI.pm loaded ok
ok 68 - Bio/DB/Qual.pm loaded ok
ok 69 - Bio/DB/Query/WebQuery.pm loaded ok
ok 70 - Bio/DB/QueryI.pm loaded ok
ok 71 - Bio/DB/RandomAccessI.pm loaded ok
ok 72 - Bio/DB/ReferenceI.pm loaded ok
ok 73 - Bio/DB/Registry.pm loaded ok
ok 74 - Bio/DB/SeqI.pm loaded ok
ok 75 - Bio/DB/Taxonomy.pm loaded ok
ok 76 - Bio/DB/Taxonomy/flatfile.pm loaded ok
ok 77 - Bio/DB/Taxonomy/greengenes.pm loaded ok
ok 78 - Bio/DB/Taxonomy/list.pm loaded ok
ok 79 - Bio/DB/Taxonomy/silva.pm loaded ok
ok 80 - Bio/DB/UpdateableSeqI.pm loaded ok
ok 81 - Bio/DB/WebDBSeqI.pm loaded ok
ok 82 - Bio/DBLinkContainerI.pm loaded ok
ok 83 - Bio/Das/FeatureTypeI.pm loaded ok
ok 84 - Bio/Das/SegmentI.pm loaded ok
ok 85 - Bio/DasI.pm loaded ok
ok 86 - Bio/DescribableI.pm loaded ok
ok 87 - Bio/Event/EventGeneratorI.pm loaded ok
ok 88 - Bio/Event/EventHandlerI.pm loaded ok
ok 89 - Bio/Factory/AnalysisI.pm loaded ok
ok 90 - Bio/Factory/ApplicationFactoryI.pm loaded ok
ok 91 - Bio/Factory/DriverFactory.pm loaded ok
ok 92 - Bio/Factory/FTLocationFactory.pm loaded ok
ok 93 - Bio/Factory/LocationFactoryI.pm loaded ok
ok 94 - Bio/Factory/ObjectBuilderI.pm loaded ok
ok 95 - Bio/Factory/ObjectFactory.pm loaded ok
ok 96 - Bio/Factory/ObjectFactoryI.pm loaded ok
ok 97 - Bio/Factory/SeqAnalysisParserFactory.pm loaded ok
ok 98 - Bio/Factory/SeqAnalysisParserFactoryI.pm loaded ok
ok 99 - Bio/Factory/SequenceFactoryI.pm loaded ok
ok 100 - Bio/Factory/SequenceProcessorI.pm loaded ok
ok 101 - Bio/Factory/SequenceStreamI.pm loaded ok
ok 102 - Bio/Factory/TreeFactoryI.pm loaded ok
ok 103 - Bio/FeatureHolderI.pm loaded ok
ok 104 - Bio/HandlerBaseI.pm loaded ok
ok 105 - Bio/IdCollectionI.pm loaded ok
ok 106 - Bio/IdentifiableI.pm loaded ok
ok 107 - Bio/Index/Abstract.pm loaded ok
ok 108 - Bio/Index/AbstractSeq.pm loaded ok
ok 109 - Bio/Index/Blast.pm loaded ok
ok 110 - Bio/Index/BlastTable.pm loaded ok
ok 111 - Bio/Index/EMBL.pm loaded ok
ok 112 - Bio/Index/Fasta.pm loaded ok
ok 113 - Bio/Index/Fastq.pm loaded ok
ok 114 - Bio/Index/GenBank.pm loaded ok
ok 115 - Bio/Index/Qual.pm loaded ok
ok 116 - Bio/Index/SwissPfam.pm loaded ok
ok 117 - Bio/Index/Swissprot.pm loaded ok
ok 118 - Bio/LocatableSeq.pm loaded ok
ok 119 - Bio/Location/Atomic.pm loaded ok
ok 120 - Bio/Location/AvWithinCoordPolicy.pm loaded ok
ok 121 - Bio/Location/CoordinatePolicyI.pm loaded ok
ok 122 - Bio/Location/Fuzzy.pm loaded ok
ok 123 - Bio/Location/FuzzyLocationI.pm loaded ok
ok 124 - Bio/Location/NarrowestCoordPolicy.pm loaded ok
ok 125 - Bio/Location/Simple.pm loaded ok
ok 126 - Bio/Location/Split.pm loaded ok
ok 127 - Bio/Location/SplitLocationI.pm loaded ok
ok 128 - Bio/Location/WidestCoordPolicy.pm loaded ok
ok 129 - Bio/LocationI.pm loaded ok
ok 130 - Bio/Matrix/Generic.pm loaded ok
ok 131 - Bio/Matrix/IO.pm loaded ok
ok 132 - Bio/Matrix/IO/mlagan.pm loaded ok
ok 133 - Bio/Matrix/IO/phylip.pm loaded ok
ok 134 - Bio/Matrix/IO/scoring.pm loaded ok
ok 135 - Bio/Matrix/MatrixI.pm loaded ok
ok 136 - Bio/Matrix/Mlagan.pm loaded ok
ok 137 - Bio/Matrix/PSM/IO.pm loaded ok
ok 138 - Bio/Matrix/PSM/IO/mast.pm loaded ok
ok 139 - Bio/Matrix/PSM/IO/masta.pm loaded ok
ok 140 - Bio/Matrix/PSM/IO/meme.pm loaded ok
ok 141 - Bio/Matrix/PSM/IO/psiblast.pm loaded ok
ok 142 - Bio/Matrix/PSM/IO/transfac.pm loaded ok
ok 143 - Bio/Matrix/PSM/InstanceSite.pm loaded ok
ok 144 - Bio/Matrix/PSM/InstanceSiteI.pm loaded ok
ok 145 - Bio/Matrix/PSM/ProtMatrix.pm loaded ok
ok 146 - Bio/Matrix/PSM/ProtPsm.pm loaded ok
ok 147 - Bio/Matrix/PSM/Psm.pm loaded ok
ok 148 - Bio/Matrix/PSM/PsmHeader.pm loaded ok
ok 149 - Bio/Matrix/PSM/PsmHeaderI.pm loaded ok
ok 150 - Bio/Matrix/PSM/PsmI.pm loaded ok
ok 151 - Bio/Matrix/PSM/SiteMatrix.pm loaded ok
ok 152 - Bio/Matrix/PSM/SiteMatrixI.pm loaded ok
ok 153 - Bio/Matrix/PhylipDist.pm loaded ok
ok 154 - Bio/Matrix/Scoring.pm loaded ok
ok 155 - Bio/Ontology/DocumentRegistry.pm loaded ok
ok 156 - Bio/Ontology/GOterm.pm loaded ok
ok 157 - Bio/Ontology/InterProTerm.pm loaded ok
ok 158 - Bio/Ontology/OBOEngine.pm loaded ok
ok 159 - Bio/Ontology/OBOterm.pm loaded ok
ok 160 - Bio/Ontology/Ontology.pm loaded ok
ok 161 - Bio/Ontology/OntologyEngineI.pm loaded ok
ok 162 - Bio/Ontology/OntologyI.pm loaded ok
ok 163 - Bio/Ontology/OntologyStore.pm loaded ok
ok 164 - Bio/Ontology/Path.pm loaded ok
ok 165 - Bio/Ontology/PathI.pm loaded ok
ok 166 - Bio/Ontology/Relationship.pm loaded ok
ok 167 - Bio/Ontology/RelationshipFactory.pm loaded ok
ok 168 - Bio/Ontology/RelationshipI.pm loaded ok
ok 169 - Bio/Ontology/RelationshipType.pm loaded ok
ok 170 - Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm loaded ok
ok 171 - Bio/Ontology/SimpleOntologyEngine.pm loaded ok
ok 172 - Bio/Ontology/Term.pm loaded ok
ok 173 - Bio/Ontology/TermFactory.pm loaded ok
ok 174 - Bio/Ontology/TermI.pm loaded ok
ok 175 - Bio/OntologyIO.pm loaded ok
ok 176 - Bio/OntologyIO/Handlers/BaseSAXHandler.pm loaded ok
ok 177 - Bio/OntologyIO/Handlers/InterProHandler.pm loaded ok
ok 178 - Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm loaded ok
ok 179 - Bio/OntologyIO/InterProParser.pm loaded ok
ok 180 - Bio/OntologyIO/dagflat.pm loaded ok
ok 181 - Bio/OntologyIO/goflat.pm loaded ok
ok 182 - Bio/OntologyIO/obo.pm loaded ok
ok 183 - Bio/OntologyIO/simplehierarchy.pm loaded ok
ok 184 - Bio/OntologyIO/soflat.pm loaded ok
ok 185 - Bio/ParameterBaseI.pm loaded ok
ok 186 - Bio/PrimarySeq.pm loaded ok
ok 187 - Bio/PrimarySeqI.pm loaded ok
ok 188 - Bio/PullParserI.pm loaded ok
ok 189 - Bio/Range.pm loaded ok
ok 190 - Bio/RangeI.pm loaded ok
ok 191 - Bio/Root/Exception.pm loaded ok
ok 192 - Bio/Root/HTTPget.pm loaded ok
ok 193 - Bio/Root/IO.pm loaded ok
ok 194 - Bio/Root/Root.pm loaded ok
ok 195 - Bio/Root/RootI.pm loaded ok
ok 196 - Bio/Root/Storable.pm loaded ok
ok 197 - Bio/Root/Test.pm loaded ok
ok 198 - Bio/Root/TestObject.pm loaded ok
ok 199 - Bio/Root/Utilities.pm loaded ok
ok 200 - Bio/Root/Version.pm loaded ok
ok 201 - Bio/Search/BlastStatistics.pm loaded ok
ok 202 - Bio/Search/BlastUtils.pm loaded ok
ok 203 - Bio/Search/DatabaseI.pm loaded ok
ok 204 - Bio/Search/GenericDatabase.pm loaded ok
ok 205 - Bio/Search/GenericStatistics.pm loaded ok
ok 206 - Bio/Search/HSP/BlastHSP.pm loaded ok
ok 207 - Bio/Search/HSP/BlastPullHSP.pm loaded ok
ok 208 - Bio/Search/HSP/FastaHSP.pm loaded ok
ok 209 - Bio/Search/HSP/GenericHSP.pm loaded ok
ok 210 - Bio/Search/HSP/HSPFactory.pm loaded ok
ok 211 - Bio/Search/HSP/HSPI.pm loaded ok
ok 212 - Bio/Search/HSP/ModelHSP.pm loaded ok
ok 213 - Bio/Search/HSP/PSLHSP.pm loaded ok
ok 214 - Bio/Search/HSP/PsiBlastHSP.pm loaded ok
ok 215 - Bio/Search/HSP/PullHSPI.pm loaded ok
ok 216 - Bio/Search/HSP/WABAHSP.pm loaded ok
ok 217 - Bio/Search/Hit/BlastHit.pm loaded ok
ok 218 - Bio/Search/Hit/BlastPullHit.pm loaded ok
ok 219 - Bio/Search/Hit/Fasta.pm loaded ok
ok 220 - Bio/Search/Hit/GenericHit.pm loaded ok
ok 221 - Bio/Search/Hit/HitFactory.pm loaded ok
ok 222 - Bio/Search/Hit/HitI.pm loaded ok
ok 223 - Bio/Search/Hit/ModelHit.pm loaded ok
ok 224 - Bio/Search/Hit/PsiBlastHit.pm loaded ok
ok 225 - Bio/Search/Hit/PullHitI.pm loaded ok
ok 226 - Bio/Search/Iteration/GenericIteration.pm loaded ok
ok 227 - Bio/Search/Iteration/IterationI.pm loaded ok
ok 228 - Bio/Search/Processor.pm loaded ok
ok 229 - Bio/Search/Result/BlastPullResult.pm loaded ok
ok 230 - Bio/Search/Result/BlastResult.pm loaded ok
ok 231 - Bio/Search/Result/CrossMatchResult.pm loaded ok
ok 232 - Bio/Search/Result/GenericResult.pm loaded ok
ok 233 - Bio/Search/Result/INFERNALResult.pm loaded ok
ok 234 - Bio/Search/Result/PullResultI.pm loaded ok
ok 235 - Bio/Search/Result/ResultFactory.pm loaded ok
ok 236 - Bio/Search/Result/ResultI.pm loaded ok
ok 237 - Bio/Search/Result/WABAResult.pm loaded ok
ok 238 - Bio/Search/SearchUtils.pm loaded ok
ok 239 - Bio/Search/StatisticsI.pm loaded ok
ok 240 - Bio/Search/Tiling/MapTileUtils.pm loaded ok
ok 241 - Bio/Search/Tiling/MapTiling.pm loaded ok
ok 242 - Bio/Search/Tiling/TilingI.pm loaded ok
ok 243 - Bio/SearchIO.pm loaded ok
ok 244 - Bio/SearchIO/EventHandlerI.pm loaded ok
ok 245 - Bio/SearchIO/FastHitEventBuilder.pm loaded ok
ok 246 - Bio/SearchIO/IteratedSearchResultEventBuilder.pm loaded ok
ok 247 - Bio/SearchIO/SearchResultEventBuilder.pm loaded ok
ok 248 - Bio/SearchIO/SearchWriterI.pm loaded ok
ok 249 - Bio/SearchIO/Writer/GbrowseGFF.pm loaded ok
ok 250 - Bio/SearchIO/Writer/HSPTableWriter.pm loaded ok
ok 251 - Bio/SearchIO/Writer/HTMLResultWriter.pm loaded ok
ok 252 - Bio/SearchIO/Writer/HitTableWriter.pm loaded ok
ok 253 - Bio/SearchIO/Writer/ResultTableWriter.pm loaded ok
ok 254 - Bio/SearchIO/Writer/TextResultWriter.pm loaded ok
ok 255 - Bio/SearchIO/axt.pm loaded ok
ok 256 - Bio/SearchIO/blast.pm loaded ok
ok 257 - Bio/SearchIO/blast_pull.pm loaded ok
ok 258 - Bio/SearchIO/blasttable.pm loaded ok
ok 259 - Bio/SearchIO/cross_match.pm loaded ok
ok 260 - Bio/SearchIO/erpin.pm loaded ok
ok 261 - Bio/SearchIO/exonerate.pm loaded ok
ok 262 - Bio/SearchIO/fasta.pm loaded ok
ok 263 - Bio/SearchIO/gmap_f9.pm loaded ok
ok 264 - Bio/SearchIO/infernal.pm loaded ok
ok 265 - Bio/SearchIO/megablast.pm loaded ok
ok 266 - Bio/SearchIO/psl.pm loaded ok
ok 267 - Bio/SearchIO/rnamotif.pm loaded ok
ok 268 - Bio/SearchIO/sim4.pm loaded ok
ok 269 - Bio/SearchIO/waba.pm loaded ok
ok 270 - Bio/SearchIO/wise.pm loaded ok
ok 271 - Bio/Seq.pm loaded ok
ok 272 - Bio/Seq/BaseSeqProcessor.pm loaded ok
ok 273 - Bio/Seq/EncodedSeq.pm loaded ok
ok 274 - Bio/Seq/LargeLocatableSeq.pm loaded ok
ok 275 - Bio/Seq/LargePrimarySeq.pm loaded ok
ok 276 - Bio/Seq/LargeSeq.pm loaded ok
ok 277 - Bio/Seq/LargeSeqI.pm loaded ok
ok 278 - Bio/Seq/Meta.pm loaded ok
ok 279 - Bio/Seq/Meta/Array.pm loaded ok
ok 280 - Bio/Seq/MetaI.pm loaded ok
ok 281 - Bio/Seq/PrimaryQual.pm loaded ok
ok 282 - Bio/Seq/PrimedSeq.pm loaded ok
ok 283 - Bio/Seq/QualI.pm loaded ok
ok 284 - Bio/Seq/Quality.pm loaded ok
ok 285 - Bio/Seq/RichSeq.pm loaded ok
ok 286 - Bio/Seq/RichSeqI.pm loaded ok
ok 287 - Bio/Seq/SeqBuilder.pm loaded ok
ok 288 - Bio/Seq/SeqFactory.pm loaded ok
ok 289 - Bio/Seq/SeqFastaSpeedFactory.pm loaded ok
ok 290 - Bio/Seq/SequenceTrace.pm loaded ok
ok 291 - Bio/Seq/SimulatedRead.pm loaded ok
ok 292 - Bio/Seq/TraceI.pm loaded ok
ok 293 - Bio/SeqAnalysisParserI.pm loaded ok
ok 294 - Bio/SeqFeature/Amplicon.pm loaded ok
ok 295 - Bio/SeqFeature/AnnotationAdaptor.pm loaded ok
ok 296 - Bio/SeqFeature/Collection.pm loaded ok
ok 297 - Bio/SeqFeature/CollectionI.pm loaded ok
ok 298 - Bio/SeqFeature/Computation.pm loaded ok
ok 299 - Bio/SeqFeature/FeaturePair.pm loaded ok
ok 300 - Bio/SeqFeature/Gene/Exon.pm loaded ok
ok 301 - Bio/SeqFeature/Gene/ExonI.pm loaded ok
ok 302 - Bio/SeqFeature/Gene/GeneStructure.pm loaded ok
ok 303 - Bio/SeqFeature/Gene/GeneStructureI.pm loaded ok
ok 304 - Bio/SeqFeature/Gene/Intron.pm loaded ok
ok 305 - Bio/SeqFeature/Gene/NC_Feature.pm loaded ok
ok 306 - Bio/SeqFeature/Gene/Poly_A_site.pm loaded ok
ok 307 - Bio/SeqFeature/Gene/Promoter.pm loaded ok
ok 308 - Bio/SeqFeature/Gene/Transcript.pm loaded ok
ok 309 - Bio/SeqFeature/Gene/TranscriptI.pm loaded ok
ok 310 - Bio/SeqFeature/Gene/UTR.pm loaded ok
ok 311 - Bio/SeqFeature/Generic.pm loaded ok
ok 312 - Bio/SeqFeature/Lite.pm loaded ok
ok 313 - Bio/SeqFeature/PositionProxy.pm loaded ok
ok 314 - Bio/SeqFeature/Primer.pm loaded ok
ok 315 - Bio/SeqFeature/Similarity.pm loaded ok
ok 316 - Bio/SeqFeature/SimilarityPair.pm loaded ok
ok 317 - Bio/SeqFeature/SubSeq.pm loaded ok
ok 318 - Bio/SeqFeature/Tools/FeatureNamer.pm loaded ok
ok 319 - Bio/SeqFeature/Tools/IDHandler.pm loaded ok
ok 320 - Bio/SeqFeature/Tools/TypeMapper.pm loaded ok
ok 321 - Bio/SeqFeature/Tools/Unflattener.pm loaded ok
ok 322 - Bio/SeqFeature/TypedSeqFeatureI.pm loaded ok
ok 323 - Bio/SeqFeatureI.pm loaded ok
ok 324 - Bio/SeqI.pm loaded ok
ok 325 - Bio/SeqIO.pm loaded ok
ok 326 - Bio/SeqIO/FTHelper.pm loaded ok
ok 327 - Bio/SeqIO/Handler/GenericRichSeqHandler.pm loaded ok
ok 328 - Bio/SeqIO/MultiFile.pm loaded ok
ok 329 - Bio/SeqIO/ace.pm loaded ok
ok 330 - Bio/SeqIO/asciitree.pm loaded ok
ok 331 - Bio/SeqIO/bsml.pm loaded ok
ok 332 - Bio/SeqIO/bsml_sax.pm loaded ok
ok 333 - Bio/SeqIO/embl.pm loaded ok
ok 334 - Bio/SeqIO/embldriver.pm loaded ok
ok 335 - Bio/SeqIO/fasta.pm loaded ok
ok 336 - Bio/SeqIO/fastq.pm loaded ok
ok 337 - Bio/SeqIO/game.pm loaded ok
ok 338 - Bio/SeqIO/game/featHandler.pm loaded ok
ok 339 - Bio/SeqIO/game/gameHandler.pm loaded ok
ok 340 - Bio/SeqIO/game/gameSubs.pm loaded ok
ok 341 - Bio/SeqIO/game/gameWriter.pm loaded ok
ok 342 - Bio/SeqIO/game/seqHandler.pm loaded ok
ok 343 - Bio/SeqIO/gbdriver.pm loaded ok
ok 344 - Bio/SeqIO/gbxml.pm loaded ok
ok 345 - Bio/SeqIO/gcg.pm loaded ok
ok 346 - Bio/SeqIO/genbank.pm loaded ok
ok 347 - Bio/SeqIO/kegg.pm loaded ok
ok 348 - Bio/SeqIO/largefasta.pm loaded ok
ok 349 - Bio/SeqIO/locuslink.pm loaded ok
ok 350 - Bio/SeqIO/mbsout.pm loaded ok
ok 351 - Bio/SeqIO/metafasta.pm loaded ok
ok 352 - Bio/SeqIO/msout.pm loaded ok
ok 353 - Bio/SeqIO/phd.pm loaded ok
ok 354 - Bio/SeqIO/pir.pm loaded ok
ok 355 - Bio/SeqIO/qual.pm loaded ok
ok 356 - Bio/SeqIO/raw.pm loaded ok
ok 357 - Bio/SeqIO/scf.pm loaded ok
ok 358 - Bio/SeqIO/seqxml.pm loaded ok
ok 359 - Bio/SeqIO/swiss.pm loaded ok
ok 360 - Bio/SeqIO/swissdriver.pm loaded ok
ok 361 - Bio/SeqIO/tab.pm loaded ok
ok 362 - Bio/SeqIO/table.pm loaded ok
ok 363 - Bio/SeqIO/tigr.pm loaded ok
ok 364 - Bio/SeqIO/tigrxml.pm loaded ok
ok 365 - Bio/SeqIO/tinyseq.pm loaded ok
ok 366 - Bio/SeqIO/tinyseq/tinyseqHandler.pm loaded ok
ok 367 - Bio/SeqUtils.pm loaded ok
ok 368 - Bio/SimpleAlign.pm loaded ok
ok 369 - Bio/SimpleAnalysisI.pm loaded ok
ok 370 - Bio/Species.pm loaded ok
ok 371 - Bio/Taxon.pm loaded ok
ok 372 - Bio/Tools/Alignment/Consed.pm loaded ok
ok 373 - Bio/Tools/Alignment/Trim.pm loaded ok
ok 374 - Bio/Tools/AmpliconSearch.pm loaded ok
ok 375 - Bio/Tools/Analysis/SimpleAnalysisBase.pm loaded ok
ok 376 - Bio/Tools/AnalysisResult.pm loaded ok
ok 377 - Bio/Tools/Blat.pm loaded ok
ok 378 - Bio/Tools/CodonTable.pm loaded ok
ok 379 - Bio/Tools/Coil.pm loaded ok
ok 380 - Bio/Tools/ECnumber.pm loaded ok
ok 381 - Bio/Tools/EMBOSS/Palindrome.pm loaded ok
ok 382 - Bio/Tools/EPCR.pm loaded ok
ok 383 - Bio/Tools/ESTScan.pm loaded ok
ok 384 - Bio/Tools/Eponine.pm loaded ok
ok 385 - Bio/Tools/Est2Genome.pm loaded ok
ok 386 - Bio/Tools/Fgenesh.pm loaded ok
ok 387 - Bio/Tools/FootPrinter.pm loaded ok
ok 388 - Bio/Tools/GFF.pm loaded ok
ok 389 - Bio/Tools/Geneid.pm loaded ok
ok 390 - Bio/Tools/Genemark.pm loaded ok
ok 391 - Bio/Tools/Genewise.pm loaded ok
ok 392 - Bio/Tools/Genomewise.pm loaded ok
ok 393 - Bio/Tools/Genscan.pm loaded ok
ok 394 - Bio/Tools/Glimmer.pm loaded ok
ok 395 - Bio/Tools/Grail.pm loaded ok
ok 396 - Bio/Tools/GuessSeqFormat.pm loaded ok
ok 397 - Bio/Tools/IUPAC.pm loaded ok
ok 398 - Bio/Tools/Lucy.pm loaded ok
ok 399 - Bio/Tools/MZEF.pm loaded ok
ok 400 - Bio/Tools/Match.pm loaded ok
ok 401 - Bio/Tools/OddCodes.pm loaded ok
ok 402 - Bio/Tools/Phylo/Gerp.pm loaded ok
ok 403 - Bio/Tools/Phylo/Molphy.pm loaded ok
ok 404 - Bio/Tools/Phylo/Molphy/Result.pm loaded ok
ok 405 - Bio/Tools/Phylo/Phylip/ProtDist.pm loaded ok
ok 406 - Bio/Tools/Prediction/Exon.pm loaded ok
ok 407 - Bio/Tools/Prediction/Gene.pm loaded ok
ok 408 - Bio/Tools/Primer/Assessor/Base.pm loaded ok
ok 409 - Bio/Tools/Primer/AssessorI.pm loaded ok
ok 410 - Bio/Tools/Primer/Feature.pm loaded ok
ok 411 - Bio/Tools/Primer/Pair.pm loaded ok
ok 412 - Bio/Tools/Primer3.pm loaded ok
ok 413 - Bio/Tools/Prints.pm loaded ok
ok 414 - Bio/Tools/Profile.pm loaded ok
ok 415 - Bio/Tools/Promoterwise.pm loaded ok
ok 416 - Bio/Tools/PrositeScan.pm loaded ok
ok 417 - Bio/Tools/Pseudowise.pm loaded ok
ok 418 - Bio/Tools/QRNA.pm loaded ok
ok 419 - Bio/Tools/RandomDistFunctions.pm loaded ok
ok 420 - Bio/Tools/RepeatMasker.pm loaded ok
ok 421 - Bio/Tools/Run/Analysis.pm loaded ok
ok 422 - Bio/Tools/Run/AnalysisFactory.pm loaded ok
ok 423 - Bio/Tools/Run/GenericParameters.pm loaded ok
ok 424 - Bio/Tools/Run/ParametersI.pm loaded ok
ok 425 - Bio/Tools/Run/Phylo/PhyloBase.pm loaded ok
ok 426 - Bio/Tools/Run/WrapperBase.pm loaded ok
ok 427 - Bio/Tools/Run/WrapperBase/CommandExts.pm loaded ok
ok 428 - Bio/Tools/Seg.pm loaded ok
ok 429 - Bio/Tools/SeqPattern.pm loaded ok
ok 430 - Bio/Tools/SeqPattern/Backtranslate.pm loaded ok
ok 431 - Bio/Tools/SeqStats.pm loaded ok
ok 432 - Bio/Tools/SeqWords.pm loaded ok
ok 433 - Bio/Tools/Sigcleave.pm loaded ok
ok 434 - Bio/Tools/Signalp.pm loaded ok
ok 435 - Bio/Tools/Signalp/ExtendedSignalp.pm loaded ok
ok 436 - Bio/Tools/Sim4/Exon.pm loaded ok
ok 437 - Bio/Tools/Sim4/Results.pm loaded ok
ok 438 - Bio/Tools/Spidey/Exon.pm loaded ok
ok 439 - Bio/Tools/Spidey/Results.pm loaded ok
ok 440 - Bio/Tools/TandemRepeatsFinder.pm loaded ok
ok 441 - Bio/Tools/TargetP.pm loaded ok
ok 442 - Bio/Tools/Tmhmm.pm loaded ok
ok 443 - Bio/Tools/ipcress.pm loaded ok
ok 444 - Bio/Tools/isPcr.pm loaded ok
ok 445 - Bio/Tools/pICalculator.pm loaded ok
ok 446 - Bio/Tools/tRNAscanSE.pm loaded ok
ok 447 - Bio/Tree/AnnotatableNode.pm loaded ok
ok 448 - Bio/Tree/Compatible.pm loaded ok
ok 449 - Bio/Tree/DistanceFactory.pm loaded ok
ok 450 - Bio/Tree/Node.pm loaded ok
ok 451 - Bio/Tree/NodeI.pm loaded ok
ok 452 - Bio/Tree/NodeNHX.pm loaded ok
ok 453 - Bio/Tree/RandomFactory.pm loaded ok
ok 454 - Bio/Tree/Statistics.pm loaded ok
ok 455 - Bio/Tree/Tree.pm loaded ok
ok 456 - Bio/Tree/TreeFunctionsI.pm loaded ok
ok 457 - Bio/Tree/TreeI.pm loaded ok
ok 458 - Bio/TreeIO.pm loaded ok
ok 459 - Bio/TreeIO/NewickParser.pm loaded ok
ok 460 - Bio/TreeIO/TreeEventBuilder.pm loaded ok
ok 461 - Bio/TreeIO/cluster.pm loaded ok
ok 462 - Bio/TreeIO/lintree.pm loaded ok
ok 463 - Bio/TreeIO/newick.pm loaded ok
ok 464 - Bio/TreeIO/nexus.pm loaded ok
ok 465 - Bio/TreeIO/nhx.pm loaded ok
ok 466 - Bio/TreeIO/pag.pm loaded ok
ok 467 - Bio/TreeIO/phyloxml.pm loaded ok
ok 468 - Bio/TreeIO/tabtree.pm loaded ok
ok 469 - Bio/UpdateableSeqI.pm loaded ok
ok 470 - Bio/WebAgent.pm loaded ok
ok 471 - BioPerl.pm loaded ok
ok 472 - bin/bp_aacomp compiled ok
ok 473 - bin/bp_bioflat_index compiled ok
ok 474 - bin/bp_biogetseq compiled ok
ok 475 - bin/bp_dbsplit compiled ok
ok 476 - bin/bp_extract_feature_seq compiled ok
ok 477 - bin/bp_fastam9_to_table compiled ok
ok 478 - bin/bp_fetch compiled ok
ok 479 - bin/bp_filter_search compiled ok
ok 480 - bin/bp_find-blast-matches compiled ok
ok 481 - bin/bp_gccalc compiled ok
ok 482 - bin/bp_genbank2gff3 compiled ok
ok 483 - bin/bp_index compiled ok
ok 484 - bin/bp_local_taxonomydb_query compiled ok
ok 485 - bin/bp_make_mrna_protein compiled ok
ok 486 - bin/bp_mask_by_search compiled ok
ok 487 - bin/bp_mrtrans compiled ok
ok 488 - bin/bp_mutate compiled ok
ok 489 - bin/bp_nexus2nh compiled ok
ok 490 - bin/bp_nrdb compiled ok
ok 491 - bin/bp_oligo_count compiled ok
ok 492 - bin/bp_process_gadfly compiled ok
ok 493 - bin/bp_process_sgd compiled ok
ok 494 - bin/bp_revtrans-motif compiled ok
ok 495 - bin/bp_search2alnblocks compiled ok
ok 496 - bin/bp_search2gff compiled ok
ok 497 - bin/bp_search2table compiled ok
ok 498 - bin/bp_search2tribe compiled ok
ok 499 - bin/bp_seq_length compiled ok
ok 500 - bin/bp_seqconvert compiled ok
ok 501 - bin/bp_seqcut compiled ok
ok 502 - bin/bp_seqpart compiled ok
ok 503 - bin/bp_seqret compiled ok
ok 504 - bin/bp_seqretsplit compiled ok
ok 505 - bin/bp_split_seq compiled ok
ok 506 - bin/bp_sreformat compiled ok
ok 507 - bin/bp_taxid4species compiled ok
ok 508 - bin/bp_taxonomy2tree compiled ok
ok 509 - bin/bp_translate_seq compiled ok
ok 510 - bin/bp_tree2pag compiled ok
ok 511 - bin/bp_unflatten_seq compiled ok
ok
t/Align/AlignStats.t ................ 
1..45
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::AlignIO;
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 38 - An object of class 'Bio::Matrix::PhylipDist' isa 'Bio::Matrix::PhylipDist'
ok 39
ok 40
ok 41
ok 42 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 43
ok 44 - Warn if seqs don't overlap
ok 45
ok
t/Align/AlignUtil.t ................. 
1..47
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqIO;
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok
t/Align/SimpleAlign.t ............... 
1..206
ok 1 - use Bio::SimpleAlign;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Location::Simple;
ok 5 - use Bio::Location::Split;
ok 6 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO'
ok 7 - pfam input test
ok 8 - match_line
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10 - num_sequences
ok 11 - num_sequences
ok 12 - select_noncont
ok 13 - select_noncont
ok 14 - num_sequences
ok 15 - select_noncont
ok 16 - select_noncont
ok 17 - select_noncont_by_name
ok 18 - select_noncont_by_name
ok 19 - select_noncont_by_name
ok 20 - select_noncont_by_name
ok 21 - each_seq
ok 22 - get_nse
ok 23 - id
ok 24 - num_gaps
ok 25 - each_alphabetically
ok 26 - column_from_residue_number
ok 27 - display_name get/set
ok 28 - display_name get
ok 29 - consensus_string
ok 30 - consensus_string
ok 31 - consensus_string
ok 32
ok 33 - each_seq_with_id
ok 34 - is_flush
ok 35 - id get/set
ok 36 - length
ok 37 - num_residues
ok 38 - num_sequences
ok 39 - overall_percentage_identity
ok 40 - overall_percentage_identity (align)
ok 41 - overall_percentage_identity (short)
ok 42 - overall_percentage_identity (long)
ok 43 - average_percentage_identity
ok 44
ok 45 - set_displayname_count
ok 46
ok 47 - set_displayname_flat
ok 48
ok 49 - set_displayname_normal
ok 50
ok 51
ok 52 - uppercase, map_chars
ok 53 - match_line
ok 54 - remove_seqs
ok 55 - remove_seqs
ok 56 - add_seq
ok 57 - add_seq
ok 58 - get_seq_by_pos
ok 59 - get_seq_by_pos
ok 60
ok 61
ok 62
ok 63 - purge
ok 64 - purge
ok 65 - IO::String consensus_iupac
ok 66 - IO::String write_aln normal
ok 67 - IO::String write_aln slice
ok 68 - IO::String write_aln slice
ok 69 - IO::String write_aln slice
ok 70 - IO::String write_aln slice
ok 71 - IO::String write_aln slice
ok 72
ok 73 - remove_columns by position
ok 74 - remove_columns by position (wrong order)
ok 75 - cigar_line
ok 76 - cigar_line
ok 77 - cigar_line
ok 78 - cigar_line
ok 79 - sort_alphabetically - before
ok 80
ok 81 - sort_alphabetically - after
ok 82 - remove_gaps
ok 83 - remove_gaps all_gaps_only
ok 84 - set_new_reference
ok 85 - set_new_reference
ok 86 - uniq_seq
ok 87 - bug 2099
ok 88 - bug 2099
ok 89 - bug 2793
ok 90 - bug 2793
ok 91 - bug 2793
ok 92 - bug 2793
ok 93 - Bad sequence, bad!
ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI'
ok 95 - added 3 seqs
ok 96 - first 2 features added
ok 97 - 3rd feature added
ok 98
ok 99 - slice 1 len
ok 100 - correct masked seq
ok 101 - correct masked seq
ok 102 - correct masked seq
ok 103
ok 104 - slice 2 len
ok 105 - correct masked seq
ok 106 - correct masked seq
ok 107 - correct masked seq
ok 108
ok 109 - slice 3 len
ok 110 - correct masked seq
ok 111 - correct masked seq
ok 112 - correct masked seq
ok 113
ok 114 - slice 4 len
ok 115 - correct masked seq
ok 116 - correct masked seq
ok 117 - correct masked seq
ok 118 - initial display id ok
ok 119 - safe display id ok
ok 120 - restored display id ok
ok 121 - sort by list ok
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128 - BIC:GGATCCATT[C/C]CTACT
ok 129 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT
ok 130 - BIC:G[G/C]ATCCATT[C/G]CTACT
ok 131 - BIC:GGATCCATT[C/G]CTACT
ok 132 - BIC:GGATCCATT[C/G]CTAC[T/A]
ok 133 - BIC:GGATCCATT[C/G]CTA[C/G][T/A]
ok 134 - BIC:GGATCCATT[C/G]CTACT
ok 135 - BIC:GGATCCATT{C.C}CTACT
ok 136 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT
ok 137 - BIC:G{G.C}ATCCATT{C.G}CTACT
ok 138 - BIC:GGATCCATT{C.G}CTACT
ok 139 - BIC:GGATCCATT{C.G}CTAC{T.A}
ok 140 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A}
ok 141 - BIC:GGATCCATT{C.G}CTACT
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 200 - consensus string looks ok
ok 201 - conservation length
ok 202 - conservation scores
ok 203 - looks like correct unmasked alignment (from clustalw)
ok 204 - looks like correct masked alignment (from clustalw)
ok 205
ok 206 - align after looks ok
ok
t/Align/TreeBuild.t ................. 
1..13
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::Align::Utilities;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Tree::DistanceFactory;
ok 6 - use Bio::TreeIO;
ok 7 - 'SimpleAlign object parsed out' isa 'Bio::SimpleAlign'
ok 8 - 'Protein distance matrix retrieved' isa 'Bio::Matrix::MatrixI'
ok 9 - 'Tree object gotten back' isa 'Bio::Tree::TreeI'
ok 10 - NJ calculated Branch length
ok 11 - NJ calculated Branch length
ok 12 - Make sure two nodes are sister
ok 13 - 10 replicates formulated
ok
t/Align/Utilities.t ................. 
1..14
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::SimpleAlign;
ok 3 - use Bio::PrimarySeq;
ok 4 - use Bio::LocatableSeq;
ok 5 - use Bio::AlignIO;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/AlignIO/AlignIO.t ................. 
1..27
ok 1 - use Bio::AlignIO;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI'
ok 3 - input filehandle method test : pfam
ok 4 - input filehandle method test : clustalw
ok 5 - input filehandle method test : po
ok 6 - input filehandle method test : selex
ok 7 - input filehandle method test : phylip
ok 8 - input filehandle method test : nexus
ok 9 - input filehandle method test : prodom
ok 10 - input filehandle method test : msf
ok 11 - input filehandle method test : metafasta
ok 12 - input filehandle method test : arp
ok 13 - input filehandle method test : mase
ok 14 - input filehandle method test : psi
ok 15 - input filehandle method test : fasta
ok 16 - input filehandle method test : xmfa
ok 17 - filehandle output test : pfam
ok 18 - filehandle output test : clustalw
ok 19 - filehandle output test : po
ok 20 - filehandle output test : selex
ok 21 - filehandle output test : phylip
ok 22 - filehandle output test : nexus
ok 23 - filehandle output test : msf
ok 24 - filehandle output test : metafasta
ok 25 - filehandle output test : psi
ok 26 - filehandle output test : fasta
ok 27 - filehandle output test : xmfa
ok
t/AlignIO/arp.t ..................... 
1..48
ok 1 - use Bio::AlignIO::arp;
ok 2 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4 - ARP get_nse()
ok 5
ok 6 - ARP num_sequences()
ok 7 - ARP id()
ok 8 - ARP description()
ok 9 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 10 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO'
ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 17 - ARP get_nse()
ok 18 - ARP num_sequences()
ok 19 - ARP id()
ok 20 - ARP description()
ok 21 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 22 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 23
ok 24
ok 25
ok 26
ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 28 - ARP get_nse()
ok 29 - ARP num_sequences()
ok 30 - ARP id()
ok 31 - ARP description()
ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 33 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 34
ok 35
ok 36
ok 37
ok 38 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 39 - ARP get_nse()
ok 40 - ARP num_sequences()
ok 41 - ARP id()
ok 42 - ARP description()
ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 44 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 45
ok 46
ok 47
ok 48
ok
t/AlignIO/bl2seq.t .................. 
1..7
ok 1 - use Bio::AlignIO::bl2seq;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - BLAST bl2seq format test
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7
ok
t/AlignIO/clustalw.t ................ 
1..6
ok 1 - use Bio::AlignIO::clustalw;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - clustalw consensus_string test
ok 4 - clustalw output test
ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 6 - clustalw input test
ok
t/AlignIO/emboss.t .................. 
1..37
ok 1 - use Bio::AlignIO::emboss;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 15
ok 16
ok 17
ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 19
ok 20
ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/AlignIO/fasta.t ................... 
1..12
ok 1 - use Bio::AlignIO::fasta;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - fasta input test 
ok 4 - fasta input test 
ok 5 - fasta input test for description
ok 6 - fasta input test for id
ok 7 - fasta input test, captures formatted start/end
ok 8 - fasta input test for end
ok 9 - fasta input test for description
ok 10 - fasta output test
ok 11 - filehandle input test  
ok 12 - filehandle output test
ok
t/AlignIO/largemultifasta.t ......... 
1..7
ok 1 - use Bio::AlignIO::largemultifasta;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - fasta input test 
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for description
ok 7 - fasta output test
ok
t/AlignIO/maf.t ..................... 
1..11
ok 1 - use Bio::AlignIO::maf;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - maf input test
ok 4
ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 6 - maf input test
ok 7
ok 8 - maf input test
ok 9
ok 10 - maf input test
ok 11
ok
t/AlignIO/mase.t .................... 
1..3
ok 1 - use Bio::AlignIO::mase;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - mase input test 
ok
t/AlignIO/mega.t .................... 
1..6
ok 1 - use Bio::AlignIO::mega;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3
ok 4
ok 5
ok 6 - mega output test
ok
t/AlignIO/meme.t .................... 
1..20
ok 1 - use Bio::AlignIO::meme;
ok 2 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5
ok 6
ok 7
ok 8 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO'
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO'
ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 17
ok 18
ok 19
ok 20
ok
t/AlignIO/metafasta.t ............... 
1..4
ok 1 - use Bio::AlignIO::metafasta;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - consensus_string on metafasta
ok 4 - symbol_chars() using metafasta
ok
t/AlignIO/msf.t ..................... 
1..4
ok 1 - use Bio::AlignIO::msf;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - msf input test
ok 4 - msf output test
ok
t/AlignIO/nexus.t ................... 
1..43
ok 1 - use Bio::AlignIO::nexus;
ok 2 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5 - nexus output test
ok 6 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 11 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 12 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 14 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 15 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 16 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 18 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 20 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 22 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 23 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 24 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 25 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 26 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 28 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 30 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 32 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 33 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 34 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 35 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 36 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 38 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 40 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 41 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 42 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 43 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok
t/AlignIO/pfam.t .................... 
1..5
ok 1 - use Bio::AlignIO::pfam;
ok 2 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5 -  pfam output test
ok
t/AlignIO/phylip.t .................. 
1..20
ok 1 - use Bio::AlignIO::phylip;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10
ok 11 - phylip output test
ok 12
ok 13
ok 14
ok 15
not ok 16 # TODO problems with default strand
#   Failed (TODO) test at t/AlignIO/phylip.t line 77.
#          got: undef
#     expected: '0'
ok 17 - newline between header and sequences is parsed correctly
ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 20
ok
t/AlignIO/po.t ...................... 
1..11
ok 1 - use Bio::AlignIO::po;
ok 2 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO'
ok 6 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 7 - po output test
ok 8 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO'
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10
ok 11
ok
t/AlignIO/prodom.t .................. 
1..3
ok 1 - use Bio::AlignIO::prodom;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - prodom input test 
ok
t/AlignIO/psi.t ..................... 
1..5
ok 1 - use Bio::AlignIO::psi;
ok 2 - An object of class 'Bio::AlignIO::psi' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5
ok
t/AlignIO/selex.t ................... 
1..4
ok 1 - use Bio::AlignIO::selex;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - selex format test 
ok 4 - selex output test
ok
t/AlignIO/xmfa.t .................... 
1..30
ok 1 - use Bio::AlignIO::xmfa;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - xmfa input test 
ok 4 - xmfa input test for start
ok 5 - xmfa input test for end
ok 6 - xmfa strand test
ok 7 - xmfa input test for id
ok 8 - xmfa input test for id
ok 9 - xmfa input test 
ok 10 - xmfa input test for start
ok 11 - xmfa input test for end
ok 12 - xmfa strand test
ok 13 - xmfa input test for id
ok 14 - xmfa input test for id
ok 15 - xmfa input test 
ok 16 - xmfa input test for start
ok 17 - xmfa input test for end
ok 18 - xmfa strand test
ok 19 - xmfa input test for id
ok 20 - xmfa input test for id
ok 21 - xmfa alignment score
ok 22 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 23 - xmfa input test 
ok 24 - xmfa strand
ok 25 - xmfa input test for description
ok 26 - xmfa input test for id
ok 27 - xmfa input test for end
ok 28 - xmfa input test for end
ok 29 - xmfa alignment score
ok 30 - xmfa output test
ok
t/Annotation/Annotation.t ........... 
1..148
ok 1 - use Bio::Annotation::Collection;
ok 2 - use Bio::Annotation::DBLink;
ok 3 - use Bio::Annotation::Comment;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6 - use Bio::Annotation::Target;
ok 7 - use Bio::Annotation::AnnotationFactory;
ok 8 - use Bio::Annotation::StructuredValue;
ok 9 - use Bio::Annotation::TagTree;
ok 10 - use Bio::Annotation::Tree;
ok 11 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::AnnotationI'
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::AnnotationI'
ok 19
ok 20
ok 21
ok 22 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 23
ok 24
ok 25 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI'
ok 26
ok 27 - An object of class 'Bio::Annotation::Reference' isa 'Bio::AnnotationI'
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::AnnotationI'
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 66
ok 67
ok 68
ok 69
ok 70 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::Annotation::StructuredValue'
ok 71
ok 72
ok 73
ok 74
ok 75 - use Bio::Annotation::OntologyTerm;
ok 76 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::Term'
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82 - An object of class 'Bio::Annotation::AnnotationFactory' isa 'Bio::Factory::ObjectFactoryI'
ok 83 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 84
ok 85 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Annotation::OntologyTerm'
ok 86 - Bio::Annotation::Comment
ok 87 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 88
ok 89 - Bio::Annotation::Comment
ok 90 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 91 - Bio::Annotation::Comment
ok 92 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 93
ok 94 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::Target'
ok 95
ok 96
ok 97 - An object of class 'Bio::Annotation::Tree' isa 'Bio::AnnotationI'
ok 98 - tree_id()
ok 99 - tagname()
ok 100
ok 101 - add tree to AlignI
ok 102 - get seq from node id
ok 103
ok 104 - An object of class 'Bio::Annotation::Tree' isa 'Bio::Annotation::Tree'
ok 105 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 106 - default itext
ok 107 - roundtrip
ok 108 - itext
ok 109 - spxr
ok 110 - indent
ok 111 - xml
ok 112 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 113
ok 114 - child changes
ok 115 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 116
ok 117 - child changes
ok 118 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 119
ok 120 - child changes
ok 121 - child changes in parent node
ok 122 - no tags
ok 123 - before Stag node
ok 124 - after Stag node
ok 125 - both stag nodes
ok 126 - different instances
ok 127 - before TagTree
ok 128 - after TagTree
ok 129 - both stag nodes
ok 130 - different instances
ok 131 - before TagTree
ok 132 - after TagTree
ok 133 - stag nodes
ok 134 - same instance
ok 135 - before TagTree
ok 136 - after TagTree
ok 137 - stag nodes
ok 138 - different instance
ok 139 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 140 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 141 - child changes
ok 142 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 143 - child changes
ok 144 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 145 - child changes
ok 146
ok 147
ok 148 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::Annotation::TagTree'
ok
t/Annotation/AnnotationAdaptor.t .... 
1..23
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::SeqFeature::AnnotationAdaptor;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
t/author-mojibake.t ................. skipped: these tests are for testing by the author
t/author-pod-syntax.t ............... skipped: these tests are for testing by the author
Subroutine new redefined at /<<PKGBUILDDIR>>/blib/lib/Bio/DB/IndexedBase.pm line 1121.
Subroutine next_seq redefined at /<<PKGBUILDDIR>>/blib/lib/Bio/DB/IndexedBase.pm line 1130.
Subroutine TIEHANDLE redefined at /<<PKGBUILDDIR>>/blib/lib/Bio/DB/IndexedBase.pm line 1139.
Subroutine READLINE redefined at /<<PKGBUILDDIR>>/blib/lib/Bio/DB/IndexedBase.pm line 1144.
t/LocalDB/Fasta.t ................... 
1..109
ok 1 - Index a directory
ok 2
ok 3 - An object of class 'Bio::DB::Fasta' isa 'Bio::DB::Fasta'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 29 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - bug 3126
ok 38
ok 39
ok 40 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 41 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 42
ok 43
ok 44
ok 45 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 46 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 47
ok 48
ok 49 - use Class::Unload;
ok 50 - Re-open an existing index
ok 51
ok 52 - Tied hash access
ok 53
ok 54
ok 55
ok 56
ok 57 - Writing with SeqIO
ok 58
ok 59
ok 60 - Index a single file
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream'
ok 73
ok 74 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90 - Make single ID
ok 91
ok 92
ok 93 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 94 - Make multiple IDs, bug \#3389
ok 95
ok 96
ok 97 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 98 - Index a set of files
ok 99
ok 100
ok 101
ok 102
ok 103 - threw Regexp ((?^:FASTA header doesn't match))
ok 104 - threw Regexp ((?^:Blank lines can only precede header lines))
ok 105
ok 106 - length is correct in sequences past spaces
ok 107
ok 108 - subseq is correct
ok 109 - subseq is correct
ok
t/LocalDB/Flat.t .................... 
1..27
ok 1 - use Bio::DB::Flat;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/LocalDB/Index/Blast.t ............. 
1..5
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::Blast;
# Subtest: BLASTP
    1..12
    ok 1
    ok 2
    ok 3
    ok 4
    ok 5
    ok 6
    ok 7
    ok 8
    ok 9
    ok 10
    ok 11
    ok 12
ok 4 - BLASTP
# Subtest: RPS-BLAST
    1..11
    ok 1
    ok 2
    ok 3
    ok 4
    ok 5
    ok 6
    ok 7
    ok 8
    ok 9
    ok 10
    ok 11
ok 5 - RPS-BLAST
ok
t/LocalDB/Index/BlastTable.t ........ 
1..27
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::BlastTable;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/LocalDB/Index/Index.t ............. 
1..65
ok 1 - use Bio::Index::Fasta;
ok 2 - use Bio::Index::Qual;
ok 3 - use Bio::Index::SwissPfam;
ok 4 - use Bio::Index::EMBL;
ok 5 - use Bio::Index::GenBank;
ok 6 - use Bio::Index::Swissprot;
ok 7 - use Bio::DB::InMemoryCache;
ok 8 - use Bio::DB::InMemoryCache;
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 18
ok 19
ok 20
ok 21 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok
t/LocalDB/Qual.t .................... 
1..56
ok 1 - use Bio::Root::IO;
ok 2 - use File::Copy;
ok 3
ok 4
ok 5 - An object of class 'Bio::DB::Qual' isa 'Bio::DB::Qual'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual'
ok 23 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI'
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual'
ok 38 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI'
ok 39
ok 40
ok 41
ok 42 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual'
ok 43 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual'
ok 44
ok 45
ok 46
ok 47
ok 48 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream'
ok 49
ok 50 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual'
ok 51
ok 52 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual'
ok 53
ok 54
ok 55
ok 56
ok

--------------------- WARNING ---------------------
MSG: Couldn't load Bio::DB::BioFetch
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: Couldn't load Bio::DB::BioFetch
---------------------------------------------------
t/LocalDB/Registry.t ................ 
1..14
ok 1 - use Bio::DB::Registry;
ok 2 - use Bio::DB::Flat;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/LocalDB/Taxonomy/greengenes.t ..... 
1..38
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
ok 4 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::greengenes'
ok 5 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::list'
ok 6 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok
t/LocalDB/Taxonomy/silva.t .......... 
1..42
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
ok 4 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::silva'
ok 5 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::list'
ok 6 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok
t/Matrix/InstanceSite.t ............. 
1..6
ok 1 - use Bio::Matrix::PSM::InstanceSite;
ok 2
ok 3
ok 4
ok 5
ok 6
ok
t/Matrix/IO/masta.t ................. 
1..16
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/Matrix/IO/psm.t ................... 
1..63
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok
t/Matrix/Matrix.t ................... 
1..77
ok 1 - use Bio::Matrix::Generic;
ok 2 - use Bio::Matrix::IO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring'
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring'
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok
t/Matrix/ProtMatrix.t ............... 
1..14
ok 1 - use Bio::Matrix::PSM::ProtMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Matrix/ProtPsm.t .................. 
1..14
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5 # skip TODO: Module incomplete
ok 6 # skip TODO: Module incomplete
ok 7 # skip TODO: Module incomplete
ok 8 # skip TODO: Module incomplete
ok 9 # skip TODO: Module incomplete
ok 10 # skip TODO: Module incomplete
ok 11 # skip TODO: Module incomplete
ok 12 # skip TODO: Module incomplete
ok 13 # skip TODO: Module incomplete
ok 14 # skip TODO: Module incomplete
ok
t/Matrix/SiteMatrix.t ............... 
1..14
ok 1 - use Bio::Matrix::PSM::SiteMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Ontology/GOterm.t ................. 
1..62
ok 1 - use Bio::Ontology::GOterm;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok
t/Ontology/GraphAdaptor.t ........... 
1..28
ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok
t/Ontology/IO/go.t .................. 
1..102
ok 1 - use Bio::OntologyIO;
ok 2
ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::OntologyI'
ok 4
ok 5 - An object of class 'Bio::Ontology::OBOEngine' isa 'Bio::Ontology::OntologyEngineI'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/Ontology/IO/interpro.t ............ 
1..69
ok 1 - use Bio::OntologyIO;
ok 2 - An object of class 'Bio::OntologyIO::InterProParser' isa 'Bio::OntologyIO::InterProParser'
ok 3
ok 4 - get_dbxrefs on leaf terms is non-empty
ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty
ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty
ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty
ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty
ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty
ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty
ok 11 - get_members on leaf terms is non-empty
ok 12 - class_list on leaf terms is non-empty
ok 13 - get_examples on leaf terms is non-empty
ok 14 - get_external_documents on leaf terms is non-empty
ok 15 - get_references on leaf terms is non-empty
ok 16 - protein_count on leaf terms is non-empty
ok 17 - to_string looks reasonable
ok 18 - There are 8 root InterPro terms
ok 19 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 20 - term Helix-turn-helix, AraC type  in ontology InterPro
ok 21 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 22 - term Kringle in ontology InterPro
ok 23 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 24 - term Active Site in ontology InterPro
ok 25 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 26 - term Region in ontology InterPro
ok 27 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 28 - term post-translational modification in ontology InterPro
ok 29 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 30 - term Repeat in ontology InterPro
ok 31 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 32 - term Cdc20/Fizzy in ontology InterPro
ok 33 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 34 - term Integrins alpha chain in ontology InterPro
ok 35 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 36 - term Conserved Site in ontology InterPro
ok 37 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 38 - term Binding Site in ontology InterPro
ok 39 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 40 - term Active Site in ontology InterPro
ok 41 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 42 - term Binding Site in ontology InterPro
ok 43 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 44 - term Conserved Site in ontology InterPro
ok 45 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 46 - term Domain in ontology InterPro
ok 47 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 48 - term Family in ontology InterPro
ok 49 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 50 - term Region in ontology InterPro
ok 51 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 52 - term Repeat in ontology InterPro
ok 53 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 54 - term post-translational modification in ontology InterPro
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 - Helix-turn-helix, AraC type  term has one parent
ok 62 - Helix-turn-helix, AraC type  term has one ancestor
ok 63 - Kringle term has one parent
ok 64 - Kringle term has one ancestor
ok 65 - Cdc20/Fizzy term has one parent
ok 66 - Cdc20/Fizzy term has one ancestor
ok 67 - Integrins alpha chain term has one parent
ok 68 - Integrins alpha chain term has one ancestor
ok 69 - secondary accession map has 2 keys
ok
t/Ontology/IO/obo.t ................. 
1..92
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - 'got a ontology IO handler' isa 'Bio::OntologyIO'
ok 47 - 'got ontology parser2' isa 'Bio::Ontology::Ontology'
ok 48 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine'
ok 49 - 'got ontology parser2' isa 'Bio::Ontology::Ontology'
ok 50 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine'
ok 51 - 'got ontology parser2' isa 'Bio::Ontology::Ontology'
ok 52 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine'
ok 53 - Gene ontology
ok 54 - biological process
ok 55 - molecular function
ok 56 - Got root
ok 57 - Got root
ok 58 - Got regulates
# 	 from gene_ontology
ok 59 - Got
# 	 positively regulates from gene_ontology
ok 60 - Got
# 	  regulates from biological_process
ok 61 - Got
# 	 positively regulates from biological_process
ok 62 - Got predicates for gene_ontology
ok 63 - Got predicates for biological_process
ok 64 - Got regulates predicate
ok 65 - Got positively regulates predicate
ok 66 - Got relationships for biological_process
ok 67 - Got relationships for molecular_function
ok 68 - Got is a relationship from
# 	 molecular_function
ok 69 - 'Got term object' isa 'Bio::Ontology::Term'
ok 70 - Got term id
ok 71 - Got term name
ok 72 - 'Got regulated object' isa 'Bio::Ontology::Term'
ok 73 - Got regulated term1 id
ok 74 - 'Got term1 object' isa 'Bio::Ontology::Term'
ok 75 - Got back the child
ok 76 - 'Got term object' isa 'Bio::Ontology::Term'
ok 77 - Got term id
ok 78 - Got term name
ok 79 - 'Got regulated object' isa 'Bio::Ontology::Term'
ok 80 - Got regulated term1 id
ok 81 - Got identical regulation
ok 82 - 'Got term1 object' isa 'Bio::Ontology::Term'
ok 83 - Got back the child
ok 84 - 'got a ontology IO handler' isa 'Bio::OntologyIO'
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok
t/Ontology/Ontology.t ............... 
1..55
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53 - Interpro XML file interpro.xml can be parsed
ok 54 - Interpro XML file interpro_sample.xml can be parsed
ok 55 - Interpro XML file interpro_relationship.xml can be parsed
ok
t/Ontology/OntologyEngine.t ......... 
1..31
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::Relationship;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - use Bio::Ontology::SimpleOntologyEngine;
ok 5 - use Bio::Ontology::Ontology;
ok 6 - An object of class 'Bio::Ontology::SimpleOntologyEngine' isa 'Bio::Ontology::OntologyEngineI'
ok 7
ok 8 - adding a relationship with an undef object term fails
ok 9 - adding a relationship with an undef object term fails
ok 10 - adding a relationship with an undef subject term fails
ok 11 - adding a relationship with an undef subject term fails
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/Ontology/OntologyStore.t .......... 
1..6
ok 1 - use Bio::Ontology::OntologyStore;
ok 2
ok 3 # skip Couldn't get sequence ontology, network problems? Skipping these tests
ok 4 # skip Couldn't get sequence ontology, network problems? Skipping these tests
ok 5 # skip Couldn't get sequence ontology, network problems? Skipping these tests
ok 6 # skip Couldn't get sequence ontology, network problems? Skipping these tests
ok
t/Ontology/Relationship.t ........... 
1..12
ok 1 - use Bio::Ontology::Relationship;
ok 2 - use Bio::Ontology::GOterm;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType'
ok 5 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 6 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 7 - An object of class 'Bio::Ontology::Relationship' isa 'Bio::Ontology::Relationship'
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/Ontology/RelationshipType.t ....... 
1..23
ok 1 - use Bio::Ontology::RelationshipType;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType'
ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::TermI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
t/Ontology/Term.t ................... 
1..54
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::TermFactory;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI'
ok 45
ok 46 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::TermI'
ok 47 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 48
ok 49
ok 50 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Ontology::TermI'
ok 51 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::AnnotationI'
ok 52
ok 53
ok 54
ok
t/RemoteDB/SeqRead_fail.t ........... 
1..12
ok 1 # skip failed to use Bio::DB::BioFetch (guessing it's not available)
ok 2 # skip failed to use Bio::DB::BioFetch (guessing it's not available)
ok 3 # skip failed to use Bio::DB::GenBank (guessing it's not available)
ok 4 # skip failed to use Bio::DB::GenBank (guessing it's not available)
ok 5 # skip failed to use Bio::DB::GenPept (guessing it's not available)
ok 6 # skip failed to use Bio::DB::GenPept (guessing it's not available)
ok 7 # skip failed to use Bio::DB::SwissProt (guessing it's not available)
ok 8 # skip failed to use Bio::DB::SwissProt (guessing it's not available)
ok 9 # skip failed to use Bio::DB::RefSeq (guessing it's not available)
ok 10 # skip failed to use Bio::DB::RefSeq (guessing it's not available)
ok 11 # skip failed to use Bio::DB::EMBL (guessing it's not available)
ok 12 # skip failed to use Bio::DB::EMBL (guessing it's not available)
ok
t/RemoteDB/Taxonomy.t ............... 
1..152
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
ok 4 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy::flatfile'
ok 5 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy'
ok 6 - removal of temporary index files: no -directory
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - removal of temporary index files: test_output_dir()
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - Bio::DB::Taxonomy::flatfile: common names
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy::list'
ok 63 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy'
ok 64
ok 65
ok 66
ok 67
ok 68 - Ranks
ok 69
ok 70
ok 71 - Ranks
ok 72
ok 73 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 91 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 92 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 93 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 94 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 95 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 96 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 97 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 98 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110 - List context
ok 111 - 'Scalar context' isa 'SCALAR'
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119 - DB with ambiguous names
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok
t/Root/Exception.t .................. 
1..7
ok 1 - use Bio::Root::TestObject;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok
t/Root/HTTPget.t .................... 
1..29
ok 1 - use Bio::Root::HTTPget;
ok 2
ok 3
ok 4
ok 5 - An object of class 'IO::Socket::INET' isa 'IO::Socket::INET'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - An object of class 'IO::Socket::INET' isa 'IO::Socket::INET'
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - An object of class 'IO::Socket::INET' isa 'IO::Socket::INET'
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok
t/Root/IO.t ......................... 
1..154
ok 1 - use Bio::Root::IO;
ok 2
ok 3 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 4 - Throw
ok 5 - threw Regexp ((?^:Testing throw))
ok 6 - Warn
ok 7 - threw Regexp ((?^:Testing throw))
ok 8 - Stack trace
ok 9
ok 10 - Verbosity
ok 11
ok 12
ok 13
ok 14 - executable file
ok 15 - non-executable file
ok 16 - executable dir
ok 17
ok 18
ok 19
ok 20 - Read from file
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30 - Write to file
ok 31
ok 32
ok 33
ok 34
ok 35 - Read+write to file
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - Read from File::Temp handle
ok 47 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 48 - is a write handle
ok 49 - no warnings in ->close()
ok 50
ok 51 - Exclusive arguments
ok 52 - threw Regexp ((?^:Input file given twice))
ok 53 - threw Regexp ((?^:File or filehandle provided with -string))
ok 54 - threw Regexp ((?^:Providing both a file and a filehandle for reading))
ok 55 - threw Regexp ((?^:File or filehandle provided with -string))
ok 56 - threw Regexp ((?^:File or filehandle provided with -string))
ok 57 - Same file
ok 58 - Pushback
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71 - _print
ok 72
ok 73 - _insert at middle of file
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79 - _insert in empty file
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: #
ok 110
ok 111
ok 112 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: #
ok 113
ok 114
ok 115 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: #
ok 116
ok 117
ok 118 # TODO Sporadic test failures when running using PerlIO::eol on Linux w/Windows line endings: #
ok 119
ok 120
ok 121
ok 122 - Bio::Root::IO->new can handle a Path::Class object
ok 123 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 124 - Read string
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 137 - A reference of type 'GLOB' isa 'GLOB'
ok 138
ok 139
ok 140 - auto UNLINK => 1
ok 141
ok 142
ok 143 - tempfile deleted
ok 144 - A reference of type 'GLOB' isa 'GLOB'
ok 145
ok 146 - UNLINK => 0
ok 147
ok 148
ok 149 - A reference of type 'GLOB' isa 'GLOB'
ok 150 - tempfile suffix
ok 151
ok 152 - A reference of type 'GLOB' isa 'GLOB'
ok 153 - tempfile() in scalar context
ok 154
ok
t/Root/RootI.t ...................... 
1..43
ok 1 - use Bio::Root::Root;
ok 2
ok 3 - An object of class 'Bio::Root::Root' isa 'Bio::Root::RootI'
ok 4 - threw Regexp ((?^:Testing throw))
ok 5 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented))
ok 6 - threw Regexp ((?^:EXCEPTION ))
ok 7 - threw Regexp ((?^:Testing throw))
ok 8
ok 9 - threw Regexp ((?^:Testing throw))
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - arg callable since method was created
ok 16 - mal-formed arg callable since method was created with good name
ok 17 - Bio::Foo2->can('t3')
ok 18 - Methods don't pollute original Bio::Root::Root namespace
ok 19 - Bio::Foo2->can('test_4')
ok 20 - Methods don't pollute original Bio::Root::Root namespace
ok 21 - Bio::Foo3->can('t5')
ok 22 - arg not in method list not created
ok 23 - Bio::Foo3->can('t5')
ok 24 - Methods don't pollute original Bio::Root::Root namespace
ok 25 - verbose was set correctly
ok 26 - synonym was set correctly
ok 27 - real method of synonym was set correctly
ok 28 - mal-formed arg correctly resolved to created method
ok 29 - synonym of set method was set correctly
ok 30 - Bio::Foo4->can('t7')
ok 31 - Methods don't pollute original Bio::Root::Root namespace
ok 32 - Bio::Foo4->can('test7')
ok 33 - Methods don't pollute original Bio::Root::Root namespace
ok 34 - Bio::Foo4->can('test_8')
ok 35 - Methods don't pollute original Bio::Root::Root namespace
ok 36 - Bio::Foo4->can('t8')
ok 37 - Methods don't pollute original Bio::Root::Root namespace
ok 38 - clone
ok 39 - clone
ok 40 - clone
ok 41 - clone changed, original didn't
ok 42 - parameters passed to clone() modify object
ok 43 - original is not modified
ok
t/Root/RootIO.t ..................... 
1..3
ok 1 - use Bio::Root::IO;
ok 2 - default -url method
ok 3
ok
t/Root/Storable.t ................... 
1..35
ok 1 - use Bio::Root::Storable;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok

--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip.
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------

--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip.
---------------------------------------------------
t/Root/Utilities.t .................. 
1..56
ok 1 - use Bio::Root::Utilities;
ok 2 - An object of class 'Bio::Root::Utilities' isa 'Bio::Root::Utilities'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - file_date()
ok 38 - unix (\n or 012 or ^J)
ok 39 - date format
ok 40 - date format
ok 41 - date format
ok 42 - date format
ok 43 - date format
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok
t/SearchIO/axt.t .................... 
1..19
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/SearchIO/blast.t .................. 
1..1389
ok 1 - use Bio::SearchIO;
ok 2 - Bio::SearchIO->new can handle a Path::Class object
ok 3 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO'
ok 4 - Bio::SearchIO->new can handle a Path::Class object
ok 5 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO'
ok 6
ok 7 - database_name()
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
not ok 415 # TODO frac_identical & frac_conserved are still too wrong
#   Failed (TODO) test at t/SearchIO/blast.t line 667.
#     '0.852'
#         >
#     '0.9'
not ok 416 # TODO frac_identical & frac_conserved are still too wrong
#   Failed (TODO) test at t/SearchIO/blast.t line 668.
#     '1.599'
#         <=
#     '1'
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517
ok 518
ok 519
ok 520
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561
ok 562
ok 563
ok 564
ok 565
ok 566
ok 567
ok 568
ok 569
ok 570
ok 571
ok 572
ok 573
ok 574
ok 575
ok 576
ok 577
ok 578
ok 579
ok 580
ok 581
ok 582
ok 583
ok 584
ok 585
ok 586
ok 587
ok 588
ok 589
ok 590
ok 591
ok 592
ok 593
ok 594
ok 595
ok 596
ok 597 - Multiblast query test
ok 598
ok 599 - Multiblast query test
ok 600
ok 601 - Multiblast query test
ok 602
ok 603 - Multiblast query test
ok 604
ok 605
ok 606
ok 607
ok 608
ok 609
ok 610
ok 611
ok 612
ok 613
ok 614
ok 615
ok 616
ok 617
ok 618
ok 619
ok 620
ok 621
ok 622
ok 623
ok 624
ok 625
ok 626
ok 627
ok 628
ok 629
ok 630
ok 631
ok 632
ok 633
ok 634
ok 635
ok 636
ok 637
ok 638
ok 639
ok 640
ok 641
ok 642
ok 643
ok 644
ok 645
ok 646
ok 647
ok 648
ok 649
ok 650
ok 651
ok 652
ok 653
ok 654
ok 655
ok 656
ok 657
ok 658
ok 659
ok 660
ok 661
ok 662
ok 663
ok 664
ok 665
ok 666
ok 667
ok 668
ok 669
ok 670
ok 671
ok 672
ok 673
ok 674
ok 675
ok 676
ok 677
ok 678
ok 679
ok 680
ok 681
ok 682
ok 683
ok 684
ok 685
ok 686
ok 687
ok 688
ok 689
ok 690
ok 691
ok 692
ok 693
ok 694
ok 695
ok 696
ok 697
ok 698
ok 699
ok 700
ok 701
ok 702
ok 703
ok 704
ok 705
ok 706
ok 707
ok 708
ok 709
ok 710
ok 711
ok 712
ok 713
ok 714
ok 715
ok 716
ok 717
ok 718
ok 719
ok 720
ok 721
ok 722
ok 723
ok 724
ok 725
ok 726
ok 727
ok 728
ok 729
ok 730
ok 731
ok 732
ok 733
ok 734
ok 735
ok 736
ok 737
ok 738
ok 739
ok 740
ok 741
ok 742
ok 743
ok 744
ok 745
ok 746
ok 747
ok 748
ok 749
ok 750
ok 751
ok 752
ok 753
ok 754
ok 755
ok 756
ok 757
ok 758
ok 759
ok 760
ok 761
ok 762
ok 763
ok 764
ok 765
ok 766
ok 767
ok 768
ok 769
ok 770
ok 771
ok 772
ok 773
ok 774
ok 775
ok 776
ok 777
ok 778
ok 779
ok 780
ok 781
ok 782
ok 783
ok 784
ok 785
ok 786
ok 787
ok 788
ok 789
ok 790
ok 791
ok 792
ok 793
ok 794
ok 795
ok 796
ok 797
ok 798
ok 799
ok 800
ok 801
ok 802
ok 803
ok 804
ok 805
ok 806
ok 807
ok 808
ok 809
ok 810
ok 811
ok 812
ok 813
ok 814
ok 815
ok 816
ok 817
ok 818
ok 819
ok 820
ok 821
ok 822
ok 823
ok 824
ok 825
ok 826
ok 827
ok 828
ok 829
ok 830
ok 831
ok 832
ok 833
ok 834
ok 835
ok 836
ok 837
ok 838
ok 839
ok 840
ok 841
ok 842
ok 843
ok 844
ok 845
ok 846
ok 847
ok 848
ok 849
ok 850
ok 851
ok 852
ok 853
ok 854
ok 855
ok 856
ok 857
ok 858
ok 859
ok 860
ok 861
ok 862
ok 863
ok 864
ok 865
ok 866
ok 867
ok 868
ok 869
ok 870
ok 871
ok 872
ok 873
ok 874
ok 875
ok 876
ok 877
ok 878
ok 879
ok 880
ok 881
ok 882
ok 883
ok 884
ok 885 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 886
ok 887
ok 888
ok 889
ok 890
ok 891
ok 892
ok 893
ok 894
ok 895
ok 896
ok 897
ok 898
ok 899
ok 900
ok 901
ok 902
ok 903
ok 904
ok 905 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 906
ok 907
ok 908
ok 909
ok 910
ok 911
ok 912
ok 913
ok 914
ok 915
ok 916
ok 917
ok 918
ok 919
ok 920
ok 921
ok 922
ok 923
ok 924
ok 925
ok 926
ok 927
ok 928
ok 929 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 930
ok 931
ok 932
ok 933
ok 934
ok 935
ok 936
ok 937
ok 938
ok 939
ok 940
ok 941
ok 942
ok 943
ok 944
ok 945
ok 946
ok 947
ok 948
ok 949
ok 950
ok 951
ok 952
ok 953 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 954
ok 955
ok 956
ok 957
ok 958
ok 959
ok 960
ok 961
ok 962
ok 963
ok 964
ok 965
ok 966
ok 967
ok 968
ok 969
ok 970
ok 971
ok 972
ok 973
ok 974
ok 975
ok 976
ok 977
ok 978
ok 979
ok 980
ok 981
ok 982 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 983
ok 984
ok 985
ok 986
ok 987
ok 988
ok 989
ok 990
ok 991
ok 992
ok 993
ok 994
ok 995
ok 996
ok 997
ok 998
ok 999
ok 1000
ok 1001
ok 1002
ok 1003
ok 1004
ok 1005
ok 1006
ok 1007 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 1008
ok 1009
ok 1010
ok 1011
ok 1012
ok 1013
ok 1014
ok 1015
ok 1016
ok 1017
ok 1018
ok 1019
ok 1020
ok 1021
ok 1022
ok 1023
ok 1024
ok 1025
ok 1026
ok 1027
ok 1028
ok 1029
ok 1030
ok 1031
ok 1032
ok 1033
ok 1034
ok 1035 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 1036
ok 1037
ok 1038
ok 1039
ok 1040
ok 1041
ok 1042
ok 1043
ok 1044
ok 1045
ok 1046
ok 1047
ok 1048
ok 1049
ok 1050
ok 1051
ok 1052
ok 1053
ok 1054
ok 1055
ok 1056
ok 1057
ok 1058
ok 1059
ok 1060
ok 1061
ok 1062
ok 1063
ok 1064 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 1065
ok 1066
ok 1067
ok 1068
ok 1069
ok 1070
ok 1071
ok 1072
ok 1073
ok 1074
ok 1075
ok 1076
ok 1077
ok 1078
ok 1079
ok 1080
ok 1081
ok 1082
ok 1083 - blast for filename.bls
ok 1084 - fasta for f.m9
ok 1085 - fasta for f.psearch
ok 1086 - fasta for f.ssearch
ok 1087 - fasta for f.osearch
ok 1088 - fasta for f.fx
ok 1089 - blast for f.blx
ok 1090 - blast for fast.bls
ok 1091 - exonerate for f.exonerate
ok 1092 - blast for f.tblx
ok 1093 - fasta for f.SSEARCH.m9
ok 1094 - fasta for f.fasta
ok 1095 - blastxml for f.xml
ok 1096 - fasta for f.fy
ok 1097 - exonerate for f.exon
ok 1098 - fasta for f.fa
ok 1099 - blastxml for f.blastxml
ok 1100 - blast for filename.blast
ok 1101
ok 1102
ok 1103
ok 1104
ok 1105
ok 1106
ok 1107
ok 1108
ok 1109
ok 1110
ok 1111
ok 1112
ok 1113
ok 1114
ok 1115
ok 1116 - full hit name
ok 1117 - hit accession
ok 1118
ok 1119
ok 1120 - query start
ok 1121 - query start
ok 1122
ok 1123
ok 1124
ok 1125
ok 1126
ok 1127
ok 1128
ok 1129
ok 1130
ok 1131
ok 1132
ok 1133
ok 1134
ok 1135
ok 1136
ok 1137
ok 1138
ok 1139
ok 1140
ok 1141
ok 1142
ok 1143
ok 1144
ok 1145
ok 1146
ok 1147
ok 1148
ok 1149
ok 1150
ok 1151
ok 1152
ok 1153
ok 1154
ok 1155
ok 1156
ok 1157
ok 1158
ok 1159
ok 1160
ok 1161
ok 1162
ok 1163
ok 1164
ok 1165
ok 1166
ok 1167
ok 1168
ok 1169
ok 1170
ok 1171
ok 1172
ok 1173
ok 1174
ok 1175
ok 1176
ok 1177
ok 1178
ok 1179
ok 1180
ok 1181
ok 1182
ok 1183
ok 1184
ok 1185
ok 1186
ok 1187
ok 1188
ok 1189
ok 1190
ok 1191
ok 1192
ok 1193
ok 1194
ok 1195
ok 1196
ok 1197
ok 1198
ok 1199
ok 1200
ok 1201
ok 1202
ok 1203
ok 1204
ok 1205
ok 1206
ok 1207
ok 1208
ok 1209
ok 1210
ok 1211
ok 1212
ok 1213
ok 1214
ok 1215
ok 1216
ok 1217
ok 1218
ok 1219
ok 1220
ok 1221
ok 1222
ok 1223
ok 1224
ok 1225
ok 1226
ok 1227
ok 1228
ok 1229
ok 1230
ok 1231
ok 1232
ok 1233
ok 1234
ok 1235
ok 1236
ok 1237
ok 1238
ok 1239
ok 1240
ok 1241
ok 1242
ok 1243
ok 1244
ok 1245
ok 1246
ok 1247
ok 1248
ok 1249
ok 1250
ok 1251
ok 1252
ok 1253
ok 1254
ok 1255
ok 1256
ok 1257
ok 1258
ok 1259
ok 1260
ok 1261
ok 1262
ok 1263
ok 1264
ok 1265
ok 1266
ok 1267
ok 1268
ok 1269
ok 1270
ok 1271
ok 1272
ok 1273
ok 1274
ok 1275
ok 1276
ok 1277
ok 1278
ok 1279
ok 1280
ok 1281
ok 1282
ok 1283
ok 1284
ok 1285
ok 1286
ok 1287
ok 1288
ok 1289
ok 1290
ok 1291
ok 1292
ok 1293
ok 1294
ok 1295
ok 1296
ok 1297
ok 1298
ok 1299
ok 1300
ok 1301
ok 1302
ok 1303
ok 1304
ok 1305
ok 1306
ok 1307
ok 1308
ok 1309
ok 1310
ok 1311
ok 1312
ok 1313
ok 1314
ok 1315
ok 1316
ok 1317
ok 1318
ok 1319
ok 1320
ok 1321
ok 1322
ok 1323
ok 1324
ok 1325
ok 1326
ok 1327
ok 1328
ok 1329
ok 1330
ok 1331
ok 1332
ok 1333
ok 1334
ok 1335
ok 1336
ok 1337
ok 1338
ok 1339
ok 1340
ok 1341
ok 1342
ok 1343
ok 1344
ok 1345
ok 1346
ok 1347
ok 1348
ok 1349
ok 1350
ok 1351
ok 1352
ok 1353
ok 1354
ok 1355
ok 1356
ok 1357
ok 1358
ok 1359
ok 1360
ok 1361
ok 1362
ok 1363
ok 1364
ok 1365
ok 1366
ok 1367
ok 1368
ok 1369
ok 1370
ok 1371
ok 1372
ok 1373
ok 1374
ok 1375
ok 1376
ok 1377
ok 1378
ok 1379
ok 1380
ok 1381
ok 1382
ok 1383
ok 1384 - testing Bug 3298
ok 1385 - testing Bug 3298
ok 1386 - testing Bug 3298
ok 1387 - testing Bug 3251
ok 1388 - testing Bug 3251
ok 1389 - testing Bug 3251
ok
t/SearchIO/blast_pull.t ............. 
1..289
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - database_name()
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
not ok 191 # TODO frac_identical failing!
#   Failed (TODO) test at t/SearchIO/blast_pull.t line 259.
#          got: '0.946'
#     expected: '0.943'
ok 192
ok 193
ok 194
ok 195
ok 196 - Multiblast query test
ok 197 - Multiblast query test
ok 198 - Multiblast query test
ok 199 - Multiblast query test
ok 200
ok 201
ok 202
ok 203 - full hit name
ok 204 - hit accession
ok 205
ok 206 - query start
ok 207 - query start
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok
t/SearchIO/blasttable.t ............. 
1..166
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::Search::SearchUtils;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6 - hit1_bits
ok 7 - hit1_name
ok 8 - hsp1_bits
ok 9 - hsp1_gaps
ok 10 - hsp1_he
ok 11 - hsp1_hs
ok 12 - hsp1_hstr
ok 13 - hsp1_qe
ok 14 - hsp1_qs
ok 15 - hsp1_qstr
ok 16 - hsp2_bits
ok 17 - hsp2_gaps
ok 18 - hsp2_he
ok 19 - hsp2_hs
ok 20 - hsp2_hstr
ok 21 - hsp2_qe
ok 22 - hsp2_qs
ok 23 - hsp2_qstr
ok 24 - hsp3_bits
ok 25 - hsp3_gaps
ok 26 - hsp3_he
ok 27 - hsp3_hs
ok 28 - hsp3_hstr
ok 29 - hsp3_qe
ok 30 - hsp3_qs
ok 31 - hsp3_qstr
ok 32 - hsp4_bits
ok 33 - hsp4_gaps
ok 34 - hsp4_he
ok 35 - hsp4_hs
ok 36 - hsp4_hstr
ok 37 - hsp4_qe
ok 38 - hsp4_qs
ok 39 - hsp4_qstr
ok 40 - hsp5_bits
ok 41 - hsp5_gaps
ok 42 - hsp5_he
ok 43 - hsp5_hs
ok 44 - hsp5_hstr
ok 45 - hsp5_qe
ok 46 - hsp5_qs
ok 47 - hsp5_qstr
ok 48 - hsp6_bits
ok 49 - hsp6_gaps
ok 50 - hsp6_he
ok 51 - hsp6_hs
ok 52 - hsp6_hstr
ok 53 - hsp6_qe
ok 54 - hsp6_qs
ok 55 - hsp6_qstr
ok 56 - hsp7_bits
ok 57 - hsp7_gaps
ok 58 - hsp7_he
ok 59 - hsp7_hs
ok 60 - hsp7_hstr
ok 61 - hsp7_qe
ok 62 - hsp7_qs
ok 63 - hsp7_qstr
ok 64 - hsp8_bits
ok 65 - hsp8_gaps
ok 66 - hsp8_he
ok 67 - hsp8_hs
ok 68 - hsp8_hstr
ok 69 - hsp8_qe
ok 70 - hsp8_qs
ok 71 - hsp8_qstr
ok 72 - query_name
ok 73 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 74
ok 75
ok 76 - hit1_bits
ok 77 - hit1_name
ok 78 - hsp1_bits
ok 79 - hsp1_gaps
ok 80 - hsp1_he
ok 81 - hsp1_hs
ok 82 - hsp1_hstr
ok 83 - hsp1_qe
ok 84 - hsp1_qs
ok 85 - hsp1_qstr
ok 86 - hsp2_bits
ok 87 - hsp2_gaps
ok 88 - hsp2_he
ok 89 - hsp2_hs
ok 90 - hsp2_hstr
ok 91 - hsp2_qe
ok 92 - hsp2_qs
ok 93 - hsp2_qstr
ok 94 - hsp3_bits
ok 95 - hsp3_gaps
ok 96 - hsp3_he
ok 97 - hsp3_hs
ok 98 - hsp3_hstr
ok 99 - hsp3_qe
ok 100 - hsp3_qs
ok 101 - hsp3_qstr
ok 102 - hsp4_bits
ok 103 - hsp4_gaps
ok 104 - hsp4_he
ok 105 - hsp4_hs
ok 106 - hsp4_hstr
ok 107 - hsp4_qe
ok 108 - hsp4_qs
ok 109 - hsp4_qstr
ok 110 - hsp5_bits
ok 111 - hsp5_gaps
ok 112 - hsp5_he
ok 113 - hsp5_hs
ok 114 - hsp5_hstr
ok 115 - hsp5_qe
ok 116 - hsp5_qs
ok 117 - hsp5_qstr
ok 118 - hsp6_bits
ok 119 - hsp6_gaps
ok 120 - hsp6_he
ok 121 - hsp6_hs
ok 122 - hsp6_hstr
ok 123 - hsp6_qe
ok 124 - hsp6_qs
ok 125 - hsp6_qstr
ok 126 - hsp7_bits
ok 127 - hsp7_gaps
ok 128 - hsp7_he
ok 129 - hsp7_hs
ok 130 - hsp7_hstr
ok 131 - hsp7_qe
ok 132 - hsp7_qs
ok 133 - hsp7_qstr
ok 134 - hsp8_bits
ok 135 - hsp8_gaps
ok 136 - hsp8_he
ok 137 - hsp8_hs
ok 138 - hsp8_hstr
ok 139 - hsp8_qe
ok 140 - hsp8_qs
ok 141 - hsp8_qstr
ok 142 - query_name
ok 143
ok 144
ok 145
ok 146
ok 147 - hit score
ok 148 - hit raw_score
ok 149 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI'
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157 - fixed bug 3343 (percent identity)
ok 158 - side effect of fixing bug 3343 (number of gaps)
ok 159 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI'
ok 160
ok 161
ok 162
ok 163 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI'
ok 164
ok 165
ok 166
ok
t/SearchIO/CigarString.t ............ 
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/cross_match.t ............ 
1..15
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/SearchIO/erpin.t .................. 
1..91
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 3 - Result ERPIN
ok 4 - Result ERPIN reference
ok 5 - Result ERPIN version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_name
ok 16 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 17 - Hit accession
ok 18 - Hit GI
ok 19 - Hit algorithm
ok 20 - Hit bits
ok 21 - Hit description
ok 22 - Hit length
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit overlap
ok 28 - Hit query_length
ok 29 - Hit rank
ok 30 - Hit raw_score
ok 31 - Hit score
ok 32
ok 33 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 34 - HSP algorithm
ok 35
ok 36 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 37 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 38 - HSP frame
ok 39 - HSP gaps
ok 40 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 41 - HSP hit_string
ok 42 - HSP homology_string
ok 43 - HSP hsp_group
ok 44 - HSP hsp_length
ok 45 - HSP length
ok 46 - HSP links
ok 47 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 48 - HSP query_string
ok 49 - HSP range
ok 50 - HSP rank
ok 51
ok 52 - HSP expect
ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58
ok 59
ok 60 - HSP strand
ok 61
ok 62
ok 63 - ERPIN get_aln warning
ok 64 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 65 - HSP algorithm
ok 66
ok 67 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 68 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 69 - HSP frame
ok 70 - HSP gaps
ok 71 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 72 - HSP hit_string
ok 73 - HSP homology_string
ok 74 - HSP query_string
ok 75 - HSP hsp_group
ok 76 - HSP hsp_length
ok 77 - HSP length
ok 78 - HSP links
ok 79 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 80 - HSP range
ok 81 - HSP rank
ok 82
ok 83 - HSP end
ok 84 - HSP expect
ok 85 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 86 - HSP seq_str
ok 87 - HSP start
ok 88 - HSP custom_score
ok 89
ok 90
ok 91 - HSP strand
ok
t/SearchIO/exonerate.t .............. 
1..52
ok 1 - use Bio::SearchIO;
ok 2
ok 3 # skip no query length available in default output
ok 4
ok 5 # skip no hit length available in default output
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 # skip no query length available in default output
ok 26
ok 27 # skip no hit length available in default output
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - query_name
ok 47
ok 48 - query_name
ok 49
ok 50 - query_name
ok 51
ok 52
ok
t/SearchIO/fasta.t .................. 
1..301
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267 - TFASTXY
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286 - num_identical()
ok 287 - num_conserved()
ok 288 - bug 2937 and FASTA version 3.5
ok 289 - algorithm version
ok 290 - query name
ok 291 - query description
ok 292 - query length
ok 293 - algorithm
ok 294 - num_identical()
ok 295 - num_conserved()
ok 296 - hsp->strand(hit)
ok 297 - hsp->hit->strand
ok 298 - hsp->strand(query)
ok 299 - hsp->query->strand
ok 300 - issue 255
ok 301 - issue 255: first hsp score
ok
t/SearchIO/gmap_f9.t ................ 
1..54
ok 1 - use Bio::SearchIO;
ok 2 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult'
ok 3 - Did we get the expected number of hits?
ok 4 - Did we get the expected algorithm?
ok 5 - Did we get the expected query_name?
ok 6 - 'Did we get a Hit?' isa 'Bio::Search::Hit::GenericHit'
ok 7 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI'
ok 8 - Check the name
ok 9 - Check the hit length
ok 10 - Check the number of hsps
ok 11 - Check the query length
ok 12 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI'
ok 13 - Check the algorithm
ok 14 - Count gaps in the query
ok 15 - Count gaps in the hit
ok 16 - Length of the query
ok 17 - Length of the hit
ok 18 - Query sequence
ok 19 - Hit sequence
ok 20 - Check query start
ok 21 - Check query end
ok 22 - Check query end
ok 23 - Check the homology string
ok 24 - Check seq_inds
ok 25 - Check hit start
ok 26 - Check hit end
ok 27 - Check hit end
ok 28 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult'
ok 29 - Did we get the expected number of hits?
ok 30 - Did we get the expected algorithm?
ok 31 - Did we get the expected query_name?
ok 32 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI'
ok 33 - Check the name
ok 34 - Check the hit length
ok 35 - Check the number of hsps
ok 36 - Check the query length
ok 37 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI'
ok 38 - Check the algorithm
ok 39 - Count gaps in the query
ok 40 - Count gaps in the hit
ok 41 - Length of the query
ok 42 - Length of the hit
ok 43 - Query sequence
ok 44 - Hit sequence
ok 45 - Check query start
ok 46 - Check query end
ok 47 - Check query end
ok 48 - Check the homology string
ok 49 - Check seq_inds
ok 50 - Check hit start
ok 51 - Check hit end
ok 52 - Check hit end
ok 53 - Can we loop over multiple results properly (expecting 58)?
ok 54 - simple query_name now caught, bug 3021
ok
t/SearchIO/infernal.t ............... 
1..496
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI'
ok 3 - Check for the correct Result reference type
ok 4 - Check algorithm
ok 5 - Check cmsearch algorithm version
ok 6 - Check cm_name
ok 7 - Check database_name
ok 8 - Check database_entries
ok 9 - Check database_letters
ok 10 - Check query_name
ok 11 - Check query_length
ok 12 - Check query_accession
ok 13 - Check query_description
ok 14 - Check num_hits
ok 15 - Check for the correct hit reference type
ok 16 - Hit algorithm
ok 17 - Check hit name
ok 18 - Check hit description
ok 19 - Check hit length
ok 20 - Check hit score
ok 21 - Check hit bits
ok 22 - Check number of HSPs
ok 23 - Check hit significance
ok 24 - Check hit rank
ok 25 - Check for correct hsp reference type
ok 26 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 28 - 'Check for hsp hit isa seqfeature similarity' isa 'Bio::SeqFeature::Similarity'
ok 29 - Check for HSP hit seq_id
ok 30 - Check for HSP query seq_id
ok 31 - Check hsp query start
ok 32 - Check hsp query end
ok 33 - Check hsp hit start
ok 34 - Check hsp hit end
ok 35 - Check hsp score
ok 36 - Check hsp bits
ok 37 - Check hsp evalue
ok 38 - Check for hsp query length
ok 39 - Check for hsp hit length
ok 40 - Check for hsp total length
ok 41 - Check for hsp query gaps
ok 42 - Check for hsp hit gaps
ok 43 - Check for hsp total gaps
ok 44 - Check hsp hit strand
ok 45 - Check hit name
ok 46 - Check hit description
ok 47 - Check hit score
ok 48 - Check hit raw_score
ok 49 - Check hit bits
ok 50 - Check hit significance
ok 51 - Check hit length
ok 52 - Hit rank
ok 53 - Check for hit seq_id
ok 54 - Check for query seq_id
ok 55 - Check hsp query start
ok 56 - Check hsp query end
ok 57 - Check hsp hit start
ok 58 - Check hsp hit end
ok 59 - Check hsp score
ok 60 - Check hsp bits
ok 61 - Check hsp evalue
ok 62 - Check for hsp query gaps
ok 63 - Check for hsp hit gaps
ok 64 - Check for hsp total gaps
ok 65 - Check hsp hit strand
ok 66 - Check for NC string
ok 67 - Check for CS string
ok 68 - Check for query string
ok 69 - Check for homology string
ok 70 - Check for hit string
ok 71 - Check for posterior probability string
ok 72 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 73 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 74 - Check hsp feature1 get_tag_values
ok 75 - Check hsp feature2 get_tag_values
ok 76 - Check for undefined result
ok 77 - Check result num_hits - multi report
ok 78 - Check result query_name - multi report
ok 79 - Check hit length - multi report
ok 80 - Check result\#2 num_hits - multi report
ok 81 - Check result\#2 query_name - multi report
ok 82 - Check result\#2 hit length - multi report
ok 83 - Check result\#2 hsp hit strand - multi report
ok 84 - Check cm_name
ok 85 - Check for undefined hit
ok 86 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI'
ok 87 - Result
ok 88 - Result reference
ok 89 - Result version
ok 90 - Result parameters
ok 91 - Result statistics
ok 92 - Result entries
ok 93 - Result letters
ok 94 - Result database_name
ok 95 - Result num_hits
ok 96 - Result program_reference
ok 97 - Result query_accession
ok 98 - Result query_description
ok 99 - Result query_length
ok 100 - Result query_name
ok 101 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 102 - Hit GI
ok 103 - Hit accession
ok 104 - Hit algorithm
ok 105 - Hit bits
ok 106 - Hit description
ok 107 - Hit locus
ok 108 - Hit n
ok 109 - Hit name
ok 110 - Hit num_hsps
ok 111 - Hit length_aln() not implemented
ok 112 - Hit num_unaligned_hit() not implemented
ok 113 - Hit num_unaligned_query() not implemented
ok 114 - Hit num_unaligned_sbjct() not implemented
ok 115 - Hit start not implemented
ok 116 - Hit end not implemented
ok 117 - Hit strand not implemented
ok 118 - Hit logical_length not implemented
ok 119 - Hit frac_aligned_hit not implemented
ok 120 - Hit frac_aligned_query not implemented
ok 121 - Hit frac_conserved not implemented
ok 122 - Hit frac_identical not implemented
ok 123 - Hit matches not implemented
ok 124 - Hit gaps not implemented
ok 125 - Hit frame not implemented
ok 126 - Hit range not implemented
ok 127 - Hit seq_inds not implemented
ok 128 - Hit length
ok 129 - Hit overlap
ok 130 - Hit query_length
ok 131 - Hit rank
ok 132 - Hit raw_score
ok 133 - Hit score
ok 134 - Hit p
ok 135
ok 136 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 137 - HSP algorithm
ok 138
ok 139 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 140 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 141
ok 142
ok 143 - HSP frame
ok 144 - HSP gaps
ok 145 - Hit length
ok 146 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 147 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 148 - HSP hit_string
ok 149 - HSP homology_string
ok 150 - HSP hsp_group
ok 151 - HSP hsp_length
ok 152 - HSP length
ok 153 - HSP links
ok 154 - HSP n
ok 155 - HSP pvalue
ok 156 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 157 - HSP query_string
ok 158 - HSP range
ok 159 - HSP rank
ok 160
ok 161 - HSP end
ok 162 - HSP expect
ok 163 - HSP seq_inds not implemented
ok 164 - HSP matches not implemented
ok 165 - HSP frac_conserved not implemented
ok 166 - HSP frac_identical not implemented
ok 167 - HSP num_conserved not implemented
ok 168 - HSP num_identical not implemented
ok 169 - HSP percent_identity not implemented
ok 170 - HSP cigar_string not implemented
ok 171 - HSP cigar_string not implemented
ok 172 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 173 - HSP seq_str
ok 174 - HSP start
ok 175 - HSP custom_score
ok 176 - HSP meta
ok 177 - HSP strand
ok 178 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 179 - HSP algorithm
ok 180
ok 181 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 182 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 183 - HSP frame
ok 184 - HSP gaps
ok 185 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 186 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 187 - HSP hit_string
ok 188 - HSP homology_string
ok 189 - HSP hsp_group
ok 190 - HSP hsp_length
ok 191 - HSP length
ok 192 - HSP links
ok 193 - HSP n
ok 194 - HSP pvalue
ok 195 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 196 - HSP query_string
ok 197 - HSP range
ok 198 - HSP rank
ok 199
ok 200 - HSP end
ok 201 - HSP expect
ok 202 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 203 - HSP seq_str
ok 204 - HSP start
ok 205 - HSP custom_score
ok 206 - HSP meta
ok 207 - HSP strand
ok 208 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI'
ok 209 - Result CMSEARCH
ok 210 - Result CMSEARCH reference
ok 211 - Result CMSEARCH version
ok 212 - Result parameters
ok 213 - Result statistics
ok 214 - Result entries
ok 215 - Result letters
ok 216 - Result database_name
ok 217 - Result num_hits
ok 218 - Result program_reference
ok 219 - Result query_accession
ok 220 - Result query_description
ok 221 - Result query_length
ok 222 - Result query_name
ok 223 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 224 - Hit GI
ok 225 - Hit accession
ok 226 - Hit algorithm
ok 227 - Hit bits
ok 228 - Hit description
ok 229 - Hit locus
ok 230 - Hit n
ok 231 - Hit name
ok 232 - Hit num_hsps
ok 233 - No p values
ok 234 - Hit length
ok 235 - Hit overlap
ok 236 - Hit query_length
ok 237 - Hit rank
ok 238 - Hit raw_score
ok 239 - Hit score
ok 240
ok 241 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 242 - HSP algorithm
ok 243
ok 244 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 245 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 246
ok 247
ok 248 - HSP frame
ok 249 - HSP gaps
ok 250 - Hit length
ok 251 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 252 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 253 - HSP hit_string
ok 254 - HSP homology_string
ok 255 - HSP hsp_group
ok 256 - HSP hsp_length
ok 257 - HSP length
ok 258 - HSP links
ok 259 - HSP n
ok 260 - HSP pvalue
ok 261 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 262 - HSP query_string
ok 263 - HSP range
ok 264 - HSP rank
ok 265
ok 266 - HSP end
ok 267 - HSP expect
ok 268 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 269 - HSP seq_str
ok 270 - HSP start
ok 271 - HSP custom_score
ok 272 - HSP meta
ok 273 - HSP strand
ok 274 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 275 - HSP algorithm
ok 276
ok 277 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 278 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 279 - HSP frame
ok 280 - HSP gaps
ok 281 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 282 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 283 - HSP hit_string
ok 284 - HSP homology_string
ok 285 - HSP hsp_group
ok 286 - HSP hsp_length
ok 287 - HSP length
ok 288 - HSP links
ok 289 - HSP n
ok 290 - HSP pvalue
ok 291 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 292 - HSP query_string
ok 293 - HSP range
ok 294 - HSP rank
ok 295
ok 296 - HSP end
ok 297 - HSP expect
ok 298 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 299 - HSP seq_str
ok 300 - HSP start
ok 301 - HSP custom_score
ok 302 - HSP meta
ok 303 - HSP strand
ok 304 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 305 - Hit accession
ok 306 - Hit GI
ok 307 - Hit algorithm
ok 308 - Hit bits
ok 309 - Hit description
ok 310 - Hit length
ok 311 - Hit locus
ok 312 - Hit n
ok 313 - Hit name
ok 314 - Hit num_hsps
ok 315 - Hit overlap
ok 316 - Hit query_length
ok 317 - Hit rank
ok 318 - Hit raw_score
ok 319 - Hit score
ok 320
ok 321 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 322 - HSP algorithm
ok 323
ok 324 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 325 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 326 - HSP frame
ok 327 - HSP gaps
ok 328 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 329 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 330 - HSP hit_string
ok 331 - HSP homology_string
ok 332 - HSP hsp_group
ok 333 - HSP hsp_length
ok 334 - HSP length
ok 335 - HSP links
ok 336 - HSP n
ok 337 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 338 - HSP query_string
ok 339 - HSP range
ok 340 - HSP rank
ok 341
ok 342 - HSP end
ok 343 - HSP expect
ok 344 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 345 - HSP seq_str
ok 346 - HSP start
ok 347 - HSP custom_score
ok 348 - HSP meta
ok 349 - HSP strand
ok 350 - HSP meta gap bug
ok 351 - HSP meta
ok 352 - HSP meta
ok 353
ok 354
ok 355 - An object of class 'Bio::Search::Result::INFERNALResult' isa 'Bio::Search::Result::ResultI'
ok 356 - Result CMSEARCH
ok 357 - Result CMSEARCH reference
ok 358 - Result CMSEARCH version
ok 359 - Result parameters
ok 360 - Result statistics
ok 361 - Result entries
ok 362 - Result letters
ok 363 - Result database_name
ok 364 - Result num_hits
ok 365 - Result program_reference
ok 366 - Result query_accession
ok 367 - Result query_description
ok 368 - Result query_length
ok 369 - Result query_name
ok 370 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 371 - Hit GI
ok 372 - Hit accession
ok 373 - Hit algorithm
ok 374 - Hit bits
ok 375 - Hit description
ok 376 - Hit locus
ok 377 - Hit n
ok 378 - Hit name
ok 379 - Hit num_hsps
ok 380 - No p values
ok 381 - Hit length
ok 382 - Hit overlap
ok 383 - Hit query_length
ok 384 - Hit rank
ok 385 - Hit raw_score
ok 386 - Hit score
ok 387
ok 388 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 389 - HSP algorithm
ok 390
ok 391 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 392 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 393
ok 394
ok 395 - HSP frame
ok 396 - HSP gaps
ok 397 - Hit length
ok 398 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 399 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 400 - HSP hit_string
ok 401 - HSP homology_string
ok 402 - HSP hsp_group
ok 403 - HSP hsp_length
ok 404 - HSP length
ok 405 - HSP links
ok 406 - HSP n
ok 407 - HSP pvalue
ok 408 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 409 - HSP query_string
ok 410 - HSP range
ok 411 - HSP rank
ok 412
ok 413 - HSP end
ok 414 - HSP expect
ok 415 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 416 - HSP seq_str
ok 417 - HSP start
ok 418 - HSP custom_score
ok 419 - HSP meta
ok 420 - HSP strand
ok 421 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 422 - HSP algorithm
ok 423
ok 424 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 425 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 426 - HSP frame
ok 427 - HSP gaps
ok 428 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 429 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 430 - HSP hit_string
ok 431 - HSP homology_string
ok 432 - HSP hsp_group
ok 433 - HSP hsp_length
ok 434 - HSP length
ok 435 - HSP links
ok 436 - HSP n
ok 437 - HSP pvalue
ok 438 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 439 - HSP query_string
ok 440 - HSP range
ok 441 - HSP rank
ok 442
ok 443 - HSP end
ok 444 - HSP expect
ok 445 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 446 - HSP seq_str
ok 447 - HSP start
ok 448 - HSP custom_score
ok 449 - HSP meta
ok 450 - HSP strand
ok 451 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 452 - Hit accession
ok 453 - Hit GI
ok 454 - Hit algorithm
ok 455 - Hit bits
ok 456 - Hit description
ok 457 - Hit length
ok 458 - Hit locus
ok 459 - Hit n
ok 460 - Hit name
ok 461 - Hit num_hsps
ok 462 - Hit overlap
ok 463 - Hit query_length
ok 464 - Hit rank
ok 465 - Hit raw_score
ok 466 - Hit score
ok 467
ok 468 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 469 - HSP algorithm
ok 470
ok 471 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 472 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 473 - HSP frame
ok 474 - HSP gaps
ok 475 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 476 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 477 - HSP hit_string
ok 478 - HSP homology_string
ok 479 - HSP hsp_group
ok 480 - HSP hsp_length
ok 481 - HSP length
ok 482 - HSP links
ok 483 - HSP n
ok 484 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 485 - HSP query_string
ok 486 - HSP range
ok 487 - HSP rank
ok 488
ok 489 - HSP end
ok 490 - HSP expect
ok 491 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 492 - HSP seq_str
ok 493 - HSP start
ok 494 - HSP custom_score
ok 495 - HSP meta
ok 496 - HSP strand
ok
t/SearchIO/megablast.t .............. 
1..31
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/SearchIO/psl.t .................... 
1..53
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - next_hsp should be undef
ok 51 - next_hit should be undef
not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string
#   Failed (TODO) test 'next_result should be undef'
#   at t/SearchIO/psl.t line 96.
#          got: ''
#     expected: undef
ok 53
ok
t/SearchIO/rnamotif.t ............... 
1..60
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 3 - Result RNAMOTIF
ok 4 - Result RNAMOTIF reference
ok 5 - Result RNAMOTIF version
ok 6 - Result entries
ok 7 - Result letters
ok 8 - Result database_name
ok 9 - Result num_hits
ok 10 - Result program_reference
ok 11 - Result query_accession
ok 12 - Result query_description
ok 13 - Result query_length
ok 14 - Result query_name
ok 15 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 16 - Hit accession
ok 17 - Hit GI
ok 18 - Hit algorithm
ok 19 - Hit description
ok 20 - Hit length
ok 21 - Hit locus
ok 22 - Hit n
ok 23 - Hit name
ok 24 - Hit num_hsps
ok 25 - Hit overlap
ok 26 - Hit rank
ok 27 - Hit raw_score
ok 28 - Hit score
ok 29
ok 30 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 31 - HSP algorithm
ok 32
ok 33 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 34 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 35 - HSP frame
ok 36 - HSP gaps
ok 37 - RNAMotif get_aln warning
ok 38 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 39 - HSP hit_string
ok 40 - HSP homology_string
ok 41 - HSP hsp_group
ok 42 - HSP hsp_length
ok 43 - HSP length
ok 44 - HSP links
ok 45 - HSP n
ok 46 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 47 - HSP query_string
ok 48 - HSP range
ok 49 - HSP rank
ok 50
ok 51 - HSP end
ok 52 - HSP expect
ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58 - HSP strand
ok 59
ok 60
ok
t/SearchIO/SearchIO.t ............... 
1..19
ok 1 - use Bio::SearchIO;
ok 2 - blast for filename.bls
ok 3 - blast for fast.bls
ok 4 - blast for filename.blast
ok 5 - blastxml for f.blastxml
ok 6 - blastxml for f.xml
ok 7 - fasta for f.fasta
ok 8 - fasta for f.ssearch
ok 9 - exonerate for f.exonerate
ok 10 - exonerate for f.exon
ok 11 - blast for f.tblx
ok 12 - blast for f.blx
ok 13 - fasta for f.fx
ok 14 - fasta for f.psearch
ok 15 - fasta for f.m9
ok 16 - fasta for f.fy
ok 17 - fasta for f.SSEARCH.m9
ok 18 - fasta for f.osearch
ok 19 - fasta for f.fa
ok
t/SearchIO/sim4.t ................... 
1..102
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/SearchIO/SimilarityPair.t ......... 
1..12
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SeqIO;
ok 3
ok 4 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 5
ok 6 - An object of class 'Bio::SearchIO::blast' isa 'Bio::SearchIO'
ok 7
ok 8 - An object of class 'Bio::Search::Hit::BlastHit' isa 'Bio::Search::Hit::HitI'
ok 9
ok 10 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI'
ok 11
ok 12
ok
t/SearchIO/Tiling.t ................. 
1..1141
ok 1 - use Bio::Search::Tiling::MapTiling;
ok 2 - use Bio::Search::Tiling::MapTileUtils;
ok 3 - use Bio::SearchIO;
ok 4 - use Bio::Search::Hit::BlastHit;
ok 5 - use File::Spec;
ok 6 - parse data file
ok 7 - got test hit
ok 8 - create tiling
ok 9 - An object of class 'Bio::Search::Tiling::MapTiling' isa 'Bio::Search::Tiling::TilingI'
ok 10 - implements 'next_tiling'
ok 11 - implements 'rewind_tilings'
ok 12 - implements 'identities'
ok 13 - implements 'conserved'
ok 14 - implements 'length'
ok 15 - identities regression test
ok 16 - conserved regression test
ok 17 - tiling iterator regression test(1)
ok 18 - tiling iterator regression test(2)
ok 19 - tiling iterator regression test(3, rewind)
ok 20 - ecolitst.wublastp
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - dnaEbsub_ecoli.wublastx
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36 - tricky.wublast
ok 37 - tricky.wublast(1)
ok 38 - tricky.wublast(2)
ok 39 - tricky.wublast(3)
ok 40 - tricky.wublast(4)
ok 41 - ecolitst.bls
ok 42 - tile ecolitst.bls hit 1 \#hsps 1
ok 43 - q id: est (0.98293) = fast (0.98293)
ok 44 - q cn: est (0.98293) = fast (0.98293)
ok 45 - h id: est (0.98293) = fast (0.98293)
ok 46 - h cn: est (0.98293) = fast (0.98293)
ok 47 - tile ecolitst.bls hit 2 \#hsps 1
ok 48 - q id: est (0.30074) = fast (0.30074)
ok 49 - q cn: est (0.49876) = fast (0.49876)
ok 50 - h id: est (0.30759) = fast (0.30759)
ok 51 - h cn: est (0.51013) = fast (0.51013)
ok 52 - tile ecolitst.bls hit 3 \#hsps 1
ok 53 - q id: est (0.31004) = fast (0.31004)
ok 54 - q cn: est (0.49782) = fast (0.49782)
ok 55 - h id: est (0.32054) = fast (0.32054)
ok 56 - h cn: est (0.51467) = fast (0.51467)
ok 57 - tile ecolitst.bls hit 4 \#hsps 1
ok 58 - q id: est (0.30435) = fast (0.30435)
ok 59 - q cn: est (0.47826) = fast (0.47826)
ok 60 - h id: est (0.29787) = fast (0.29787)
ok 61 - h cn: est (0.46809) = fast (0.46809)
ok 62 - tricky.wublast
ok 63 - tile tricky.wublast hit 1 \#hsps 7
ok 64 - q id: exact (0.22153) ~ est (0.22153)
ok 65 - q id: exact (0.22153) <= max (0.22153)
ok 66 - q cn: exact (0.42760) ~ est (0.42760)
ok 67 - q cn: exact (0.42760) <= max (0.42760)
ok 68 - h id: exact (0.22704) ~ est (0.22704)
ok 69 - h id: exact (0.22704) <= max (0.22704)
ok 70 - h cn: exact (0.43335) ~ est (0.43335)
ok 71 - h cn: exact (0.43335) <= max (0.43335)
ok 72 - a_thaliana.blastn
ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1
ok 74 - q id: est (0.96667) = fast (0.96667)
ok 75 - q cn: est (0.96667) = fast (0.96667)
ok 76 - h id: est (0.98305) = fast (0.98305)
ok 77 - h cn: est (0.98305) = fast (0.98305)
ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1
ok 79 - q id: est (0.96667) = fast (0.96667)
ok 80 - q cn: est (0.96667) = fast (0.96667)
ok 81 - h id: est (0.98305) = fast (0.98305)
ok 82 - h cn: est (0.98305) = fast (0.98305)
ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1
ok 84 - q id: est (1.00000) = fast (1.00000)
ok 85 - q cn: est (1.00000) = fast (1.00000)
ok 86 - h id: est (1.00000) = fast (1.00000)
ok 87 - h cn: est (1.00000) = fast (1.00000)
ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1
ok 89 - q id: est (1.00000) = fast (1.00000)
ok 90 - q cn: est (1.00000) = fast (1.00000)
ok 91 - h id: est (1.00000) = fast (1.00000)
ok 92 - h cn: est (1.00000) = fast (1.00000)
ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1
ok 94 - q id: est (0.92308) = fast (0.92308)
ok 95 - q cn: est (0.92308) = fast (0.92308)
ok 96 - h id: est (0.92308) = fast (0.92308)
ok 97 - h cn: est (0.92308) = fast (0.92308)
ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1
ok 99 - q id: est (1.00000) = fast (1.00000)
ok 100 - q cn: est (1.00000) = fast (1.00000)
ok 101 - h id: est (1.00000) = fast (1.00000)
ok 102 - h cn: est (1.00000) = fast (1.00000)
ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1
ok 104 - q id: est (1.00000) = fast (1.00000)
ok 105 - q cn: est (1.00000) = fast (1.00000)
ok 106 - h id: est (1.00000) = fast (1.00000)
ok 107 - h cn: est (1.00000) = fast (1.00000)
ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1
ok 109 - q id: est (1.00000) = fast (1.00000)
ok 110 - q cn: est (1.00000) = fast (1.00000)
ok 111 - h id: est (1.00000) = fast (1.00000)
ok 112 - h cn: est (1.00000) = fast (1.00000)
ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1
ok 114 - q id: est (1.00000) = fast (1.00000)
ok 115 - q cn: est (1.00000) = fast (1.00000)
ok 116 - h id: est (1.00000) = fast (1.00000)
ok 117 - h cn: est (1.00000) = fast (1.00000)
ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1
ok 119 - q id: est (1.00000) = fast (1.00000)
ok 120 - q cn: est (1.00000) = fast (1.00000)
ok 121 - h id: est (1.00000) = fast (1.00000)
ok 122 - h cn: est (1.00000) = fast (1.00000)
ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1
ok 124 - q id: est (1.00000) = fast (1.00000)
ok 125 - q cn: est (1.00000) = fast (1.00000)
ok 126 - h id: est (1.00000) = fast (1.00000)
ok 127 - h cn: est (1.00000) = fast (1.00000)
ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1
ok 129 - q id: est (1.00000) = fast (1.00000)
ok 130 - q cn: est (1.00000) = fast (1.00000)
ok 131 - h id: est (1.00000) = fast (1.00000)
ok 132 - h cn: est (1.00000) = fast (1.00000)
ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1
ok 134 - q id: est (1.00000) = fast (1.00000)
ok 135 - q cn: est (1.00000) = fast (1.00000)
ok 136 - h id: est (1.00000) = fast (1.00000)
ok 137 - h cn: est (1.00000) = fast (1.00000)
ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1
ok 139 - q id: est (1.00000) = fast (1.00000)
ok 140 - q cn: est (1.00000) = fast (1.00000)
ok 141 - h id: est (1.00000) = fast (1.00000)
ok 142 - h cn: est (1.00000) = fast (1.00000)
ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1
ok 144 - q id: est (1.00000) = fast (1.00000)
ok 145 - q cn: est (1.00000) = fast (1.00000)
ok 146 - h id: est (1.00000) = fast (1.00000)
ok 147 - h cn: est (1.00000) = fast (1.00000)
ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1
ok 149 - q id: est (1.00000) = fast (1.00000)
ok 150 - q cn: est (1.00000) = fast (1.00000)
ok 151 - h id: est (1.00000) = fast (1.00000)
ok 152 - h cn: est (1.00000) = fast (1.00000)
ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1
ok 154 - q id: est (1.00000) = fast (1.00000)
ok 155 - q cn: est (1.00000) = fast (1.00000)
ok 156 - h id: est (1.00000) = fast (1.00000)
ok 157 - h cn: est (1.00000) = fast (1.00000)
ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1
ok 159 - q id: est (1.00000) = fast (1.00000)
ok 160 - q cn: est (1.00000) = fast (1.00000)
ok 161 - h id: est (1.00000) = fast (1.00000)
ok 162 - h cn: est (1.00000) = fast (1.00000)
ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1
ok 164 - q id: est (1.00000) = fast (1.00000)
ok 165 - q cn: est (1.00000) = fast (1.00000)
ok 166 - h id: est (1.00000) = fast (1.00000)
ok 167 - h cn: est (1.00000) = fast (1.00000)
ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1
ok 169 - q id: est (0.95238) = fast (0.95238)
ok 170 - q cn: est (0.95238) = fast (0.95238)
ok 171 - h id: est (0.95238) = fast (0.95238)
ok 172 - h cn: est (0.95238) = fast (0.95238)
ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1
ok 174 - q id: est (1.00000) = fast (1.00000)
ok 175 - q cn: est (1.00000) = fast (1.00000)
ok 176 - h id: est (1.00000) = fast (1.00000)
ok 177 - h cn: est (1.00000) = fast (1.00000)
ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1
ok 179 - q id: est (0.95238) = fast (0.95238)
ok 180 - q cn: est (0.95238) = fast (0.95238)
ok 181 - h id: est (0.95238) = fast (0.95238)
ok 182 - h cn: est (0.95238) = fast (0.95238)
ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1
ok 184 - q id: est (1.00000) = fast (1.00000)
ok 185 - q cn: est (1.00000) = fast (1.00000)
ok 186 - h id: est (1.00000) = fast (1.00000)
ok 187 - h cn: est (1.00000) = fast (1.00000)
ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1
ok 189 - q id: est (0.95238) = fast (0.95238)
ok 190 - q cn: est (0.95238) = fast (0.95238)
ok 191 - h id: est (0.95238) = fast (0.95238)
ok 192 - h cn: est (0.95238) = fast (0.95238)
ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1
ok 194 - q id: est (1.00000) = fast (1.00000)
ok 195 - q cn: est (1.00000) = fast (1.00000)
ok 196 - h id: est (1.00000) = fast (1.00000)
ok 197 - h cn: est (1.00000) = fast (1.00000)
ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1
ok 199 - q id: est (1.00000) = fast (1.00000)
ok 200 - q cn: est (1.00000) = fast (1.00000)
ok 201 - h id: est (1.00000) = fast (1.00000)
ok 202 - h cn: est (1.00000) = fast (1.00000)
ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1
ok 204 - q id: est (1.00000) = fast (1.00000)
ok 205 - q cn: est (1.00000) = fast (1.00000)
ok 206 - h id: est (1.00000) = fast (1.00000)
ok 207 - h cn: est (1.00000) = fast (1.00000)
ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1
ok 209 - q id: est (1.00000) = fast (1.00000)
ok 210 - q cn: est (1.00000) = fast (1.00000)
ok 211 - h id: est (1.00000) = fast (1.00000)
ok 212 - h cn: est (1.00000) = fast (1.00000)
ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1
ok 214 - q id: est (1.00000) = fast (1.00000)
ok 215 - q cn: est (1.00000) = fast (1.00000)
ok 216 - h id: est (1.00000) = fast (1.00000)
ok 217 - h cn: est (1.00000) = fast (1.00000)
ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1
ok 219 - q id: est (1.00000) = fast (1.00000)
ok 220 - q cn: est (1.00000) = fast (1.00000)
ok 221 - h id: est (1.00000) = fast (1.00000)
ok 222 - h cn: est (1.00000) = fast (1.00000)
ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1
ok 224 - q id: est (1.00000) = fast (1.00000)
ok 225 - q cn: est (1.00000) = fast (1.00000)
ok 226 - h id: est (1.00000) = fast (1.00000)
ok 227 - h cn: est (1.00000) = fast (1.00000)
ok 228 - brassica_ATH.WUBLASTN
ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3
ok 230 - q id: exact (0.82465) ~ est (0.82343)
ok 231 - q id: exact (0.82465) <= max (0.83333)
ok 232 - q cn: exact (0.85590) ~ est (0.85312)
ok 233 - q cn: exact (0.85590) <= max (0.86458)
ok 234 - h id: exact (0.83920) ~ est (0.83920)
ok 235 - h id: exact (0.83920) <= max (0.83920)
ok 236 - h cn: exact (0.86935) ~ est (0.86935)
ok 237 - h cn: exact (0.86935) <= max (0.86935)
ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2
ok 239 - q id: exact (0.82486) ~ est (0.82486)
ok 240 - q id: exact (0.82486) <= max (0.82486)
ok 241 - q cn: exact (0.85122) ~ est (0.85122)
ok 242 - q cn: exact (0.85122) <= max (0.85122)
ok 243 - h id: exact (0.82955) ~ est (0.82955)
ok 244 - h id: exact (0.82955) <= max (0.82955)
ok 245 - h cn: exact (0.85606) ~ est (0.85606)
ok 246 - h cn: exact (0.85606) <= max (0.85606)
ok 247 - no_hsps.blastp
ok 248 - tile no_hsps.blastp hit 1 \#hsps 0
ok 249 - tile no_hsps.blastp hit 2 \#hsps 0
ok 250 - tile no_hsps.blastp hit 3 \#hsps 0
ok 251 - tile no_hsps.blastp hit 4 \#hsps 0
ok 252 - tile no_hsps.blastp hit 5 \#hsps 0
ok 253 - tile no_hsps.blastp hit 6 \#hsps 0
ok 254 - tile no_hsps.blastp hit 7 \#hsps 0
ok 255 - tile no_hsps.blastp hit 8 \#hsps 0
ok 256 - tile no_hsps.blastp hit 9 \#hsps 0
ok 257 - tile no_hsps.blastp hit 10 \#hsps 0
ok 258 - tile no_hsps.blastp hit 11 \#hsps 0
ok 259 - tile no_hsps.blastp hit 12 \#hsps 0
ok 260 - tile no_hsps.blastp hit 13 \#hsps 0
ok 261 - tile no_hsps.blastp hit 14 \#hsps 0
ok 262 - tile no_hsps.blastp hit 15 \#hsps 0
ok 263 - tile no_hsps.blastp hit 16 \#hsps 0
ok 264 - tile no_hsps.blastp hit 17 \#hsps 0
ok 265 - tile no_hsps.blastp hit 18 \#hsps 0
ok 266 - tile no_hsps.blastp hit 19 \#hsps 0
ok 267 - tile no_hsps.blastp hit 20 \#hsps 0
ok 268 - tile no_hsps.blastp hit 21 \#hsps 0
ok 269 - tile no_hsps.blastp hit 22 \#hsps 0
ok 270 - tile no_hsps.blastp hit 23 \#hsps 0
ok 271 - tile no_hsps.blastp hit 24 \#hsps 0
ok 272 - tile no_hsps.blastp hit 25 \#hsps 0
ok 273 - tile no_hsps.blastp hit 26 \#hsps 0
ok 274 - tile no_hsps.blastp hit 27 \#hsps 0
ok 275 - tile no_hsps.blastp hit 28 \#hsps 0
ok 276 - tile no_hsps.blastp hit 29 \#hsps 0
ok 277 - tile no_hsps.blastp hit 30 \#hsps 0
ok 278 - tile no_hsps.blastp hit 31 \#hsps 0
ok 279 - tile no_hsps.blastp hit 32 \#hsps 0
ok 280 - tile no_hsps.blastp hit 33 \#hsps 0
ok 281 - tile no_hsps.blastp hit 34 \#hsps 0
ok 282 - tile no_hsps.blastp hit 35 \#hsps 0
ok 283 - tile no_hsps.blastp hit 36 \#hsps 0
ok 284 - tile no_hsps.blastp hit 37 \#hsps 0
ok 285 - tile no_hsps.blastp hit 38 \#hsps 0
ok 286 - tile no_hsps.blastp hit 39 \#hsps 0
ok 287 - tile no_hsps.blastp hit 40 \#hsps 0
ok 288 - tile no_hsps.blastp hit 41 \#hsps 0
ok 289 - tile no_hsps.blastp hit 42 \#hsps 0
ok 290 - tile no_hsps.blastp hit 43 \#hsps 0
ok 291 - tile no_hsps.blastp hit 44 \#hsps 0
ok 292 - tile no_hsps.blastp hit 45 \#hsps 0
ok 293 - tile no_hsps.blastp hit 46 \#hsps 0
ok 294 - tile no_hsps.blastp hit 47 \#hsps 0
ok 295 - tile no_hsps.blastp hit 48 \#hsps 0
ok 296 - tile no_hsps.blastp hit 49 \#hsps 0
ok 297 - tile no_hsps.blastp hit 50 \#hsps 0
ok 298 - tile no_hsps.blastp hit 51 \#hsps 0
ok 299 - tile no_hsps.blastp hit 52 \#hsps 0
ok 300 - tile no_hsps.blastp hit 53 \#hsps 0
ok 301 - tile no_hsps.blastp hit 54 \#hsps 0
ok 302 - tile no_hsps.blastp hit 55 \#hsps 0
ok 303 - tile no_hsps.blastp hit 56 \#hsps 0
ok 304 - tile no_hsps.blastp hit 57 \#hsps 0
ok 305 - tile no_hsps.blastp hit 58 \#hsps 0
ok 306 - tile no_hsps.blastp hit 59 \#hsps 0
ok 307 - tile no_hsps.blastp hit 60 \#hsps 0
ok 308 - tile no_hsps.blastp hit 61 \#hsps 0
ok 309 - tile no_hsps.blastp hit 62 \#hsps 0
ok 310 - tile no_hsps.blastp hit 63 \#hsps 0
ok 311 - tile no_hsps.blastp hit 64 \#hsps 0
ok 312 - tile no_hsps.blastp hit 65 \#hsps 0
ok 313 - tile no_hsps.blastp hit 66 \#hsps 0
ok 314 - tile no_hsps.blastp hit 67 \#hsps 0
ok 315 - tile no_hsps.blastp hit 68 \#hsps 0
ok 316 - tile no_hsps.blastp hit 69 \#hsps 0
ok 317 - tile no_hsps.blastp hit 70 \#hsps 0
ok 318 - tile no_hsps.blastp hit 71 \#hsps 0
ok 319 - tile no_hsps.blastp hit 72 \#hsps 0
ok 320 - tile no_hsps.blastp hit 73 \#hsps 0
ok 321 - tile no_hsps.blastp hit 74 \#hsps 0
ok 322 - tile no_hsps.blastp hit 75 \#hsps 0
ok 323 - tile no_hsps.blastp hit 76 \#hsps 0
ok 324 - tile no_hsps.blastp hit 77 \#hsps 0
ok 325 - tile no_hsps.blastp hit 78 \#hsps 0
ok 326 - tile no_hsps.blastp hit 79 \#hsps 0
ok 327 - tile no_hsps.blastp hit 80 \#hsps 0
ok 328 - tile no_hsps.blastp hit 81 \#hsps 0
ok 329 - tile no_hsps.blastp hit 82 \#hsps 0
ok 330 - tile no_hsps.blastp hit 83 \#hsps 0
ok 331 - tile no_hsps.blastp hit 84 \#hsps 0
ok 332 - tile no_hsps.blastp hit 85 \#hsps 0
ok 333 - tile no_hsps.blastp hit 86 \#hsps 0
ok 334 - tile no_hsps.blastp hit 87 \#hsps 0
ok 335 - tile no_hsps.blastp hit 88 \#hsps 0
ok 336 - tile no_hsps.blastp hit 89 \#hsps 0
ok 337 - tile no_hsps.blastp hit 90 \#hsps 0
ok 338 - tile no_hsps.blastp hit 91 \#hsps 0
ok 339 - tile no_hsps.blastp hit 92 \#hsps 0
ok 340 - tile no_hsps.blastp hit 93 \#hsps 0
ok 341 - tile no_hsps.blastp hit 94 \#hsps 0
ok 342 - tile no_hsps.blastp hit 95 \#hsps 0
ok 343 - tile no_hsps.blastp hit 96 \#hsps 0
ok 344 - tile no_hsps.blastp hit 97 \#hsps 0
ok 345 - tile no_hsps.blastp hit 98 \#hsps 0
ok 346 - tile no_hsps.blastp hit 99 \#hsps 0
ok 347 - tile no_hsps.blastp hit 100 \#hsps 0
ok 348 - tile no_hsps.blastp hit 101 \#hsps 0
ok 349 - tile no_hsps.blastp hit 102 \#hsps 0
ok 350 - tile no_hsps.blastp hit 103 \#hsps 0
ok 351 - tile no_hsps.blastp hit 104 \#hsps 0
ok 352 - tile no_hsps.blastp hit 105 \#hsps 0
ok 353 - tile no_hsps.blastp hit 106 \#hsps 0
ok 354 - tile no_hsps.blastp hit 107 \#hsps 0
ok 355 - tile no_hsps.blastp hit 108 \#hsps 0
ok 356 - tile no_hsps.blastp hit 109 \#hsps 0
ok 357 - tile no_hsps.blastp hit 110 \#hsps 0
ok 358 - tile no_hsps.blastp hit 111 \#hsps 0
ok 359 - tile no_hsps.blastp hit 112 \#hsps 0
ok 360 - tile no_hsps.blastp hit 113 \#hsps 0
ok 361 - tile no_hsps.blastp hit 114 \#hsps 0
ok 362 - tile no_hsps.blastp hit 115 \#hsps 0
ok 363 - tile no_hsps.blastp hit 116 \#hsps 0
ok 364 - tile no_hsps.blastp hit 117 \#hsps 0
ok 365 - tile no_hsps.blastp hit 118 \#hsps 0
ok 366 - tile no_hsps.blastp hit 119 \#hsps 0
ok 367 - tile no_hsps.blastp hit 120 \#hsps 0
ok 368 - tile no_hsps.blastp hit 121 \#hsps 0
ok 369 - tile no_hsps.blastp hit 122 \#hsps 0
ok 370 - tile no_hsps.blastp hit 123 \#hsps 0
ok 371 - tile no_hsps.blastp hit 124 \#hsps 0
ok 372 - tile no_hsps.blastp hit 125 \#hsps 0
ok 373 - tile no_hsps.blastp hit 126 \#hsps 0
ok 374 - tile no_hsps.blastp hit 127 \#hsps 0
ok 375 - tile no_hsps.blastp hit 128 \#hsps 0
ok 376 - tile no_hsps.blastp hit 129 \#hsps 0
ok 377 - tile no_hsps.blastp hit 130 \#hsps 0
ok 378 - tile no_hsps.blastp hit 131 \#hsps 0
ok 379 - tile no_hsps.blastp hit 132 \#hsps 0
ok 380 - tile no_hsps.blastp hit 133 \#hsps 0
ok 381 - tile no_hsps.blastp hit 134 \#hsps 0
ok 382 - tile no_hsps.blastp hit 135 \#hsps 0
ok 383 - tile no_hsps.blastp hit 136 \#hsps 0
ok 384 - tile no_hsps.blastp hit 137 \#hsps 0
ok 385 - tile no_hsps.blastp hit 138 \#hsps 0
ok 386 - tile no_hsps.blastp hit 139 \#hsps 0
ok 387 - tile no_hsps.blastp hit 140 \#hsps 0
ok 388 - tile no_hsps.blastp hit 141 \#hsps 0
ok 389 - tile no_hsps.blastp hit 142 \#hsps 0
ok 390 - tile no_hsps.blastp hit 143 \#hsps 0
ok 391 - tile no_hsps.blastp hit 144 \#hsps 0
ok 392 - tile no_hsps.blastp hit 145 \#hsps 0
ok 393 - tile no_hsps.blastp hit 146 \#hsps 0
ok 394 - tile no_hsps.blastp hit 147 \#hsps 0
ok 395 - tile no_hsps.blastp hit 148 \#hsps 0
ok 396 - tile no_hsps.blastp hit 149 \#hsps 0
ok 397 - tile no_hsps.blastp hit 150 \#hsps 0
ok 398 - tile no_hsps.blastp hit 151 \#hsps 0
ok 399 - tile no_hsps.blastp hit 152 \#hsps 0
ok 400 - tile no_hsps.blastp hit 153 \#hsps 0
ok 401 - tile no_hsps.blastp hit 154 \#hsps 0
ok 402 - tile no_hsps.blastp hit 155 \#hsps 0
ok 403 - tile no_hsps.blastp hit 156 \#hsps 0
ok 404 - tile no_hsps.blastp hit 157 \#hsps 0
ok 405 - tile no_hsps.blastp hit 158 \#hsps 0
ok 406 - tile no_hsps.blastp hit 159 \#hsps 0
ok 407 - tile no_hsps.blastp hit 160 \#hsps 0
ok 408 - tile no_hsps.blastp hit 161 \#hsps 0
ok 409 - tile no_hsps.blastp hit 162 \#hsps 0
ok 410 - tile no_hsps.blastp hit 163 \#hsps 0
ok 411 - tile no_hsps.blastp hit 164 \#hsps 0
ok 412 - tile no_hsps.blastp hit 165 \#hsps 0
ok 413 - tile no_hsps.blastp hit 166 \#hsps 0
ok 414 - tile no_hsps.blastp hit 167 \#hsps 0
ok 415 - tile no_hsps.blastp hit 168 \#hsps 0
ok 416 - tile no_hsps.blastp hit 169 \#hsps 0
ok 417 - tile no_hsps.blastp hit 170 \#hsps 0
ok 418 - tile no_hsps.blastp hit 171 \#hsps 0
ok 419 - tile no_hsps.blastp hit 172 \#hsps 0
ok 420 - tile no_hsps.blastp hit 173 \#hsps 0
ok 421 - tile no_hsps.blastp hit 174 \#hsps 0
ok 422 - tile no_hsps.blastp hit 175 \#hsps 0
ok 423 - tile no_hsps.blastp hit 176 \#hsps 0
ok 424 - tile no_hsps.blastp hit 177 \#hsps 0
ok 425 - tile no_hsps.blastp hit 178 \#hsps 0
ok 426 - tile no_hsps.blastp hit 179 \#hsps 0
ok 427 - tile no_hsps.blastp hit 180 \#hsps 0
ok 428 - tile no_hsps.blastp hit 181 \#hsps 0
ok 429 - tile no_hsps.blastp hit 182 \#hsps 0
ok 430 - tile no_hsps.blastp hit 183 \#hsps 0
ok 431 - tile no_hsps.blastp hit 184 \#hsps 0
ok 432 - tile no_hsps.blastp hit 185 \#hsps 0
ok 433 - tile no_hsps.blastp hit 186 \#hsps 0
ok 434 - tile no_hsps.blastp hit 187 \#hsps 0
ok 435 - tile no_hsps.blastp hit 188 \#hsps 0
ok 436 - tile no_hsps.blastp hit 189 \#hsps 0
ok 437 - tile no_hsps.blastp hit 190 \#hsps 0
ok 438 - tile no_hsps.blastp hit 191 \#hsps 0
ok 439 - tile no_hsps.blastp hit 192 \#hsps 0
ok 440 - tile no_hsps.blastp hit 193 \#hsps 0
ok 441 - tile no_hsps.blastp hit 194 \#hsps 0
ok 442 - tile no_hsps.blastp hit 195 \#hsps 0
ok 443 - tile no_hsps.blastp hit 196 \#hsps 0
ok 444 - tile no_hsps.blastp hit 197 \#hsps 0
ok 445 - tile no_hsps.blastp hit 198 \#hsps 0
ok 446 - tile no_hsps.blastp hit 199 \#hsps 0
ok 447 - tile no_hsps.blastp hit 200 \#hsps 0
ok 448 - tile no_hsps.blastp hit 201 \#hsps 0
ok 449 - tile no_hsps.blastp hit 202 \#hsps 0
ok 450 - tile no_hsps.blastp hit 203 \#hsps 0
ok 451 - tile no_hsps.blastp hit 204 \#hsps 0
ok 452 - tile no_hsps.blastp hit 205 \#hsps 0
ok 453 - tile no_hsps.blastp hit 206 \#hsps 0
ok 454 - tile no_hsps.blastp hit 207 \#hsps 0
ok 455 - tile no_hsps.blastp hit 208 \#hsps 0
ok 456 - tile no_hsps.blastp hit 209 \#hsps 0
ok 457 - tile no_hsps.blastp hit 210 \#hsps 0
ok 458 - tile no_hsps.blastp hit 211 \#hsps 0
ok 459 - tile no_hsps.blastp hit 212 \#hsps 0
ok 460 - tile no_hsps.blastp hit 213 \#hsps 0
ok 461 - tile no_hsps.blastp hit 214 \#hsps 0
ok 462 - tile no_hsps.blastp hit 215 \#hsps 0
ok 463 - tile no_hsps.blastp hit 216 \#hsps 0
ok 464 - tile no_hsps.blastp hit 217 \#hsps 0
ok 465 - tile no_hsps.blastp hit 218 \#hsps 0
ok 466 - tile no_hsps.blastp hit 219 \#hsps 0
ok 467 - tile no_hsps.blastp hit 220 \#hsps 0
ok 468 - tile no_hsps.blastp hit 221 \#hsps 0
ok 469 - tile no_hsps.blastp hit 222 \#hsps 0
ok 470 - tile no_hsps.blastp hit 223 \#hsps 0
ok 471 - tile no_hsps.blastp hit 224 \#hsps 0
ok 472 - tile no_hsps.blastp hit 225 \#hsps 0
ok 473 - tile no_hsps.blastp hit 226 \#hsps 0
ok 474 - tile no_hsps.blastp hit 227 \#hsps 0
ok 475 - tile no_hsps.blastp hit 228 \#hsps 0
ok 476 - tile no_hsps.blastp hit 229 \#hsps 0
ok 477 - tile no_hsps.blastp hit 230 \#hsps 0
ok 478 - tile no_hsps.blastp hit 231 \#hsps 0
ok 479 - tile no_hsps.blastp hit 232 \#hsps 0
ok 480 - tile no_hsps.blastp hit 233 \#hsps 0
ok 481 - tile no_hsps.blastp hit 234 \#hsps 0
ok 482 - tile no_hsps.blastp hit 235 \#hsps 0
ok 483 - tile no_hsps.blastp hit 236 \#hsps 0
ok 484 - tile no_hsps.blastp hit 237 \#hsps 0
ok 485 - tile no_hsps.blastp hit 238 \#hsps 0
ok 486 - tile no_hsps.blastp hit 239 \#hsps 0
ok 487 - tile no_hsps.blastp hit 240 \#hsps 0
ok 488 - tile no_hsps.blastp hit 241 \#hsps 0
ok 489 - tile no_hsps.blastp hit 242 \#hsps 0
ok 490 - tile no_hsps.blastp hit 243 \#hsps 0
ok 491 - tile no_hsps.blastp hit 244 \#hsps 0
ok 492 - tile no_hsps.blastp hit 245 \#hsps 0
ok 493 - tile no_hsps.blastp hit 246 \#hsps 0
ok 494 - tile no_hsps.blastp hit 247 \#hsps 0
ok 495 - tile no_hsps.blastp hit 248 \#hsps 0
ok 496 - tile no_hsps.blastp hit 249 \#hsps 0
ok 497 - tile no_hsps.blastp hit 250 \#hsps 0
ok 498 - tile no_hsps.blastp hit 251 \#hsps 0
ok 499 - tile no_hsps.blastp hit 252 \#hsps 0
ok 500 - tile no_hsps.blastp hit 253 \#hsps 0
ok 501 - tile no_hsps.blastp hit 254 \#hsps 0
ok 502 - tile no_hsps.blastp hit 255 \#hsps 0
ok 503 - tile no_hsps.blastp hit 256 \#hsps 0
ok 504 - tile no_hsps.blastp hit 257 \#hsps 0
ok 505 - tile no_hsps.blastp hit 258 \#hsps 0
ok 506 - tile no_hsps.blastp hit 259 \#hsps 0
ok 507 - tile no_hsps.blastp hit 260 \#hsps 0
ok 508 - tile no_hsps.blastp hit 261 \#hsps 0
ok 509 - tile no_hsps.blastp hit 262 \#hsps 0
ok 510 - tile no_hsps.blastp hit 263 \#hsps 0
ok 511 - tile no_hsps.blastp hit 264 \#hsps 0
ok 512 - tile no_hsps.blastp hit 265 \#hsps 0
ok 513 - tile no_hsps.blastp hit 266 \#hsps 0
ok 514 - tile no_hsps.blastp hit 267 \#hsps 0
ok 515 - tile no_hsps.blastp hit 268 \#hsps 0
ok 516 - tile no_hsps.blastp hit 269 \#hsps 0
ok 517 - tile no_hsps.blastp hit 270 \#hsps 0
ok 518 - tile no_hsps.blastp hit 271 \#hsps 0
ok 519 - tile no_hsps.blastp hit 272 \#hsps 0
ok 520 - tile no_hsps.blastp hit 273 \#hsps 0
ok 521 - tile no_hsps.blastp hit 274 \#hsps 0
ok 522 - tile no_hsps.blastp hit 275 \#hsps 0
ok 523 - tile no_hsps.blastp hit 276 \#hsps 0
ok 524 - tile no_hsps.blastp hit 277 \#hsps 0
ok 525 - tile no_hsps.blastp hit 278 \#hsps 0
ok 526 - tile no_hsps.blastp hit 279 \#hsps 0
ok 527 - tile no_hsps.blastp hit 280 \#hsps 0
ok 528 - tile no_hsps.blastp hit 281 \#hsps 0
ok 529 - tile no_hsps.blastp hit 282 \#hsps 0
ok 530 - tile no_hsps.blastp hit 283 \#hsps 0
ok 531 - tile no_hsps.blastp hit 284 \#hsps 0
ok 532 - tile no_hsps.blastp hit 285 \#hsps 0
ok 533 - tile no_hsps.blastp hit 286 \#hsps 0
ok 534 - tile no_hsps.blastp hit 287 \#hsps 0
ok 535 - tile no_hsps.blastp hit 288 \#hsps 0
ok 536 - tile no_hsps.blastp hit 289 \#hsps 0
ok 537 - tile no_hsps.blastp hit 290 \#hsps 0
ok 538 - tile no_hsps.blastp hit 291 \#hsps 0
ok 539 - tile no_hsps.blastp hit 292 \#hsps 0
ok 540 - tile no_hsps.blastp hit 293 \#hsps 0
ok 541 - tile no_hsps.blastp hit 294 \#hsps 0
ok 542 - tile no_hsps.blastp hit 295 \#hsps 0
ok 543 - tile no_hsps.blastp hit 296 \#hsps 0
ok 544 - tile no_hsps.blastp hit 297 \#hsps 0
ok 545 - tile no_hsps.blastp hit 298 \#hsps 0
ok 546 - tile no_hsps.blastp hit 299 \#hsps 0
ok 547 - tile no_hsps.blastp hit 300 \#hsps 0
ok 548 - tile no_hsps.blastp hit 301 \#hsps 0
ok 549 - tile no_hsps.blastp hit 302 \#hsps 0
ok 550 - tile no_hsps.blastp hit 303 \#hsps 0
ok 551 - tile no_hsps.blastp hit 304 \#hsps 0
ok 552 - tile no_hsps.blastp hit 305 \#hsps 0
ok 553 - tile no_hsps.blastp hit 306 \#hsps 0
ok 554 - tile no_hsps.blastp hit 307 \#hsps 0
ok 555 - tile no_hsps.blastp hit 308 \#hsps 0
ok 556 - tile no_hsps.blastp hit 309 \#hsps 0
ok 557 - tile no_hsps.blastp hit 310 \#hsps 0
ok 558 - tile no_hsps.blastp hit 311 \#hsps 0
ok 559 - tile no_hsps.blastp hit 312 \#hsps 0
ok 560 - tile no_hsps.blastp hit 313 \#hsps 0
ok 561 - tile no_hsps.blastp hit 314 \#hsps 0
ok 562 - tile no_hsps.blastp hit 315 \#hsps 0
ok 563 - tile no_hsps.blastp hit 316 \#hsps 0
ok 564 - tile no_hsps.blastp hit 317 \#hsps 0
ok 565 - tile no_hsps.blastp hit 318 \#hsps 0
ok 566 - tile no_hsps.blastp hit 319 \#hsps 0
ok 567 - tile no_hsps.blastp hit 320 \#hsps 0
ok 568 - tile no_hsps.blastp hit 321 \#hsps 0
ok 569 - tile no_hsps.blastp hit 322 \#hsps 0
ok 570 - tile no_hsps.blastp hit 323 \#hsps 0
ok 571 - tile no_hsps.blastp hit 324 \#hsps 0
ok 572 - tile no_hsps.blastp hit 325 \#hsps 0
ok 573 - tile no_hsps.blastp hit 326 \#hsps 0
ok 574 - tile no_hsps.blastp hit 327 \#hsps 0
ok 575 - tile no_hsps.blastp hit 328 \#hsps 0
ok 576 - tile no_hsps.blastp hit 329 \#hsps 0
ok 577 - tile no_hsps.blastp hit 330 \#hsps 0
ok 578 - tile no_hsps.blastp hit 331 \#hsps 0
ok 579 - tile no_hsps.blastp hit 332 \#hsps 0
ok 580 - tile no_hsps.blastp hit 333 \#hsps 0
ok 581 - tile no_hsps.blastp hit 334 \#hsps 0
ok 582 - tile no_hsps.blastp hit 335 \#hsps 0
ok 583 - tile no_hsps.blastp hit 336 \#hsps 0
ok 584 - tile no_hsps.blastp hit 337 \#hsps 0
ok 585 - tile no_hsps.blastp hit 338 \#hsps 0
ok 586 - tile no_hsps.blastp hit 339 \#hsps 0
ok 587 - tile no_hsps.blastp hit 340 \#hsps 0
ok 588 - tile no_hsps.blastp hit 341 \#hsps 0
ok 589 - tile no_hsps.blastp hit 342 \#hsps 0
ok 590 - tile no_hsps.blastp hit 343 \#hsps 0
ok 591 - tile no_hsps.blastp hit 344 \#hsps 0
ok 592 - tile no_hsps.blastp hit 345 \#hsps 0
ok 593 - tile no_hsps.blastp hit 346 \#hsps 0
ok 594 - tile no_hsps.blastp hit 347 \#hsps 0
ok 595 - tile no_hsps.blastp hit 348 \#hsps 0
ok 596 - tile no_hsps.blastp hit 349 \#hsps 0
ok 597 - tile no_hsps.blastp hit 350 \#hsps 0
ok 598 - tile no_hsps.blastp hit 351 \#hsps 0
ok 599 - tile no_hsps.blastp hit 352 \#hsps 0
ok 600 - tile no_hsps.blastp hit 353 \#hsps 0
ok 601 - tile no_hsps.blastp hit 354 \#hsps 0
ok 602 - tile no_hsps.blastp hit 355 \#hsps 0
ok 603 - tile no_hsps.blastp hit 356 \#hsps 0
ok 604 - tile no_hsps.blastp hit 357 \#hsps 0
ok 605 - tile no_hsps.blastp hit 358 \#hsps 0
ok 606 - tile no_hsps.blastp hit 359 \#hsps 0
ok 607 - tile no_hsps.blastp hit 360 \#hsps 0
ok 608 - tile no_hsps.blastp hit 361 \#hsps 0
ok 609 - tile no_hsps.blastp hit 362 \#hsps 0
ok 610 - tile no_hsps.blastp hit 363 \#hsps 0
ok 611 - tile no_hsps.blastp hit 364 \#hsps 0
ok 612 - tile no_hsps.blastp hit 365 \#hsps 0
ok 613 - tile no_hsps.blastp hit 366 \#hsps 0
ok 614 - tile no_hsps.blastp hit 367 \#hsps 0
ok 615 - tile no_hsps.blastp hit 368 \#hsps 0
ok 616 - tile no_hsps.blastp hit 369 \#hsps 0
ok 617 - tile no_hsps.blastp hit 370 \#hsps 0
ok 618 - tile no_hsps.blastp hit 371 \#hsps 0
ok 619 - tile no_hsps.blastp hit 372 \#hsps 0
ok 620 - tile no_hsps.blastp hit 373 \#hsps 0
ok 621 - tile no_hsps.blastp hit 374 \#hsps 0
ok 622 - tile no_hsps.blastp hit 375 \#hsps 0
ok 623 - tile no_hsps.blastp hit 376 \#hsps 0
ok 624 - tile no_hsps.blastp hit 377 \#hsps 0
ok 625 - tile no_hsps.blastp hit 378 \#hsps 0
ok 626 - tile no_hsps.blastp hit 379 \#hsps 0
ok 627 - tile no_hsps.blastp hit 380 \#hsps 0
ok 628 - tile no_hsps.blastp hit 381 \#hsps 0
ok 629 - tile no_hsps.blastp hit 382 \#hsps 0
ok 630 - tile no_hsps.blastp hit 383 \#hsps 0
ok 631 - tile no_hsps.blastp hit 384 \#hsps 0
ok 632 - tile no_hsps.blastp hit 385 \#hsps 0
ok 633 - tile no_hsps.blastp hit 386 \#hsps 0
ok 634 - tile no_hsps.blastp hit 387 \#hsps 0
ok 635 - tile no_hsps.blastp hit 388 \#hsps 0
ok 636 - tile no_hsps.blastp hit 389 \#hsps 0
ok 637 - tile no_hsps.blastp hit 390 \#hsps 0
ok 638 - tile no_hsps.blastp hit 391 \#hsps 0
ok 639 - tile no_hsps.blastp hit 392 \#hsps 0
ok 640 - tile no_hsps.blastp hit 393 \#hsps 0
ok 641 - tile no_hsps.blastp hit 394 \#hsps 0
ok 642 - tile no_hsps.blastp hit 395 \#hsps 0
ok 643 - tile no_hsps.blastp hit 396 \#hsps 0
ok 644 - tile no_hsps.blastp hit 397 \#hsps 0
ok 645 - tile no_hsps.blastp hit 398 \#hsps 0
ok 646 - tile no_hsps.blastp hit 399 \#hsps 0
ok 647 - tile no_hsps.blastp hit 400 \#hsps 0
ok 648 - tile no_hsps.blastp hit 401 \#hsps 0
ok 649 - tile no_hsps.blastp hit 402 \#hsps 0
ok 650 - tile no_hsps.blastp hit 403 \#hsps 0
ok 651 - tile no_hsps.blastp hit 404 \#hsps 0
ok 652 - tile no_hsps.blastp hit 405 \#hsps 0
ok 653 - tile no_hsps.blastp hit 406 \#hsps 0
ok 654 - tile no_hsps.blastp hit 407 \#hsps 0
ok 655 - tile no_hsps.blastp hit 408 \#hsps 0
ok 656 - tile no_hsps.blastp hit 409 \#hsps 0
ok 657 - tile no_hsps.blastp hit 410 \#hsps 0
ok 658 - tile no_hsps.blastp hit 411 \#hsps 0
ok 659 - tile no_hsps.blastp hit 412 \#hsps 0
ok 660 - tile no_hsps.blastp hit 413 \#hsps 0
ok 661 - tile no_hsps.blastp hit 414 \#hsps 0
ok 662 - tile no_hsps.blastp hit 415 \#hsps 0
ok 663 - catalase-webblast.BLASTP
ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1
ok 665 - q id: est (1.00000) = fast (1.00000)
ok 666 - q cn: est (1.00000) = fast (1.00000)
ok 667 - h id: est (1.00000) = fast (1.00000)
ok 668 - h cn: est (1.00000) = fast (1.00000)
ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1
ok 670 - q id: est (0.80973) = fast (0.80973)
ok 671 - q cn: est (0.89006) = fast (0.89006)
ok 672 - h id: est (0.82543) = fast (0.82543)
ok 673 - h cn: est (0.90733) = fast (0.90733)
ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1
ok 675 - q id: est (0.71670) = fast (0.71670)
ok 676 - q cn: est (0.84144) = fast (0.84144)
ok 677 - h id: est (0.72747) = fast (0.72747)
ok 678 - h cn: est (0.85408) = fast (0.85408)
ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1
ok 680 - q id: est (0.58910) = fast (0.58910)
ok 681 - q cn: est (0.70860) = fast (0.70860)
ok 682 - h id: est (0.65654) = fast (0.65654)
ok 683 - h cn: est (0.78972) = fast (0.78972)
ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1
ok 685 - q id: est (0.49245) = fast (0.49245)
ok 686 - q cn: est (0.65257) = fast (0.65257)
ok 687 - h id: est (0.49544) = fast (0.49544)
ok 688 - h cn: est (0.65653) = fast (0.65653)
ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1
ok 690 - q id: est (0.44366) = fast (0.44366)
ok 691 - q cn: est (0.58920) = fast (0.58920)
ok 692 - h id: est (0.44787) = fast (0.44787)
ok 693 - h cn: est (0.59479) = fast (0.59479)
ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1
ok 695 - q id: est (0.42564) = fast (0.42564)
ok 696 - q cn: est (0.61282) = fast (0.61282)
ok 697 - h id: est (0.43229) = fast (0.43229)
ok 698 - h cn: est (0.62240) = fast (0.62240)
ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1
ok 700 - q id: est (0.48358) = fast (0.48358)
ok 701 - q cn: est (0.63881) = fast (0.63881)
ok 702 - h id: est (0.48943) = fast (0.48943)
ok 703 - h cn: est (0.64653) = fast (0.64653)
ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1
ok 705 - q id: est (0.42308) = fast (0.42308)
ok 706 - q cn: est (0.61282) = fast (0.61282)
ok 707 - h id: est (0.42969) = fast (0.42969)
ok 708 - h cn: est (0.62240) = fast (0.62240)
ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1
ok 710 - q id: est (0.39675) = fast (0.39675)
ok 711 - q cn: est (0.58933) = fast (0.58933)
ok 712 - h id: est (0.39767) = fast (0.39767)
ok 713 - h cn: est (0.59070) = fast (0.59070)
ok 714 - dcr1_sp.WUBLASTP
ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1
ok 716 - q id: est (1.00000) = fast (1.00000)
ok 717 - q cn: est (1.00000) = fast (1.00000)
ok 718 - h id: est (1.00000) = fast (1.00000)
ok 719 - h cn: est (1.00000) = fast (1.00000)
ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4
ok 721 - q id: exact (0.36876) ~ est (0.36973)
ok 722 - q id: exact (0.36876) <= max (0.37070)
ok 723 - q cn: exact (0.55022) ~ est (0.55041)
ok 724 - q cn: exact (0.55022) <= max (0.55105)
ok 725 - h id: exact (0.35111) ~ est (0.35111)
ok 726 - h id: exact (0.35111) <= max (0.35111)
ok 727 - h cn: exact (0.52305) ~ est (0.52305)
ok 728 - h cn: exact (0.52305) <= max (0.52305)
ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1
ok 730 - q id: est (0.38685) = fast (0.38685)
ok 731 - q cn: est (0.55397) = fast (0.55397)
ok 732 - h id: est (0.37613) = fast (0.37613)
ok 733 - h cn: est (0.53863) = fast (0.53863)
ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1
ok 735 - q id: est (0.38247) = fast (0.38247)
ok 736 - q cn: est (0.55068) = fast (0.55068)
ok 737 - h id: est (0.37306) = fast (0.37306)
ok 738 - h cn: est (0.53715) = fast (0.53715)
ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5
ok 740 - q id: exact (0.35010) ~ est (0.35010)
ok 741 - q id: exact (0.35010) <= max (0.35010)
ok 742 - q cn: exact (0.53183) ~ est (0.53183)
ok 743 - q cn: exact (0.53183) <= max (0.53183)
ok 744 - h id: exact (0.35082) ~ est (0.35082)
ok 745 - h id: exact (0.35082) <= max (0.35082)
ok 746 - h cn: exact (0.53292) ~ est (0.53292)
ok 747 - h cn: exact (0.53292) <= max (0.53292)
ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8
ok 749 - q id: exact (0.30547) ~ est (0.30659)
ok 750 - q id: exact (0.30547) <= max (0.30623)
ok 751 - q cn: exact (0.50076) ~ est (0.50205)
ok 752 - q cn: exact (0.50076) <= max (0.50076)
ok 753 - h id: exact (0.31390) ~ est (0.31179)
ok 754 - h id: exact (0.31390) <= max (0.31795)
ok 755 - h cn: exact (0.50531) ~ est (0.50557)
ok 756 - h cn: exact (0.50531) <= max (0.51091)
ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7
ok 758 - q id: exact (0.30136) ~ est (0.30184)
ok 759 - q id: exact (0.30136) <= max (0.30498)
ok 760 - q cn: exact (0.48688) ~ est (0.48742)
ok 761 - q cn: exact (0.48688) <= max (0.49140)
ok 762 - h id: exact (0.30944) ~ est (0.31034)
ok 763 - h id: exact (0.30944) <= max (0.30988)
ok 764 - h cn: exact (0.50178) ~ est (0.50277)
ok 765 - h cn: exact (0.50178) <= max (0.50223)
ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10
ok 767 - q id: exact (0.28918) ~ est (0.28961)
ok 768 - q id: exact (0.28918) <= max (0.28955)
ok 769 - q cn: exact (0.46418) ~ est (0.46247)
ok 770 - q cn: exact (0.46418) <= max (0.46866)
ok 771 - h id: exact (0.30166) ~ est (0.30299)
ok 772 - h id: exact (0.30166) <= max (0.30800)
ok 773 - h cn: exact (0.48179) ~ est (0.48439)
ok 774 - h cn: exact (0.48179) <= max (0.48535)
ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8
ok 776 - q id: exact (0.30289) ~ est (0.30238)
ok 777 - q id: exact (0.30289) <= max (0.30651)
ok 778 - q cn: exact (0.49955) ~ est (0.49787)
ok 779 - q cn: exact (0.49955) <= max (0.50362)
ok 780 - h id: exact (0.31395) ~ est (0.31347)
ok 781 - h id: exact (0.31395) <= max (0.31721)
ok 782 - h cn: exact (0.51535) ~ est (0.51578)
ok 783 - h cn: exact (0.51535) <= max (0.51814)
ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5
ok 785 - q id: exact (0.29334) ~ est (0.29534)
ok 786 - q id: exact (0.29334) <= max (0.29810)
ok 787 - q cn: exact (0.46617) ~ est (0.46719)
ok 788 - q cn: exact (0.46617) <= max (0.47040)
ok 789 - h id: exact (0.31176) ~ est (0.31176)
ok 790 - h id: exact (0.31176) <= max (0.31176)
ok 791 - h cn: exact (0.49299) ~ est (0.49299)
ok 792 - h cn: exact (0.49299) <= max (0.49299)
ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7
ok 794 - q id: exact (0.30456) ~ est (0.30514)
ok 795 - q id: exact (0.30456) <= max (0.30650)
ok 796 - q cn: exact (0.48739) ~ est (0.48879)
ok 797 - q cn: exact (0.48739) <= max (0.49370)
ok 798 - h id: exact (0.32062) ~ est (0.31987)
ok 799 - h id: exact (0.32062) <= max (0.32932)
ok 800 - h cn: exact (0.51071) ~ est (0.51306)
ok 801 - h cn: exact (0.51071) <= max (0.52410)
ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8
ok 803 - q id: exact (0.29615) ~ est (0.29879)
ok 804 - q id: exact (0.29615) <= max (0.30009)
ok 805 - q cn: exact (0.47419) ~ est (0.47394)
ok 806 - q cn: exact (0.47419) <= max (0.48119)
ok 807 - h id: exact (0.31611) ~ est (0.31482)
ok 808 - h id: exact (0.31611) <= max (0.32227)
ok 809 - h cn: exact (0.49779) ~ est (0.49788)
ok 810 - h cn: exact (0.49779) <= max (0.50616)
ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8
ok 812 - q id: exact (0.30390) ~ est (0.30440)
ok 813 - q id: exact (0.30390) <= max (0.30701)
ok 814 - q cn: exact (0.45874) ~ est (0.45993)
ok 815 - q cn: exact (0.45874) <= max (0.45963)
ok 816 - h id: exact (0.32282) ~ est (0.32324)
ok 817 - h id: exact (0.32282) <= max (0.32560)
ok 818 - h cn: exact (0.48052) ~ est (0.48136)
ok 819 - h cn: exact (0.48052) <= max (0.48330)
ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6
ok 821 - q id: exact (0.29769) ~ est (0.29851)
ok 822 - q id: exact (0.29769) <= max (0.29769)
ok 823 - q cn: exact (0.48480) ~ est (0.48628)
ok 824 - q cn: exact (0.48480) <= max (0.48637)
ok 825 - h id: exact (0.30704) ~ est (0.30810)
ok 826 - h id: exact (0.30704) <= max (0.30917)
ok 827 - h cn: exact (0.50107) ~ est (0.50292)
ok 828 - h cn: exact (0.50107) <= max (0.50320)
ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6
ok 830 - q id: exact (0.27854) ~ est (0.27854)
ok 831 - q id: exact (0.27854) <= max (0.27854)
ok 832 - q cn: exact (0.48174) ~ est (0.48174)
ok 833 - q cn: exact (0.48174) <= max (0.48174)
ok 834 - h id: exact (0.28514) ~ est (0.28623)
ok 835 - h id: exact (0.28514) <= max (0.28594)
ok 836 - h cn: exact (0.49197) ~ est (0.49154)
ok 837 - h cn: exact (0.49197) <= max (0.49237)
ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8
ok 839 - q id: exact (0.30362) ~ est (0.30824)
ok 840 - q id: exact (0.30362) <= max (0.30852)
ok 841 - q cn: exact (0.47111) ~ est (0.47587)
ok 842 - q cn: exact (0.47111) <= max (0.47405)
ok 843 - h id: exact (0.32347) ~ est (0.32392)
ok 844 - h id: exact (0.32347) <= max (0.32643)
ok 845 - h cn: exact (0.49310) ~ est (0.49360)
ok 846 - h cn: exact (0.49310) <= max (0.49606)
ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4
ok 848 - q id: exact (0.29174) ~ est (0.29174)
ok 849 - q id: exact (0.29174) <= max (0.29174)
ok 850 - q cn: exact (0.46230) ~ est (0.46230)
ok 851 - q cn: exact (0.46230) <= max (0.46230)
ok 852 - h id: exact (0.30204) ~ est (0.30204)
ok 853 - h id: exact (0.30204) <= max (0.30204)
ok 854 - h cn: exact (0.47862) ~ est (0.47862)
ok 855 - h cn: exact (0.47862) <= max (0.47862)
ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6
ok 857 - q id: exact (0.29064) ~ est (0.29089)
ok 858 - q id: exact (0.29064) <= max (0.29115)
ok 859 - q cn: exact (0.48765) ~ est (0.48670)
ok 860 - q cn: exact (0.48765) <= max (0.48868)
ok 861 - h id: exact (0.29848) ~ est (0.29887)
ok 862 - h id: exact (0.29848) <= max (0.29902)
ok 863 - h cn: exact (0.50108) ~ est (0.50116)
ok 864 - h cn: exact (0.50108) <= max (0.50163)
ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5
ok 866 - q id: exact (0.29510) ~ est (0.29505)
ok 867 - q id: exact (0.29510) <= max (0.29510)
ok 868 - q cn: exact (0.48982) ~ est (0.49039)
ok 869 - q cn: exact (0.48982) <= max (0.49029)
ok 870 - h id: exact (0.30019) ~ est (0.30019)
ok 871 - h id: exact (0.30019) <= max (0.30019)
ok 872 - h cn: exact (0.49906) ~ est (0.49906)
ok 873 - h cn: exact (0.49906) <= max (0.49906)
ok 874 - 503384.MEGABLAST.2
ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5
ok 876 - q id: exact (0.91435) ~ est (0.91435)
ok 877 - q id: exact (0.91435) <= max (0.91435)
ok 878 - q cn: exact (0.91435) ~ est (0.91435)
ok 879 - q cn: exact (0.91435) <= max (0.91435)
ok 880 - h id: exact (0.91157) ~ est (0.91157)
ok 881 - h id: exact (0.91157) <= max (0.91157)
ok 882 - h cn: exact (0.91157) ~ est (0.91157)
ok 883 - h cn: exact (0.91157) <= max (0.91157)
ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9
ok 885 - q id: exact (0.92895) ~ est (0.92895)
ok 886 - q id: exact (0.92895) <= max (0.92895)
ok 887 - q cn: exact (0.92895) ~ est (0.92895)
ok 888 - q cn: exact (0.92895) <= max (0.92895)
ok 889 - h id: exact (0.92854) ~ est (0.92854)
ok 890 - h id: exact (0.92854) <= max (0.92854)
ok 891 - h cn: exact (0.92854) ~ est (0.92854)
ok 892 - h cn: exact (0.92854) <= max (0.92854)
ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3
ok 894 - q id: exact (0.93516) ~ est (0.93516)
ok 895 - q id: exact (0.93516) <= max (0.93516)
ok 896 - q cn: exact (0.93516) ~ est (0.93516)
ok 897 - q cn: exact (0.93516) <= max (0.93516)
ok 898 - h id: exact (0.93651) ~ est (0.93651)
ok 899 - h id: exact (0.93651) <= max (0.93651)
ok 900 - h cn: exact (0.93651) ~ est (0.93651)
ok 901 - h cn: exact (0.93651) <= max (0.93651)
ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3
ok 903 - q id: exact (0.93064) ~ est (0.93064)
ok 904 - q id: exact (0.93064) <= max (0.93064)
ok 905 - q cn: exact (0.93064) ~ est (0.93064)
ok 906 - q cn: exact (0.93064) <= max (0.93064)
ok 907 - h id: exact (0.92885) ~ est (0.92885)
ok 908 - h id: exact (0.92885) <= max (0.92885)
ok 909 - h cn: exact (0.92885) ~ est (0.92885)
ok 910 - h cn: exact (0.92885) <= max (0.92885)
ok 911 - bl2seq.blastx.out
ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6
ok 913 - q id: exact (0.70536) ~ est (0.70495)
ok 914 - q id: exact (0.70536) <= max (0.94286)
ok 915 - q cn: exact (0.78810) ~ est (0.78803)
ok 916 - q cn: exact (0.78810) <= max (0.96429)
ok 917 - q id: est (0.35714) = fast (0.35714)
ok 918 - q cn: est (0.57143) = fast (0.57143)
ok 919 - q id: est (0.71429) = fast (0.71429)
ok 920 - q cn: est (1.00000) = fast (1.00000)
ok 921 - h id: exact (0.61923) ~ est (0.61955)
ok 922 - h id: exact (0.61923) <= max (0.64231)
ok 923 - h cn: exact (0.73077) ~ est (0.73077)
ok 924 - h cn: exact (0.73077) <= max (0.75000)
ok 925 - dnaEbsub_ecoli.wublastx
ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1
ok 927 - q id: est (0.36386) = fast (0.36386)
ok 928 - q cn: est (0.53735) = fast (0.53735)
ok 929 - h id: est (0.36562) = fast (0.36562)
ok 930 - h cn: est (0.53995) = fast (0.53995)
ok 931 - tblastn.out
ok 932 - tile tblastn.out hit 1 \#hsps 2
ok 933 - q id: exact (0.31250) ~ est (0.33325)
ok 934 - q id: exact (0.31250) <= max (0.33333)
ok 935 - q cn: exact (0.44792) ~ est (0.47055)
ok 936 - q cn: exact (0.44792) <= max (0.45833)
ok 937 - h id: exact (0.33333) ~ est (0.33333)
ok 938 - h id: exact (0.33333) <= max (0.33333)
ok 939 - h cn: exact (0.47059) ~ est (0.47059)
ok 940 - h cn: exact (0.47059) <= max (0.47059)
ok 941 - tile tblastn.out hit 2 \#hsps 2
ok 942 - q id: exact (0.68750) ~ est (0.68750)
ok 943 - q id: exact (0.68750) <= max (0.68750)
ok 944 - q cn: exact (0.81250) ~ est (0.81250)
ok 945 - q cn: exact (0.81250) <= max (0.81250)
ok 946 - h id: est (0.71429) = fast (0.71429)
ok 947 - h cn: est (0.85714) = fast (0.85714)
ok 948 - h id: est (0.66667) = fast (0.66667)
ok 949 - h cn: est (0.77778) = fast (0.77778)
ok 950 - dnaEbsub_ecoli.wutblastn
ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1
ok 952 - q id: est (0.36386) = fast (0.36386)
ok 953 - q cn: est (0.53735) = fast (0.53735)
ok 954 - h id: est (0.36562) = fast (0.36562)
ok 955 - h cn: est (0.53995) = fast (0.53995)
ok 956 - HUMBETGLOA.tblastx
ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1
ok 958 - q id: est (0.42308) = fast (0.42308)
ok 959 - q cn: est (0.61538) = fast (0.61538)
ok 960 - h id: est (0.42308) = fast (0.42308)
ok 961 - h cn: est (0.61538) = fast (0.61538)
ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1
ok 963 - q id: est (0.47059) = fast (0.47059)
ok 964 - q cn: est (0.76471) = fast (0.76471)
ok 965 - h id: est (0.47059) = fast (0.47059)
ok 966 - h cn: est (0.76471) = fast (0.76471)
ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1
ok 968 - q id: est (0.36000) = fast (0.36000)
ok 969 - q cn: est (0.56000) = fast (0.56000)
ok 970 - h id: est (0.36000) = fast (0.36000)
ok 971 - h cn: est (0.56000) = fast (0.56000)
ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1
ok 973 - q id: est (0.29268) = fast (0.29268)
ok 974 - q cn: est (0.58537) = fast (0.58537)
ok 975 - h id: est (0.29268) = fast (0.29268)
ok 976 - h cn: est (0.58537) = fast (0.58537)
ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1
ok 978 - q id: est (0.38889) = fast (0.38889)
ok 979 - q cn: est (0.55556) = fast (0.55556)
ok 980 - h id: est (0.38889) = fast (0.38889)
ok 981 - h cn: est (0.55556) = fast (0.55556)
ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1
ok 983 - q id: est (0.43590) = fast (0.43590)
ok 984 - q cn: est (0.51282) = fast (0.51282)
ok 985 - h id: est (0.43590) = fast (0.43590)
ok 986 - h cn: est (0.51282) = fast (0.51282)
ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1
ok 988 - q id: est (0.35714) = fast (0.35714)
ok 989 - q cn: est (0.42857) = fast (0.42857)
ok 990 - h id: est (0.35714) = fast (0.35714)
ok 991 - h cn: est (0.42857) = fast (0.42857)
ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1
ok 993 - q id: est (0.33333) = fast (0.33333)
ok 994 - q cn: est (0.66667) = fast (0.66667)
ok 995 - h id: est (0.33333) = fast (0.33333)
ok 996 - h cn: est (0.66667) = fast (0.66667)
ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2
ok 998 - q id: exact (0.40541) ~ est (0.40541)
ok 999 - q id: exact (0.40541) <= max (0.40541)
ok 1000 - q cn: exact (0.56757) ~ est (0.56757)
ok 1001 - q cn: exact (0.56757) <= max (0.56757)
ok 1002 - h id: est (0.42308) = fast (0.42308)
ok 1003 - h cn: est (0.53846) = fast (0.53846)
ok 1004 - h id: est (0.36364) = fast (0.36364)
ok 1005 - h cn: est (0.63636) = fast (0.63636)
ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1
ok 1007 - q id: est (0.29167) = fast (0.29167)
ok 1008 - q cn: est (0.39583) = fast (0.39583)
ok 1009 - h id: est (0.29167) = fast (0.29167)
ok 1010 - h cn: est (0.39583) = fast (0.39583)
ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1
ok 1012 - q id: est (0.60000) = fast (0.60000)
ok 1013 - q cn: est (0.65000) = fast (0.65000)
ok 1014 - h id: est (0.60000) = fast (0.60000)
ok 1015 - h cn: est (0.65000) = fast (0.65000)
ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1
ok 1017 - q id: est (0.50000) = fast (0.50000)
ok 1018 - q cn: est (0.68182) = fast (0.68182)
ok 1019 - h id: est (0.50000) = fast (0.50000)
ok 1020 - h cn: est (0.68182) = fast (0.68182)
ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1
ok 1022 - q id: est (0.29630) = fast (0.29630)
ok 1023 - q cn: est (0.48148) = fast (0.48148)
ok 1024 - h id: est (0.29630) = fast (0.29630)
ok 1025 - h cn: est (0.48148) = fast (0.48148)
ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1
ok 1027 - q id: est (0.47826) = fast (0.47826)
ok 1028 - q cn: est (0.52174) = fast (0.52174)
ok 1029 - h id: est (0.47826) = fast (0.47826)
ok 1030 - h cn: est (0.52174) = fast (0.52174)
ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1
ok 1032 - q id: est (0.47368) = fast (0.47368)
ok 1033 - q cn: est (0.63158) = fast (0.63158)
ok 1034 - h id: est (0.47368) = fast (0.47368)
ok 1035 - h cn: est (0.63158) = fast (0.63158)
ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1
ok 1037 - q id: est (0.44444) = fast (0.44444)
ok 1038 - q cn: est (0.55556) = fast (0.55556)
ok 1039 - h id: est (0.44444) = fast (0.44444)
ok 1040 - h cn: est (0.55556) = fast (0.55556)
ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1
ok 1042 - q id: est (0.47059) = fast (0.47059)
ok 1043 - q cn: est (0.70588) = fast (0.70588)
ok 1044 - h id: est (0.47059) = fast (0.47059)
ok 1045 - h cn: est (0.70588) = fast (0.70588)
ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1
ok 1047 - q id: est (0.38889) = fast (0.38889)
ok 1048 - q cn: est (0.66667) = fast (0.66667)
ok 1049 - h id: est (0.38889) = fast (0.38889)
ok 1050 - h cn: est (0.66667) = fast (0.66667)
ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1
ok 1052 - q id: est (0.27660) = fast (0.27660)
ok 1053 - q cn: est (0.48936) = fast (0.48936)
ok 1054 - h id: est (0.27660) = fast (0.27660)
ok 1055 - h cn: est (0.48936) = fast (0.48936)
ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1
ok 1057 - q id: est (0.40000) = fast (0.40000)
ok 1058 - q cn: est (0.60000) = fast (0.60000)
ok 1059 - h id: est (0.40000) = fast (0.40000)
ok 1060 - h cn: est (0.60000) = fast (0.60000)
ok 1061 - dnaEbsub_ecoli.wutblastx
ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12
ok 1063 - q id: exact (0.40224) ~ est (0.40912)
ok 1064 - q id: exact (0.40224) <= max (0.42628)
ok 1065 - q cn: exact (0.58494) ~ est (0.58968)
ok 1066 - q cn: exact (0.58494) <= max (0.62179)
ok 1067 - q id: est (0.37500) = fast (0.37500)
ok 1068 - q cn: est (0.62500) = fast (0.62500)
ok 1069 - q id: est (0.25352) = fast (0.25352)
ok 1070 - q cn: est (0.47887) = fast (0.47887)
ok 1071 - q id: exact (0.44118) ~ est (0.44118)
ok 1072 - q id: exact (0.44118) <= max (0.44118)
ok 1073 - q cn: exact (0.54412) ~ est (0.54412)
ok 1074 - q cn: exact (0.54412) <= max (0.54412)
ok 1075 - h id: exact (0.39848) ~ est (0.40304)
ok 1076 - h id: exact (0.39848) <= max (0.40355)
ok 1077 - h cn: exact (0.58376) ~ est (0.58889)
ok 1078 - h cn: exact (0.58376) <= max (0.58883)
ok 1079 - h id: exact (0.44118) ~ est (0.44118)
ok 1080 - h id: exact (0.44118) <= max (0.44118)
ok 1081 - h cn: exact (0.54412) ~ est (0.54412)
ok 1082 - h cn: exact (0.54412) <= max (0.54412)
ok 1083 - h id: est (0.25352) = fast (0.25352)
ok 1084 - h cn: est (0.47887) = fast (0.47887)
ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2
ok 1086 - q id: exact (0.41818) ~ est (0.41818)
ok 1087 - q id: exact (0.41818) <= max (0.41818)
ok 1088 - q cn: exact (0.52727) ~ est (0.52727)
ok 1089 - q cn: exact (0.52727) <= max (0.52727)
ok 1090 - h id: est (0.37500) = fast (0.37500)
ok 1091 - h cn: est (0.47500) = fast (0.47500)
ok 1092 - h id: est (0.53333) = fast (0.53333)
ok 1093 - h cn: est (0.66667) = fast (0.66667)
ok 1094 - bug2942: query m0: range correct
ok 1095 - bug2942: query m1: range correct
ok 1096 - bug2942: query m2: range correct
ok 1097 - bug2942: subject all : range correct
ok 1098 - get_tiled_alns
ok 1099 - got all alns
ok 1100
ok 1101 - aln and qfeat lengths correspond
ok 1102 - q length correct
ok 1103
ok 1104 - features on q and s correspond
ok 1105 - aln and hfeat lengths correspond
ok 1106 - s length correct
ok 1107
ok 1108 - aln and qfeat lengths correspond
ok 1109 - q length correct
ok 1110
ok 1111 - features on q and s correspond
ok 1112 - aln and hfeat lengths correspond
ok 1113 - s length correct
ok 1114
ok 1115 - aln and qfeat lengths correspond
ok 1116 - q length correct
ok 1117
ok 1118 - features on q and s correspond
ok 1119 - aln and hfeat lengths correspond
ok 1120 - s length correct
ok 1121
ok 1122 - aln and qfeat lengths correspond
ok 1123 - q length correct
ok 1124
ok 1125 - features on q and s correspond
ok 1126 - aln and hfeat lengths correspond
ok 1127 - s length correct
ok 1128
ok 1129 - aln and qfeat lengths correspond
ok 1130 - q length correct
ok 1131
ok 1132 - features on q and s correspond
ok 1133 - aln and hfeat lengths correspond
ok 1134 - s length correct
ok 1135
ok 1136 - aln and qfeat lengths correspond
ok 1137 - q length correct
ok 1138
ok 1139 - features on q and s correspond
ok 1140 - aln and hfeat lengths correspond
ok 1141 - s length correct
ok
t/SearchIO/waba.t ................... 
1..64
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::SearchIO::waba' isa 'Bio::SearchIO'
ok 3 - query_name
ok 4 - query database
ok 5 - database name
ok 6 - name
ok 7 - hsps
ok 8 - total length
ok 9 - start
ok 10 - end
ok 11 - strand
ok 12 - start
ok 13 - end
ok 14 - strand
ok 15 - query string
ok 16 - hit_string
ok 17 - hmmstate string
ok 18
ok 19
ok 20
ok 21 - total length
ok 22 - start
ok 23 - end
ok 24 - strand
ok 25 - start
ok 26 - end
ok 27 - strand
ok 28 - query string
ok 29 - hit_string
ok 30 - hmmstate string
ok 31
ok 32
ok 33
ok 34 - total length
ok 35 - start
ok 36 - end
ok 37 - strand
ok 38 - start
ok 39 - end
ok 40 - strand
ok 41 - query string
ok 42 - hit_string
ok 43 - hmmstate string
ok 44
ok 45
ok 46
ok 47 - query_name
ok 48 - query database
ok 49 - database name
ok 50 - name
ok 51 - hsps
ok 52 - total length
ok 53 - start
ok 54 - end
ok 55 - strand
ok 56 - start
ok 57 - end
ok 58 - strand
ok 59 - query string
ok 60 - hit_string
ok 61 - hmmstate string
ok 62
ok 63
ok 64
ok
t/SearchIO/wise.t ................... 
1..20
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok
t/SearchIO/Writer/GbrowseGFF.t ...... 
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/Writer/HitTableWriter.t .. 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HitTableWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/Writer/HSPTableWriter.t .. 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HSPTableWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/Writer/HTMLWriter.t ...... 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/Writer/TextWriter.t ...... 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::TextResultWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/Seq/DBLink.t ...................... 
1..131
ok 1 - use Bio::SeqIO;
ok 2 - "swissprot:K1C9_HUMAN"
ok 3 - no double colon
ok 4 - no trailing colon
ok 5 - no double space
ok 6 - dblink value is splittable
ok 7 - "GenBank:Z29074.1"
ok 8 - no double colon
ok 9 - no trailing colon
ok 10 - no double space
ok 11 - dblink value is splittable
ok 12 - "GenPept:CAA82315.1"
ok 13 - no double colon
ok 14 - no trailing colon
ok 15 - no double space
ok 16 - dblink value is splittable
ok 17 - "GenBank:S69510.1"
ok 18 - no double colon
ok 19 - no trailing colon
ok 20 - no double space
ok 21 - dblink value is splittable
ok 22 - "GenPept:AAC60619.1"
ok 23 - no double colon
ok 24 - no trailing colon
ok 25 - no double space
ok 26 - dblink value is splittable
ok 27 - "GenBank:X75015.1"
ok 28 - no double colon
ok 29 - no trailing colon
ok 30 - no double space
ok 31 - dblink value is splittable
ok 32 - "GenPept:CAA52924.1"
ok 33 - no double colon
ok 34 - no trailing colon
ok 35 - no double space
ok 36 - dblink value is splittable
ok 37 - "GenBank:AB001594.1"
ok 38 - no double colon
ok 39 - no trailing colon
ok 40 - no double space
ok 41 - dblink value is splittable
ok 42 - "GenPept:BAA19418.1"
ok 43 - no double colon
ok 44 - no trailing colon
ok 45 - no double space
ok 46 - dblink value is splittable
ok 47 - "GenBank:I37984"
ok 48 - no double colon
ok 49 - no trailing colon
ok 50 - no double space
ok 51 - dblink value is splittable
ok 52 - "HSSP:P08670"
ok 53 - no double colon
ok 54 - no trailing colon
ok 55 - no double space
ok 56 - dblink value is splittable
ok 57 - "IntAct:P35527"
ok 58 - no double colon
ok 59 - no trailing colon
ok 60 - no double space
ok 61 - dblink value is splittable
ok 62 - "Ensembl:ENSG00000171403"
ok 63 - no double colon
ok 64 - no trailing colon
ok 65 - no double space
ok 66 - dblink value is splittable
ok 67 - "KEGG:hsa:3857"
ok 68 - no double colon
ok 69 - no trailing colon
ok 70 - no double space
ok 71 - dblink value is splittable
ok 72 - "HGNC:6447"
ok 73 - no double colon
ok 74 - no trailing colon
ok 75 - no double space
ok 76 - dblink value is splittable
ok 77 - "MIM:144200"
ok 78 - no double colon
ok 79 - no trailing colon
ok 80 - no double space
ok 81 - dblink value is splittable
ok 82 - "MIM:607606"
ok 83 - no double colon
ok 84 - no trailing colon
ok 85 - no double space
ok 86 - dblink value is splittable
ok 87 - "ArrayExpress:P35527"
ok 88 - no double colon
ok 89 - no trailing colon
ok 90 - no double space
ok 91 - dblink value is splittable
ok 92 - "GO:0005200"
ok 93 - no double colon
ok 94 - no trailing colon
ok 95 - no double space
ok 96 - dblink value is splittable
ok 97 - "GO:0008544"
ok 98 - no double colon
ok 99 - no trailing colon
ok 100 - no double space
ok 101 - dblink value is splittable
ok 102 - "InterPro:IPR011000"
ok 103 - no double colon
ok 104 - no trailing colon
ok 105 - no double space
ok 106 - dblink value is splittable
ok 107 - "InterPro:IPR001664"
ok 108 - no double colon
ok 109 - no trailing colon
ok 110 - no double space
ok 111 - dblink value is splittable
ok 112 - "InterPro:IPR002957"
ok 113 - no double colon
ok 114 - no trailing colon
ok 115 - no double space
ok 116 - dblink value is splittable
ok 117 - "Pfam:PF00038"
ok 118 - no double colon
ok 119 - no trailing colon
ok 120 - no double space
ok 121 - dblink value is splittable
ok 122 - "PRINTS:PR01248"
ok 123 - no double colon
ok 124 - no trailing colon
ok 125 - no double space
ok 126 - dblink value is splittable
ok 127 - "PROSITE:PS00226"
ok 128 - no double colon
ok 129 - no trailing colon
ok 130 - no double space
ok 131 - dblink value is splittable
ok
t/Seq/EncodedSeq.t .................. 
1..37
ok 1 - use Bio::Seq::EncodedSeq;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 12
ok 13
ok 14 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/Seq/LargeLocatableSeq.t ........... 
1..8
ok 1 - use Bio::Seq::LargeLocatableSeq;
ok 2
ok 3 - An object of class 'Bio::Seq::LargeLocatableSeq' isa 'Bio::Seq::LargeSeqI'
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Seq/LargePSeq.t ................... 
1..30
ok 1 - use Bio::Seq::LargePrimarySeq;
ok 2 - use Bio::Seq::LargeSeq;
ok 3 - use Bio::Location::Simple;
ok 4 - use Bio::Location::Fuzzy;
ok 5 - use Bio::Location::Split;
ok 6 - use Bio::SeqIO;
ok 7
ok 8
ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 10 - Subseq is GGGGT
ok 11
ok 12
ok 13
ok 14 - trunc seq was GGGGTGAA
ok 15
ok 16
ok 17
ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 19
ok 20 - output via Bio::SeqIO::fasta
ok 21 - Subseq is GGGGT
ok 22 - trunc seq was GGGGTGAA
ok 23
ok 24
ok 25
ok 26 - Sequence is ATGGGGTGGGGT
ok 27 - Subseq is GGGGT
ok 28 - trunc seq was GGGGT
ok 29
ok 30
ok
t/Seq/LocatableSeq.t ................ 
1..119
ok 1 - use Bio::LocatableSeq;
ok 2 - use Bio::AlignIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 13
ok 14
ok 15 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 16
ok 17
ok 18
ok 19
not ok 20 # TODO Need to fix columns before start of seq w/ start > 1
#   Failed (TODO) test at t/Seq/LocatableSeq.t line 46.
#          got: 'Bio::Location::Simple=HASH(0x56233a2a8b90)'
#     expected: undef
ok 21
ok 22 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO'
ok 23
ok 24
ok 25
ok 26
ok 27 - threw Regexp ((?^:.+))
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 51
ok 52
ok 53 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106 - * is counted in length
ok 107 - * is counted in length, but end is wrong
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues
#   Failed (TODO) test at t/Seq/LocatableSeq.t line 306.
#          got: '\-\.=~'
#     expected: '-\?'
not ok 119 # TODO Bio::LocatableSeq global variables have scoping issues
#   Failed (TODO) test at t/Seq/LocatableSeq.t line 308.
#          got: '19'
#     expected: anything else
ok
t/Seq/MetaSeq.t ..................... 
1..132
ok 1 - use Bio::Seq::Meta;
ok 2 - use Bio::Seq::Meta::Array;
ok 3 - use Bio::SeqIO;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Seq::Quality;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - aa-bb  bb 
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok
t/Seq/PrimaryQual.t ................. 
1..70
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::Quality;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8 - A reference of type 'ARRAY' isa 'ARRAY'
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26 - threw Regexp ((?^:.+))
ok 27 - threw Regexp ((?^:.+))
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33 - threw Regexp ((?^:EX))
ok 34
ok 35
ok 36 - threw Regexp ((?^:EX))
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok
t/Seq/PrimarySeq.t .................. 
1..312
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::Location::Split;
ok 5 - Bare object
ok 6 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::IdentifiableI'
ok 26 - An object of class 'Bio::PrimarySeq' isa 'Bio::DescribableI'
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51 - threw Regexp ((?^:.+))
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 59
ok 60 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 61
ok 62 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 63
ok 64 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76 - Translation: LVAST
ok 77 - Translation: MVAST
ok 78 - Translation: MVAST
ok 79 - Translation: MVAST*
ok 80 - Translation: M*
ok 81 - Translation: M
ok 82
ok 83 - Translation: MWP
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92 - frame 0 start, frame 1 stop < frame 0 stop
ok 93 - frame 1 start, frame 2 stop < frame 1 stop
ok 94
ok 95
ok 96
ok 97 - Alphabet
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131 - Bug 2438
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140 - Bug \#2864
ok 141 - Terminator + inside sequence
ok 142
ok 143 - Length method
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163 - threw Regexp ((?^:.+))
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - threw Regexp ((?^:.+))
ok 176 - Validation
ok 177
ok 178
ok 179 - threw Regexp ((?^:.+))
ok 180
ok 181
ok 182 - _find_orfs 1
ok 183 - orfs are sorted by descending length
ok 184 - got correct -orf => "longest" seq
ok 185 - _find_orfs 1
ok 186 - orfs are sorted by descending length
ok 187 - got correct -orf => "longest" seq
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok
t/Seq/PrimedSeq.t ................... 
1..65
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::PrimedSeq;
ok 3 - Priming the target with sequence objects
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 13
ok 14
ok 15 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26 - Priming the target with primer objects
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - Priming the target with located primer objects
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok
t/Seq/Quality.t ..................... 
1..85
ok 1 - use Bio::Seq::Quality;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bug 2845
ok 73
ok 74 - Bug 2845
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok
t/Seq/Seq.t ......................... 
1..76
ok 1 - use Bio::Seq;
ok 2 - use Bio::Seq::RichSeq;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Species;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7 - An object of class 'Bio::Seq' isa 'Bio::AnnotatableI'
ok 8
ok 9
ok 10
ok 11 - truncated sequence length
ok 12 - truncated sequence string
ok 13
ok 14
ok 15 - alphabet
ok 16 - id
ok 17 - accession number
ok 18 - subseq
ok 19 - An object of class 'Bio::Seq' isa 'Bio::IdentifiableI'
ok 20 - An object of class 'Bio::Seq' isa 'Bio::DescribableI'
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - translated sequence
ok 35 - translated sequence with explicit unambiguous codons
ok 36 - translated sequence with unknown unambiguous codons
ok 37 - translated sequence with unknown unambiguous codons, completed
ok 38 - translated sequence with unambiguous codons
ok 39 - translated sequence with unambiguous codons
ok 40 - translated sequence with unknown unambiguous codons, completed
ok 41 - translated sequence with unambiguous codons
ok 42 - translated sequence with unknown unambiguous codons, completed
ok 43 - translated sequence with stop
ok 44 - translated sequence
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62 - Don't use clone for trunc of Bio::Seq::RichSeq
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68 - Bug \#2864
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok
t/Seq/SimulatedRead.t ............... 
1..194
ok 1 - use Bio::Seq;
ok 2 - use Bio::Seq::Quality;
ok 3 - use Bio::PrimarySeq;
ok 4 - use Bio::LocatableSeq;
ok 5 - use Bio::Seq::SimulatedRead;
ok 6
ok 7 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::SimulatedRead'
ok 8 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::LocatableSeq'
ok 9 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::Quality'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102 - redundant errors
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114 - errors()
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130 - track()
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137 - qual_levels()
ok 138
ok 139 - reference()
ok 140
ok 141 - mid()
ok 142
ok 143
ok 144
ok 145 - ACGT
ok 146
ok 147
ok 148
ok 149
ok 150 - TTTAAA
ok 151
ok 152
ok 153
ok 154
ok 155 - Bio::Seq::Quality
ok 156 - Bio::Seq
ok 157 - Bio::PrimarySeq
ok 158 - Bio::LocatableSeq
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok
t/SeqFeature/Amplicon.t ............. 
1..21
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::SeqFeature::Primer;
ok 3 - use Bio::SeqFeature::Amplicon;
ok 4 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 5 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::SubSeq'
ok 6
ok 7
ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 16
ok 17
ok 18
ok 19
ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 21
ok
t/SeqFeature/Clone.t ................ 
1..17
ok 1 - clone()
ok 2 - start() clone set
ok 3 - start() clone get
ok 4 - start() original unchanged
ok 5 - clone() with arguments
ok 6 - start() orig get
ok 7 - end() orig get
ok 8 - start() clone get
ok 9 - end() clone get
ok 10 - start() clone set
ok 11 - start() clone get
ok 12 - start() original unchanged
ok 13 - location() Bio::Location::Split
ok 14 - clone()
ok 15 - start() clone set
ok 16 - start() clone get
ok 17 - start() original unchanged
ok
t/SeqFeature/Collection.t ........... 
1..24
ok 1 - use Bio::SeqFeature::Collection;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Tools::GFF;
ok 4 - use Bio::SeqIO;
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/SeqFeature/Computation.t .......... 
1..12
ok 1 - use Bio::SeqFeature::Computation;
ok 2
ok 3 - computation id
ok 4 - score value
ok 5
ok 6
ok 7
ok 8 - sft[0] is exon
ok 9
ok 10 - computation id
ok 11
ok 12 - score value
ok
t/SeqFeature/FeaturePair.t .......... 
1..19
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::SeqFeature::FeaturePair;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8 - feature1 of pair stored
ok 9 - feature2 of pair stored
ok 10 - feature start
ok 11 - feature end
ok 12 - primary tag
ok 13 - source tag
ok 14 - hstart
ok 15 - hend
ok 16 - hprimary tag
ok 17 - hsource tag
ok 18
ok 19 - inverted end
ok
t/SeqFeature/Gene.t ................. 
1..28
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Gene::Transcript;
ok 3 - use Bio::SeqFeature::Gene::UTR;
ok 4 - use Bio::SeqFeature::Gene::Exon;
ok 5 - use Bio::SeqFeature::Gene::Poly_A_site;
ok 6 - use Bio::SeqFeature::Gene::GeneStructure;
ok 7 - use Bio::Location::Fuzzy;
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - mRNA spliced length
ok 28 - has 2 UTRs
ok
t/SeqFeature/Generic.t .............. 
1..364
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - Start of feature location
ok 10 - End of feature location
ok 11 - Primary tag
ok 12 - Source tag
ok 13 - Display name
ok 14 - Undef phase by default
ok 15 - Phase accessor returns
ok 16 - Phase is persistent
ok 17
ok 18
ok 19 - Set phase from constructor
ok 20
ok 21
ok 22 - Start of first seqfeature
ok 23 - End of first seqfeature
ok 24 - Strand of first seqfeature
ok 25
ok 26 - Sequence of first seqfeature
ok 27
ok 28
ok 29
ok 30 - Start of second seqfeature
ok 31 - End of second seqfeature
ok 32 - Strand of second seqfeature
ok 33
ok 34 - Sequence of second seqfeature
ok 35
ok 36
ok 37
ok 38 - sfeat start for EXPAND-ED feature (bug \#947)
ok 39 - sfeat end for EXPAND-ED feature (bug \#947)
ok 40
ok 41
ok 42 - Can create feature starting and ending at 0
ok 43
ok 44 - Can create feature starting and ending at 0
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 55
ok 56 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq'
ok 57
ok 58 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 59 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 60 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 61 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 62 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 63
ok 64 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 65
ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq'
ok 67
ok 68 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 69 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 70
ok 71 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 72
ok 73
ok 74 - spliced_seq translation matches expected
ok 75
ok 76 - spliced_seq translation matches expected
ok 77
ok 78 - spliced_seq translation matches expected
ok 79
ok 80 - spliced_seq translation matches expected
ok 81
ok 82 - spliced_seq translation matches expected
ok 83
ok 84 - spliced_seq translation matches expected
ok 85
ok 86 - spliced_seq translation matches expected
ok 87
ok 88 - spliced_seq translation matches expected
ok 89
ok 90 - spliced_seq translation matches expected
ok 91
ok 92 - spliced_seq translation matches expected
ok 93
ok 94 - spliced_seq translation matches expected
ok 95
ok 96 - spliced_seq translation matches expected
ok 97
ok 98 - spliced_seq translation matches expected
ok 99
ok 100 - spliced_seq translation matches expected
ok 101
ok 102 - spliced_seq translation matches expected
ok 103
ok 104 - spliced_seq translation matches expected
ok 105
ok 106 - spliced_seq translation matches expected
ok 107
ok 108 - spliced_seq translation matches expected
ok 109
ok 110 - spliced_seq translation matches expected
ok 111
ok 112 - spliced_seq translation matches expected
ok 113
ok 114 - spliced_seq translation matches expected
ok 115
ok 116 - spliced_seq translation matches expected
ok 117
ok 118 - spliced_seq translation matches expected
ok 119
ok 120 - spliced_seq translation matches expected
ok 121
ok 122 - spliced_seq translation matches expected
ok 123
ok 124 - spliced_seq translation matches expected
ok 125
ok 126 - spliced_seq translation matches expected
ok 127
ok 128 - spliced_seq translation matches expected
ok 129
ok 130 - spliced_seq translation matches expected
ok 131
ok 132 - spliced_seq translation matches expected
ok 133
ok 134 - spliced_seq translation matches expected
ok 135
ok 136 - spliced_seq translation matches expected
ok 137
ok 138 - spliced_seq translation matches expected
ok 139
ok 140 - spliced_seq translation matches expected
ok 141
ok 142 - spliced_seq translation matches expected
ok 143
ok 144 - spliced_seq translation matches expected
ok 145
ok 146 - spliced_seq translation matches expected
ok 147
ok 148 - spliced_seq translation matches expected
ok 149
ok 150 - spliced_seq translation matches expected
ok 151
ok 152 - spliced_seq translation matches expected
ok 153
ok 154 - spliced_seq translation matches expected
ok 155
ok 156 - spliced_seq translation matches expected
ok 157
ok 158 - spliced_seq translation matches expected
ok 159
ok 160 - spliced_seq translation matches expected
ok 161
ok 162 - spliced_seq translation matches expected
ok 163
ok 164 - spliced_seq translation matches expected
ok 165
ok 166 - spliced_seq translation matches expected
ok 167
ok 168 - spliced_seq translation matches expected
ok 169
ok 170 - spliced_seq translation matches expected
ok 171
ok 172 - spliced_seq translation matches expected
ok 173
ok 174 - spliced_seq translation matches expected
ok 175
ok 176 - spliced_seq translation matches expected
ok 177
ok 178 - spliced_seq translation matches expected
ok 179
ok 180 - spliced_seq translation matches expected
ok 181
ok 182 - spliced_seq translation matches expected
ok 183
ok 184 - spliced_seq translation matches expected
ok 185
ok 186 - spliced_seq translation matches expected
ok 187
ok 188 - spliced_seq translation matches expected
ok 189
ok 190 - spliced_seq translation matches expected
ok 191
ok 192 - spliced_seq translation matches expected
ok 193
ok 194 - spliced_seq translation matches expected
ok 195
ok 196 - spliced_seq translation matches expected
ok 197
ok 198 - spliced_seq translation matches expected
ok 199
ok 200 - spliced_seq translation matches expected
ok 201
ok 202 - spliced_seq translation matches expected
ok 203
ok 204 - spliced_seq translation matches expected
ok 205
ok 206 - spliced_seq translation matches expected
ok 207
ok 208 - spliced_seq translation matches expected
ok 209
ok 210 - spliced_seq translation matches expected
ok 211
ok 212 - spliced_seq translation matches expected
ok 213
ok 214 - spliced_seq translation matches expected
ok 215
ok 216 - spliced_seq translation matches expected
ok 217
ok 218 - spliced_seq translation matches expected
ok 219
ok 220 - spliced_seq translation matches expected
ok 221
ok 222 - spliced_seq translation matches expected
ok 223
ok 224 - spliced_seq translation matches expected
ok 225
ok 226 - spliced_seq translation matches expected
ok 227
ok 228 - spliced_seq translation matches expected
ok 229
ok 230 - spliced_seq translation matches expected
ok 231
ok 232 - spliced_seq translation matches expected
ok 233
ok 234 - spliced_seq translation matches expected
ok 235
ok 236 - spliced_seq translation matches expected
ok 237
ok 238 - spliced_seq translation matches expected
ok 239
ok 240 - spliced_seq translation matches expected
ok 241
ok 242 - spliced_seq translation matches expected
ok 243
ok 244 - spliced_seq translation matches expected
ok 245
ok 246 - spliced_seq translation matches expected
ok 247
ok 248 - spliced_seq translation matches expected
ok 249
ok 250 - spliced_seq translation matches expected
ok 251
ok 252 - spliced_seq translation matches expected
ok 253
ok 254 - spliced_seq translation matches expected
ok 255
ok 256 - spliced_seq translation matches expected
ok 257
ok 258 - spliced_seq translation matches expected
ok 259
ok 260 - spliced_seq translation matches expected
ok 261
ok 262 - spliced_seq translation matches expected
ok 263
ok 264 - spliced_seq translation matches expected
ok 265
ok 266 - spliced_seq translation matches expected
ok 267
ok 268 - spliced_seq translation matches expected
ok 269
ok 270 - spliced_seq translation matches expected
ok 271
ok 272 - spliced_seq translation matches expected
ok 273
ok 274 - spliced_seq translation matches expected
ok 275
ok 276 - spliced_seq translation matches expected
ok 277
ok 278 - spliced_seq translation matches expected
ok 279
ok 280 - spliced_seq translation matches expected
ok 281
ok 282 - spliced_seq translation matches expected
ok 283
ok 284 - spliced_seq translation matches expected
ok 285
ok 286 - spliced_seq translation matches expected
ok 287
ok 288 - spliced_seq translation matches expected
ok 289
ok 290 - spliced_seq translation matches expected
ok 291
ok 292 - spliced_seq translation matches expected
ok 293
ok 294 - spliced_seq translation matches expected
ok 295
ok 296 - spliced_seq translation matches expected
ok 297
ok 298 - spliced_seq translation matches expected
ok 299
ok 300 - spliced_seq translation matches expected
ok 301
ok 302 - spliced_seq translation matches expected
ok 303
ok 304 - spliced_seq translation matches expected
ok 305
ok 306 - spliced_seq translation matches expected
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312 - phase check
ok 313
ok 314
ok 315 - phase check
ok 316
ok 317
ok 318 - phase check
ok 319
ok 320
ok 321 - phase check
ok 322
ok 323
ok 324 - phase check
ok 325
ok 326
ok 327
ok 328 - Tags found
ok 329 - get_tagset_values tag values found
ok 330 - get_tagset_values tag values for multiple tags found
ok 331 - get_tag_values tag values found
ok 332 - get_tag_values lives with tag
ok 333 - get_tagset_values no tag values found
ok 334 - get_tagset_values lives with no tag
ok 335 - get_tag_values throws with no tag
ok 336 - Phi-X174 genome is circular
ok 337
ok 338 - Only 3 split locations
ok 339 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 340
ok 341 - Feature string
ok 342 - First ten nucleotides
ok 343 - Strand
ok 344 - Start
ok 345 - End
ok 346 - Expected length
ok 347 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 348
ok 349 - Feature string
ok 350 - First ten nucleotides
ok 351 - Strand
ok 352 - Start
ok 353 - End
ok 354 - Expected length
ok 355 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 356
ok 357 - Feature string
ok 358 - First ten nucleotides
ok 359 - Strand
ok 360 - Start
ok 361 - End
ok 362 - Expected length
ok 363 - Reverse strand is spliced correctly
ok 364 - Reverse strand is spliced correctly
ok
t/SeqFeature/Location.t ............. 
1..109
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Location::Split;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::SeqFeature::Generic;
ok 5 - use Bio::SeqFeature::SimilarityPair;
ok 6 - use Bio::SeqFeature::FeaturePair;
ok 7 - use Bio::SeqFeature::Lite;
ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 9 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI'
ok 10 - Bio::Location::Simple tests
ok 11
ok 12
ok 13
ok 14
ok 15 - 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI'
ok 16 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::RangeI'
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 - Bio::SeqFeature::FeaturePair tests
ok 25
ok 26
ok 27
ok 28 - Bio::SeqFeature::Generic tests
ok 29
ok 30 - Bio::Location::Fuzzy tests
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - Bio::Location::Split tests
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 - Bugfix 1074
ok 62
ok 63
ok 64
ok 65 - Positive length
ok 66
ok 67 - seq_id() on Bio::Location::Split
ok 68
ok 69
ok 70 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 71 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI'
ok 72 - Bio::Location::Simple EXACT
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78 - Bio::Location::Simple IN-BETWEEN
ok 79
ok 80
ok 81
ok 82
ok 83 - Testing error handling
ok 84
ok 85
ok 86
ok 87 - use Bio::Location::WidestCoordPolicy;
ok 88 - use Bio::Location::NarrowestCoordPolicy;
ok 89 - use Bio::Location::AvWithinCoordPolicy;
ok 90 - Default coodinate policy
ok 91
ok 92
ok 93
ok 94 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy'
ok 95 - Narrowest coodinate policy
ok 96
ok 97
ok 98
ok 99 - An object of class 'Bio::Location::NarrowestCoordPolicy' isa 'Bio::Location::NarrowestCoordPolicy'
ok 100 - Average coodinate policy
ok 101
ok 102
ok 103
ok 104 - An object of class 'Bio::Location::AvWithinCoordPolicy' isa 'Bio::Location::AvWithinCoordPolicy'
ok 105 - Widest coodinate policy
ok 106
ok 107
ok 108
ok 109 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy'
ok
t/SeqFeature/LocationFactory.t ...... 
1..325
ok 1 - use Bio::Factory::FTLocationFactory;
ok 2 - An object of class 'Bio::Factory::FTLocationFactory' isa 'Bio::Factory::LocationFactoryI'
ok 3 - Bio::Location::Split
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - Location String: join(12..78,134..202)
ok 13
ok 14 - Bio::Location::Fuzzy
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23 - Location String: 145^177
ok 24
ok 25 - Bio::Location::Split
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599)
ok 35
ok 36 - Bio::Location::Simple
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - Location String: J00194:100..202
ok 46
ok 47 - Bio::Location::Fuzzy
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - Location String: 1..>888
ok 57
ok 58 - Bio::Location::Fuzzy
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - Location String: <1..888
ok 68
ok 69 - Bio::Location::Simple
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78 - Location String: J00194:100..202
ok 79
ok 80 - Bio::Location::Fuzzy
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - Location String: (102.110)
ok 90
ok 91 - Bio::Location::Split
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100 - Location String: complement(join(2691..4571,4918..5163))
ok 101
ok 102 - Bio::Location::Simple
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111 - Location String: 123^124
ok 112
ok 113 - Bio::Location::Split
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122 - Location String: complement(join(94468..94578,94578..>94889))
ok 123
ok 124 - Bio::Location::Fuzzy
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133 - Location String: (122.133)..(204.221)
ok 134
ok 135 - Bio::Location::Fuzzy
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144 - Location String: (23.45)..600
ok 145
ok 146 - Bio::Location::Fuzzy
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155 - Location String: 22..?64
ok 156
ok 157 - Bio::Location::Fuzzy
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166 - Location String: ?..?
ok 167
ok 168 - Bio::Location::Split
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177 - Location String: join(1..100,J00194.1:100..202)
ok 178
ok 179 - Bio::Location::Fuzzy
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188 - Location String: <345..500
ok 189
ok 190 - Bio::Location::Simple
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199 - Location String: 340..565
ok 200
ok 201 - Bio::Location::Fuzzy
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210 - Location String: ?2465..2774
ok 211
ok 212 - Bio::Location::Fuzzy
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221 - Location String: ?1..12
ok 222
ok 223 - Bio::Location::Fuzzy
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232 - Location String: 1..?
ok 233
ok 234 - Bio::Location::Simple
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243 - Location String: 467
ok 244
ok 245 - Bio::Location::Fuzzy
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254 - Location String: ?22..?64
ok 255
ok 256 - Bio::Location::Fuzzy
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265 - Location String: complement(34..(122.126))
ok 266
ok 267 - Bio::Location::Fuzzy
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276 - Location String: ?..536
ok 277
ok 278 - Bio::Location::Fuzzy
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287 - Location String: ?..>393
ok 288
ok 289 - Bio::Location::Fuzzy
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298 - Location String: <1..?
ok 299
ok 300 - Bio::Location::Fuzzy
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309 - Location String: (122.133)..(204.221)
ok 310
ok 311 - complement(join(2691..4571,4918..5163))
ok 312 - join(complement(4918..5163),complement(2691..4571))
ok 313 - equivalent remote location strings
ok 314 - complement(join(TEST0001.1:2691..4571,4918..5163))
ok 315 - join(complement(4918..5163),complement(TEST0001.1:2691..4571))
ok 316 - equivalent remote location strings
ok 317 - complement(join(TEST0001.1:2691..4571,TEST0008.1:4918..5163))
ok 318 - join(complement(TEST0008.1:4918..5163),complement(TEST0001.1:2691..4571))
ok 319 - equivalent remote location strings
ok 320 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294)))
ok 321 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081)))
ok 322 - join(20464..20694,21548..22763,complement(join(231520..231669,232596..232990,314652..314672)))
ok 323 - join(20464..20694,21548..22763,join(complement(314652..314672),complement(232596..232990),complement(231520..231669)))
ok 324 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000)
ok 325 - order(S67862.1:72..75,join(S67863.1:1..788,1..19))
ok
t/SeqFeature/Primer.t ............... 
1..47
ok 1 - use Bio::SeqFeature::Primer;
ok 2 - use Bio::PrimarySeq;
ok 3 - Implied primer sequence
ok 4 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 5 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::SubSeq'
ok 6
ok 7
ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 9
ok 10 - PrimarySeq primer
ok 11
ok 12
ok 13 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 42
ok 43
ok 44 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 45 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 46
ok 47
ok
t/SeqFeature/Range.t ................ 
1..49
ok 1 - use Bio::Range;
ok 2 - 'BioRange object' isa 'Bio::Range'
ok 3
ok 4 - 'BioRange object' isa 'Bio::Range'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - 'BioRange object' isa 'Bio::Range'
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - 'BioRange object' isa 'Bio::Range'
ok 26 - 'BioRange object' isa 'Bio::Range'
ok 27 - 'BioRange object' isa 'Bio::Range'
ok 28 -  1 & -1
ok 29 -  1 & 1 true
ok 30 -  1 & 0 true
ok 31 -  1 & -1 false
ok 32 -  1 & 1 true
ok 33 -  1 & 0 false
ok 34 -  1 & -1 false
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - 'Bio::Range object' isa 'Bio::Range'
ok 46
ok 47
ok 48
ok 49
ok
t/SeqFeature/RangeI.t ............... 
1..45
ok 1 - use Bio::SeqFeature::Generic;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39 - subtract() of split features
ok 40 -    0 start
ok 41 -    0 end
ok 42 -    1 start
ok 43 -    1 end
ok 44 -    2 start
ok 45 -    2 end
ok
t/SeqFeature/SeqAnalysisParser.t .... 
1..14
ok 1 - use Bio::Factory::SeqAnalysisParserFactory;
ok 2 - use Bio::SeqIO;
ok 3 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO'
ok 4 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 5 - An object of class 'Bio::Tools::Genscan' isa 'Bio::SeqAnalysisParserI'
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 10 - An object of class 'Bio::Tools::MZEF' isa 'Bio::SeqAnalysisParserI'
ok 11
ok 12
ok 13 - An object of class 'Bio::Tools::EPCR' isa 'Bio::SeqAnalysisParserI'
ok 14
ok
t/SeqFeature/SubSeq.t ............... 
1..37
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::SeqFeature::SubSeq;
ok 3 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::SubSeq'
ok 4 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::Generic'
ok 5
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 10
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 15
ok 16
ok 17
ok 18
ok 19 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 26
ok 27
ok 28
ok 29
ok 30 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 31
ok 32
ok 33
ok 34
ok 35 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 36
ok 37
ok
t/SeqFeature/Unflattener.t .......... 
1..21
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Tools::Unflattener;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok
t/SeqIO/ace.t ....................... 
1..7
ok 1 - use Bio::SeqIO;
ok 2 - number of sequence objects
ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters
ok 4 - alphabets detected
ok 5 - alphabets detected
ok 6 - writing sequence
ok 7 - test output
ok
t/SeqIO/asciitree.t ................. 
1..2
ok 1 - use Bio::SeqIO;
not ok 2 # TODO Output doesn't exists on linux
#   Failed (TODO) test at t/SeqIO/asciitree.t line 38.
ok
t/SeqIO/bsml.t ...................... 
1..16
ok 1 - use XML::DOM;
ok 2 - use Bio::SeqIO::bsml;
ok 3 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 4 - got correct number of refs
ok 5 - display_id
ok 6 - molecule
ok 7 - is_circular
ok 8 - dates
ok 9 - accession_number
ok 10 - seq_version
ok 11 - got correct number of SeqFeatures
ok 12 - feature start
ok 13 - feature end
ok 14 - get_tag_values db_xref
ok 15 - get_Annotations reference
ok 16 - get_Annotations dblink
ok
t/SeqIO/bsml_sax.t .................. 
1..15
ok 1 - use Bio::SeqIO;
ok 2 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/SeqIO/embl.t ...................... 
1..100
ok 1 - use Bio::SeqIO::embl;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 - success reading Embl with ^ location and badly split double quotes
ok 25
ok 26 - success writing Embl format with ^ < and > locations
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - genus duplication test
ok 55
ok 56
ok 57
ok 58
ok 59 - CDS - accession on PA line
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - CDS - OX tagname
ok 68 - CDS - OX database
ok 69 - CDS - OX primary_id
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85 - Check if product was parsed correctly
ok 86 - Parse long qualifier
ok 87
ok 88 - TaxID set correctly
ok 89 - The read sequence has a species object
ok 90 - NCBI TaxID has roundtripped
ok 91 - Name has roundtripped
ok 92 - TaxID set correctly
ok 93 - The read sequence has a species object
ok 94 - The taxid of the source feature overrides that of the OX line
ok 95 - Name has roundtripped
ok 96 - The ID field was written correctly
ok 97 - EMBL format with space after equal sign parses
ok 98 - CDS read
ok 99 - /product found
ok 100 - Qualifier /product value matches
ok
t/SeqIO/fasta.t ..................... 
1..22
ok 1 - use Bio::SeqIO::fasta;
ok 2 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO'
ok 3 - Bio::SeqIO::fasta->can('next_seq')
ok 4 - Bio::SeqIO::fasta->can('write_seq')
ok 5 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 6 - sequence
ok 7 - length
ok 8 - primary_id
ok 9 - description
ok 10 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 11 - sequence
ok 12 - length
ok 13 - primary_id
ok 14 - description
ok 15 - use Algorithm::Diff;
ok 16 - use IO::ScalarArray;
ok 17 - use IO::String;
ok 18 - fasta format can round-trip
ok 19 - dies with roa1.genbank
ok 20 - dies with test.gcg
ok 21 - dies with test.ace
ok 22 - dies with test.raw
ok
t/SeqIO/fastq.t ..................... 
1..149
ok 1 - use Bio::SeqIO::fastq;
ok 2 - use Bio::Seq::Quality;
ok 3 - RT98876 parses
ok 4 - correct num. seqs in RT98876
ok 5 - sample sequence obtained
ok 6 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 7 - seq() matches RT98876
ok 8 - desc() matches RT98876
ok 9 - display_id() matches RT98876
ok 10 - qual() matches RT98876
ok 11
ok 12 - bug2335 parses
ok 13 - correct num. seqs in bug2335
ok 14 - sample sequence obtained
ok 15 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 16 - seq() matches bug2335
ok 17 - desc() matches bug2335
ok 18 - display_id() matches bug2335
ok 19 - qual() matches bug2335
ok 20
ok 21 - evil_wrapping parses
ok 22 - correct num. seqs in evil_wrapping
ok 23 - sample sequence obtained
ok 24 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 25 - seq() matches evil_wrapping
ok 26 - desc() matches evil_wrapping
ok 27 - display_id() matches evil_wrapping
ok 28 - qual() matches evil_wrapping
ok 29
ok 30 - example parses
ok 31 - correct num. seqs in example
ok 32 - sample sequence obtained
ok 33 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 34 - seq() matches example
ok 35 - desc() matches example
ok 36 - display_id() matches example
ok 37 - qual() matches example
ok 38
ok 39 - illumina_faked parses
ok 40 - correct num. seqs in illumina_faked
ok 41 - sample sequence obtained
ok 42 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 43 - seq() matches illumina_faked
ok 44 - desc() matches illumina_faked
ok 45 - display_id() matches illumina_faked
ok 46 - qual() matches illumina_faked
ok 47
ok 48 - sanger_93 parses
ok 49 - correct num. seqs in sanger_93
ok 50 - sample sequence obtained
ok 51 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 52 - seq() matches sanger_93
ok 53 - desc() matches sanger_93
ok 54 - display_id() matches sanger_93
ok 55 - qual() matches sanger_93
ok 56
ok 57 - sanger_faked parses
ok 58 - correct num. seqs in sanger_faked
ok 59 - sample sequence obtained
ok 60 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 61 - seq() matches sanger_faked
ok 62 - desc() matches sanger_faked
ok 63 - display_id() matches sanger_faked
ok 64 - qual() matches sanger_faked
ok 65
ok 66 - solexa_example parses
ok 67 - correct num. seqs in solexa_example
ok 68 - sample sequence obtained
ok 69 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 70 - seq() matches solexa_example
ok 71 - desc() matches solexa_example
ok 72 - display_id() matches solexa_example
ok 73 - qual() matches solexa_example
ok 74
ok 75 - solexa_faked parses
ok 76 - correct num. seqs in solexa_faked
ok 77 - sample sequence obtained
ok 78 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 79 - seq() matches solexa_faked
ok 80 - desc() matches solexa_faked
ok 81 - display_id() matches solexa_faked
ok 82 - qual() matches solexa_faked
ok 83
ok 84 - test1_sanger parses
ok 85 - correct num. seqs in test1_sanger
ok 86 - sample sequence obtained
ok 87 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 88 - seq() matches test1_sanger
ok 89 - desc() matches test1_sanger
ok 90 - display_id() matches test1_sanger
ok 91 - qual() matches test1_sanger
ok 92
ok 93 - test2_solexa parses
ok 94 - correct num. seqs in test2_solexa
ok 95 - sample sequence obtained
ok 96 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 97 - seq() matches test2_solexa
ok 98 - desc() matches test2_solexa
ok 99 - display_id() matches test2_solexa
ok 100 - qual() matches test2_solexa
ok 101
ok 102 - test3_illumina parses
ok 103 - correct num. seqs in test3_illumina
ok 104 - sample sequence obtained
ok 105 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 106 - seq() matches test3_illumina
ok 107 - desc() matches test3_illumina
ok 108 - display_id() matches test3_illumina
ok 109 - qual() matches test3_illumina
ok 110
ok 111 - tricky parses
ok 112 - correct num. seqs in tricky
ok 113 - sample sequence obtained
ok 114 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 115 - seq() matches tricky
ok 116 - desc() matches tricky
ok 117 - display_id() matches tricky
ok 118 - qual() matches tricky
ok 119
ok 120 - Conversion from illumina to sanger
ok 121 - Conversion from illumina to illumina
ok 122 - Conversion from illumina to solexa
ok 123 - Conversion from sanger to sanger
ok 124 - Conversion from sanger to illumina
ok 125 - Conversion from sanger to solexa
ok 126 - Conversion from solexa to sanger
ok 127 - Conversion from solexa to illumina
ok 128 - Conversion from solexa to solexa
ok 129 - Exception caught for error_diff_ids
ok 130 - Exception caught for error_long_qual
ok 131 - Exception caught for error_no_qual
ok 132 - Exception caught for error_qual_del
ok 133 - Exception caught for error_qual_escape
ok 134 - Exception caught for error_qual_null
ok 135 - Exception caught for error_qual_space
ok 136 - Exception caught for error_qual_tab
ok 137 - Exception caught for error_qual_unit_sep
ok 138 - Exception caught for error_qual_vtab
ok 139 - Exception caught for error_short_qual
ok 140 - Exception caught for error_spaces
ok 141 - Exception caught for error_tabs
ok 142 - Exception caught for error_trunc_at_plus
ok 143 - Exception caught for error_trunc_at_qual
ok 144 - Exception caught for error_trunc_at_seq
ok 145 - Exception caught for error_trunc_in_plus
ok 146 - Exception caught for error_trunc_in_qual
ok 147 - Exception caught for error_trunc_in_seq
ok 148 - Exception caught for error_trunc_in_title
ok 149 - edge case; single 0 in quality fails
ok
t/SeqIO/game.t ...................... 
1..24
ok 1 - use Bio::SeqIO::game;
ok 2 - An object of class 'Bio::SeqIO::game' isa 'Bio::SeqIO'
ok 3 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/SeqIO/gbxml.t ..................... 
1..14
ok 1 - use Bio::SeqIO::gbxml;
ok 2 - An object of class 'Bio::SeqIO::gbxml' isa 'Bio::SeqIO'
ok 3 - molecule
ok 4 - alphabet
ok 5 - primary_id
ok 6 - display_id
ok 7 - version
ok 8 - is_circular
ok 9 - description
ok 10 - sequence
ok 11 - classification
ok 12 - feat - clone_lib
ok 13 - feat - db_xref
ok 14 - feat - lab_host
ok
t/SeqIO/gcg.t ....................... 
1..17
ok 1 - use Bio::SeqIO::gcg;
ok 2 - An object of class 'Bio::SeqIO::gcg' isa 'Bio::SeqIO'
ok 3 - Bio::SeqIO::gcg->can('next_seq')
ok 4 - Bio::SeqIO::gcg->can('write_seq')
ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq'
ok 6 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq'
ok 7 - sequence
ok 8 - length
not ok 9 - primary_id # TODO possible bug: RichSeq not setting primary_id?
#   Failed (TODO) test 'primary_id'
#   at t/SeqIO/gcg.t line 53.
#          got: 'Bio::PrimarySeq=HASH(0x562b40ae4910)'
#     expected: 'roa1_drome'
ok 10 - description
ok 11
ok 12 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI'
ok 13
ok 14 - use Algorithm::Diff;
ok 15 - use IO::ScalarArray;
ok 16 - use IO::String;
ok 17 - gcg format can round-trip
ok
t/SeqIO/genbank.t ................... 
1..306
ok 1 - use Bio::SeqIO::genbank;
ok 2 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 3 - AI129902
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - NT_021877
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - BAB68554
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28 - operator overloading in AnnotationI is deprecated
ok 29 - NC_006346
ok 30
ok 31
ok 32 - U71225
ok 33
ok 34 - AB077698
ok 35
ok 36 - DQ018368
ok 37 - D10483
ok 38
ok 39
ok 40
ok 41 - bug 1487
ok 42
ok 43 - bug 1647
ok 44
ok 45
ok 46 - bug 1673
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52 - AF165282
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 - species parsing incorrect for genbank
ok 62 - genus duplicated in genbank parsing
ok 63
ok 64
ok 65 - species parsing incorrect for genbank
ok 66 - genus duplicated in genbank parsing
ok 67
ok 68
ok 69 - species parsing incorrect for genbank
ok 70 - genus duplicated in genbank parsing
ok 71
ok 72 - streaming
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78 - Total number of sequences in test file
ok 79
ok 80 - Fuzzy in
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92 - Fuzzy out
ok 93 - BK000016
ok 94
ok 95 - BK000016
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110 - BK000016
ok 111 - roundtrip
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129 - revcomp split location
ok 130 - Bug 1925
ok 131
ok 132
ok 133 - wgs
ok 134
ok 135 - wgs_scafld
ok 136
ok 137 - wgs_scafld
ok 138
ok 139
ok 140 - BC000007
ok 141 - BK000016-tpa.gbk
ok 142 - ay116458.gb
ok 143 - ay149291.gb
ok 144 - NC_006346.gb
ok 145 - ay007676.gb
ok 146 - dq519393.gb
ok 147
ok 148 - swissprot:K1C9_HUMAN
ok 149
ok 150 - swissprot
ok 151
ok 152 - GenBank:Z29074.1
ok 153
ok 154 - GenBank
ok 155
ok 156 - GenPept:CAA82315.1
ok 157
ok 158 - GenPept
ok 159
ok 160 - GenBank:S69510.1
ok 161
ok 162 - GenBank
ok 163
ok 164 - GenPept:AAC60619.1
ok 165
ok 166 - GenPept
ok 167
ok 168 - GenBank:X75015.1
ok 169
ok 170 - GenBank
ok 171
ok 172 - GenPept:CAA52924.1
ok 173
ok 174 - GenPept
ok 175
ok 176 - GenBank:AB001594.1
ok 177
ok 178 - GenBank
ok 179
ok 180 - GenPept:BAA19418.1
ok 181
ok 182 - GenPept
ok 183
ok 184 - GenBank:I37984
ok 185
ok 186 - GenBank
ok 187
ok 188 - HSSP:P08670
ok 189
ok 190 - HSSP
ok 191
ok 192 - IntAct:P35527
ok 193
ok 194 - IntAct
ok 195
ok 196 - Ensembl:ENSG00000171403
ok 197
ok 198 - Ensembl
ok 199
ok 200 - KEGG:hsa:3857
ok 201
ok 202 - KEGG
ok 203
ok 204 - HGNC:6447
ok 205
ok 206 - HGNC
ok 207
ok 208 - MIM:144200
ok 209
ok 210 - MIM
ok 211
ok 212 - MIM:607606
ok 213
ok 214 - MIM
ok 215
ok 216 - ArrayExpress:P35527
ok 217
ok 218 - ArrayExpress
ok 219
ok 220 - GO:0005200
ok 221
ok 222 - GO
ok 223
ok 224 - GO:0008544
ok 225
ok 226 - GO
ok 227
ok 228 - InterPro:IPR011000
ok 229
ok 230 - InterPro
ok 231
ok 232 - InterPro:IPR001664
ok 233
ok 234 - InterPro
ok 235
ok 236 - InterPro:IPR002957
ok 237
ok 238 - InterPro
ok 239
ok 240 - Pfam:PF00038
ok 241
ok 242 - Pfam
ok 243
ok 244 - PRINTS:PR01248
ok 245
ok 246 - PRINTS
ok 247
ok 248 - PROSITE:PS00226
ok 249
ok 250 - PROSITE
ok 251
ok 252 - Bug 2195
ok 253 - Bug 2195
ok 254 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 255
ok 256 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 257
ok 258 - P39765
ok 259 - P39765
ok 260 - P39765
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270 - operator overloading in AnnotationI is deprecated
ok 271
ok 272
ok 273
ok 274
ok 275 - bug3375 database is BioProject
ok 276 - bug3375 primary_id is PRJNA15288
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282 - Label is the same
ok 283
ok 284
ok 285 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 286
ok 287
ok 288
ok 289
ok 290 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 291
ok 292
ok 293 - Got 11 features
ok 294 - Got 1 feature
ok 295 - Correct primary tag for feature
ok 296 - Got 10 features
ok 297 - Got correct Structured Comment
ok 298 - Got correct Structured Comment
ok 299 - Got correct Structured Comment
ok 300 - Got correct Structured Comment
ok 301 - Got correct Structured Comment
ok 302 - Got correct Structured Comment
ok 303 - Got correct Structured Comment
ok 304 - Got correct Structured Comment
ok 305 - unquoted labels wrap at comma
ok 306 - Label is the same
ok
t/SeqIO/Handler.t ................... 
1..561
ok 1 - use Bio::SeqIO;
ok 2 - AI129902
ok 3
ok 4
ok 5
ok 6 - NT_021877
ok 7
ok 8
ok 9
ok 10
ok 11 - BAB68554
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21 - operator overloading in AnnotationI is deprecated
ok 22 - NC_006346
ok 23
ok 24
ok 25 - U71225
ok 26
ok 27 - AB077698
ok 28
ok 29 - DQ018368
ok 30 - D10483
ok 31
ok 32
ok 33
ok 34 - bug 1487
ok 35
ok 36 - bug 1647
ok 37
ok 38
ok 39 - bug 1673
ok 40
ok 41
ok 42
ok 43 - AF165282
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52 - species parsing incorrect for genbank
ok 53 - genus duplicated in genbank parsing
ok 54
ok 55
ok 56 - species parsing incorrect for genbank
ok 57 - genus duplicated in genbank parsing
ok 58
ok 59
ok 60 - species parsing incorrect for genbank
ok 61 - genus duplicated in genbank parsing
ok 62
ok 63 - streaming
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69 - Total number of sequences in test file
ok 70
ok 71 - Fuzzy in
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83 - Fuzzy out
ok 84 - BK000016
ok 85
ok 86 - BK000016
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101 - BK000016
ok 102 - roundtrip
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120 - revcomp split location
ok 121 - Bug 1925
ok 122
ok 123
ok 124 - wgs
ok 125
ok 126 - wgs_scafld
ok 127
ok 128 - wgs_scafld
ok 129
ok 130
ok 131 - BC000007
ok 132 - BK000016-tpa.gbk
ok 133 - ay116458.gb
ok 134 - ay149291.gb
ok 135 - NC_006346.gb
ok 136 - ay007676.gb
ok 137 - dq519393.gb
ok 138
ok 139 - swissprot:K1C9_HUMAN
ok 140
ok 141 - swissprot
ok 142
ok 143 - GenBank:Z29074.1
ok 144
ok 145 - GenBank
ok 146
ok 147 - GenPept:CAA82315.1
ok 148
ok 149 - GenPept
ok 150
ok 151 - GenBank:S69510.1
ok 152
ok 153 - GenBank
ok 154
ok 155 - GenPept:AAC60619.1
ok 156
ok 157 - GenPept
ok 158
ok 159 - GenBank:X75015.1
ok 160
ok 161 - GenBank
ok 162
ok 163 - GenPept:CAA52924.1
ok 164
ok 165 - GenPept
ok 166
ok 167 - GenBank:AB001594.1
ok 168
ok 169 - GenBank
ok 170
ok 171 - GenPept:BAA19418.1
ok 172
ok 173 - GenPept
ok 174
ok 175 - GenBank:I37984
ok 176
ok 177 - GenBank
ok 178
ok 179 - HSSP:P08670
ok 180
ok 181 - HSSP
ok 182
ok 183 - IntAct:P35527
ok 184
ok 185 - IntAct
ok 186
ok 187 - Ensembl:ENSG00000171403
ok 188
ok 189 - Ensembl
ok 190
ok 191 - KEGG:hsa:3857
ok 192
ok 193 - KEGG
ok 194
ok 195 - HGNC:6447
ok 196
ok 197 - HGNC
ok 198
ok 199 - MIM:144200
ok 200
ok 201 - MIM
ok 202
ok 203 - MIM:607606
ok 204
ok 205 - MIM
ok 206
ok 207 - ArrayExpress:P35527
ok 208
ok 209 - ArrayExpress
ok 210
ok 211 - GO:0005200
ok 212
ok 213 - GO
ok 214
ok 215 - GO:0008544
ok 216
ok 217 - GO
ok 218
ok 219 - InterPro:IPR011000
ok 220
ok 221 - InterPro
ok 222
ok 223 - InterPro:IPR001664
ok 224
ok 225 - InterPro
ok 226
ok 227 - InterPro:IPR002957
ok 228
ok 229 - InterPro
ok 230
ok 231 - Pfam:PF00038
ok 232
ok 233 - Pfam
ok 234
ok 235 - PRINTS:PR01248
ok 236
ok 237 - PRINTS
ok 238
ok 239 - PROSITE:PS00226
ok 240
ok 241 - PROSITE
ok 242
ok 243 - Bug 2195
ok 244 - Bug 2195
ok 245 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 246
ok 247 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273 - success reading Embl with ^ location and badly split double quotes
ok 274
ok 275
ok 276 - success writing Embl format with ^ < and > locations
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309 - genus duplication test
ok 310
ok 311
ok 312 - An object of class 'Bio::SeqIO::swissdriver' isa 'Bio::SeqIO'
ok 313 - An object of class 'Bio::Species' isa 'Bio::Species'
ok 314
ok 315
ok 316 - operator overloading in AnnotationI is deprecated
ok 317
ok 318 - dates
ok 319 - dates
ok 320 - dates
ok 321
ok 322 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 323
ok 324
ok 325
ok 326 - operator overloading in AnnotationI is deprecated
ok 327
ok 328
ok 329
ok 330
ok 331 - id is ROA1_HUMAN
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339 - operator overloading in AnnotationI is deprecated
ok 340
ok 341
ok 342
ok 343 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353 - operator overloading in AnnotationI is deprecated
ok 354
ok 355
ok 356
ok 357 - GC1QBP
ok 358 - HABP1
ok 359 - SF2P32
ok 360 - C1QBP
ok 361
ok 362 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369 - F54H12.1
ok 370 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 383
ok 384
ok 385
ok 386
ok 387 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485 - An object of class 'Bio::Species' isa 'Bio::Species'
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517 - An object of class 'Bio::Species' isa 'Bio::Species'
ok 518
ok 519
ok 520 - operator overloading in AnnotationI is deprecated
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551 - P39765
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561 - operator overloading in AnnotationI is deprecated
ok
t/SeqIO/kegg.t ...................... 
1..16
ok 1 - use Bio::SeqIO::kegg;
ok 2 - An object of class 'Bio::SeqIO::kegg' isa 'Bio::SeqIO'
ok 3
ok 4 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/SeqIO/largefasta.t ................ 
1..16
ok 1 - use Bio::SeqIO::largefasta;
ok 2 - An object of class 'Bio::SeqIO::largefasta' isa 'Bio::SeqIO'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/SeqIO/locuslink.t ................. 
1..26
ok 1 - use Bio::SeqIO::locuslink;
ok 2 - use Bio::SeqFeature::Generic;
ok 3 - use Bio::SeqFeature::AnnotationAdaptor;
ok 4
ok 5 - An object of class 'Bio::SeqIO::locuslink' isa 'Bio::SeqIO'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok
t/SeqIO/mbsout.t .................... 
1..74
ok 1 - use Bio::SeqIO::mbsout;
ok 2 - Bio::SeqIO::mbsout is at least api version 1.1.3
ok 3 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout'
ok 4 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout'
ok 5 - Get TRAJ_FILENAME
ok 6 - Get NEXT_RUN_NUM
ok 7 - Get NREPS
ok 8 - Get POP_RECOMB_PARAM_PER_SITE
ok 9 - Get TOT_RUN_HAPS
ok 10 - Get RUNS
ok 11 - Get POP_MUT_PARAM_PER_SITE
ok 12 - Get POSITIONS
ok 13 - Get SEGSITES
ok 14 - Get LAST_READ_HAP_NUM
ok 15 - Get MBS_INFO_LINE
ok 16 - Get CURRENT_RUN_SEGSITES
ok 17 - Get NSITES
ok 18 - Get SELPOS
ok 19 - Get NFILES
ok 20 - Get next_hap at beginning of run
ok 21 - Get next_hap after beginning of run
ok 22 - Get next_pop after beginning of pop
ok 23 - Get next_hap
ok 24 - Get next_hap
ok 25 - Get next_run after beginning of run
ok 26 - Get next_run at beginning of run
ok 27 - Get next_run at beginning of run
ok 28 - have all lines been read?
ok 29 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout'
ok 30 - Get POP_RECOMB_PARAM_PER_SITE
ok 31 - Get NREPS
ok 32 - Get NEXT_RUN_NUM
ok 33 - Get TRAJ_FILENAME
ok 34 - Get RUNS
ok 35 - Get TOT_RUN_HAPS
ok 36 - Get SELPOS
ok 37 - Get NSITES
ok 38 - Get CURRENT_RUN_SEGSITES
ok 39 - Get MBS_INFO_LINE
ok 40 - Get LAST_READ_HAP_NUM
ok 41 - Get POP_MUT_PARAM_PER_SITE
ok 42 - Get SEGSITES
ok 43 - Get POSITIONS
ok 44 - Get NFILES
ok 45 - Get next_hap at beginning of run
ok 46 - Get next_hap after beginning of run
ok 47 - Testing mbsout::outgroup
ok 48 - Get next_run after beginning of run
ok 49 - Get next_run after beginning of run
ok 50 - Get next_run at beginning of run
ok 51 - Get next_hap at beginning of run 2
ok 52 - Get next_run after hap
ok 53 - next run should be 5.
ok 54 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout'
ok 55 - Get NREPS
ok 56 - Get NEXT_RUN_NUM
ok 57 - Get POP_RECOMB_PARAM_PER_SITE
ok 58 - Get TRAJ_FILENAME
ok 59 - Get RUNS
ok 60 - Get TOT_RUN_HAPS
ok 61 - Get MBS_INFO_LINE
ok 62 - Get CURRENT_RUN_SEGSITES
ok 63 - Get NSITES
ok 64 - Get SELPOS
ok 65 - Get POP_MUT_PARAM_PER_SITE
ok 66 - Get POSITIONS
ok 67 - Get SEGSITES
ok 68 - Get LAST_READ_HAP_NUM
ok 69 - Get NFILES
ok 70 - Get next_run at end/beginning of run
ok 71 - have all lines been read?
ok 72 - Get next_run at eof
ok 73 - Get next_hap at eof
ok 74 - Get next_seq at eof
ok
t/SeqIO/metafasta.t ................. 
1..6
ok 1 - use Bio::SeqIO::metafasta;
ok 2 - An object of class 'Bio::SeqIO::metafasta' isa 'Bio::SeqIO'
ok 3
ok 4 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta'
ok 5
ok 6
ok
t/SeqIO/msout.t ..................... 
1..165
ok 1 - use Bio::SeqIO::msout;
ok 2 - Bio::SeqIO::msout is at least api version 1.1.5
ok 3 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 4 - Get SEGSITES
ok 5 - Get N_SITES
ok 6 - Get POSITIONS
ok 7 - Get NEXT_RUN_NUM
ok 8 - Get TOT_RUN_HAPS
ok 9 - Get MS_INFO_LINE
ok 10 - Get CURRENT_RUN_SEGSITES
ok 11 - Get POPS
ok 12 - Get RUNS
ok 13 - Get LAST_READ_HAP_NUM
ok 14 - Get SEEDS
ok 15 - Get next_hap at beginning of run
ok 16 - Get next_hap after beginning of run
ok 17 - Testing msout::outgroup
ok 18 - Get next_pop after beginning of pop
ok 19 - Get next_pop at beginning of pop
ok 20 - Get next_run after beginning of run
ok 21 - Get next_pop at beginning of run
ok 22 - Get next_hap after pop
ok 23 - Get next_run after pop and hap
ok 24 - Get next_run at beginning of run
ok 25 - have all lines been read?
ok 26 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 27 - Get LAST_READ_HAP_NUM
ok 28 - Get POPS
ok 29 - Get RUNS
ok 30 - Get SEEDS
ok 31 - Get POSITIONS
ok 32 - Get TOT_RUN_HAPS
ok 33 - Get NEXT_RUN_NUM
ok 34 - Get SEGSITES
ok 35 - Get N_SITES
ok 36 - Get CURRENT_RUN_SEGSITES
ok 37 - Get MS_INFO_LINE
ok 38 - Get next_hap at beginning of run
ok 39 - Get next_hap after beginning of run
ok 40 - Testing msout::outgroup
ok 41 - Get next_pop after beginning of pop
ok 42 - Get next_pop at beginning of pop/run
ok 43 - Get next_run at beginning of run
ok 44 - Get next_hap at beginning of run 2
ok 45 - Get next_run after hap
ok 46 - next run should be 5.
ok 47 - Get last hap through next_hap
ok 48 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 49 - Get MS_INFO_LINE
ok 50 - Get CURRENT_RUN_SEGSITES
ok 51 - Get SEEDS
ok 52 - Get POSITIONS
ok 53 - Get LAST_READ_HAP_NUM
ok 54 - Get TOT_RUN_HAPS
ok 55 - Get NEXT_RUN_NUM
ok 56 - Get SEGSITES
ok 57 - Get RUNS
ok 58 - Get POPS
ok 59 - Get next_pop at end of run
ok 60 - have all lines been read?
ok 61 - Get next_pop at eof
ok 62 - Get next_run at eof
ok 63 - Get next_hap at eof
ok 64 - Get next_seq at eof
ok 65 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 66 - Get LAST_READ_HAP_NUM
ok 67 - Get POPS
ok 68 - Get RUNS
ok 69 - Get SEEDS
ok 70 - Get TOT_RUN_HAPS
ok 71 - Get NEXT_RUN_NUM
ok 72 - Get POSITIONS
ok 73 - Get N_SITES
ok 74 - Get SEGSITES
ok 75 - Get CURRENT_RUN_SEGSITES
ok 76 - Get MS_INFO_LINE
ok 77 - Get next_hap at beginning of run
ok 78 - Get next_hap after beginning of run
ok 79 - Testing msout::outgroup
ok 80 - Get next_pop after beginning of pop
ok 81 - Get next_pop at beginning of pop
ok 82 - Get next_run after beginning of run
ok 83 - Get next_pop at beginning of run
ok 84 - Get next_hap after pop
ok 85 - Get next_run after pop and hap
ok 86 - Get next_run at beginning of run
ok 87 - have all lines been read?
ok 88 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 89 - Caught error in bad msout file 1
ok 90 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 91 - Caught error in bad msout file 2
ok 92 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 93 - Get LAST_READ_HAP_NUM
ok 94 - Get POPS
ok 95 - Get RUNS
ok 96 - Get SEEDS
ok 97 - Get NEXT_RUN_NUM
ok 98 - Get TOT_RUN_HAPS
ok 99 - Get POSITIONS
ok 100 - Get N_SITES
ok 101 - Get SEGSITES
ok 102 - Get MS_INFO_LINE
ok 103 - Get CURRENT_RUN_SEGSITES
ok 104 - Get next_hap at beginning of run
ok 105 - Get next_hap after beginning of run
ok 106 - Testing msout::outgroup
ok 107 - Get next_pop after beginning of pop
ok 108 - Get next_pop at beginning of pop
ok 109 - Get next_run after beginning of run
ok 110 - Get next_pop at beginning of run
ok 111 - Get next_hap after pop
ok 112 - Get next_run after pop and hap
ok 113 - Get next_run at beginning of run
ok 114 - have all lines been read?
ok 115 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 116 - Get SEEDS
ok 117 - Get LAST_READ_HAP_NUM
ok 118 - Get POPS
ok 119 - Get RUNS
ok 120 - Get MS_INFO_LINE
ok 121 - Get CURRENT_RUN_SEGSITES
ok 122 - Get TOT_RUN_HAPS
ok 123 - Get NEXT_RUN_NUM
ok 124 - Get POSITIONS
ok 125 - Get N_SITES
ok 126 - Get SEGSITES
ok 127 - Get next_hap at beginning of run
ok 128 - Get next_hap after beginning of run
ok 129 - Testing msout::outgroup
ok 130 - Get next_pop after beginning of pop
ok 131 - Get next_pop at beginning of pop/run
ok 132 - Get next_run at beginning of run
ok 133 - Get next_hap at beginning of run 2
ok 134 - Get next_run after hap
ok 135 - next run should be 5.
ok 136 - Get last hap through next_hap
ok 137 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 138 - Get NEXT_RUN_NUM
ok 139 - Get TOT_RUN_HAPS
ok 140 - Get POSITIONS
ok 141 - Get N_SITES
ok 142 - Get SEGSITES
ok 143 - Get MS_INFO_LINE
ok 144 - Get CURRENT_RUN_SEGSITES
ok 145 - Get LAST_READ_HAP_NUM
ok 146 - Get POPS
ok 147 - Get RUNS
ok 148 - Get SEEDS
ok 149 - Get next_hap at beginning of run
ok 150 - Get next_hap after beginning of run
ok 151 - Testing msout::outgroup
ok 152 - Get next_pop after beginning of pop
ok 153 - Get next_pop at beginning of pop
ok 154 - Get next_run after beginning of run
ok 155 - Get next_pop at beginning of run
ok 156 - Get next_hap after pop
ok 157 - Get next_run after pop and hap
ok 158 - Get next_run at beginning of run
ok 159 - have all lines been read?
ok 160 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 161 - Caught error in bad msout file 1
ok 162 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout'
ok 163 - Caught error in bad msout file 2
ok 164 - threw Regexp ((?^:first argument needs to be a positive integer. argument supplied: -1))
ok 165 - too few n_sites failed OK
ok
t/SeqIO/MultiFile.t ................. 
1..5
ok 1 - use Bio::SeqIO::MultiFile;
ok 2
ok 3
ok 4
ok 5
ok
t/SeqIO/Multiple_fasta.t ............ 
1..9
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - all sequences in the file
ok
t/SeqIO/phd.t ....................... 
1..21
ok 1 - use Bio::SeqIO::phd;
ok 2 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd'
ok 3 - Did you get the 'QUALITY_LEVELS' comment?
ok 4 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 5 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd'
ok 6
ok 7 - $seq->subseq()
ok 8 - $seq->subqual_tex()
ok 9 - $seq->subqual_tex()
ok 10 - $phd->chromat_file()
ok 11 - $phd->chromat_file()
ok 12
ok 13 - $seq->subseq()
ok 14 - $seq->subqual_tex()
ok 15 - $seq->subqual_tex()
ok 16
ok 17 - $seq->subseq()
ok 18 - $seq->subqual_tex()
ok 19 - $seq->subqual_tex()
ok 20 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd'
ok 21
ok
t/SeqIO/pir.t ....................... 
1..12
ok 1 - use Bio::SeqIO::pir;
ok 2 - new instance is defined 
ok 3 - An object of class 'Bio::SeqIO::pir' isa 'Bio::SeqIO'
ok 4 - checked length
ok 5 - checked length
ok 6 - checked length
ok 7 - checked length
ok 8 - checked length
ok 9 - checked length
ok 10 - Correct start
ok 11 - Correct start
ok 12 - Correct start
ok
t/SeqIO/qual.t ...................... 
1..18
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::PrimaryQual;
ok 3
ok 4 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 5
ok 6 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 7 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 8 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 9 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 10 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 11 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 12 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/SeqIO/raw.t ....................... 
1..25
ok 1 - use Bio::SeqIO::raw;
ok 2 - An object of class 'Bio::SeqIO::raw' isa 'Bio::SeqIO'
ok 3
ok 4 - Bio::SeqIO::raw->can('next_seq')
ok 5 - Bio::SeqIO::raw->can('write_seq')
ok 6 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 7 - sequence
ok 8 - length
ok 9 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 10 - sequence
ok 11 - length
ok 12 - use Algorithm::Diff;
ok 13 - raw format can round-trip
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok
t/SeqIO/scf.t ....................... 
1..80
ok 1 - use Bio::SeqIO::scf;
ok 2 - use Bio::Seq::SequenceTrace;
ok 3
ok 4 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 14 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality'
ok 15 - alphabet
ok 16 - display_id
ok 17 - primary_id is the stringified memory position
ok 18 - set primary_id
ok 19 - accession_number
ok 20 - desc
ok 21 - desc
ok 22 - id
ok 23 - id
ok 24 - seq
ok 25 - subseq
ok 26 - baseat
ok 27 - qualat
ok 28 - trace_value_at
not ok 29 - accuracies # TODO documentation and code for accuracies() do not match
#   Failed (TODO) test 'accuracies'
#   at t/SeqIO/scf.t line 77.
#          got: 'ARRAY(0x56385e9e4d38)'
#     expected: '482'
ok 30
ok 31 - sub_peak_index
ok 32 - peak_index_at
ok 33
ok 34
ok 35 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 36 - accuracy_at
ok 37 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 38
ok 39
ok 40
ok 41 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 42
ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 44
ok 45
ok 46 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 55 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 56
ok 57
ok 58
ok 59
ok 60 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 61
ok 62 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 63 - qual scores match
ok 64 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 65
ok 66 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
not ok 67 - display_id matches # TODO display_id doesn't round trip yet
#   Failed (TODO) test 'display_id matches'
#   at t/SeqIO/scf.t line 284.
#          got: 'ML4942R'
#     expected: undef
ok 68 - qual scores match
ok 69 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 70
ok 71 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
not ok 72 - display_id matches # TODO display_id doesn't round trip yet
#   Failed (TODO) test 'display_id matches'
#   at t/SeqIO/scf.t line 284.
#          got: 'IIABP1D4373'
#     expected: undef
ok 73 - qual scores match
ok 74 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
ok 75
ok 76 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace'
not ok 77 - display_id matches # TODO display_id doesn't round trip yet
#   Failed (TODO) test 'display_id matches'
#   at t/SeqIO/scf.t line 284.
#          got: 'IIABP1D4373'
#     expected: undef
ok 78 - qual scores match
ok 79 - Bio::Sequence::Quality matches
ok 80 - Bio::Sequence::Quality matches
ok
t/SeqIO/SeqBuilder.t ................ 
1..137
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41 - An object of class 'Bio::Seq::SeqBuilder' isa 'Bio::Factory::ObjectBuilderI'
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok
t/SeqIO/SeqIO.t ..................... 
1..58
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4 - ID for format gcg
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - ID for format fasta
ok 11
ok 12
ok 13
ok 14 - accession.version
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23 - ID for format pir
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30 - ID for format tab
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - ID for format ace
ok 38
ok 39
ok 40
ok 41
ok 42 - use Algorithm::Diff;
ok 43 - use IO::ScalarArray;
ok 44 - use IO::String;
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
not ok 55 - Must pass a file or file handle # TODO file/fh-based tests should be in Bio::Root::IO, see issue #3204
#   Failed (TODO) test 'Must pass a file or file handle'
#   at t/SeqIO/SeqIO.t line 158.
# expecting: Regexp ((?^:No file, fh, or string argument provided))
# found: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: Could not guess format from file, filehandle or string
# STACK: Error::throw
# STACK: Bio::Root::Root::throw /<<PKGBUILDDIR>>/blib/lib/Bio/Root/Root.pm:449
# STACK: Bio::SeqIO::new /<<PKGBUILDDIR>>/blib/lib/Bio/SeqIO.pm:420
# STACK: Test::Exception::throws_ok t/SeqIO/SeqIO.t:157
# STACK: t/SeqIO/SeqIO.t:158
# -----------------------------------------------------------
# )
ok 56 - Must pass a file or file handle
ok 57 - Must pass a file or file handle
ok 58 - Must pass a real file
ok
t/SeqIO/seqxml.t .................... 
1..61
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::PrimarySeq;
ok 3 - use Bio::SeqIO::seqxml;
ok 4 - stream ok
ok 5 - seqXML version
ok 6 - source
ok 7 - source version
ok 8 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 9 - display id
ok 10 - primary id
ok 11 - description
ok 12 - sequence
ok 13 - length
ok 14 - entry source
ok 15 - 'species' isa 'Bio::Species'
ok 16 - species name
ok 17 - NCBI tax id
ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::Annotation::DBLink'
ok 19 - dblink source
ok 20 - dblink ID
ok 21 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 22 - boolean property
ok 23 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 24 - property with value
ok 25 - writer ok
ok 26 - outfile is created
ok 27 - seqXML version
ok 28 - source
ok 29 - source version
ok 30 - schemaLocation
ok 31 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 32 - display id
ok 33 - primary id
ok 34 - description
ok 35 - sequence
ok 36 - length
ok 37 - entry source
ok 38 - 'species' isa 'Bio::Species'
ok 39 - species name
ok 40 - NCBI tax id
ok 41 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::Annotation::DBLink'
ok 42 - dblink source
ok 43 - dblink ID
ok 44 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 45 - boolean property
ok 46 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 47 - property with value
ok 48 - outfile is created
ok 49 - seqXML version
ok 50 - source
ok 51 - source version
ok 52 - display id
ok 53 - primary id
ok 54 - description
ok 55 - sequence
ok 56 - length
ok 57 - display id
ok 58 - primary id
ok 59 - description
ok 60 - sequence
ok 61 - length
ok
t/SeqIO/Splicedseq.t ................ 
1..27
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13 - get_SeqFeatures()
ok 14 - protein sequence
ok 15 - nucleotide sequence - correct CDS range
ok 16 - nucleotide length
ok 17 - appropriate warning if db not provided for remote sequence
ok 18 - correct number of Ns added if remote sequence not provided
ok 19 - cut by origin sequence using $feat->seq
ok 20 - cut by origin sequence using $feat->spliced_seq
ok 21 - cut by origin start using $feat->start
ok 22 - cut by origin end using $feat->end
ok 23 - cut by origin start using $feat->location->start
ok 24 - cut by origin end using $feat->location->end
ok 25 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 26 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok 27 # skip The optional module Bio::DB::GenBank (or dependencies thereof) was not installed
ok
t/SeqIO/swiss.t ..................... 
1..247
ok 1 - use Bio::SeqIO::swiss;
ok 2 - An object of class 'Bio::SeqIO::swiss' isa 'Bio::SeqIO'
ok 3 - An object of class 'Bio::Species' isa 'Bio::Species'
ok 4
ok 5
ok 6 - operator overloading in AnnotationI is deprecated
ok 7 - dates
ok 8 - dates
ok 9 - dates
ok 10
ok 11 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 12
ok 13
ok 14
ok 15 - operator overloading in AnnotationI is deprecated
ok 16
ok 17
ok 18
ok 19
ok 20 - id is ROA1_HUMAN
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28 - operator overloading in AnnotationI is deprecated
ok 29
ok 30
ok 31
ok 32
ok 33 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43 - operator overloading in AnnotationI is deprecated
ok 44
ok 45
ok 46
ok 47 - GC1QBP
ok 48 - HABP1
ok 49 - SF2P32
ok 50 - C1QBP
ok 51
ok 52 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - F54H12.1
ok 60 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 73
ok 74
ok 75
ok 76
ok 77 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI'
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - An object of class 'Bio::Species' isa 'Bio::Species'
ok 176
ok 177
ok 178 - operator overloading in AnnotationI is deprecated
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207 - An object of class 'Bio::Species' isa 'Bio::Species'
ok 208
ok 209
ok 210 - operator overloading in AnnotationI is deprecated
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241 - Converting to fasta seqids match
ok 242 - Converting to fasta sequences match
ok 243 - Can parse generated swiss
ok 244 - Roundtrip, seqids match
ok 245 - Roundtrip, sequences match
ok 246
ok 247
ok
t/SeqIO/tab.t ....................... 
1..8
ok 1 - use Bio::SeqIO::tab;
ok 2 - An object of class 'Bio::SeqIO::tab' isa 'Bio::SeqIO'
ok 3 - seq is defined
ok 4 - check seq length
ok 5 - check matching
ok 6 - seq is defined
ok 7 - check seq length
ok 8 - check matching
ok
t/SeqIO/table.t ..................... 
1..351
ok 1 - use Bio::Tools::CodonTable;
ok 2 - use Bio::SeqIO::table;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok
t/SeqIO/tigr.t ...................... 
1..8
ok 1 - use Bio::SeqIO::tigr;
not ok 2 # TODO & SKIP No tests for tigr format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for tigr format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for tigr format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for tigr format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for tigr format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for tigr format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for tigr format -- no sample file to test against
ok
t/SeqIO/tigrxml.t ................... 
1..49
ok 1 - use Bio::SeqIO::tigrxml;
ok 2 - An object of class 'Bio::SeqIO::tigrxml' isa 'Bio::SeqIO'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok
t/SeqIO/tinyseq.t ................... 
1..16
ok 1 - use Bio::SeqIO::tinyseq;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/SeqTools/Backtranslate.t .......... 
1..8
ok 1 - use Bio::Tools::SeqPattern::Backtranslate;
ok 2 - Bio::Tools::SeqPattern::Backtranslate->can('_reverse_translate_motif')
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8 - threw Regexp ((?^:syntax token))
ok
t/SeqTools/CodonTable.t ............. 
1..84
ok 1 - use Bio::Tools::CodonTable;
ok 2 - use Bio::CodonUsage::IO;
ok 3
ok 4 - An object of class 'Bio::Tools::CodonTable' isa 'Bio::Tools::CodonTable'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - is_start_codon, ATG
ok 35 - is_start_codon, GGH
ok 36 - is_start_codon, HTG
ok 37 - is_start_codon, CCC
ok 38 - is_ter_codon, U should map to T, UAG
ok 39 - is_ter_codon,TaG
ok 40 - is_ter_codon,TaR
ok 41 - is_ter_codon,tRa
ok 42 - is_ter_codon,ttA
ok 43 - is_ter_codon, ambiguous codons should fail, NNN
ok 44 - is_ter_codon, ambiguous codons should fail, TAN
ok 45 - is_ter_codon, incomplete codons should fail, CC
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok
t/SeqTools/ECnumber.t ............... 
1..27
ok 1 - use Bio::Tools::ECnumber;
ok 2 - An object of class 'Bio::Tools::ECnumber' isa 'Bio::Tools::ECnumber'
ok 3 - An object of class 'Bio::Tools::ECnumber' isa 'Bio::Tools::ECnumber'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/SeqTools/GuessSeqFormat.t ......... 
1..105
ok 1 - use Bio::Tools::GuessSeqFormat;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::AlignIO;
ok 4
ok 5 - An object of class 'Bio::Tools::GuessSeqFormat' isa 'Bio::Tools::GuessSeqFormat'
ok 6 - File input
ok 7
ok 8 - String input
ok 9
ok 10 - Filehandle input
ok 11
ok 12 - Unknown file format
ok 13 - threw Regexp ((?^:Could not guess format))
ok 14 - ace format
ok 15
ok 16
ok 17 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 18 - embl format
ok 19
ok 20
ok 21 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 22 - fasta format
ok 23
ok 24
ok 25 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 26 - fastq format
ok 27
ok 28
ok 29 - An object of class 'Bio::Seq::Quality' isa 'Bio::PrimarySeqI'
ok 30 - game format
ok 31
ok 32
ok 33 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 34 - gcg format
ok 35
ok 36
ok 37 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 38 - genbank format
ok 39
ok 40
ok 41 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 42 - pir format
ok 43
ok 44
ok 45 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 46 - raw format
ok 47
ok 48
ok 49 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 50 - swiss format
ok 51
ok 52
ok 53 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 54 - tab format
ok 55
ok 56
ok 57 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 58 # skip The optional module Bio::AlignIO::stockholm (or dependencies thereof) was not installed
ok 59 # skip The optional module Bio::AlignIO::stockholm (or dependencies thereof) was not installed
ok 60 # skip The optional module Bio::AlignIO::stockholm (or dependencies thereof) was not installed
ok 61 # skip The optional module Bio::AlignIO::stockholm (or dependencies thereof) was not installed
ok 62 - clustalw format
ok 63
ok 64
ok 65 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 66 - fasta format
ok 67
ok 68
ok 69 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 70 - fastq format
ok 71 - mase format
ok 72
ok 73
ok 74 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 75 - mega format
ok 76
ok 77
ok 78 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 79 - msf format
ok 80
ok 81
ok 82 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 83 - nexus format
ok 84
ok 85
ok 86 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 87 - pfam format
ok 88
ok 89
ok 90 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 91 - phylip format
ok 92
ok 93
ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 95 - prodom format
ok 96
ok 97
ok 98 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 99 - selex format
ok 100
ok 101
ok 102 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 103 - vcf format
ok 104 - gcgblast format
ok 105 - blast format
ok
t/SeqTools/OddCodes.t ............... 
1..11
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Tools::OddCodes;
ok 3 - An object of class 'Bio::Tools::OddCodes' isa 'Bio::Tools::OddCodes'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok
t/SeqTools/SeqPattern.t ............. 
1..28
ok 1 - use Bio::Tools::SeqPattern;
ok 2
ok 3 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 8
ok 9
ok 10 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 11
ok 12 - threw Regexp ((?^:revcom for .+ sequence types))
ok 13 - threw Regexp ((?^:backtranslate for .+ sequence types))
ok 14 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 15 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 16
ok 17 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 18 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 19
ok 20 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 21 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 22
ok 23 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 24 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 25
ok 26 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 27 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern'
ok 28
ok
t/SeqTools/SeqStats.t ............... 
1..47
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Tools::SeqStats;
ok 3 - new Bio::Root::IO object
ok 4 - new Bio::Tools:SeqStats object
ok 5 - count_monomers()
ok 6 - count_codons()
ok 7 - get_mol_wt()
ok 8
ok 9 - An object of class 'Bio::Tools::SeqStats' isa 'Bio::Tools::SeqStats'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok
t/SeqTools/SeqUtils.t ............... 
1..133
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::SeqUtils;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Annotation::SimpleValue;
ok 5 - use Bio::Annotation::Collection;
ok 6 - use Bio::Annotation::Comment;
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed
ok 25 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed
ok 26 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed
ok 27 # skip The optional module Bio::LiveSeq::Mutation (or dependencies thereof) was not installed
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36 - cat - has expected tags
ok 37 - cat - has expected tag values
ok 38 - cat - note tag transfered (no throw)
ok 39 - cat - note tag values transfered (correct count)
ok 40 - get correct start of feature before 'cat'
ok 41 - get correct start of feature after 'cat'
ok 42 - different alphabets
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48 - trunc_with_features - has expected tags
ok 49 - trunc_with_features - has expected tag values
ok 50
ok 51 - primary_tag matches original feature...
ok 52 - but tagged sf is now revcom
ok 53 - primary_tag matches original feature...
ok 54 - but tagged sf is now revcom
ok 55 - primary_tag matches original feature...
ok 56 - but tagged sf is now revcom
ok 57 - revcom_with_features - has expected tags
ok 58 - revcom_with_features - has expected tag values
ok 59 - still not circular
ok 60 - still circular
ok 61 - No error thrown when deleting a segment of the sequence
ok 62 - annotation of whole sequence has been moved to new molecule
ok 63 - the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'
ok 64 - The composite feature is still present
ok 65 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 66 - 'a composite feature that spanned the deletion site has been split up, Location' isa 'Bio::Location::Split'
ok 67 - one of the sub-eatures of the composite feature has been deleted completely
ok 68 - sub-feature 1 of the composite feature is still present
ok 69 - the original end of sf1 is 12
ok 70 - after deletion, the end of sf1 is 1nt before the deletion site
ok 71 - the original end location of sf1 EXACT
ok 72 - annotation of subeature 1 has been moved to new molecule
ok 73 - feature1 is till present
ok 74 - 'feature1 location has now been split by the deletion and location object' isa 'Bio::Location::Split'
ok 75 - feature1 has two locations after the deletion
ok 76 - feature1 start is unaffected by the deletion
ok 77 - feature1 end of first split is 1nt before deletion site
ok 78 - feature1 start of second split is 1nt after deletion site
ok 79 - feature1 end of second split has been adjusted correctly
ok 80 - split feature now has a note
ok 81 - got the expected note about length and position of deletion
ok 82 - feature3 is till present
ok 83 - a feature downstream of the deletion site is shifted entirely by 10nt to the left
ok 84 - feature4 is till present
ok 85 - a feature upstream of the deletion site is not repositioned by the deletion
ok 86 - feature2 is till present
ok 87 - start pos of a feature that started in the deletion site has been altered accordingly
ok 88 - feature 2 now has a note
ok 89 - note added to feature2 about deletion at 3' end
ok 90 - a feature that was completely positioned inside the deletion site is not present on the new molecule
ok 91 - feature6 is till present
ok 92 - start pos of a feature that started in the deletion site has been altered accordingly
ok 93 - end pos of a feature that started in the deletion site has been altered accordingly
ok 94 - No error thrown when inserting a fragment into recipient sequence
ok 95 - annotation of whole sequence has been moved to new molecule
ok 96 - The composite feature is still present
ok 97 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 98 - 'a composite feature that spanned the insertion site has been split up, Location' isa 'Bio::Location::Split'
ok 99 - all of the parts of the composite feature are still present
ok 100 - sub-feature 1 of the composite feature is still present
ok 101 - the original end of sf1 is 12
ok 102 - after insertion, the end of sf1 has been shifted by the length of the insertion
ok 103 - 'sub-feature 1 (spans insertion site) is now split up and' isa 'Bio::Location::Split'
ok 104 - the start and end position types of sub-feature1 have not changed
ok 105 - annotation of subeature 1 has been moved to new molecule
ok 106 - split feature now has a note
ok 107 - got the expected note about length and position of insertion
ok 108 - feature3 is till present
ok 109 - a feature downstream of the insertion site is shifted entirely to the left by the length of the insertion
ok 110 - feature4 is till present
ok 111 - a feature upstream of the insertion site is not repositioned
ok 112 - a feature on the inserted fragment is present on the product molecule
ok 113 - position of the feature on the insert has been adjusted to product coordinates
ok 114 - strand of the feature on insert has not changed
ok 115 - desctription of the product contains description of the fragment
ok 116 - desctription of the product contains description of the recipient
ok 117 - the product has an additional 'misc_feature' with note='inserted fragment'
ok 118 - No error thrown using 'ligate' of fragment into recipient
ok 119 - product has the expected length
ok 120 - the sequence of the fragment is inserted into the product
ok 121 - we have a feature annotating the ligated fragment
ok 122 - coordinates of the feature annotating the ligated feature are correct
ok 123 - the fragment feature1 is now a feature of the product
ok 124 - start and end of a feature on the fragment are correct after insertion with "flip" option
ok 125 - Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error
ok 126 - Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new'
ok 127 - An object of class 'Bio::Seq::Foo' isa 'Bio::Seq::Foo'
ok 128 - the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'
ok 129 - The composite feature is still present
ok 130 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 131 - 'a composite feature that spanned the deletion site has been split up, Location' isa 'Bio::Location::Split'
ok 132 - 'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new
ok 133 - 'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new
ok
t/SeqTools/SeqWords.t ............... 
1..22
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Tools::SeqWords;
ok 3 - new Bio::Root::IO object
ok 4 - new Bio::Tools::SeqWords object
ok 5 - count_words
ok 6
ok 7 - An object of class 'Bio::Tools::SeqWords' isa 'Bio::Tools::SeqWords'
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - An object of class 'Bio::Tools::SeqWords' isa 'Bio::Tools::SeqWords'
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok
t/Species.t ......................... 
1..27
ok 1 - use Bio::Species;
ok 2 - use Bio::DB::Taxonomy;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 18 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 19 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 20 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 21 # skip The optional module Bio::DB::Taxonomy::entrez (or dependencies thereof) was not installed
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
Attempt to call undefined import method with arguments ("dumpValue") via package "Dumpvalue" (Perhaps you forgot to load the package?) at /<<PKGBUILDDIR>>/blib/lib/Bio/Tools/Alignment/Consed.pm line 114.
t/Tools/Alignment/Consed.t .......... 
1..15
ok 1 - use Bio::Tools::Alignment::Consed;
ok 2 - new CSM::Consed object was created
ok 3 - An object of class 'Bio::Tools::Alignment::Consed' isa 'Bio::Tools::Alignment::Consed'
ok 4 - singlets can be successfully set
ok 5 - singlets can be retrieved
ok 6 - doublets can be set
ok 7 - doublets can be retreived
ok 8 - doublets can be retrieved
ok 9 - pairs can be retrieved
ok 10 - multiplets can be retrieved
ok 11 - singletons can be retrieved
ok 12 - how many sequences there are in the acefile _and_ in the singlets file
ok 13 - statistics from the Bio::Tools::Alignment::Consed object to compare the total number of sequences accounted for there to the number of sequences found via grep
ok 14
ok 15
ok
t/Tools/AmpliconSearch.t ............ 
1..185
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::SeqFeature::Primer;
ok 3 - use Bio::Tools::AmpliconSearch;
ok 4 - Basic
ok 5 - An object of class 'Bio::Tools::AmpliconSearch' isa 'Bio::Tools::AmpliconSearch'
ok 6 - Forward primer only
ok 7
ok 8
ok 9
ok 10 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 11
ok 12
ok 13 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - Reverse primer only
ok 26
ok 27
ok 28
ok 29
ok 30 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38 - Two primers, no match
ok 39
ok 40
ok 41
ok 42
ok 43 - Two degenerate primers from a file
ok 44
ok 45
ok 46
ok 47
ok 48 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - RNA template
ok 55
ok 56
ok 57
ok 58
ok 59 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65 - Forward primer from file
ok 66
ok 67
ok 68
ok 69
ok 70 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 71
ok 72
ok 73 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79 - Multiple amplicons
ok 80
ok 81 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93 - Amplicon on reverse strand
ok 94
ok 95 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107 - Overlapping amplicons (1)
ok 108
ok 109 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115 - Overlapping amplicons (2)
ok 116
ok 117 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123 - Overlapping amplicons (3)
ok 124
ok 125 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131 - Amplicons on both strands
ok 132
ok 133 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145 - Overlapping amplicons on both strands
ok 146
ok 147 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153 - Annotated template
ok 154
ok 155 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 156 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 157 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 158
ok 159
ok 160 - Update primers
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - Update template
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok
t/Tools/EMBOSS/Palindrome.t ......... 
1..13
ok 1 - use Bio::Tools::EMBOSS::Palindrome;
ok 2 - use Bio::Tools::GFF;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok
t/Tools/ePCR.t ...................... 
1..27
ok 1 - use Bio::Tools::EPCR;
ok 2 - use Bio::SeqIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26 - got 3 forward strand ePCR hits
ok 27 - got 3 reverse strand ePCR hits
ok
t/Tools/Est2Genome.t ................ 
1..61
ok 1 - use Bio::Tools::Est2Genome;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok
t/Tools/FootPrinter.t ............... 
1..27
ok 1 - use Bio::Tools::FootPrinter;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/Tools/Geneid.t .................... 
1..26
ok 1 - use Bio::Tools::Geneid;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok
t/Tools/Genewise.t .................. 
1..33
ok 1 - use Bio::Tools::Genewise;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok
t/Tools/Genomewise.t ................ 
1..21
ok 1 - use Bio::Tools::Genomewise;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok
t/Tools/Genpred.t ................... 
1..185
ok 1 - use Bio::Tools::Fgenesh;
ok 2 - use Bio::Tools::Genscan;
ok 3 - use Bio::Tools::Genemark;
ok 4 - use Bio::Tools::Glimmer;
ok 5 - use Bio::Tools::MZEF;
ok 6 - use Bio::SeqIO;
ok 7
ok 8
ok 9
ok 10 - strand match (-1  and -1)
ok 11 - score match (1.05 and 1.05)
ok 12
ok 13 - predicted and extracted protein seqs match
ok 14 - strand match (1 and 1)
ok 15 - score match (4.46 and 4.46)
ok 16
ok 17 - predicted and extracted protein seqs match
ok 18 - initial exons 0
ok 19 - score match 1.74
ok 20
ok 21 - predicted and extracted protein seqs match
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - Genemark tests
ok 43
ok 44
ok 45
ok 46 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy'
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy'
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy'
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy'
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok
t/Tools/GFF.t ....................... 
1..34
ok 1 - use Bio::Tools::GFF;
ok 2 - use Bio::SeqFeature::Generic;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok
t/Tools/IUPAC.t ..................... 
1..46
ok 1 - use Bio::Tools::IUPAC;
ok 2 - use Bio::Seq;
ok 3 - use Bio::PrimarySeq;
ok 4
ok 5
ok 6 - Regexp
ok 7
ok 8 - Regexp
ok 9 - Count
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - Regexp matches ambiguous sequences
ok 28
ok 29 - Nucleic IUPAC
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36 - Proteic IUPAC
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok
t/Tools/Lucy.t ...................... 
1..22
ok 1 - use Bio::Tools::Lucy;
ok 2 - An object of class 'Bio::Tools::Lucy' isa 'Bio::Tools::Lucy'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok
t/Tools/Match.t ..................... 
1..38
ok 1 - use Bio::Tools::Match;
ok 2
ok 3 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 4 - correct source
ok 5 - feature start correct
ok 6 - feature end correct
ok 7 - feature core score correct
ok 8 - feature matrix score correct
ok 9 - feature matrix id correct
ok 10 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 11 - correct source
ok 12 - feature start correct
ok 13 - feature end correct
ok 14 - feature core score correct
ok 15 - feature matrix score correct
ok 16 - feature matrix id correct
ok 17 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 18 - correct source
ok 19 - feature start correct
ok 20 - feature end correct
ok 21 - feature core score correct
ok 22 - feature matrix score correct
ok 23 - feature matrix id correct
ok 24 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 25 - correct source
ok 26 - feature start correct
ok 27 - feature end correct
ok 28 - feature core score correct
ok 29 - feature matrix score correct
ok 30 - feature matrix id correct
ok 31 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 32 - correct source
ok 33 - feature start correct
ok 34 - feature end correct
ok 35 - feature core score correct
ok 36 - feature matrix score correct
ok 37 - feature matrix id correct
ok 38 - correct number of results managed to get tested
ok
t/Tools/Phylo/Gerp.t ................ 
1..33
ok 1 - use Bio::Tools::Phylo::Gerp;
ok 2
ok 3 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 4 - correct source
ok 5 - feature start correct
ok 6 - feature end correct
ok 7 - feature score correct
ok 8 - feature pvalue correct
ok 9 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 10 - correct source
ok 11 - feature start correct
ok 12 - feature end correct
ok 13 - feature score correct
ok 14 - feature pvalue correct
ok 15 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 16 - correct source
ok 17 - feature start correct
ok 18 - feature end correct
ok 19 - feature score correct
ok 20 - feature pvalue correct
ok 21 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 22 - correct source
ok 23 - feature start correct
ok 24 - feature end correct
ok 25 - feature score correct
ok 26 - feature pvalue correct
ok 27 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic'
ok 28 - correct source
ok 29 - feature start correct
ok 30 - feature end correct
ok 31 - feature score correct
ok 32 - feature pvalue correct
ok 33 - correct number of results parsed out
ok
t/Tools/Phylo/Molphy.t .............. 
1..18
ok 1 - use Bio::Tools::Phylo::Molphy;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/Tools/Phylo/Phylip/ProtDist.t ..... 
1..47
ok 1 - use Bio::Tools::Phylo::Phylip::ProtDist;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok
t/Tools/pICalculator.t .............. 
1..38
ok 1 - use Bio::Seq;
ok 2 - use Bio::Tools::pICalculator;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok
t/Tools/Primer3.t ................... 
1..14
ok 1 - use Bio::Tools::Primer3;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - An object of class 'Bio::Seq::PrimedSeq' isa 'Bio::Seq::PrimedSeq'
ok 11
ok 12
ok 13
ok 14 - bug 2862
ok
t/Tools/Promoterwise.t .............. 
1..7
ok 1 - use Bio::Tools::Promoterwise;
ok 2 - An object of class 'Bio::Tools::Promoterwise' isa 'Bio::Tools::Promoterwise'
ok 3
ok 4
ok 5
ok 6
ok 7
ok
t/Tools/PrositeScan.t ............... 
1..3
ok 1 - use Bio::Tools::PrositeScan;
ok 2 - use Bio::SeqFeature::FeaturePair;
# Subtest: Predictions
    ok 1 - Comparing parsed prediction input
    1..1
ok 3 - Predictions
ok
t/Tools/Pseudowise.t ................ 
1..21
ok 1 - use Bio::Tools::Pseudowise;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok
t/Tools/QRNA.t ...................... 
1..30
ok 1 - use Bio::Tools::QRNA;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok
t/Tools/RandDistFunctions.t ......... 
1..5
ok 1 - use Bio::Tools::RandomDistFunctions;
ok 2
ok 3
ok 4
ok 5
ok
t/Tools/RepeatMasker.t .............. 
1..28
ok 1 - use Bio::Tools::RepeatMasker;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok
t/Tools/Seg.t ....................... 
1..15
ok 1 - use Bio::Tools::Seg;
ok 2 - parser defined
ok 3
ok 4 - seq id for seq 0 identified
ok 5 - start for seq 0 identified
ok 6 - end for seq 0 identified
ok 7 - score for seq 0 identified
ok 8 - seq id for seq 1 identified
ok 9 - start for seq 1 identified
ok 10 - end for seq 1 identified
ok 11 - score for seq 1 identified
ok 12 - seq id for seq 2 identified
ok 13 - start for seq 2 identified
ok 14 - end for seq 2 identified
ok 15 - score for seq 2 identified
ok
t/Tools/Sigcleave.t ................. 
1..18
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Tools::Sigcleave;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - unable to get raw sigcleave results
ok 16
ok 17 - unable to get raw sigcleave results
ok 18
ok
t/Tools/Signalp.t ................... 
1..11
ok 1 - use Bio::Tools::Signalp;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok
t/Tools/Signalp/ExtendedSignalp.t ... 
1..185
ok 1 - use Bio::Tools::Signalp::ExtendedSignalp;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok
t/Tools/Sim4.t ...................... 
1..27
ok 1 - use Bio::Tools::Sim4::Results;
ok 2 - new Sim4 results instance
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - new Sim4 results instance
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/Tools/Spidey/Spidey.t ............. 
1..26
ok 1 - use Bio::Tools::Spidey::Results;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok
t/Tools/TandemRepeatsFinder.t ....... 
1..66
ok 1 - use Bio::Tools::TandemRepeatsFinder;
ok 2 - Parser created  successfully
ok 3 - empty results file correctly returns no results
ok 4 - Second parser created  successfully
ok 5 - seq_id for first result correctly parsed
ok 6 - start for first result correctly parsed
ok 7 - end for first result correctly parsed
ok 8 - source tag for first result correctly parsed
ok 9 - primary tag for first result correctly parsed
ok 10 - score for first result correctly parsed
ok 11 - sequence description correctly parsed.
ok 12 - correctly parsed all run parameters
ok 13 - correctly parsed period_size for first result
ok 14 - correctly parsed copy_number for first result
ok 15 - correctly parsed consensus_size for first result
ok 16 - correctly parsed percent_matches for first result
ok 17 - correctly parsed percent_indels for first result
ok 18 - correctly parsed percent_a for first result
ok 19 - correctly parsed percent_c for first result
ok 20 - correctly parsed percent_g for first result
ok 21 - correctly parsed percent_t for first result
ok 22 - correctly parsed entropy for first result
ok 23 - correctly parsed repeat_sequence for first result
ok 24 - correctly parsed consensus_sequence for first result
ok 25 - seq_id for second result correctly parsed
ok 26 - start for second result correctly parsed
ok 27 - end for second result correctly parsed
ok 28 - source tag for first result correctly parsed
ok 29 - primary tag for first result correctly parsed
ok 30 - score for first result correctly parsed
ok 31 - sequence description correctly parsed.
ok 32 - correctly reatained all run parameters for second feature
ok 33 - correctly parsed period_size for second result
ok 34 - correctly parsed copy_number for second result
ok 35 - correctly parsed consensus_size for second result
ok 36 - correctly parsed percent_matches for second result
ok 37 - correctly parsed percent_indels for second result
ok 38 - correctly parsed percent_a for second result
ok 39 - correctly parsed percent_c for second result
ok 40 - correctly parsed percent_g for second result
ok 41 - correctly parsed percent_t for second result
ok 42 - correctly parsed entropy for second result
ok 43 - correctly parsed repeat_sequence for second result
ok 44 - correctly parsed consensus_sequence for second result
ok 45 - seq_id for first result correctly parsed
ok 46 - start for first result correctly parsed
ok 47 - end for first result correctly parsed
ok 48 - source tag for first result correctly parsed
ok 49 - primary tag for first result correctly parsed
ok 50 - score for first result correctly parsed
ok 51 - sequence description correctly parsed.
ok 52 - correctly reatained all run parameters for third feature
ok 53 - correctly parsed period_size for third result
ok 54 - correctly parsed copy_number for third result
ok 55 - correctly parsed consensus_size for third result
ok 56 - correctly parsed percent_matches for third result
ok 57 - correctly parsed percent_indels for third result
ok 58 - correctly parsed percent_a for third result
ok 59 - correctly parsed percent_c for third result
ok 60 - correctly parsed percent_g for third result
ok 61 - correctly parsed percent_t for third result
ok 62 - correctly parsed entropy for third result
ok 63 - correctly parsed repeat_sequence for third result
ok 64 - correctly parsed consensus_sequence for third result
ok 65 - correctly return undef when no features are left
ok 66 - Correctly parsed seq_id even if description does not exist
ok
t/Tools/TargetP.t ................... 
1..124
ok 1 - use Bio::Tools::TargetP;
ok 2
ok 3
ok 4
ok 5 - good SeqID
ok 6 - good Seqlength
ok 7 - correct Mitochondrion cutoff
ok 8 - correct signalpPeptide cutoff
ok 9 - correct other cutoff
ok 10 - correct location
ok 11 - correct Reliability class score
ok 12 - No peptide signal length reported
ok 13 - good SeqID
ok 14 - good Seqlength
ok 15 - correct Mitochondrion cutoff
ok 16 - correct signalpPeptide cutoff
ok 17 - correct other cutoff
ok 18 - correct location
ok 19 - correct Reliability class score
ok 20 - correct peptide signal length
ok 21 - good SeqID
ok 22 - good Seqlength
ok 23 - correct Mitochondrion cutoff
ok 24 - correct signalpPeptide cutoff
ok 25 - correct other cutoff
ok 26 - correct location
ok 27 - correct Reliability class score
ok 28 - correct peptide signal length
ok 29 - good SeqID
ok 30 - good Seqlength
ok 31 - correct Mitochondrion cutoff
ok 32 - correct signalpPeptide cutoff
ok 33 - correct other cutoff
ok 34 - correct location
ok 35 - correct Reliability class score
ok 36 - No peptide signal length reported
ok 37 - good SeqID
ok 38 - good Seqlength
ok 39 - correct Mitochondrion cutoff
ok 40 - correct signalpPeptide cutoff
ok 41 - correct other cutoff
ok 42 - correct location
ok 43 - correct Reliability class score
ok 44 - No peptide signal length reported
ok 45 - good SeqID
ok 46 - good Seqlength
ok 47 - correct Mitochondrion cutoff
ok 48 - correct signalpPeptide cutoff
ok 49 - correct other cutoff
ok 50 - correct location
ok 51 - correct Reliability class score
ok 52 - No peptide signal length reported
ok 53 - good SeqID
ok 54 - good Seqlength
ok 55 - correct Mitochondrion cutoff
ok 56 - correct signalpPeptide cutoff
ok 57 - correct other cutoff
ok 58 - correct location
ok 59 - correct Reliability class score
ok 60 - No peptide signal length reported
ok 61 - good SeqID
ok 62 - good Seqlength
ok 63 - correct Mitochondrion cutoff
ok 64 - correct signalpPeptide cutoff
ok 65 - correct other cutoff
ok 66 - correct location
ok 67 - correct Reliability class score
ok 68 - correct peptide signal length
ok 69 - good SeqID
ok 70 - good Seqlength
ok 71 - correct Mitochondrion cutoff
ok 72 - correct signalpPeptide cutoff
ok 73 - correct other cutoff
ok 74 - correct location
ok 75 - correct Reliability class score
ok 76 - No peptide signal length reported
ok 77 - good SeqID
ok 78 - good Seqlength
ok 79 - correct Mitochondrion cutoff
ok 80 - correct signalpPeptide cutoff
ok 81 - correct other cutoff
ok 82 - correct location
ok 83 - correct Reliability class score
ok 84 - No peptide signal length reported
ok 85 - good SeqID
ok 86 - good Seqlength
ok 87 - correct Mitochondrion cutoff
ok 88 - correct signalpPeptide cutoff
ok 89 - correct other cutoff
ok 90 - correct location
ok 91 - correct Reliability class score
ok 92 - No peptide signal length reported
ok 93 - good SeqID
ok 94 - good Seqlength
ok 95 - correct Mitochondrion cutoff
ok 96 - correct signalpPeptide cutoff
ok 97 - correct other cutoff
ok 98 - correct location
ok 99 - correct Reliability class score
ok 100 - No peptide signal length reported
ok 101 - good SeqID
ok 102 - good Seqlength
ok 103 - correct Mitochondrion cutoff
ok 104 - correct signalpPeptide cutoff
ok 105 - correct other cutoff
ok 106 - correct location
ok 107 - correct Reliability class score
ok 108 - correct peptide signal length
ok 109 - good SeqID
ok 110 - good Seqlength
ok 111 - correct Mitochondrion cutoff
ok 112 - correct signalpPeptide cutoff
ok 113 - correct other cutoff
ok 114 - correct location
ok 115 - correct Reliability class score
ok 116 - No peptide signal length reported
ok 117 - good SeqID
ok 118 - good Seqlength
ok 119 - correct Mitochondrion cutoff
ok 120 - correct signalpPeptide cutoff
ok 121 - correct other cutoff
ok 122 - correct location
ok 123 - correct Reliability class score
ok 124 - No peptide signal length reported
ok
t/Tools/Tmhmm.t ..................... 
1..12
ok 1 - use Bio::Tools::Tmhmm;
ok 2 - new()
ok 3 - got 3 feat
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/Tools/tRNAscanSE.t ................ 
1..14
ok 1 - use Bio::Tools::tRNAscanSE;
ok 2 - An object of class 'Bio::Tools::tRNAscanSE' isa 'Bio::Tools::tRNAscanSE'
ok 3
ok 4 - seq_id
ok 5 - codon
ok 6 - start
ok 7 - end
ok 8 - strand
ok 9 - exons
ok 10 - end
ok 11 - start
ok 12 - start
ok 13 - end
ok 14 - seq_id
ok
t/Tree/Compatible.t ................. 
1..5
ok 1 - use Bio::Tree::Compatible;
ok 2 - use Bio::TreeIO;
ok 3
ok 4
ok 5
ok
t/Tree/Node.t ....................... 
1..33
ok 1 - use Bio::Tree::Node;
ok 2 - use Bio::TreeIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - retrieve the first value
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - with fake node
ok 30 - after reroot on fake node
ok 31 - reroot on B
ok 32 - remove fake node, reroot on former B anc
ok 33 - roundtrip
ok
t/Tree/RandomTreeFactory.t .......... 
1..5
ok 1 - use Bio::Tree::RandomFactory;
ok 2 - use Bio::TreeIO;
ok 3 - use Bio::Tree::Statistics;
ok 4
ok 5
ok
t/Tree/Tree.t ....................... 
1..66
ok 1 - use Bio::TreeIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7 - retrieve the first value
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - Number of nodes that have ADH2 as name
ok 15 - Test Monophyly
ok 16 - Height
ok 17 - Depth
ok 18 - non-monophyletic group
ok 19 - not a binary tree
ok 20 - 12 nodes
ok 21 - after force_binary() it is
ok 22 - and there are more nodes (17)
ok 23 - B,C are Monophyletic
ok 24 - A,B are Monophyletic
ok 25 - B,F are not Monophyletic
ok 26 - A,B are Monophyletic
ok 27 - A,B,C are not Monophyletic w D as outgroup
ok 28 - A,F,E are monophyletic with I as outgroup
ok 29 - subtree_length() without attributes is an alias to total_branch_lenght()
ok 30 - Length of the tree is larger that lenght of a subtree
ok 31 - Can re-root with A as outgroup
ok 32 - Count the number of nodes
ok 33 - same length
ok 34 - Root node is A
ok 35 - Root node is A's ancestor
ok 36 - Can reroot with C's ancsestor
ok 37 - Node count correct
ok 38 - Total original branch length is what it is supposed to be
ok 39 - Updated total branch length after the reroot
ok 40 - Make sure root is really what we asked for
ok 41 - Testing for failed re-rerooting
ok 42 - Test that rooting succeeded
ok 43 - Test that re-rooted tree has proper number of nodes after re-rooting
ok 44 - Branch length before rerooting
ok 45 - Branch length after rerooting
ok 46 - Root is really the ancestor we asked for
ok 47 - BFS traversal order
ok 48 - DFS travfersal order
ok 49 - DFS traversal after removing H
ok 50 - DFS traversal after removing G
ok 51 - DFS traversal after removing E
ok 52 - DFS after removing all but 0,1,2,A,B,C,D
ok 53 - Testing bootstrap copy
ok 54 - Testing bootstrap copy
ok 55 - Testing bootstrap copy
ok 56 - Testing bootstrap copy
ok 57 - Testing bootstrap copy
ok 58 - Testing bootstrap copy
ok 59 - Testing bootstrap copy
ok 60 - Testing bootstrap copy
ok 61 - Testing auto-boostrap copy during parse
ok 62 - Testing auto-boostrap copy during parse
ok 63 - Testing auto-boostrap copy during parse
ok 64 - Testing auto-boostrap copy during parse
ok 65
ok 66
ok
t/Tree/TreeIO.t ..................... 
1..76
ok 1 - use Bio::TreeIO;
ok 2
ok 3 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 14
ok 15
ok 16
ok 17
ok 18 - Saw SINFRUP0000006110 as expected
ok 19
ok 20 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 21 - Total Nodes
ok 22
ok 23
ok 24
ok 25 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 41 - Leaf nodes
ok 42 - All nodes
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - bug 2356
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73 - An object of class 'Bio::Tree::Node' isa 'Bio::Tree::NodeI'
ok 74
ok 75 - An object of class 'Bio::Tree::Node' isa 'Bio::Tree::NodeI'
not ok 76 # TODO The nodes are garbage-collected away b/c Tree isn't retained in memory
#   Failed (TODO) test at t/Tree/TreeIO.t line 332.
#          got: '0'
#     expected: '198'
ok
t/Tree/TreeIO/lintree.t ............. 
1..24
ok 1 - use Bio::TreeIO;
ok 2 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 18 - Leaf nodes
ok 19 - All nodes
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/Tree/TreeIO/newick.t .............. 
1..51
ok 1 - use Bio::TreeIO;
ok 2
ok 3 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 14
ok 15
ok 16
ok 17
ok 18 - Saw SINFRUP0000006110 as expected
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - Round trip: simple newick
ok 28 - Round trip: Root node branch length
ok 29 - Round trip: Root node branch length
ok 30 - Round trip: from Wikipedia
ok 31 - Branch length on root
ok 32 - Tiny branch length on root
ok 33 - Zero branch lenghts
ok 34 - wkp blank tree
ok 35 - wkp only leaves labeled
ok 36 - wkp all nodes labeled
ok 37 - wkp branch lengths, no labels
ok 38 - wkp branch lengths, including root
ok 39 - wkp distances and leaf names
ok 40 - wkp distances and all names
ok 41 - wkp rooted on leaf node
ok 42 - phylip simple tree
ok 43 - phylip no labels
ok 44 - phylip w/ branch lengths
ok 45 - phylip w/ internal label
ok 46 - phylip raccoon tree
ok 47 - phylip mammal tree
ok 48 - phylip mammal tree w/ underbars
ok 49 - phylip single node
ok 50 - phylip_quartet
ok 51 - phylip greek
ok
t/Tree/TreeIO/nexus.t ............... 
1..24
ok 1 - use Bio::TreeIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - bug 2356
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/Tree/TreeIO/nhx.t ................. 
1..19
ok 1 - use Bio::TreeIO;
ok 2
ok 3 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 4 - Total Nodes
ok 5
ok 6
ok 7
ok 8 - Roundtrip: simple newick
ok 9 - Roundtrip: bug 1471 test
ok 10 - Roundtrip: different combinations of label, NHX, and branch length
ok 11 - Roundtrip: doot node branch length
ok 12 - Roundtrip: Example from Wikipedia
ok 13 - Roundtrip: ADH NHX tree
ok 14 - Roundtrip: notung nhx example http://www.cs.cmu.edu/~aiton/split/Manual-2.6.master014.html
ok 15 - Roundtrip: notung nhx bootstrap http://www.cs.cmu.edu/~aiton/split/Manual-2.6.master014.html
ok 16 - Roundtrip: r-sig-phylo mailing list http://www.mail-archive.com/r-sig-phylo@r-project.org/msg00516.html
ok 17 - Roundtrip: treebest example nhx
ok 18 - Roundtrip: Wellcome Trust ToL (from http://iphylo.blogspot.com/2009/02/thoughts-on-wellcome-interactive-tree.html)
ok 19 - Roundtrip: Biorecipes NHX file (http://www.biorecipes.com/Orthologues/StatusPage/pics/TreeEukaryota.nt)
ok
t/Tree/TreeIO/phyloxml.t ............ 
1..98
ok 1 - use Bio::TreeIO;
ok 2 - use Bio::TreeIO::phyloxml;
ok 3
ok 4 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 24
ok 25
ok 26
ok 27
ok 28 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 29 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 30 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 31
ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 33
ok 34 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 35 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 36
ok 37
ok 38 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 39
ok 40 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 41 - An object of class 'Bio::Annotation::Relation' isa 'Bio::Annotation::Relation'
ok 42
ok 43 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 44 - An object of class 'Bio::Annotation::Relation' isa 'Bio::Annotation::Relation'
ok 45
ok 46 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 47
ok 48 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 49 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 50
ok 51
ok 52
ok 53 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 54
ok 55 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 56 - An object of class 'Bio::Annotation::Relation' isa 'Bio::Annotation::Relation'
ok 57
ok 58 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode'
ok 59
ok 60
ok 61
ok 62 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 63 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode'
ok 64 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 66
ok 67
ok 68
ok 69 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 70 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode'
ok 71 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 72 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection'
ok 73
ok 74
ok 75
ok 76 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 77
ok 78 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 91
ok 92 - An object of class 'Bio::Tree::AnnotatableNode' isa 'Bio::Tree::AnnotatableNode'
ok 93
ok 94
ok 95
ok 96
ok 97 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 98
ok
t/Tree/TreeIO/tabtree.t ............. 
1..24
ok 1 - use Bio::TreeIO;
ok 2 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 18 - Leaf nodes
ok 19 - All nodes
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/Tree/TreeStatistics.t ............. 
1..44
ok 1 - use Bio::TreeIO;
ok 2 - use Bio::Tree::Statistics;
ok 3 - cherries
ok 4 - cherries
# Subtest: transfer-bootstrap-expectation (experimental)
    1..15
    ok 1 - Testing TBE for node 
    ok 2 - Testing TBE for node N7
    ok 3 - Testing TBE for node N3
    ok 4 - Testing TBE for node N1
    ok 5 - Testing TBE for node N2
    ok 6 - Testing TBE for node N6
    ok 7 - Testing TBE for node N4
    ok 8 - Testing TBE for node N5
    ok 9 - Testing TBE for node N14
    ok 10 - Testing TBE for node N10
    ok 11 - Testing TBE for node N8
    ok 12 - Testing TBE for node N9
    ok 13 - Testing TBE for node N13
    ok 14 - Testing TBE for node N11
    ok 15 - Testing TBE for node N12
ok 5 - transfer-bootstrap-expectation (experimental)
# Subtest: assess_bootstrap
    1..15
    ok 1 - Testing bootstrap for node 
    ok 2 - Testing bootstrap for node N7
    ok 3 - Testing bootstrap for node N3
    ok 4 - Testing bootstrap for node N1
    ok 5 - Testing bootstrap for node N2
    ok 6 - Testing bootstrap for node N6
    ok 7 - Testing bootstrap for node N4
    ok 8 - Testing bootstrap for node N5
    ok 9 - Testing bootstrap for node N14
    ok 10 - Testing bootstrap for node N10
    ok 11 - Testing bootstrap for node N8
    ok 12 - Testing bootstrap for node N9
    ok 13 - Testing bootstrap for node N13
    ok 14 - Testing bootstrap for node N11
    ok 15 - Testing bootstrap for node N12
ok 6 - assess_bootstrap
ok 7 - read traits
ok 8 - Add traits in second column and ignore missing
ok 9 - Add traits in third column
ok 10 - parsimony score
ok 11 - subtree parsimony score
ok 12 - ps value
ok 13 - fitch_down
ok 14 - ps value after fitch_down
ok 15 - persistence of a leaf
ok 16 - persistence of an internal node value 
ok 17 - persistence of an internal node value
ok 18 - persistence of an internal node value
ok 19 - leaf node: number of clusters = 0 
ok 20 - number of clusters 
ok 21 - number of clusters 
ok 22 - number of clusters 
ok 23 - number of leaves in phylotype 
ok 24 - number of leaves in phylotype 
ok 25 - number of leaves in phylotype 
ok 26 - number of leaves in phylotype 
ok 27 - phylotype length
ok 28 - phylotype length
ok 29 - phylotype length
ok 30 - phylotype length
ok 31 - phylotype length
ok 32 - sum of leaf distances
ok 33 - sum of leaf distances
ok 34 - sum of leaf distances
ok 35 - sum of leaf distances
ok 36 - sum of leaf distances
ok 37 - genetic diversity
ok 38 - separation
ok 39 - association index
ok 40 - subtree association index
ok 41 - monophyletic clade size
ok 42 - monophyletic clade size
ok 43 - monophyletic clade size
ok 44 - monophyletic clade size
ok
All tests successful.

Test Summary Report
-------------------
t/Root/IO.t                       (Wstat: 0 Tests: 154 Failed: 0)
  TODO passed:   109, 112, 115, 118
Files=211, Tests=14841, 78 wallclock secs ( 1.35 usr  0.27 sys + 60.73 cusr  9.71 csys = 72.06 CPU)
Result: PASS
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   create-stamp debian/debhelper-build-stamp
   dh_prep
   dh_auto_install
	make -j2 install DESTDIR=/<<PKGBUILDDIR>>/debian/tmp AM_UPDATE_INFO_DIR=no PREFIX=/usr
make[1]: Entering directory '/<<PKGBUILDDIR>>'
Manifying 40 pod documents
Manifying 35 pod documents
Manifying 33 pod documents
Manifying 32 pod documents
Manifying 34 pod documents
Manifying 32 pod documents
Manifying 32 pod documents
Manifying 30 pod documents
Manifying 27 pod documents
Manifying 35 pod documents
Manifying 29 pod documents
Manifying 35 pod documents
Manifying 36 pod documents
Manifying 33 pod documents
Manifying 33 pod documents
Manifying 15 pod documents
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/BioPerl.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/PrimarySeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AnalysisI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqAnalysisParserI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Range.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/IdentifiableI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Species.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/FeatureHolderI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqUtils.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/RangeI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DescribableI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/PullParserI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/HandlerBaseI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AnnotatableI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AnnotationI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AnalysisResultI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SimpleAlign.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/PrimarySeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DasI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DBLinkContainerI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeatureI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/UpdateableSeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SimpleAnalysisI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Taxon.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/ParameterBaseI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AnnotationCollectionI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/LocatableSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AnalysisParserI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/WebAgent.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/LocationI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/IdCollectionI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/EventHandlerI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/SearchResultEventBuilder.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/sim4.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/axt.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/FastHitEventBuilder.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/erpin.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/megablast.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/IteratedSearchResultEventBuilder.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/blasttable.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/rnamotif.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/waba.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/gmap_f9.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/wise.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/exonerate.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/cross_match.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/psl.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/blast.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/blast_pull.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/infernal.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/SearchWriterI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/HitTableWriter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/GbrowseGFF.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/HSPTableWriter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/ResultTableWriter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SearchIO/Writer/TextResultWriter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Failover.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Qual.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/QueryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/FileCache.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/DBFetch.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/SeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Registry.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/RandomAccessI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/WebDBSeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/InMemoryCache.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/GenericWebAgent.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/UpdateableSeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/ReferenceI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/LocationI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/IndexedBase.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/GFF/Util/Rearrange.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/GFF/Util/Binning.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/silva.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/greengenes.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/list.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Taxonomy/flatfile.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat/BinarySearch.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/swiss.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/genbank.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Flat/BDB/embl.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/DB/Query/WebQuery.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/DatabaseI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/GenericDatabase.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/BlastStatistics.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/GenericStatistics.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/StatisticsI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/BlastUtils.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Processor.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/SearchUtils.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/PsiBlastHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/FastaHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/BlastPullHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/WABAHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/PullHSPI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/HSPI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/BlastHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/PSLHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/HSPFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/GenericHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/HSP/ModelHSP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/PullHitI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/GenericHit.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/ModelHit.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/BlastHit.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/BlastPullHit.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/PsiBlastHit.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/Fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/HitI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Hit/HitFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Tiling/MapTileUtils.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Tiling/TilingI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Tiling/MapTiling.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/CrossMatchResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/BlastResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/ResultI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/WABAResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/BlastPullResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/PullResultI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/ResultFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/GenericResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Result/INFERNALResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Iteration/IterationI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Search/Iteration/GenericIteration.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/Tree.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/TreeI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/TreeFunctionsI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/NodeI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/Node.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/Compatible.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/AnnotatableNode.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/Statistics.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/NodeNHX.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/RandomFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tree/DistanceFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/phd.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/MultiFile.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/locuslink.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/FTHelper.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/seqxml.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/tab.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/mbsout.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/kegg.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/game.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/swiss.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/msout.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/largefasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/scf.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/pir.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/tinyseq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/tigr.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/fastq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/bsml_sax.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/tigrxml.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/embldriver.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/gcg.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/genbank.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/gbdriver.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/asciitree.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/raw.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/embl.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/bsml.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/table.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/metafasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/qual.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/gbxml.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/swissdriver.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/ace.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/game/gameHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/game/gameWriter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/game/seqHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/game/gameSubs.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/game/featHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/tinyseq/tinyseqHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqIO/Handler/GenericRichSeqHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Event/EventHandlerI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Event/EventGeneratorI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/Scoring.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/MatrixI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/Mlagan.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PhylipDist.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/Generic.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/IO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/ProtPsm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/PsmHeader.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/ProtMatrix.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/SiteMatrix.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/Psm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/PsmHeaderI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/InstanceSite.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/SiteMatrixI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/PsmI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/InstanceSiteI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/transfac.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/psiblast.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/masta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/mast.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/PSM/IO/meme.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/IO/mlagan.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/IO/phylip.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Matrix/IO/scoring.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Align/Utilities.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Align/PairwiseStatistics.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Align/ProteinStatistics.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Align/StatisticsI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Align/DNAStatistics.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Align/AlignI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/AbstractSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/Qual.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/Abstract.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/Blast.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/GenBank.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/Fastq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/EMBL.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/SwissPfam.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/BlastTable.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/Fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Index/Swissprot.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/Fuzzy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/NarrowestCoordPolicy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/Atomic.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/FuzzyLocationI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/Simple.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/Split.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/SplitLocationI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/CoordinatePolicyI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/AvWithinCoordPolicy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Location/WidestCoordPolicy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/TraceI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/RichSeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/BaseSeqProcessor.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/LargeSeqI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/SeqBuilder.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/LargeLocatableSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/RichSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/PrimedSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/QualI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/MetaI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/EncodedSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/Meta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/SimulatedRead.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/Quality.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/SeqFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/PrimaryQual.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/LargeSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/SequenceTrace.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/LargePrimarySeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/SeqFastaSpeedFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Seq/Meta/Array.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/pfam.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/msf.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/mase.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/nexus.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/prodom.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/psi.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/phylip.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/mega.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/arp.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/proda.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/largemultifasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/maf.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/fasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/xmfa.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/clustalw.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/emboss.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/po.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/meme.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/metafasta.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/selex.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/bl2seq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/AlignIO/Handler/GenericAlignHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/CodonUsage/Table.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/CodonUsage/IO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Das/FeatureTypeI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Das/SegmentI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/TypedSeqFeatureI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/SubSeq.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/PositionProxy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/AnnotationAdaptor.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Collection.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Similarity.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Computation.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Lite.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Primer.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/FeaturePair.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/CollectionI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/SimilarityPair.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Generic.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Amplicon.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/FeatureNamer.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/IDHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/TypeMapper.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Tools/Unflattener.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Promoter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Exon.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Transcript.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Poly_A_site.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/GeneStructure.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/TranscriptI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/UTR.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/NC_Feature.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/ExonI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/GeneStructureI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/SeqFeature/Gene/Intron.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/cluster.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/phyloxml.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/nhx.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/NewickParser.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/tabtree.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/nexus.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/TreeEventBuilder.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/lintree.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/pag.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/TreeIO/newick.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/OntologyTerm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/Tree.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/Collection.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/Reference.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/Target.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/DBLink.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/TypeManager.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/Relation.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/StructuredValue.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/SimpleValue.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/TagTree.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/Comment.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Annotation/AnnotationFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/AnalysisI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/ObjectFactoryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/SequenceStreamI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/SeqAnalysisParserFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/ObjectBuilderI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/FTLocationFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/LocationFactoryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/TreeFactoryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/ObjectFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/ApplicationFactoryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/DriverFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/SequenceFactoryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/SequenceProcessorI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Factory/SeqAnalysisParserFactoryI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/simplehierarchy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/InterProParser.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/obo.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/goflat.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/dagflat.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/soflat.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/Handlers/InterProHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/OntologyIO/Handlers/BaseSAXHandler.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Fgenesh.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/tRNAscanSE.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/GFF.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Primer3.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/CodonTable.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Glimmer.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Genewise.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/isPcr.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Tmhmm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/TandemRepeatsFinder.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Match.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Coil.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/EPCR.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/GuessSeqFormat.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/RandomDistFunctions.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Eponine.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/pICalculator.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/MZEF.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Blat.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Geneid.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Prints.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/ECnumber.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/ipcress.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Lucy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Sigcleave.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Seg.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Profile.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/QRNA.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/SeqWords.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/SeqStats.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/AmpliconSearch.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/ESTScan.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/FootPrinter.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/IUPAC.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/SeqPattern.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Pseudowise.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Genomewise.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Genscan.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Est2Genome.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/AnalysisResult.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Grail.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/RepeatMasker.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/PrositeScan.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/TargetP.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Signalp.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Promoterwise.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Genemark.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/OddCodes.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/GenericParameters.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/AnalysisFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/WrapperBase.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/ParametersI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/Analysis.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/WrapperBase/CommandExts.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Run/Phylo/PhyloBase.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Primer/Pair.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Primer/AssessorI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Primer/Feature.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Primer/Assessor/Base.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Sim4/Exon.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Sim4/Results.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Signalp/ExtendedSignalp.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Alignment/Trim.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Alignment/Consed.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Spidey/Exon.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Spidey/Results.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Analysis/SimpleAnalysisBase.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/EMBOSS/Palindrome.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Gerp.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Molphy.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Molphy/Result.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Phylo/Phylip/ProtDist.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Prediction/Exon.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/Prediction/Gene.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Tools/SeqPattern/Backtranslate.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/RelationshipFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/OntologyI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/Path.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/RelationshipType.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/GOterm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/TermFactory.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/OntologyEngineI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/OBOEngine.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/OBOterm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/Ontology.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/OntologyStore.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/RelationshipI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/PathI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/InterProTerm.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/Relationship.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/DocumentRegistry.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/TermI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/SimpleOntologyEngine.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/Term.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/Exception.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/Root.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/Utilities.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/Test.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/RootI.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/TestObject.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/IO.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/Storable.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/Version.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/perl5/Bio/Root/HTTPget.pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_process_sgd.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_search2gff.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_seqcut.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_extract_feature_seq.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_seqconvert.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_fetch.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_search2table.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_split_seq.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_mrtrans.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_nrdb.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_seq_length.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_tree2pag.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_unflatten_seq.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_biogetseq.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_taxid4species.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_mask_by_search.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_search2tribe.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_bioflat_index.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_oligo_count.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_process_gadfly.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_search2alnblocks.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_index.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_find-blast-matches.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_sreformat.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_filter_search.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_translate_seq.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_dbsplit.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_seqret.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_seqpart.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_local_taxonomydb_query.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_fastam9_to_table.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_seqretsplit.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_aacomp.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_genbank2gff3.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_taxonomy2tree.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_nexus2nh.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_revtrans-motif.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_mutate.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_make_mrna_protein.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man1/bp_gccalc.1p
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::OBOEngine.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::QueryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Align::AlignI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::WABAResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::pag.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::FTHelper.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Fgenesh.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Glimmer.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::HTTPget.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::silva.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Geneid.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::FastaHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::GenericDatabase.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::pfam.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::embl.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::MultiFile.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::LargeSeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::TermI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::nexus.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::BlastTable.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::Root.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::SubSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::IO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::Collection.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::DatabaseI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::TextResultWriter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::seqxml.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::AmpliconSearch.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::FeaturePair.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::Reference.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::TranscriptI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::GFF::Util::Rearrange.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::InterProParser.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Promoterwise.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Computation.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::RepeatMasker.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AnnotationI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::RichSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::Relation.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::tabtree.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::newick.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::RandomDistFunctions.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Similarity.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::Pair.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::swiss.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::GbrowseGFF.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::Feature.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Est2Genome.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::ExonI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DescribableI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::INFERNALResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/BioPerl.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Genscan.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::cluster.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Promoter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::psiblast.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::gameHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::po.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::fastq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::TreeFunctionsI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::SeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::FTLocationFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Tiling::TilingI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Phylip::ProtDist.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::HitTableWriter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::IDHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Gerp.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Analysis::SimpleAnalysisBase.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AnalysisParserI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Pseudowise.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::SeqStats.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::axt.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::TagTree.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::flatfile.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Spidey::Exon.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::SearchWriterI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Tiling::MapTileUtils.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactoryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::FuzzyLocationI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::ApplicationFactoryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::DBFetch.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::InterProTerm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::PullResultI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::goflat.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Generic.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::ParametersI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::RootI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::SequenceFactoryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::PsmHeaderI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::Assessor::Base.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Blat.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::LocationI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::SiteMatrixI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::TargetP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::FileCache.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Signalp::ExtendedSignalp.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::ModelHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::locuslink.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::Tree.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::msout.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Species.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::FastHitEventBuilder.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqAnalysisParserI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::RelationshipType.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::swiss.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::CodonUsage::Table.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::GenericHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::PositionProxy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::StructuredValue.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::Comment.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::LocationFactoryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::DistanceFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Qual.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::exonerate.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::proda.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::HSPI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Taxon.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::LocatableSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::megablast.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Amplicon.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::Handlers::BaseSAXHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::TreeFactoryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::tRNAscanSE.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::MatrixI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::PullHSPI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::HandlerBaseI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::WABAHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::WrapperBase::CommandExts.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::PrimaryQual.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::AbstractSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::PullParserI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::GenericStatistics.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::IO::phylip.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::Node.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::OntologyI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Processor.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::Meta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::Atomic.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::TestObject.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Sim4::Results.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::qual.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::PullHitI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::msf.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::pICalculator.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::Utilities.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::tigrxml.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::emboss.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::NC_Feature.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructure.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Primer3.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::swissdriver.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::InstanceSiteI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::DBLink.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::PsiBlastHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::pir.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::selex.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BinarySearch.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::PSLHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Prints.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::EMBL.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::LargeLocatableSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::Quality.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::Compatible.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Genomewise.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::scf.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::EncodedSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::SwissPfam.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Poly_A_site.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Sim4::Exon.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Lucy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::EMBOSS::Palindrome.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::MZEF.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SimpleAlign.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::BlastPullHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Query::WebQuery.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::LocationI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::prodom.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Primer::AssessorI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::QualI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::gbxml.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Transcript.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::ReferenceI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::BlastHSP.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::seqHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::Test.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::kegg.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::obo.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Prediction::Gene.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::tigr.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Molphy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::arp.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::SimulatedRead.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::NewickParser.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::SequenceProcessorI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Das::SegmentI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::StatisticsI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::GenBank.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::WidestCoordPolicy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Spidey::Results.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::SearchResultEventBuilder.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Align::StatisticsI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::IO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::embl.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::NodeI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::ESTScan.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::Statistics.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Alignment::Trim.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::tinyseq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DBLinkContainerI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::clustalw.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::BlastHit.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::ParameterBaseI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::PrimarySeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::gameSubs.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Tmhmm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::SeqFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::UpdateableSeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::meme.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::HitFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::RandomAccessI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::OntologyEngineI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::dagflat.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::Mlagan.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::SimpleGOEngine::GraphAdaptor.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::psi.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::psl.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::Analysis.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::PrimarySeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::blasttable.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::tinyseq::tinyseqHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Range.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::Target.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Collection.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::rnamotif.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::ObjectBuilderI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Coil.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::ResultI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::HSP::HSPFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Registry.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::waba.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Iteration::GenericIteration.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::Phylo::PhyloBase.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::OntologyStore.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::infernal.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Profile.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::ResultFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::bl2seq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::sim4.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::GOterm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::Split.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::metafasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Genemark.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::isPcr.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::table.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::AvWithinCoordPolicy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::LargeSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::masta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::TypedSeqFeatureI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::SearchUtils.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::PrositeScan.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Prediction::Exon.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::AnnotationAdaptor.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::tab.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::largefasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::DriverFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::SimilarityPair.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::RelationshipI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::CodonUsage::IO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Genewise.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::GuessSeqFormat.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::ipcress.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::gmap_f9.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::CrossMatchResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::PsiBlastHit.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::SeqWords.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Event::EventGeneratorI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::SiteMatrix.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::lintree.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::CoordinatePolicyI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::gcg.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::EPCR.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::Path.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::ECnumber.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::TypeMapper.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Align::Utilities.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::BlastResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Alignment::Consed.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::bsml_sax.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::game.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::asciitree.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::Psm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::RichSeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::cross_match.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::Exception.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::BlastStatistics.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AnnotatableI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::ProtMatrix.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::OBOterm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::AnalysisI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::BlastUtils.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::SequenceStreamI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::genbank.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::AnalysisFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::SeqFastaSpeedFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::UTR.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::metafasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::Ontology.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::gbdriver.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PhylipDist.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::FootPrinter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::HTMLResultWriter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::phyloxml.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AnalysisResultI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Align::DNAStatistics.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Sigcleave.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::Relationship.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::list.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Primer.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::PathI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::Meta::Array.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqUtils.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::FeatureNamer.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::RandomFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::AnnotationFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Seg.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Align::ProteinStatistics.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::DocumentRegistry.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::TraceI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::WebAgent.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::MetaI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::BlastPullHit.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::CollectionI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::largemultifasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::IndexedBase.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::nexus.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::GenericParameters.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::gameWriter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::Fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Match.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::IO::mlagan.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::erpin.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::ResultTableWriter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::PsmI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::NodeNHX.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Lite.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::meme.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Das::FeatureTypeI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SimpleAnalysisI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::Fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::ObjectFactoryI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::Blast.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Intron.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::SimpleValue.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::Fuzzy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::phd.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::Version.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::Handler::GenericAlignHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::IUPAC.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::IO::scoring.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Tools::Unflattener.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeatureI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::UpdateableSeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::RelationshipFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::wise.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::TermFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::OddCodes.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::Term.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Iteration::IterationI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::mase.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::ProtPsm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::TandemRepeatsFinder.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::Handler::GenericRichSeqHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::blast.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::BaseSeqProcessor.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::Exon.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Root::Storable.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::Qual.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Signalp.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::raw.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::game::featHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::fasta.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AnnotationCollectionI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::FeatureHolderI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::Tree.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::simplehierarchy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::TreeEventBuilder.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::BlastPullResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::Scoring.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DasI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::IdCollectionI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::mast.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::AnalysisResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::Fastq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::Generic.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::bsml.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Failover.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::phylip.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::InMemoryCache.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Phylo::Molphy::Result.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::AnnotatableNode.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Result::GenericResult.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::NarrowestCoordPolicy.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::ModelHit.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Flat::BDB::genbank.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AnalysisI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructureI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::GenericHit.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Hit::HitI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::InstanceSite.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::IteratedSearchResultEventBuilder.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::SplitLocationI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::SeqBuilder.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::CodonTable.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::Writer::HSPTableWriter.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::TypeManager.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Location::Simple.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Search::Tiling::MapTiling.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::mega.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::PrimedSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::Abstract.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Run::WrapperBase.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tree::TreeI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::RangeI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::Taxonomy::greengenes.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::EventHandlerI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Annotation::OntologyTerm.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::embldriver.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::GFF::Util::Binning.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Index::Swissprot.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::xmfa.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Event::EventHandlerI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::LargePrimarySeq.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::SeqPattern::Backtranslate.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::ace.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::PsmHeader.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::GFF.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::IdentifiableI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Seq::SequenceTrace.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::WebDBSeqI.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::soflat.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::QRNA.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::AlignIO::maf.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Factory::ObjectFactory.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO::transfac.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::OntologyIO::Handlers::InterProHandler.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::DB::GenericWebAgent.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO::mbsout.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Matrix::PSM::IO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Grail.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::SeqPattern.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Align::PairwiseStatistics.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Tools::Eponine.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::Ontology::SimpleOntologyEngine.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SeqIO.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::SearchIO::blast_pull.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/share/man/man3/Bio::TreeIO::nhx.3pm
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_seqpart
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_search2gff
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_genbank2gff3
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_tree2pag
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_seqretsplit
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_search2alnblocks
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_extract_feature_seq
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_mutate
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_nexus2nh
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_seqconvert
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_bioflat_index
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_aacomp
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_mask_by_search
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_taxid4species
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_biogetseq
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_taxonomy2tree
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_split_seq
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_local_taxonomydb_query
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_search2table
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_search2tribe
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_find-blast-matches
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_filter_search
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_index
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_dbsplit
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_gccalc
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_revtrans-motif
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_fastam9_to_table
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_oligo_count
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_process_sgd
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_fetch
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_seqcut
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_unflatten_seq
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_sreformat
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_seq_length
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_nrdb
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_mrtrans
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_make_mrna_protein
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_process_gadfly
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_seqret
Installing /<<PKGBUILDDIR>>/debian/tmp/usr/bin/bp_translate_seq
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_install
   dh_installdocs
   debian/rules override_dh_installchangelogs
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_installchangelogs Changes
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   debian/rules override_dh_installexamples
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_installexamples examples/*
for pl in `grep -Rl '#![[:space:]]*/usr/bin/env[[:space:]]\+perl' debian/*/usr/*` ; do \
    sed -i '1s?^#![[:space:]]*/usr/bin/env[[:space:]]\+perl?#!/usr/bin/perl?' ${pl} ; \
done
for pl in `grep -Rl '#![[:space:]]*/usr/local/bin/perl' debian/*/usr/*` ; do \
    sed -i '1s?^#![[:space:]]*/usr/local/bin/[[:space:]]*perl?#!/usr/bin/perl?' ${pl} ; \
done
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_installman
   dh_perl
   dh_link
   dh_strip_nondeterminism
   dh_compress
   dh_fixperms
   dh_missing
   dh_installdeb
   dh_gencontrol
   dh_md5sums
   dh_builddeb
dpkg-deb: building package 'bioperl' in '../bioperl_1.7.8-1_all.deb'.
dpkg-deb: building package 'libbio-perl-perl' in '../libbio-perl-perl_1.7.8-1_all.deb'.
 dpkg-genbuildinfo -O../bioperl_1.7.8-1_amd64.buildinfo
 dpkg-genchanges -O../bioperl_1.7.8-1_amd64.changes
dpkg-genchanges: info: including full source code in upload
 dpkg-source -Zxz --after-build .
dpkg-buildpackage: info: full upload (original source is included)
--------------------------------------------------------------------------------
Build finished at 2024-06-03T00:01:05Z

Finished
--------

I: Built successfully

+------------------------------------------------------------------------------+
| Changes                                                                      |
+------------------------------------------------------------------------------+


bioperl_1.7.8-1_amd64.changes:
------------------------------

Format: 1.8
Date: Sun, 15 Aug 2021 18:26:03 +0530
Source: bioperl
Binary: bioperl libbio-perl-perl
Architecture: source all
Version: 1.7.8-1
Distribution: perl-5.40-throwaway
Urgency: medium
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Changed-By: Nilesh Patra <nilesh@debian.org>
Description:
 bioperl    - Perl tools for computational molecular biology
 libbio-perl-perl - BioPerl core perl modules
Changes:
 bioperl (1.7.8-1) unstable; urgency=medium
 .
   * Team Upload.
   * New upstream version 1.7.8
   * Remove d/p/FTlineParsingHickups.patch: merged upstream
   * Bump debhelper-compat version to 13
   * Declare compliance with policy 4.5.1
   * Add d/salsa-ci.yml
Checksums-Sha1:
 62c8e15afc53e1b2498e186f001a616275ca4848 2258 bioperl_1.7.8-1.dsc
 f8997b7a920c1dbb58936e63ba994b62b8794114 7527658 bioperl_1.7.8.orig.tar.gz
 02cb59d1ba0cd7c538eb1168b44ed14a50951eef 11880 bioperl_1.7.8-1.debian.tar.xz
 e1c33b097892cfb5cbacccf80a4f5f927544dcf5 231124 bioperl_1.7.8-1_all.deb
 521974756fbf8646b807cd54a9c8576fa61472c1 12562 bioperl_1.7.8-1_amd64.buildinfo
 7b1c6944606c655854f8e23689defca6aaedb781 2498256 libbio-perl-perl_1.7.8-1_all.deb
Checksums-Sha256:
 a9a97bff4c7d29efbf613035a1d0e22ad51df0daeb3dbda39137d579523e6d5c 2258 bioperl_1.7.8-1.dsc
 c490a3be7715ea6e4305efd9710e5edab82dabc55fd786b6505b550a30d71738 7527658 bioperl_1.7.8.orig.tar.gz
 3a46e8e6c6d7ffe8d1af45f87786e70a9a84654927fb3a467063c6166163edd8 11880 bioperl_1.7.8-1.debian.tar.xz
 5f45bf64be2a164538f8f92700fe1a013636200cb3959547cdb46c91d1560614 231124 bioperl_1.7.8-1_all.deb
 a34132fc8ee7d7d8ae506a39f380e270d9ad903631b9d800c7f2759c5b1c528c 12562 bioperl_1.7.8-1_amd64.buildinfo
 9197a526ef49eea7d74aa9bf66fc53a02045f2bef3dfabda6ccddfc6bb7e982b 2498256 libbio-perl-perl_1.7.8-1_all.deb
Files:
 9ffc9fd376b8e403cc1cfa3e9b01c086 2258 science optional bioperl_1.7.8-1.dsc
 8164ac52f37bc6355ec1b69633ac795f 7527658 science optional bioperl_1.7.8.orig.tar.gz
 f3d69e28df0607902e23fc9f91717eef 11880 science optional bioperl_1.7.8-1.debian.tar.xz
 da90ae4687be781f59b6d29478fc93e4 231124 science optional bioperl_1.7.8-1_all.deb
 35ff1cd71742bebacab25c611af7cdfb 12562 science optional bioperl_1.7.8-1_amd64.buildinfo
 acfdf517ebf6f50a04b9a46a7833df32 2498256 perl optional libbio-perl-perl_1.7.8-1_all.deb

+------------------------------------------------------------------------------+
| Buildinfo                                                                    |
+------------------------------------------------------------------------------+

Format: 1.0
Source: bioperl
Binary: bioperl libbio-perl-perl
Architecture: all source
Version: 1.7.8-1
Checksums-Md5:
 9ffc9fd376b8e403cc1cfa3e9b01c086 2258 bioperl_1.7.8-1.dsc
 da90ae4687be781f59b6d29478fc93e4 231124 bioperl_1.7.8-1_all.deb
 acfdf517ebf6f50a04b9a46a7833df32 2498256 libbio-perl-perl_1.7.8-1_all.deb
Checksums-Sha1:
 62c8e15afc53e1b2498e186f001a616275ca4848 2258 bioperl_1.7.8-1.dsc
 e1c33b097892cfb5cbacccf80a4f5f927544dcf5 231124 bioperl_1.7.8-1_all.deb
 7b1c6944606c655854f8e23689defca6aaedb781 2498256 libbio-perl-perl_1.7.8-1_all.deb
Checksums-Sha256:
 a9a97bff4c7d29efbf613035a1d0e22ad51df0daeb3dbda39137d579523e6d5c 2258 bioperl_1.7.8-1.dsc
 5f45bf64be2a164538f8f92700fe1a013636200cb3959547cdb46c91d1560614 231124 bioperl_1.7.8-1_all.deb
 9197a526ef49eea7d74aa9bf66fc53a02045f2bef3dfabda6ccddfc6bb7e982b 2498256 libbio-perl-perl_1.7.8-1_all.deb
Build-Origin: Debian
Build-Architecture: amd64
Build-Date: Mon, 03 Jun 2024 00:01:04 +0000
Build-Path: /<<PKGBUILDDIR>>
Build-Tainted-By:
 merged-usr-via-aliased-dirs
 usr-local-has-programs
Installed-Build-Depends:
 autoconf (= 2.71-3),
 automake (= 1:1.16.5-1.3),
 autopoint (= 0.21-14),
 autotools-dev (= 20220109.1),
 base-files (= 13.2),
 base-passwd (= 3.6.3),
 bash (= 5.2.21-2+b1),
 binutils (= 2.42-4),
 binutils-common (= 2.42-4),
 binutils-x86-64-linux-gnu (= 2.42-4),
 bsdextrautils (= 2.40.1-7),
 bsdutils (= 1:2.40.1-7),
 build-essential (= 12.10),
 bzip2 (= 1.0.8-5.1),
 ca-certificates (= 20240203),
 coreutils (= 9.4-3.1),
 cpp (= 4:13.2.0-7),
 cpp-13 (= 13.2.0-25),
 cpp-13-x86-64-linux-gnu (= 13.2.0-25),
 cpp-x86-64-linux-gnu (= 4:13.2.0-7),
 dash (= 0.5.12-8),
 debconf (= 1.5.86),
 debhelper (= 13.15.3),
 debianutils (= 5.17),
 dh-autoreconf (= 20),
 dh-strip-nondeterminism (= 1.14.0-1),
 diffutils (= 1:3.10-1),
 dpkg (= 1.22.6),
 dpkg-dev (= 1.22.6),
 dwz (= 0.15-1+b1),
 file (= 1:5.45-3),
 findutils (= 4.9.0-6),
 fontconfig (= 2.15.0-1.1),
 fontconfig-config (= 2.15.0-1.1),
 fonts-dejavu-core (= 2.37-8),
 fonts-dejavu-mono (= 2.37-8),
 g++ (= 4:13.2.0-7),
 g++-13 (= 13.2.0-25),
 g++-13-x86-64-linux-gnu (= 13.2.0-25),
 g++-x86-64-linux-gnu (= 4:13.2.0-7),
 gcc (= 4:13.2.0-7),
 gcc-13 (= 13.2.0-25),
 gcc-13-base (= 13.2.0-25),
 gcc-13-x86-64-linux-gnu (= 13.2.0-25),
 gcc-14-base (= 14.1.0-1),
 gcc-x86-64-linux-gnu (= 4:13.2.0-7),
 gettext (= 0.21-14+b1),
 gettext-base (= 0.21-14+b1),
 graphviz (= 2.42.2-9+b2),
 grep (= 3.11-4),
 groff-base (= 1.23.0-4),
 gzip (= 1.12-1.1),
 hostname (= 3.23+nmu2),
 init-system-helpers (= 1.66),
 intltool-debian (= 0.35.0+20060710.6),
 libabsl20230802 (= 20230802.1-4),
 libace-perl (= 1.92-11+b5),
 libacl1 (= 2.3.2-2),
 libalgorithm-diff-perl (= 1.201-1),
 libalgorithm-munkres-perl (= 0.08-5),
 libann0 (= 1.1.2+doc-9+b1),
 libaom3 (= 3.8.2-2),
 libarchive-zip-perl (= 1.68-1),
 libarray-compare-perl (= 3.0.8-1),
 libasan8 (= 14.1.0-1),
 libatomic1 (= 14.1.0-1),
 libattr1 (= 1:2.5.2-1),
 libaudit-common (= 1:3.1.2-2.1),
 libaudit1 (= 1:3.1.2-2.1),
 libavif16 (= 1.0.4-3),
 libb-hooks-op-check-perl (= 0.22-3+b2),
 libbinutils (= 2.42-4),
 libbio-asn1-entrezgene-perl (= 1.730-3),
 libbio-cluster-perl (= 1.7.3-6),
 libbio-perl-perl (= 1.7.8-1),
 libbio-samtools-perl (= 1.43-5+b1),
 libbio-variation-perl (= 1.7.5-3),
 libblkid1 (= 2.40.1-7),
 libbrotli1 (= 1.1.0-2+b3),
 libbsd0 (= 0.12.2-1),
 libbz2-1.0 (= 1.0.8-5.1),
 libc-bin (= 2.38-12),
 libc-dev-bin (= 2.38-12),
 libc6 (= 2.38-12),
 libc6-dev (= 2.38-12),
 libcache-cache-perl (= 1.08-3),
 libcairo2 (= 1.18.0-3+b1),
 libcap-ng0 (= 0.8.5-1),
 libcap2 (= 1:2.66-5),
 libcapture-tiny-perl (= 0.48-2),
 libcc1-0 (= 14.1.0-1),
 libcdt5 (= 2.42.2-9+b2),
 libcgi-pm-perl (= 4.64-1),
 libcgraph6 (= 2.42.2-9+b2),
 libclass-data-inheritable-perl (= 0.08-3),
 libclass-inspector-perl (= 1.36-3),
 libclass-method-modifiers-perl (= 2.15-1),
 libclass-unload-perl (= 0.11-3),
 libclass-xsaccessor-perl (= 1.19-4+b4),
 libclone-perl (= 0.46-1+b3),
 libcom-err2 (= 1.47.1-1),
 libconvert-binary-c-perl (= 0.84-1+b5),
 libconvert-binhex-perl (= 1.125-3),
 libcrypt-dev (= 1:4.4.36-4),
 libcrypt-rc4-perl (= 2.02-5),
 libcrypt1 (= 1:4.4.36-4),
 libctf-nobfd0 (= 2.42-4),
 libctf0 (= 2.42-4),
 libdata-stag-perl (= 0.14-3),
 libdatrie1 (= 0.2.13-3),
 libdav1d7 (= 1.4.2-1),
 libdb5.3t64 (= 5.3.28+dfsg2-7),
 libdbd-mysql-perl (= 4.052-1+b3),
 libdbd-pg-perl (= 3.18.0-1+b3),
 libdbd-sqlite3-perl (= 1.74-1+b3),
 libdbi-perl (= 1.643-4+b3),
 libde265-0 (= 1.0.15-1+b1),
 libdebconfclient0 (= 0.272),
 libdebhelper-perl (= 13.15.3),
 libdeflate0 (= 1.20-1),
 libdevel-callchecker-perl (= 0.009-1+b1),
 libdevel-cycle-perl (= 1.12-2),
 libdevel-stacktrace-perl (= 2.0500-1),
 libdigest-perl-md5-perl (= 1.9-5),
 libdpkg-perl (= 1.22.6),
 libdynaloader-functions-perl (= 0.003-3),
 libelf1t64 (= 0.191-1+b1),
 libencode-locale-perl (= 1.05-3),
 liberror-perl (= 0.17029-2),
 libexception-class-perl (= 1.45-1),
 libexpat1 (= 2.6.2-1),
 libexporter-tiny-perl (= 1.006002-1),
 libfcgi-perl (= 0.82+ds-3+b2),
 libfcgi0t64 (= 2.4.2-2.1),
 libffi8 (= 3.4.6-1),
 libfile-listing-perl (= 6.16-1),
 libfile-slurp-tiny-perl (= 0.004-2),
 libfile-stripnondeterminism-perl (= 1.14.0-1),
 libfontconfig1 (= 2.15.0-1.1),
 libfreetype6 (= 2.13.2+dfsg-1+b4),
 libfribidi0 (= 1.0.13-3+b1),
 libgav1-1 (= 0.19.0-2+b1),
 libgcc-13-dev (= 13.2.0-25),
 libgcc-s1 (= 14.1.0-1),
 libgd-perl (= 2.78-1+b3),
 libgd3 (= 2.3.3-9+b3),
 libgdbm-compat4t64 (= 1.23-5.1+b1),
 libgdbm6t64 (= 1.23-5.1+b1),
 libglib2.0-0t64 (= 2.80.2-2),
 libgmp10 (= 2:6.3.0+dfsg-2+b1),
 libgnutls30t64 (= 3.8.5-4),
 libgomp1 (= 14.1.0-1),
 libgprofng0 (= 2.42-4),
 libgraph-perl (= 1:0.9727-1),
 libgraphite2-3 (= 1.3.14-2),
 libgraphviz-perl (= 2.24-1),
 libgssapi-krb5-2 (= 1.20.1-6+b1),
 libgts-0.7-5t64 (= 0.7.6+darcs121130-5.2),
 libgvc6 (= 2.42.2-9+b2),
 libgvpr2 (= 2.42.2-9+b2),
 libharfbuzz0b (= 8.3.0-2+b1),
 libheap-perl (= 0.80-5),
 libheif-plugin-dav1d (= 1.17.6-1+b2),
 libheif-plugin-libde265 (= 1.17.6-1+b2),
 libheif1 (= 1.17.6-1+b2),
 libhogweed6t64 (= 3.9.1-2.2),
 libhtml-parser-perl (= 3.82-1+b1),
 libhtml-tableextract-perl (= 2.15-2),
 libhtml-tagset-perl (= 3.24-1),
 libhtml-tree-perl (= 5.07-3),
 libhttp-cookies-perl (= 6.11-1),
 libhttp-daemon-perl (= 6.16-1),
 libhttp-date-perl (= 6.06-1),
 libhttp-message-perl (= 6.46-1),
 libhttp-negotiate-perl (= 6.01-2),
 libhwasan0 (= 14.1.0-1),
 libice6 (= 2:1.0.10-1+b1),
 libicu72 (= 72.1-4+b1),
 libidn2-0 (= 2.3.7-2),
 libimport-into-perl (= 1.002005-2),
 libio-html-perl (= 1.004-3),
 libio-pty-perl (= 1:1.20-1+b2),
 libio-sessiondata-perl (= 1.03-3),
 libio-socket-ssl-perl (= 2.085-1),
 libio-string-perl (= 1.08-4),
 libio-stringy-perl (= 2.111-3),
 libipc-run-perl (= 20231003.0-2),
 libipc-sharelite-perl (= 0.17-5+b3),
 libisl23 (= 0.26-3+b2),
 libitm1 (= 14.1.0-1),
 libjansson4 (= 2.14-2+b2),
 libjbig0 (= 2.1-6.1+b1),
 libjcode-pm-perl (= 2.06-1.1),
 libjpeg62-turbo (= 1:2.1.5-3),
 libk5crypto3 (= 1.20.1-6+b1),
 libkeyutils1 (= 1.6.3-3),
 libkrb5-3 (= 1.20.1-6+b1),
 libkrb5support0 (= 1.20.1-6+b1),
 liblab-gamut1 (= 2.42.2-9+b2),
 libldap-2.5-0 (= 2.5.17+dfsg-1+b1),
 liblerc4 (= 4.0.0+ds-4+b1),
 liblist-moreutils-perl (= 0.430-2),
 liblist-moreutils-xs-perl (= 0.430-4+b2),
 liblsan0 (= 14.1.0-1),
 libltdl7 (= 2.4.7-7+b1),
 liblwp-mediatypes-perl (= 6.04-2),
 liblwp-protocol-https-perl (= 6.14-1),
 liblzma5 (= 5.6.1+really5.4.5-1),
 libmagic-mgc (= 1:5.45-3),
 libmagic1t64 (= 1:5.45-3),
 libmailtools-perl (= 2.21-3),
 libmariadb3 (= 1:10.11.8-1),
 libmath-derivative-perl (= 1.01-3),
 libmath-spline-perl (= 0.02-4),
 libmd0 (= 1.1.0-2),
 libmime-tools-perl (= 5.515-1),
 libmodule-build-perl (= 0.423400-2),
 libmodule-runtime-perl (= 0.016-2),
 libmoo-perl (= 2.005005-1),
 libmount1 (= 2.40.1-7),
 libmpc3 (= 1.3.1-1+b2),
 libmpfr6 (= 4.2.1-1+b1),
 libnet-http-perl (= 6.23-1),
 libnet-smtp-ssl-perl (= 1.04-2),
 libnet-ssleay-perl (= 1.94-1+b2),
 libnettle8t64 (= 3.9.1-2.2),
 libole-storage-lite-perl (= 0.22-1),
 libp11-kit0 (= 0.25.3-5),
 libpadwalker-perl (= 2.5-1+b6),
 libpam-modules (= 1.5.3-7),
 libpam-modules-bin (= 1.5.3-7),
 libpam-runtime (= 1.5.3-7),
 libpam0g (= 1.5.3-7),
 libpango-1.0-0 (= 1.52.2+ds-1),
 libpangocairo-1.0-0 (= 1.52.2+ds-1),
 libpangoft2-1.0-0 (= 1.52.2+ds-1),
 libparams-classify-perl (= 0.015-2+b4),
 libparse-recdescent-perl (= 1.967015+dfsg-4),
 libpath-class-perl (= 0.37-4),
 libpathplan4 (= 2.42.2-9+b2),
 libpcre2-8-0 (= 10.42-4+b1),
 libperl5.40 (= 5.40.0~rc1-1),
 libperlio-eol-perl (= 0.19-1+b3),
 libpipeline1 (= 1.5.7-2),
 libpixman-1-0 (= 0.42.2-1+b1),
 libpng16-16t64 (= 1.6.43-5),
 libpostscript-perl (= 0.06-3.1),
 libpq5 (= 16.3-1+b1),
 libquadmath0 (= 14.1.0-1),
 librav1e0 (= 0.7.1-2),
 librole-tiny-perl (= 2.002004-1),
 libsasl2-2 (= 2.1.28+dfsg1-6),
 libsasl2-modules-db (= 2.1.28+dfsg1-6),
 libseccomp2 (= 2.5.5-1),
 libselinux1 (= 3.5-2+b2),
 libset-object-perl (= 1.42-1+b5),
 libset-scalar-perl (= 1.29-3),
 libsframe1 (= 2.42-4),
 libsharpyuv0 (= 1.4.0-0.1),
 libsm6 (= 2:1.2.3-1+b1),
 libsmartcols1 (= 2.40.1-7),
 libsoap-lite-perl (= 1.27-3),
 libsort-naturally-perl (= 1.03-4),
 libspreadsheet-parseexcel-perl (= 0.6600-1),
 libspreadsheet-writeexcel-perl (= 2.40-4),
 libsqlite3-0 (= 3.46.0-1),
 libssl3t64 (= 3.2.1-3),
 libstatistics-descriptive-perl (= 3.0801-1),
 libstdc++-13-dev (= 13.2.0-25),
 libstdc++6 (= 14.1.0-1),
 libsub-quote-perl (= 2.006008-1),
 libsub-uplevel-perl (= 0.2800-3),
 libsvg-graph-perl (= 0.02-4),
 libsvg-perl (= 2.87-1),
 libsvtav1enc1d1 (= 1.7.0+dfsg-2+b1),
 libsystemd0 (= 256~rc3-7),
 libtask-weaken-perl (= 1.06-2),
 libtasn1-6 (= 4.19.0-3+b2),
 libtest-deep-perl (= 1.204-1),
 libtest-differences-perl (= 0.71-1),
 libtest-exception-perl (= 0.43-3),
 libtest-memory-cycle-perl (= 1.06-2),
 libtest-most-perl (= 0.38-1),
 libtest-pod-perl (= 1.52-3),
 libtest-requiresinternet-perl (= 0.05-4),
 libtest-warn-perl (= 0.37-2),
 libtest-weaken-perl (= 3.022000-1.1),
 libtext-diff-perl (= 1.45-2),
 libthai-data (= 0.1.29-2),
 libthai0 (= 0.1.29-2),
 libtiff6 (= 4.5.1+git230720-4),
 libtimedate-perl (= 2.3300-2),
 libtinfo6 (= 6.5-2),
 libtool (= 2.4.7-7),
 libtree-dagnode-perl (= 1.32-1),
 libtry-tiny-perl (= 0.31-2),
 libtsan2 (= 14.1.0-1),
 libtype-tiny-perl (= 2.004000-1),
 libubsan1 (= 14.1.0-1),
 libuchardet0 (= 0.0.8-1+b1),
 libudev1 (= 256~rc3-7),
 libunicode-map-perl (= 0.112-13+b4),
 libunistring5 (= 1.2-1),
 liburi-perl (= 5.28-1),
 libuuid1 (= 2.40.1-7),
 libwebp7 (= 1.4.0-0.1),
 libwww-perl (= 6.77-1),
 libwww-robotrules-perl (= 6.02-1),
 libx11-6 (= 2:1.8.7-1+b1),
 libx11-data (= 2:1.8.7-1),
 libxau6 (= 1:1.0.9-1+b1),
 libxaw7 (= 2:1.0.14-1+b2),
 libxcb-render0 (= 1.17.0-2),
 libxcb-shm0 (= 1.17.0-2),
 libxcb1 (= 1.17.0-2),
 libxdmcp6 (= 1:1.1.2-3+b1),
 libxext6 (= 2:1.3.4-1+b1),
 libxml-dom-perl (= 1.46-2),
 libxml-dom-xpath-perl (= 0.14-4),
 libxml-filter-buffertext-perl (= 1.01-7),
 libxml-libxml-perl (= 2.0207+dfsg+really+2.0134-3+b1),
 libxml-namespacesupport-perl (= 1.12-2),
 libxml-parser-perl (= 2.47-1+b3),
 libxml-perl (= 0.08-4),
 libxml-regexp-perl (= 0.04-1.1),
 libxml-sax-base-perl (= 1.09-3),
 libxml-sax-expatxs-perl (= 1.33-3+b4),
 libxml-sax-perl (= 1.02+dfsg-3),
 libxml-sax-writer-perl (= 0.57-3),
 libxml-simple-perl (= 2.25-2),
 libxml-twig-perl (= 1:3.52-3),
 libxml-writer-perl (= 0.900-2),
 libxml-xpath-perl (= 1.48-1),
 libxml-xpathengine-perl (= 0.14-2),
 libxml2 (= 2.12.7+dfsg-2),
 libxmu6 (= 2:1.1.3-3+b2),
 libxpm4 (= 1:3.5.17-1+b1),
 libxrender1 (= 1:0.9.10-1.1+b1),
 libxt6t64 (= 1:1.2.1-1.2),
 libyaml-perl (= 1.31-1),
 libyuv0 (= 0.0.1888.20240509-4),
 libzstd1 (= 1.5.5+dfsg2-2),
 linux-libc-dev (= 6.8.12-1),
 login (= 1:4.13+dfsg1-4),
 m4 (= 1.4.19-4),
 make (= 4.3-4.1),
 man-db (= 2.12.1-1),
 mariadb-common (= 1:10.11.8-1),
 mawk (= 1.3.4.20240123-1),
 mysql-common (= 5.8+1.1.0),
 ncurses-base (= 6.5-2),
 ncurses-bin (= 6.5-2),
 netbase (= 6.4),
 openssl (= 3.2.1-3),
 patch (= 2.7.6-7),
 perl (= 5.40.0~rc1-1),
 perl-base (= 5.40.0~rc1-1),
 perl-modules-5.40 (= 5.40.0~rc1-1),
 perl-openssl-defaults (= 7+b2),
 po-debconf (= 1.0.21+nmu1),
 rename (= 2.02-1),
 rpcsvc-proto (= 1.4.3-1),
 sed (= 4.9-2),
 sensible-utils (= 0.0.22),
 sysvinit-utils (= 3.09-1),
 tar (= 1.35+dfsg-3),
 ucf (= 3.0043+nmu1),
 usr-is-merged (= 39),
 util-linux (= 2.40.1-7),
 x11-common (= 1:7.7+23),
 xz-utils (= 5.6.1+really5.4.5-1),
 zlib1g (= 1:1.3.dfsg+really1.3.1-1)
Environment:
 DEB_BUILD_OPTIONS="parallel=2"
 LANG="en_GB.UTF-8"
 LC_ALL="C.UTF-8"
 LC_COLLATE="C.UTF-8"
 LD_LIBRARY_PATH="/usr/lib/libeatmydata"
 SOURCE_DATE_EPOCH="1629032163"


+------------------------------------------------------------------------------+
| Package contents                                                             |
+------------------------------------------------------------------------------+


bioperl_1.7.8-1_all.deb
-----------------------

 new Debian package, version 2.0.
 size 231124 bytes: control archive=4488 bytes.
    1182 bytes,    23 lines      control
    9628 bytes,   132 lines      md5sums
 Package: bioperl
 Version: 1.7.8-1
 Architecture: all
 Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
 Installed-Size: 675
 Depends: libbio-perl-perl (= 1.7.8-1), perl:any, libtest-most-perl
 Recommends: bioperl-run, perl-doc, libhttp-message-perl, libwww-perl, libcache-cache-perl, libbio-perl-run-perl, libdbi-perl, libgd-gd2-perl, libapache-dbi-perl, liburi-perl, libxml-simple-perl, libyaml-perl, libace-perl, liblist-moreutils-perl, libxml-twig-perl, libset-scalar-perl
 Suggests: groff-base
 Section: science
 Priority: optional
 Homepage: http://www.bioperl.org/
 Description: Perl tools for computational molecular biology
  The Bioperl project is a coordinated effort to collect computational methods
  routinely used in bioinformatics into a set of standard CPAN-style,
  well-documented, and freely available Perl modules. It is well-accepted
  throughout the community and used in many high-profile projects, e.g.,
  Ensembl.
  .
  The recommended packages are needed to run some of the included
  binaries, for a detailed explanation including the specific Perl
  modules please see README.Debian.
  .
  The suggested package enhances the manual pages.

drwxr-xr-x root/root         0 2021-08-15 12:56 ./
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/bin/
-rwxr-xr-x root/root      2764 2021-08-15 12:56 ./usr/bin/bp_aacomp
-rwxr-xr-x root/root      3599 2021-08-15 12:56 ./usr/bin/bp_bioflat_index
-rwxr-xr-x root/root      1508 2021-08-15 12:56 ./usr/bin/bp_biogetseq
-rwxr-xr-x root/root      2706 2021-08-15 12:56 ./usr/bin/bp_dbsplit
-rwxr-xr-x root/root      2769 2021-08-15 12:56 ./usr/bin/bp_extract_feature_seq
-rwxr-xr-x root/root      3905 2021-08-15 12:56 ./usr/bin/bp_fastam9_to_table
-rwxr-xr-x root/root      7288 2021-08-15 12:56 ./usr/bin/bp_fetch
-rwxr-xr-x root/root      1712 2021-08-15 12:56 ./usr/bin/bp_filter_search
-rwxr-xr-x root/root     15024 2021-08-15 12:56 ./usr/bin/bp_find-blast-matches
-rwxr-xr-x root/root      3330 2021-08-15 12:56 ./usr/bin/bp_gccalc
-rwxr-xr-x root/root     79645 2021-08-15 12:56 ./usr/bin/bp_genbank2gff3
-rwxr-xr-x root/root      4520 2021-08-15 12:56 ./usr/bin/bp_index
-rwxr-xr-x root/root      1780 2021-08-15 12:56 ./usr/bin/bp_local_taxonomydb_query
-rwxr-xr-x root/root      3142 2021-08-15 12:56 ./usr/bin/bp_make_mrna_protein
-rwxr-xr-x root/root      4801 2021-08-15 12:56 ./usr/bin/bp_mask_by_search
-rwxr-xr-x root/root      2944 2021-08-15 12:56 ./usr/bin/bp_mrtrans
-rwxr-xr-x root/root      4195 2021-08-15 12:56 ./usr/bin/bp_mutate
-rwxr-xr-x root/root       830 2021-08-15 12:56 ./usr/bin/bp_nexus2nh
-rwxr-xr-x root/root      3436 2021-08-15 12:56 ./usr/bin/bp_nrdb
-rwxr-xr-x root/root      6234 2021-08-15 12:56 ./usr/bin/bp_oligo_count
-rwxr-xr-x root/root      7220 2021-08-15 12:56 ./usr/bin/bp_process_gadfly
-rwxr-xr-x root/root      3655 2021-08-15 12:56 ./usr/bin/bp_process_sgd
-rwxr-xr-x root/root     24319 2021-08-15 12:56 ./usr/bin/bp_revtrans-motif
-rwxr-xr-x root/root      4093 2021-08-15 12:56 ./usr/bin/bp_search2alnblocks
-rwxr-xr-x root/root     12422 2021-08-15 12:56 ./usr/bin/bp_search2gff
-rwxr-xr-x root/root      2358 2021-08-15 12:56 ./usr/bin/bp_search2table
-rwxr-xr-x root/root      2642 2021-08-15 12:56 ./usr/bin/bp_search2tribe
-rwxr-xr-x root/root      1682 2021-08-15 12:56 ./usr/bin/bp_seq_length
-rwxr-xr-x root/root      2192 2021-08-15 12:56 ./usr/bin/bp_seqconvert
-rwxr-xr-x root/root      3736 2021-08-15 12:56 ./usr/bin/bp_seqcut
-rwxr-xr-x root/root      4498 2021-08-15 12:56 ./usr/bin/bp_seqpart
-rwxr-xr-x root/root      2242 2021-08-15 12:56 ./usr/bin/bp_seqret
-rwxr-xr-x root/root      1452 2021-08-15 12:56 ./usr/bin/bp_seqretsplit
-rwxr-xr-x root/root      4200 2021-08-15 12:56 ./usr/bin/bp_split_seq
-rwxr-xr-x root/root      5815 2021-08-15 12:56 ./usr/bin/bp_sreformat
-rwxr-xr-x root/root      3146 2021-08-15 12:56 ./usr/bin/bp_taxid4species
-rwxr-xr-x root/root      2843 2021-08-15 12:56 ./usr/bin/bp_taxonomy2tree
-rwxr-xr-x root/root      1527 2021-08-15 12:56 ./usr/bin/bp_translate_seq
-rwxr-xr-x root/root      1391 2021-08-15 12:56 ./usr/bin/bp_tree2pag
-rwxr-xr-x root/root      7407 2021-08-15 12:56 ./usr/bin/bp_unflatten_seq
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/
-rw-r--r-- root/root      2740 2021-02-03 05:04 ./usr/share/doc/bioperl/AUTHORS.gz
-rw-r--r-- root/root      2625 2021-02-03 05:04 ./usr/share/doc/bioperl/README.md
-rw-r--r-- root/root       942 2021-08-15 12:56 ./usr/share/doc/bioperl/changelog.Debian.gz
-rw-r--r-- root/root     31723 2021-02-03 05:04 ./usr/share/doc/bioperl/changelog.gz
-rw-r--r-- root/root      8717 2021-05-01 12:23 ./usr/share/doc/bioperl/copyright
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/
drwxr-xr-x root/root         0 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/Bio-DB-GFF/
-rw-r--r-- root/root     15280 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/Bio-DB-GFF/load_ucsc.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/align/
-rw-r--r-- root/root      6822 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/FastAlign.pl
-rw-r--r-- root/root      4700 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/align_on_codons.pl
-rw-r--r-- root/root      3489 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/aligntutorial.pl
-rw-r--r-- root/root     13526 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/align/simplealign.pl
-rw-r--r-- root/root      7810 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/classify_hits_kingdom
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/contributed/
-rw-r--r-- root/root      4650 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/contributed/nmrpdb_parse.pl
-rw-r--r-- root/root       644 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/contributed/prosite2perl.pl
-rw-r--r-- root/root       549 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/contributed/rebase2list.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/db/
-rw-r--r-- root/root      4838 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/est_tissue_query.pl
-rw-r--r-- root/root      1675 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/get_seqs.pl
-rw-r--r-- root/root      1290 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/rfetch.pl
-rw-r--r-- root/root       314 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/db/use_registry.pl
-rw-r--r-- root/root      2488 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/generate_random_seq.pl
-rw-r--r-- root/root      4241 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/longorf.pl
-rw-r--r-- root/root      5302 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/make_primers.pl
drwxr-xr-x root/root         0 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/quality/
-rw-r--r-- root/root      1577 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/quality/svgtrace.pl
-rw-r--r-- root/root      1163 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/rev_and_trans.pl
-rw-r--r-- root/root      2294 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/revcom_dir.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/root/
-rw-r--r-- root/root      7779 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/README
-rw-r--r-- root/root      4563 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions1.pl
-rw-r--r-- root/root      4506 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions2.pl
-rw-r--r-- root/root      1277 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions3.pl
-rw-r--r-- root/root      3338 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/root/exceptions4.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/searchio/
-rw-r--r-- root/root      6846 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/blast_example.pl
-rw-r--r-- root/root      3171 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/custom_writer.pl
-rw-r--r-- root/root      4036 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/hitwriter.pl
-rw-r--r-- root/root      3110 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/hspwriter.pl
-rw-r--r-- root/root      1947 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/htmlwriter.pl
-rw-r--r-- root/root      1628 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/psiblast_features.pl
-rw-r--r-- root/root      2213 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/psiblast_iterations.pl
-rw-r--r-- root/root      1939 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/rawwriter.pl
-rw-r--r-- root/root      3802 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/resultwriter.pl
-rw-r--r-- root/root       779 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/waba2gff.pl
-rw-r--r-- root/root      4533 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/searchio/waba2gff3.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/tk/
-rw-r--r-- root/root     52860 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tk/gsequence.pl
-rw-r--r-- root/root      3375 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tk/hitdisplay.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/tools/
-rw-r--r-- root/root      3437 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/extract_genes.pl
-rw-r--r-- root/root       608 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/gb_to_gff.pl
-rw-r--r-- root/root      5758 2021-08-15 12:56 ./usr/share/doc/bioperl/examples/tools/gff2ps.pl
-rw-r--r-- root/root      1217 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/parse_codeml.pl
-rw-r--r-- root/root      1377 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/reverse-translate.pl
-rw-r--r-- root/root      2386 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/run_genscan.pl
-rw-r--r-- root/root      2379 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/run_primer3.pl
-rw-r--r-- root/root      3850 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/seq_pattern.pl
-rw-r--r-- root/root     15008 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tools/standaloneblast.pl
drwxr-xr-x root/root         0 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tree/
-rw-r--r-- root/root       526 2021-02-03 05:04 ./usr/share/doc/bioperl/examples/tree/paup2phylip.pl
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/man/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/man/man1/
-rw-r--r-- root/root      1520 2021-08-15 12:56 ./usr/share/man/man1/bp_aacomp.1p.gz
-rw-r--r-- root/root      1453 2021-08-15 12:56 ./usr/share/man/man1/bp_bioflat_index.1p.gz
-rw-r--r-- root/root      1116 2021-08-15 12:56 ./usr/share/man/man1/bp_biogetseq.1p.gz
-rw-r--r-- root/root      1645 2021-08-15 12:56 ./usr/share/man/man1/bp_dbsplit.1p.gz
-rw-r--r-- root/root      1587 2021-08-15 12:56 ./usr/share/man/man1/bp_extract_feature_seq.1p.gz
-rw-r--r-- root/root      1411 2021-08-15 12:56 ./usr/share/man/man1/bp_fastam9_to_table.1p.gz
-rw-r--r-- root/root      2479 2021-08-15 12:56 ./usr/share/man/man1/bp_fetch.1p.gz
-rw-r--r-- root/root      1382 2021-08-15 12:56 ./usr/share/man/man1/bp_filter_search.1p.gz
-rw-r--r-- root/root      2107 2021-08-15 12:56 ./usr/share/man/man1/bp_find-blast-matches.1p.gz
-rw-r--r-- root/root      1549 2021-08-15 12:56 ./usr/share/man/man1/bp_gccalc.1p.gz
-rw-r--r-- root/root      4291 2021-08-15 12:56 ./usr/share/man/man1/bp_genbank2gff3.1p.gz
-rw-r--r-- root/root      2189 2021-08-15 12:56 ./usr/share/man/man1/bp_index.1p.gz
-rw-r--r-- root/root      1228 2021-08-15 12:56 ./usr/share/man/man1/bp_local_taxonomydb_query.1p.gz
-rw-r--r-- root/root      1307 2021-08-15 12:56 ./usr/share/man/man1/bp_make_mrna_protein.1p.gz
-rw-r--r-- root/root      1862 2021-08-15 12:56 ./usr/share/man/man1/bp_mask_by_search.1p.gz
-rw-r--r-- root/root      1259 2021-08-15 12:56 ./usr/share/man/man1/bp_mrtrans.1p.gz
-rw-r--r-- root/root      1504 2021-08-15 12:56 ./usr/share/man/man1/bp_mutate.1p.gz
-rw-r--r-- root/root      1021 2021-08-15 12:56 ./usr/share/man/man1/bp_nexus2nh.1p.gz
-rw-r--r-- root/root      1277 2021-08-15 12:56 ./usr/share/man/man1/bp_nrdb.1p.gz
-rw-r--r-- root/root      1691 2021-08-15 12:56 ./usr/share/man/man1/bp_oligo_count.1p.gz
-rw-r--r-- root/root      2050 2021-08-15 12:56 ./usr/share/man/man1/bp_process_gadfly.1p.gz
-rw-r--r-- root/root      1394 2021-08-15 12:56 ./usr/share/man/man1/bp_process_sgd.1p.gz
-rw-r--r-- root/root      1885 2021-08-15 12:56 ./usr/share/man/man1/bp_revtrans-motif.1p.gz
-rw-r--r-- root/root      1626 2021-08-15 12:56 ./usr/share/man/man1/bp_search2alnblocks.1p.gz
-rw-r--r-- root/root      2283 2021-08-15 12:56 ./usr/share/man/man1/bp_search2gff.1p.gz
-rw-r--r-- root/root      1343 2021-08-15 12:56 ./usr/share/man/man1/bp_search2table.1p.gz
-rw-r--r-- root/root      1494 2021-08-15 12:56 ./usr/share/man/man1/bp_search2tribe.1p.gz
-rw-r--r-- root/root      1456 2021-08-15 12:56 ./usr/share/man/man1/bp_seq_length.1p.gz
-rw-r--r-- root/root      1426 2021-08-15 12:56 ./usr/share/man/man1/bp_seqconvert.1p.gz
-rw-r--r-- root/root      1721 2021-08-15 12:56 ./usr/share/man/man1/bp_seqcut.1p.gz
-rw-r--r-- root/root      1852 2021-08-15 12:56 ./usr/share/man/man1/bp_seqpart.1p.gz
-rw-r--r-- root/root      1209 2021-08-15 12:56 ./usr/share/man/man1/bp_seqret.1p.gz
-rw-r--r-- root/root      1484 2021-08-15 12:56 ./usr/share/man/man1/bp_seqretsplit.1p.gz
-rw-r--r-- root/root      1579 2021-08-15 12:56 ./usr/share/man/man1/bp_split_seq.1p.gz
-rw-r--r-- root/root      1457 2021-08-15 12:56 ./usr/share/man/man1/bp_sreformat.1p.gz
-rw-r--r-- root/root      1410 2021-08-15 12:56 ./usr/share/man/man1/bp_taxid4species.1p.gz
-rw-r--r-- root/root      1460 2021-08-15 12:56 ./usr/share/man/man1/bp_taxonomy2tree.1p.gz
-rw-r--r-- root/root      1326 2021-08-15 12:56 ./usr/share/man/man1/bp_translate_seq.1p.gz
-rw-r--r-- root/root      1104 2021-08-15 12:56 ./usr/share/man/man1/bp_tree2pag.1p.gz
-rw-r--r-- root/root      2794 2021-08-15 12:56 ./usr/share/man/man1/bp_unflatten_seq.1p.gz


libbio-perl-perl_1.7.8-1_all.deb
--------------------------------

 new Debian package, version 2.0.
 size 2498256 bytes: control archive=23528 bytes.
    1520 bytes,    19 lines      control
   75475 bytes,   945 lines      md5sums
 Package: libbio-perl-perl
 Source: bioperl
 Version: 1.7.8-1
 Architecture: all
 Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
 Installed-Size: 8281
 Depends: libio-string-perl, libdata-stag-perl, perl:any
 Recommends: bioperl-run | libbio-perl-run-perl, libace-perl, libalgorithm-munkres-perl, libarray-compare-perl, libbio-asn1-entrezgene-perl, libclone-perl, libconvert-binary-c-perl, libdbd-sqlite3-perl, libdbd-mysql-perl, libdbd-pg-perl, libgd-perl, libgraph-perl, libgraphviz-perl, libhtml-parser-perl, libhtml-tableextract-perl, liblist-moreutils-perl, libpostscript-perl, libset-scalar-perl, libsoap-lite-perl, libsort-naturally-perl, libspreadsheet-parseexcel-perl, libspreadsheet-writeexcel-perl, libstorable-perl, libsvg-perl, libsvg-graph-perl, liburi-perl, libxml-dom-xpath-perl, libxml-parser-perl, libxml-sax-perl, libxml-sax-writer-perl, libxml-simple-perl, libxml-twig-perl, libxml-writer-perl, libxml-libxml-perl, libwww-perl
 Suggests: bioperl, libxml-sax-expatxs-perl
 Breaks: libbio-perl-run-perl (<< 1.7.3), roary (<< 3.13)
 Replaces: libbio-perl-run-perl (<< 1.7.3)
 Section: perl
 Priority: optional
 Homepage: http://www.bioperl.org/
 Description: BioPerl core perl modules
  BioPerl is a toolkit of perl modules useful in building bioinformatics
  solutions in Perl. It is built in an object-oriented manner so that many
  modules depend on each other to achieve a task. The collection of modules in
  libbio-perl-perl consist of the core of the functionality of bioperl.

drwxr-xr-x root/root         0 2021-08-15 12:56 ./
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/doc/libbio-perl-perl/
-rw-r--r-- root/root       944 2021-08-15 12:56 ./usr/share/doc/libbio-perl-perl/changelog.Debian.gz
-rw-r--r-- root/root     31723 2021-02-03 05:04 ./usr/share/doc/libbio-perl-perl/changelog.gz
-rw-r--r-- root/root      8717 2021-05-01 12:23 ./usr/share/doc/libbio-perl-perl/copyright
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/man/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/man/man3/
-rw-r--r-- root/root      5879 2021-08-15 12:56 ./usr/share/man/man3/Bio::Align::AlignI.3pm.gz
-rw-r--r-- root/root      5538 2021-08-15 12:56 ./usr/share/man/man3/Bio::Align::DNAStatistics.3pm.gz
-rw-r--r-- root/root      2101 2021-08-15 12:56 ./usr/share/man/man3/Bio::Align::PairwiseStatistics.3pm.gz
-rw-r--r-- root/root      2297 2021-08-15 12:56 ./usr/share/man/man3/Bio::Align::ProteinStatistics.3pm.gz
-rw-r--r-- root/root      1811 2021-08-15 12:56 ./usr/share/man/man3/Bio::Align::StatisticsI.3pm.gz
-rw-r--r-- root/root      3371 2021-08-15 12:56 ./usr/share/man/man3/Bio::Align::Utilities.3pm.gz
-rw-r--r-- root/root      5056 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO.3pm.gz
-rw-r--r-- root/root      4251 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::Handler::GenericAlignHandler.3pm.gz
-rw-r--r-- root/root      2355 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::arp.3pm.gz
-rw-r--r-- root/root      2432 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::bl2seq.3pm.gz
-rw-r--r-- root/root      2163 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::clustalw.3pm.gz
-rw-r--r-- root/root      1894 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::emboss.3pm.gz
-rw-r--r-- root/root      1888 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::fasta.3pm.gz
-rw-r--r-- root/root      1870 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::largemultifasta.3pm.gz
-rw-r--r-- root/root      1926 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::maf.3pm.gz
-rw-r--r-- root/root      1617 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::mase.3pm.gz
-rw-r--r-- root/root      1986 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::mega.3pm.gz
-rw-r--r-- root/root      2029 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::meme.3pm.gz
-rw-r--r-- root/root      2011 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::metafasta.3pm.gz
-rw-r--r-- root/root      1735 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::msf.3pm.gz
-rw-r--r-- root/root      2549 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::nexus.3pm.gz
-rw-r--r-- root/root      1592 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::pfam.3pm.gz
-rw-r--r-- root/root      3080 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::phylip.3pm.gz
-rw-r--r-- root/root      1740 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::po.3pm.gz
-rw-r--r-- root/root      2284 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::proda.3pm.gz
-rw-r--r-- root/root      1618 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::prodom.3pm.gz
-rw-r--r-- root/root      1796 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::psi.3pm.gz
-rw-r--r-- root/root      1842 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::selex.3pm.gz
-rw-r--r-- root/root      1993 2021-08-15 12:56 ./usr/share/man/man3/Bio::AlignIO::xmfa.3pm.gz
-rw-r--r-- root/root      7223 2021-08-15 12:56 ./usr/share/man/man3/Bio::AnalysisI.3pm.gz
-rw-r--r-- root/root      2789 2021-08-15 12:56 ./usr/share/man/man3/Bio::AnalysisParserI.3pm.gz
-rw-r--r-- root/root      2845 2021-08-15 12:56 ./usr/share/man/man3/Bio::AnalysisResultI.3pm.gz
-rw-r--r-- root/root      1951 2021-08-15 12:56 ./usr/share/man/man3/Bio::AnnotatableI.3pm.gz
-rw-r--r-- root/root      2293 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::AnnotationFactory.3pm.gz
-rw-r--r-- root/root      3888 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::Collection.3pm.gz
-rw-r--r-- root/root      1960 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::Comment.3pm.gz
-rw-r--r-- root/root      3256 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::DBLink.3pm.gz
-rw-r--r-- root/root      3809 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::OntologyTerm.3pm.gz
-rw-r--r-- root/root      3291 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::Reference.3pm.gz
-rw-r--r-- root/root      2835 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::Relation.3pm.gz
-rw-r--r-- root/root      2662 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::SimpleValue.3pm.gz
-rw-r--r-- root/root      3141 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::StructuredValue.3pm.gz
-rw-r--r-- root/root      4860 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::TagTree.3pm.gz
-rw-r--r-- root/root      1938 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::Target.3pm.gz
-rw-r--r-- root/root      2177 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::Tree.3pm.gz
-rw-r--r-- root/root      1742 2021-08-15 12:56 ./usr/share/man/man3/Bio::Annotation::TypeManager.3pm.gz
-rw-r--r-- root/root      3203 2021-08-15 12:56 ./usr/share/man/man3/Bio::AnnotationCollectionI.3pm.gz
-rw-r--r-- root/root      2879 2021-08-15 12:56 ./usr/share/man/man3/Bio::AnnotationI.3pm.gz
-rw-r--r-- root/root      1953 2021-08-15 12:56 ./usr/share/man/man3/Bio::CodonUsage::IO.3pm.gz
-rw-r--r-- root/root      3494 2021-08-15 12:56 ./usr/share/man/man3/Bio::CodonUsage::Table.3pm.gz
-rw-r--r-- root/root      2925 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::DBFetch.3pm.gz
-rw-r--r-- root/root      1828 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Failover.3pm.gz
-rw-r--r-- root/root      3262 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Fasta.3pm.gz
-rw-r--r-- root/root      2468 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::FileCache.3pm.gz
-rw-r--r-- root/root      2958 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat.3pm.gz
-rw-r--r-- root/root      2087 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat::BDB.3pm.gz
-rw-r--r-- root/root      1582 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat::BDB::embl.3pm.gz
-rw-r--r-- root/root      1583 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat::BDB::fasta.3pm.gz
-rw-r--r-- root/root      1583 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat::BDB::genbank.3pm.gz
-rw-r--r-- root/root      1586 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat::BDB::swiss.3pm.gz
-rw-r--r-- root/root      5031 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Flat::BinarySearch.3pm.gz
-rw-r--r-- root/root      1561 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::GFF::Util::Binning.3pm.gz
-rw-r--r-- root/root      1563 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::GFF::Util::Rearrange.3pm.gz
-rw-r--r-- root/root      3118 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::GenericWebAgent.3pm.gz
-rw-r--r-- root/root      1766 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::InMemoryCache.3pm.gz
-rw-r--r-- root/root      6282 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::IndexedBase.3pm.gz
-rw-r--r-- root/root      2196 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::LocationI.3pm.gz
-rw-r--r-- root/root      3535 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Qual.3pm.gz
-rw-r--r-- root/root      3289 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Query::WebQuery.3pm.gz
-rw-r--r-- root/root      2382 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::QueryI.3pm.gz
-rw-r--r-- root/root      1987 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::RandomAccessI.3pm.gz
-rw-r--r-- root/root      2179 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::ReferenceI.3pm.gz
-rw-r--r-- root/root      2226 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Registry.3pm.gz
-rw-r--r-- root/root      2365 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::SeqI.3pm.gz
-rw-r--r-- root/root      3025 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Taxonomy.3pm.gz
-rw-r--r-- root/root      2786 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Taxonomy::flatfile.3pm.gz
-rw-r--r-- root/root      2084 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Taxonomy::greengenes.3pm.gz
-rw-r--r-- root/root      2977 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Taxonomy::list.3pm.gz
-rw-r--r-- root/root      2086 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::Taxonomy::silva.3pm.gz
-rw-r--r-- root/root      2586 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::UpdateableSeqI.3pm.gz
-rw-r--r-- root/root      4458 2021-08-15 12:56 ./usr/share/man/man3/Bio::DB::WebDBSeqI.3pm.gz
-rw-r--r-- root/root      1866 2021-08-15 12:56 ./usr/share/man/man3/Bio::DBLinkContainerI.3pm.gz
-rw-r--r-- root/root      3580 2021-08-15 12:56 ./usr/share/man/man3/Bio::Das::FeatureTypeI.3pm.gz
-rw-r--r-- root/root      4347 2021-08-15 12:56 ./usr/share/man/man3/Bio::Das::SegmentI.3pm.gz
-rw-r--r-- root/root      5176 2021-08-15 12:56 ./usr/share/man/man3/Bio::DasI.3pm.gz
-rw-r--r-- root/root      2038 2021-08-15 12:56 ./usr/share/man/man3/Bio::DescribableI.3pm.gz
-rw-r--r-- root/root      1711 2021-08-15 12:56 ./usr/share/man/man3/Bio::Event::EventGeneratorI.3pm.gz
-rw-r--r-- root/root      3708 2021-08-15 12:56 ./usr/share/man/man3/Bio::Event::EventHandlerI.3pm.gz
-rw-r--r-- root/root      2312 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::AnalysisI.3pm.gz
-rw-r--r-- root/root      1698 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::ApplicationFactoryI.3pm.gz
-rw-r--r-- root/root      2221 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::DriverFactory.3pm.gz
-rw-r--r-- root/root      2030 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::FTLocationFactory.3pm.gz
-rw-r--r-- root/root      1871 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::LocationFactoryI.3pm.gz
-rw-r--r-- root/root      2579 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::ObjectBuilderI.3pm.gz
-rw-r--r-- root/root      2718 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::ObjectFactory.3pm.gz
-rw-r--r-- root/root      1831 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::ObjectFactoryI.3pm.gz
-rw-r--r-- root/root      2808 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactory.3pm.gz
-rw-r--r-- root/root      2302 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::SeqAnalysisParserFactoryI.3pm.gz
-rw-r--r-- root/root      2016 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::SequenceFactoryI.3pm.gz
-rw-r--r-- root/root      3104 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::SequenceProcessorI.3pm.gz
-rw-r--r-- root/root      2171 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::SequenceStreamI.3pm.gz
-rw-r--r-- root/root      1903 2021-08-15 12:56 ./usr/share/man/man3/Bio::Factory::TreeFactoryI.3pm.gz
-rw-r--r-- root/root      2913 2021-08-15 12:56 ./usr/share/man/man3/Bio::FeatureHolderI.3pm.gz
-rw-r--r-- root/root      3615 2021-08-15 12:56 ./usr/share/man/man3/Bio::HandlerBaseI.3pm.gz
-rw-r--r-- root/root      1893 2021-08-15 12:56 ./usr/share/man/man3/Bio::IdCollectionI.3pm.gz
-rw-r--r-- root/root      2588 2021-08-15 12:56 ./usr/share/man/man3/Bio::IdentifiableI.3pm.gz
-rw-r--r-- root/root      4851 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::Abstract.3pm.gz
-rw-r--r-- root/root      2608 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::AbstractSeq.3pm.gz
-rw-r--r-- root/root      4891 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::Blast.3pm.gz
-rw-r--r-- root/root      4690 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::BlastTable.3pm.gz
-rw-r--r-- root/root      2235 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::EMBL.3pm.gz
-rw-r--r-- root/root      2860 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::Fasta.3pm.gz
-rw-r--r-- root/root      2594 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::Fastq.3pm.gz
-rw-r--r-- root/root      2605 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::GenBank.3pm.gz
-rw-r--r-- root/root      2882 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::Qual.3pm.gz
-rw-r--r-- root/root      2144 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::SwissPfam.3pm.gz
-rw-r--r-- root/root      2659 2021-08-15 12:56 ./usr/share/man/man3/Bio::Index::Swissprot.3pm.gz
-rw-r--r-- root/root      4447 2021-08-15 12:56 ./usr/share/man/man3/Bio::LocatableSeq.3pm.gz
-rw-r--r-- root/root      3854 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::Atomic.3pm.gz
-rw-r--r-- root/root      1984 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::AvWithinCoordPolicy.3pm.gz
-rw-r--r-- root/root      2157 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::CoordinatePolicyI.3pm.gz
-rw-r--r-- root/root      3660 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::Fuzzy.3pm.gz
-rw-r--r-- root/root      2842 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::FuzzyLocationI.3pm.gz
-rw-r--r-- root/root      1906 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::NarrowestCoordPolicy.3pm.gz
-rw-r--r-- root/root      3122 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::Simple.3pm.gz
-rw-r--r-- root/root      4407 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::Split.3pm.gz
-rw-r--r-- root/root      3053 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::SplitLocationI.3pm.gz
-rw-r--r-- root/root      1911 2021-08-15 12:56 ./usr/share/man/man3/Bio::Location::WidestCoordPolicy.3pm.gz
-rw-r--r-- root/root      4041 2021-08-15 12:56 ./usr/share/man/man3/Bio::LocationI.3pm.gz
-rw-r--r-- root/root      3531 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::Generic.3pm.gz
-rw-r--r-- root/root      2367 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::IO.3pm.gz
-rw-r--r-- root/root      1842 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::IO::mlagan.3pm.gz
-rw-r--r-- root/root      1828 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::IO::phylip.3pm.gz
-rw-r--r-- root/root      1821 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::IO::scoring.3pm.gz
-rw-r--r-- root/root      2243 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::MatrixI.3pm.gz
-rw-r--r-- root/root      2242 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::Mlagan.3pm.gz
-rw-r--r-- root/root      3116 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::IO.3pm.gz
-rw-r--r-- root/root      2244 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::IO::mast.3pm.gz
-rw-r--r-- root/root      2293 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::IO::masta.3pm.gz
-rw-r--r-- root/root      2426 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::IO::meme.3pm.gz
-rw-r--r-- root/root      1753 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::IO::psiblast.3pm.gz
-rw-r--r-- root/root      1920 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::IO::transfac.3pm.gz
-rw-r--r-- root/root      2916 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::InstanceSite.3pm.gz
-rw-r--r-- root/root      2450 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::InstanceSiteI.3pm.gz
-rw-r--r-- root/root      6059 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::ProtMatrix.3pm.gz
-rw-r--r-- root/root      3354 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::ProtPsm.3pm.gz
-rw-r--r-- root/root      3185 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::Psm.3pm.gz
-rw-r--r-- root/root      2315 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::PsmHeader.3pm.gz
-rw-r--r-- root/root      2746 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::PsmHeaderI.3pm.gz
-rw-r--r-- root/root      3233 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::PsmI.3pm.gz
-rw-r--r-- root/root      6211 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::SiteMatrix.3pm.gz
-rw-r--r-- root/root      4553 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PSM::SiteMatrixI.3pm.gz
-rw-r--r-- root/root      2898 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::PhylipDist.3pm.gz
-rw-r--r-- root/root      1961 2021-08-15 12:56 ./usr/share/man/man3/Bio::Matrix::Scoring.3pm.gz
-rw-r--r-- root/root      2039 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::DocumentRegistry.3pm.gz
-rw-r--r-- root/root      2632 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::GOterm.3pm.gz
-rw-r--r-- root/root      2935 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::InterProTerm.3pm.gz
-rw-r--r-- root/root      3951 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::OBOEngine.3pm.gz
-rw-r--r-- root/root      2075 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::OBOterm.3pm.gz
-rw-r--r-- root/root      4688 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::Ontology.3pm.gz
-rw-r--r-- root/root      4491 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::OntologyEngineI.3pm.gz
-rw-r--r-- root/root      3733 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::OntologyI.3pm.gz
-rw-r--r-- root/root      3175 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::OntologyStore.3pm.gz
-rw-r--r-- root/root      2179 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::Path.3pm.gz
-rw-r--r-- root/root      2260 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::PathI.3pm.gz
-rw-r--r-- root/root      2919 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::Relationship.3pm.gz
-rw-r--r-- root/root      1829 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::RelationshipFactory.3pm.gz
-rw-r--r-- root/root      2451 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::RelationshipI.3pm.gz
-rw-r--r-- root/root      2850 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::RelationshipType.3pm.gz
-rw-r--r-- root/root      2459 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::SimpleGOEngine::GraphAdaptor.3pm.gz
-rw-r--r-- root/root      3978 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::SimpleOntologyEngine.3pm.gz
-rw-r--r-- root/root      4870 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::Term.3pm.gz
-rw-r--r-- root/root      2041 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::TermFactory.3pm.gz
-rw-r--r-- root/root      3165 2021-08-15 12:56 ./usr/share/man/man3/Bio::Ontology::TermI.3pm.gz
-rw-r--r-- root/root      3164 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO.3pm.gz
-rw-r--r-- root/root      2372 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::Handlers::BaseSAXHandler.3pm.gz
-rw-r--r-- root/root      2639 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::Handlers::InterProHandler.3pm.gz
-rw-r--r-- root/root      2928 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::Handlers::InterPro_BioSQL_Handler.3pm.gz
-rw-r--r-- root/root      2430 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::InterProParser.3pm.gz
-rw-r--r-- root/root      3230 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::dagflat.3pm.gz
-rw-r--r-- root/root      2428 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::goflat.3pm.gz
-rw-r--r-- root/root      2892 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::obo.3pm.gz
-rw-r--r-- root/root      3174 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::simplehierarchy.3pm.gz
-rw-r--r-- root/root      2363 2021-08-15 12:56 ./usr/share/man/man3/Bio::OntologyIO::soflat.3pm.gz
-rw-r--r-- root/root      3326 2021-08-15 12:56 ./usr/share/man/man3/Bio::ParameterBaseI.3pm.gz
-rw-r--r-- root/root      6772 2021-08-15 12:56 ./usr/share/man/man3/Bio::PrimarySeq.3pm.gz
-rw-r--r-- root/root      6642 2021-08-15 12:56 ./usr/share/man/man3/Bio::PrimarySeqI.3pm.gz
-rw-r--r-- root/root      4986 2021-08-15 12:56 ./usr/share/man/man3/Bio::PullParserI.3pm.gz
-rw-r--r-- root/root      3021 2021-08-15 12:56 ./usr/share/man/man3/Bio::Range.3pm.gz
-rw-r--r-- root/root      3687 2021-08-15 12:56 ./usr/share/man/man3/Bio::RangeI.3pm.gz
-rw-r--r-- root/root      4053 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::Exception.3pm.gz
-rw-r--r-- root/root      2409 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::HTTPget.3pm.gz
-rw-r--r-- root/root      5689 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::IO.3pm.gz
-rw-r--r-- root/root      4126 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::Root.3pm.gz
-rw-r--r-- root/root      6106 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::RootI.3pm.gz
-rw-r--r-- root/root      2869 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::Storable.3pm.gz
-rw-r--r-- root/root      3409 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::Test.3pm.gz
-rw-r--r-- root/root       992 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::TestObject.3pm.gz
-rw-r--r-- root/root      7312 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::Utilities.3pm.gz
-rw-r--r-- root/root      1279 2021-08-15 12:56 ./usr/share/man/man3/Bio::Root::Version.3pm.gz
-rw-r--r-- root/root      1833 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::BlastStatistics.3pm.gz
-rw-r--r-- root/root      3932 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::BlastUtils.3pm.gz
-rw-r--r-- root/root      1956 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::DatabaseI.3pm.gz
-rw-r--r-- root/root      1887 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::GenericDatabase.3pm.gz
-rw-r--r-- root/root      1882 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::GenericStatistics.3pm.gz
-rw-r--r-- root/root      9339 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::BlastHSP.3pm.gz
-rw-r--r-- root/root      2661 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::BlastPullHSP.3pm.gz
-rw-r--r-- root/root      1908 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::FastaHSP.3pm.gz
-rw-r--r-- root/root      7018 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::GenericHSP.3pm.gz
-rw-r--r-- root/root      1884 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::HSPFactory.3pm.gz
-rw-r--r-- root/root      5095 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::HSPI.3pm.gz
-rw-r--r-- root/root      4655 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::ModelHSP.3pm.gz
-rw-r--r-- root/root      1887 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::PSLHSP.3pm.gz
-rw-r--r-- root/root      9345 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::PsiBlastHSP.3pm.gz
-rw-r--r-- root/root      5343 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::PullHSPI.3pm.gz
-rw-r--r-- root/root      1964 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::HSP::WABAHSP.3pm.gz
-rw-r--r-- root/root      2451 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::BlastHit.3pm.gz
-rw-r--r-- root/root      2616 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::BlastPullHit.3pm.gz
-rw-r--r-- root/root      1940 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::Fasta.3pm.gz
-rw-r--r-- root/root      8843 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::GenericHit.3pm.gz
-rw-r--r-- root/root      1878 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::HitFactory.3pm.gz
-rw-r--r-- root/root      6930 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::HitI.3pm.gz
-rw-r--r-- root/root      5562 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::ModelHit.3pm.gz
-rw-r--r-- root/root     12521 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::PsiBlastHit.3pm.gz
-rw-r--r-- root/root      7800 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Hit::PullHitI.3pm.gz
-rw-r--r-- root/root      3277 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Iteration::GenericIteration.3pm.gz
-rw-r--r-- root/root      5361 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Iteration::IterationI.3pm.gz
-rw-r--r-- root/root      1753 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Processor.3pm.gz
-rw-r--r-- root/root      2749 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::BlastPullResult.3pm.gz
-rw-r--r-- root/root      3590 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::BlastResult.3pm.gz
-rw-r--r-- root/root      3298 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::CrossMatchResult.3pm.gz
-rw-r--r-- root/root      4813 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::GenericResult.3pm.gz
-rw-r--r-- root/root      1956 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::INFERNALResult.3pm.gz
-rw-r--r-- root/root      4161 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::PullResultI.3pm.gz
-rw-r--r-- root/root      1884 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::ResultFactory.3pm.gz
-rw-r--r-- root/root      4111 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::ResultI.3pm.gz
-rw-r--r-- root/root      1981 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Result::WABAResult.3pm.gz
-rw-r--r-- root/root      4382 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::SearchUtils.3pm.gz
-rw-r--r-- root/root      1824 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::StatisticsI.3pm.gz
-rw-r--r-- root/root      3165 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Tiling::MapTileUtils.3pm.gz
-rw-r--r-- root/root      7621 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Tiling::MapTiling.3pm.gz
-rw-r--r-- root/root      3793 2021-08-15 12:56 ./usr/share/man/man3/Bio::Search::Tiling::TilingI.3pm.gz
-rw-r--r-- root/root      5087 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO.3pm.gz
-rw-r--r-- root/root      2376 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::EventHandlerI.3pm.gz
-rw-r--r-- root/root      2514 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::FastHitEventBuilder.3pm.gz
-rw-r--r-- root/root      2300 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::IteratedSearchResultEventBuilder.3pm.gz
-rw-r--r-- root/root      3114 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::SearchResultEventBuilder.3pm.gz
-rw-r--r-- root/root      1763 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::SearchWriterI.3pm.gz
-rw-r--r-- root/root      2514 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::Writer::GbrowseGFF.3pm.gz
-rw-r--r-- root/root      3495 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::Writer::HSPTableWriter.3pm.gz
-rw-r--r-- root/root      4797 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::Writer::HTMLResultWriter.3pm.gz
-rw-r--r-- root/root      3753 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::Writer::HitTableWriter.3pm.gz
-rw-r--r-- root/root      3101 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::Writer::ResultTableWriter.3pm.gz
-rw-r--r-- root/root      4276 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::Writer::TextResultWriter.3pm.gz
-rw-r--r-- root/root      2518 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::axt.3pm.gz
-rw-r--r-- root/root      5039 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::blast.3pm.gz
-rw-r--r-- root/root      2475 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::blast_pull.3pm.gz
-rw-r--r-- root/root      2937 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::blasttable.3pm.gz
-rw-r--r-- root/root      2349 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::cross_match.3pm.gz
-rw-r--r-- root/root      2794 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::erpin.3pm.gz
-rw-r--r-- root/root      3273 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::exonerate.3pm.gz
-rw-r--r-- root/root      3268 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::fasta.3pm.gz
-rw-r--r-- root/root      2547 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::gmap_f9.3pm.gz
-rw-r--r-- root/root      3811 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::infernal.3pm.gz
-rw-r--r-- root/root      2866 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::megablast.3pm.gz
-rw-r--r-- root/root      2562 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::psl.3pm.gz
-rw-r--r-- root/root      3493 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::rnamotif.3pm.gz
-rw-r--r-- root/root      2841 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::sim4.3pm.gz
-rw-r--r-- root/root      2385 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::waba.3pm.gz
-rw-r--r-- root/root      2367 2021-08-15 12:56 ./usr/share/man/man3/Bio::SearchIO::wise.3pm.gz
-rw-r--r-- root/root     11463 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq.3pm.gz
-rw-r--r-- root/root      2846 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::BaseSeqProcessor.3pm.gz
-rw-r--r-- root/root      4739 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::EncodedSeq.3pm.gz
-rw-r--r-- root/root      2351 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::LargeLocatableSeq.3pm.gz
-rw-r--r-- root/root      2208 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::LargePrimarySeq.3pm.gz
-rw-r--r-- root/root      2104 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::LargeSeq.3pm.gz
-rw-r--r-- root/root      2047 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::LargeSeqI.3pm.gz
-rw-r--r-- root/root      5098 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::Meta.3pm.gz
-rw-r--r-- root/root      4331 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::Meta::Array.3pm.gz
-rw-r--r-- root/root      4421 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::MetaI.3pm.gz
-rw-r--r-- root/root      3974 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::PrimaryQual.3pm.gz
-rw-r--r-- root/root      3621 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::PrimedSeq.3pm.gz
-rw-r--r-- root/root      4841 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::QualI.3pm.gz
-rw-r--r-- root/root      4057 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::Quality.3pm.gz
-rw-r--r-- root/root      3163 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::RichSeq.3pm.gz
-rw-r--r-- root/root      2393 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::RichSeqI.3pm.gz
-rw-r--r-- root/root      4992 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::SeqBuilder.3pm.gz
-rw-r--r-- root/root      2062 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::SeqFactory.3pm.gz
-rw-r--r-- root/root      1963 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::SeqFastaSpeedFactory.3pm.gz
-rw-r--r-- root/root      5889 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::SequenceTrace.3pm.gz
-rw-r--r-- root/root      3569 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::SimulatedRead.3pm.gz
-rw-r--r-- root/root      2986 2021-08-15 12:56 ./usr/share/man/man3/Bio::Seq::TraceI.3pm.gz
-rw-r--r-- root/root      2193 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqAnalysisParserI.3pm.gz
-rw-r--r-- root/root      2131 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Amplicon.3pm.gz
-rw-r--r-- root/root      4025 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::AnnotationAdaptor.3pm.gz
-rw-r--r-- root/root      3621 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Collection.3pm.gz
-rw-r--r-- root/root      2305 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::CollectionI.3pm.gz
-rw-r--r-- root/root      3475 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Computation.3pm.gz
-rw-r--r-- root/root      3038 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::FeaturePair.3pm.gz
-rw-r--r-- root/root      2661 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::Exon.3pm.gz
-rw-r--r-- root/root      1965 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::ExonI.3pm.gz
-rw-r--r-- root/root      3058 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructure.3pm.gz
-rw-r--r-- root/root      2160 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::GeneStructureI.3pm.gz
-rw-r--r-- root/root      2011 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::Intron.3pm.gz
-rw-r--r-- root/root      1715 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::NC_Feature.3pm.gz
-rw-r--r-- root/root      1551 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::Poly_A_site.3pm.gz
-rw-r--r-- root/root      1542 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::Promoter.3pm.gz
-rw-r--r-- root/root      4301 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::Transcript.3pm.gz
-rw-r--r-- root/root      2355 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::TranscriptI.3pm.gz
-rw-r--r-- root/root      1921 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Gene::UTR.3pm.gz
-rw-r--r-- root/root      5999 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Generic.3pm.gz
-rw-r--r-- root/root      4128 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Lite.3pm.gz
-rw-r--r-- root/root      2948 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::PositionProxy.3pm.gz
-rw-r--r-- root/root      3252 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Primer.3pm.gz
-rw-r--r-- root/root      2015 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Similarity.3pm.gz
-rw-r--r-- root/root      2380 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::SimilarityPair.3pm.gz
-rw-r--r-- root/root      2386 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::SubSeq.3pm.gz
-rw-r--r-- root/root      2734 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Tools::FeatureNamer.3pm.gz
-rw-r--r-- root/root      2255 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Tools::IDHandler.3pm.gz
-rw-r--r-- root/root      2929 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Tools::TypeMapper.3pm.gz
-rw-r--r-- root/root     11152 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::Tools::Unflattener.3pm.gz
-rw-r--r-- root/root      2100 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeature::TypedSeqFeatureI.3pm.gz
-rw-r--r-- root/root      5188 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqFeatureI.3pm.gz
-rw-r--r-- root/root      2966 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqI.3pm.gz
-rw-r--r-- root/root      6626 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO.3pm.gz
-rw-r--r-- root/root      2210 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::FTHelper.3pm.gz
-rw-r--r-- root/root      3893 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::Handler::GenericRichSeqHandler.3pm.gz
-rw-r--r-- root/root      1869 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::MultiFile.3pm.gz
-rw-r--r-- root/root      1960 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::ace.3pm.gz
-rw-r--r-- root/root      2019 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::asciitree.3pm.gz
-rw-r--r-- root/root      6090 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::bsml.3pm.gz
-rw-r--r-- root/root      1936 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::bsml_sax.3pm.gz
-rw-r--r-- root/root      3381 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::embl.3pm.gz
-rw-r--r-- root/root      2419 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::embldriver.3pm.gz
-rw-r--r-- root/root      2319 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::fasta.3pm.gz
-rw-r--r-- root/root      3931 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::fastq.3pm.gz
-rw-r--r-- root/root      2116 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::game.3pm.gz
-rw-r--r-- root/root      2647 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::game::featHandler.3pm.gz
-rw-r--r-- root/root      1839 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::game::gameHandler.3pm.gz
-rw-r--r-- root/root      2530 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::game::gameSubs.3pm.gz
-rw-r--r-- root/root      4130 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::game::gameWriter.3pm.gz
-rw-r--r-- root/root      2290 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::game::seqHandler.3pm.gz
-rw-r--r-- root/root      3308 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::gbdriver.3pm.gz
-rw-r--r-- root/root      1761 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::gbxml.3pm.gz
-rw-r--r-- root/root      2102 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::gcg.3pm.gz
-rw-r--r-- root/root      4261 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::genbank.3pm.gz
-rw-r--r-- root/root      2318 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::kegg.3pm.gz
-rw-r--r-- root/root      2103 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::largefasta.3pm.gz
-rw-r--r-- root/root      1968 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::locuslink.3pm.gz
-rw-r--r-- root/root      4343 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::mbsout.3pm.gz
-rw-r--r-- root/root      2230 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::metafasta.3pm.gz
-rw-r--r-- root/root      5072 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::msout.3pm.gz
-rw-r--r-- root/root      2582 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::phd.3pm.gz
-rw-r--r-- root/root      1875 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::pir.3pm.gz
-rw-r--r-- root/root      2428 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::qual.3pm.gz
-rw-r--r-- root/root      2012 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::raw.3pm.gz
-rw-r--r-- root/root      4095 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::scf.3pm.gz
-rw-r--r-- root/root      3897 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::seqxml.3pm.gz
-rw-r--r-- root/root      4446 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::swiss.3pm.gz
-rw-r--r-- root/root      2217 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::swissdriver.3pm.gz
-rw-r--r-- root/root      2225 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::tab.3pm.gz
-rw-r--r-- root/root      4861 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::table.3pm.gz
-rw-r--r-- root/root      1677 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::tigr.3pm.gz
-rw-r--r-- root/root      1660 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::tigrxml.3pm.gz
-rw-r--r-- root/root      2738 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::tinyseq.3pm.gz
-rw-r--r-- root/root      2143 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqIO::tinyseq::tinyseqHandler.3pm.gz
-rw-r--r-- root/root      7395 2021-08-15 12:56 ./usr/share/man/man3/Bio::SeqUtils.3pm.gz
-rw-r--r-- root/root     11449 2021-08-15 12:56 ./usr/share/man/man3/Bio::SimpleAlign.3pm.gz
-rw-r--r-- root/root      3600 2021-08-15 12:56 ./usr/share/man/man3/Bio::SimpleAnalysisI.3pm.gz
-rw-r--r-- root/root      3749 2021-08-15 12:56 ./usr/share/man/man3/Bio::Species.3pm.gz
-rw-r--r-- root/root      5484 2021-08-15 12:56 ./usr/share/man/man3/Bio::Taxon.3pm.gz
-rw-r--r-- root/root      7858 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Alignment::Consed.3pm.gz
-rw-r--r-- root/root      3986 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Alignment::Trim.3pm.gz
-rw-r--r-- root/root      3247 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::AmpliconSearch.3pm.gz
-rw-r--r-- root/root      2293 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Analysis::SimpleAnalysisBase.3pm.gz
-rw-r--r-- root/root      3394 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::AnalysisResult.3pm.gz
-rw-r--r-- root/root      1833 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Blat.3pm.gz
-rw-r--r-- root/root      5106 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::CodonTable.3pm.gz
-rw-r--r-- root/root      2100 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Coil.3pm.gz
-rw-r--r-- root/root      2904 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::ECnumber.3pm.gz
-rw-r--r-- root/root      2176 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::EMBOSS::Palindrome.3pm.gz
-rw-r--r-- root/root      2453 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::EPCR.3pm.gz
-rw-r--r-- root/root      2520 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::ESTScan.3pm.gz
-rw-r--r-- root/root      2529 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Eponine.3pm.gz
-rw-r--r-- root/root      2597 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Est2Genome.3pm.gz
-rw-r--r-- root/root      2753 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Fgenesh.3pm.gz
-rw-r--r-- root/root      2052 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::FootPrinter.3pm.gz
-rw-r--r-- root/root      4118 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::GFF.3pm.gz
-rw-r--r-- root/root      2399 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Geneid.3pm.gz
-rw-r--r-- root/root      2900 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Genemark.3pm.gz
-rw-r--r-- root/root      2197 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Genewise.3pm.gz
-rw-r--r-- root/root      2248 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Genomewise.3pm.gz
-rw-r--r-- root/root      2723 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Genscan.3pm.gz
-rw-r--r-- root/root      3057 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Glimmer.3pm.gz
-rw-r--r-- root/root      2254 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Grail.3pm.gz
-rw-r--r-- root/root      4338 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::GuessSeqFormat.3pm.gz
-rw-r--r-- root/root      3522 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::IUPAC.3pm.gz
-rw-r--r-- root/root      5249 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Lucy.3pm.gz
-rw-r--r-- root/root      2665 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::MZEF.3pm.gz
-rw-r--r-- root/root      2002 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Match.3pm.gz
-rw-r--r-- root/root      3134 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::OddCodes.3pm.gz
-rw-r--r-- root/root      2180 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Phylo::Gerp.3pm.gz
-rw-r--r-- root/root      2252 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Phylo::Molphy.3pm.gz
-rw-r--r-- root/root      2861 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Phylo::Molphy::Result.3pm.gz
-rw-r--r-- root/root      1849 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Phylo::Phylip::ProtDist.3pm.gz
-rw-r--r-- root/root      2363 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Prediction::Exon.3pm.gz
-rw-r--r-- root/root      2229 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Prediction::Gene.3pm.gz
-rw-r--r-- root/root      3116 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Primer3.3pm.gz
-rw-r--r-- root/root      1593 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Primer::Assessor::Base.3pm.gz
-rw-r--r-- root/root      1654 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Primer::AssessorI.3pm.gz
-rw-r--r-- root/root      1777 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Primer::Feature.3pm.gz
-rw-r--r-- root/root      1720 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Primer::Pair.3pm.gz
-rw-r--r-- root/root      1978 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Prints.3pm.gz
-rw-r--r-- root/root      1829 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Profile.3pm.gz
-rw-r--r-- root/root      2151 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Promoterwise.3pm.gz
-rw-r--r-- root/root      1647 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::PrositeScan.3pm.gz
-rw-r--r-- root/root      2257 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Pseudowise.3pm.gz
-rw-r--r-- root/root      3000 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::QRNA.3pm.gz
-rw-r--r-- root/root      2226 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::RandomDistFunctions.3pm.gz
-rw-r--r-- root/root      1817 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::RepeatMasker.3pm.gz
-rw-r--r-- root/root      5799 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::Analysis.3pm.gz
-rw-r--r-- root/root      3767 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::AnalysisFactory.3pm.gz
-rw-r--r-- root/root      1942 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::GenericParameters.3pm.gz
-rw-r--r-- root/root      1832 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::ParametersI.3pm.gz
-rw-r--r-- root/root      2360 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::Phylo::PhyloBase.3pm.gz
-rw-r--r-- root/root      3621 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::WrapperBase.3pm.gz
-rw-r--r-- root/root      7724 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Run::WrapperBase::CommandExts.3pm.gz
-rw-r--r-- root/root      2108 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Seg.3pm.gz
-rw-r--r-- root/root      5397 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::SeqPattern.3pm.gz
-rw-r--r-- root/root      1068 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::SeqPattern::Backtranslate.3pm.gz
-rw-r--r-- root/root      4393 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::SeqStats.3pm.gz
-rw-r--r-- root/root      3100 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::SeqWords.3pm.gz
-rw-r--r-- root/root      3963 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Sigcleave.3pm.gz
-rw-r--r-- root/root      2359 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Signalp.3pm.gz
-rw-r--r-- root/root      2875 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Signalp::ExtendedSignalp.3pm.gz
-rw-r--r-- root/root      2315 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Sim4::Exon.3pm.gz
-rw-r--r-- root/root      3773 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Sim4::Results.3pm.gz
-rw-r--r-- root/root      2418 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Spidey::Exon.3pm.gz
-rw-r--r-- root/root      3245 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Spidey::Results.3pm.gz
-rw-r--r-- root/root      2516 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::TandemRepeatsFinder.3pm.gz
-rw-r--r-- root/root      3324 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::TargetP.3pm.gz
-rw-r--r-- root/root      2057 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::Tmhmm.3pm.gz
-rw-r--r-- root/root      2585 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::ipcress.3pm.gz
-rw-r--r-- root/root      2598 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::isPcr.3pm.gz
-rw-r--r-- root/root      2899 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::pICalculator.3pm.gz
-rw-r--r-- root/root      2452 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tools::tRNAscanSE.3pm.gz
-rw-r--r-- root/root      2587 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::AnnotatableNode.3pm.gz
-rw-r--r-- root/root      4009 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::Compatible.3pm.gz
-rw-r--r-- root/root      2822 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::DistanceFactory.3pm.gz
-rw-r--r-- root/root      4336 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::Node.3pm.gz
-rw-r--r-- root/root      3948 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::NodeI.3pm.gz
-rw-r--r-- root/root      2075 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::NodeNHX.3pm.gz
-rw-r--r-- root/root      2946 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::RandomFactory.3pm.gz
-rw-r--r-- root/root      4562 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::Statistics.3pm.gz
-rw-r--r-- root/root      4100 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::Tree.3pm.gz
-rw-r--r-- root/root      5152 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::TreeFunctionsI.3pm.gz
-rw-r--r-- root/root      2903 2021-08-15 12:56 ./usr/share/man/man3/Bio::Tree::TreeI.3pm.gz
-rw-r--r-- root/root      2331 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO.3pm.gz
-rw-r--r-- root/root      1842 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::NewickParser.3pm.gz
-rw-r--r-- root/root      2014 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::TreeEventBuilder.3pm.gz
-rw-r--r-- root/root      1960 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::cluster.3pm.gz
-rw-r--r-- root/root      2499 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::lintree.3pm.gz
-rw-r--r-- root/root      2501 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::newick.3pm.gz
-rw-r--r-- root/root      2208 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::nexus.3pm.gz
-rw-r--r-- root/root      1690 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::nhx.3pm.gz
-rw-r--r-- root/root      2203 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::pag.3pm.gz
-rw-r--r-- root/root      3665 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::phyloxml.3pm.gz
-rw-r--r-- root/root      1846 2021-08-15 12:56 ./usr/share/man/man3/Bio::TreeIO::tabtree.3pm.gz
-rw-r--r-- root/root      2173 2021-08-15 12:56 ./usr/share/man/man3/Bio::UpdateableSeqI.3pm.gz
-rw-r--r-- root/root      2522 2021-08-15 12:56 ./usr/share/man/man3/Bio::WebAgent.3pm.gz
-rw-r--r-- root/root      3921 2021-08-15 12:56 ./usr/share/man/man3/BioPerl.3pm.gz
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Align/
-rw-r--r-- root/root     19407 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/AlignI.pm
-rw-r--r-- root/root     51172 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/DNAStatistics.pm
-rw-r--r-- root/root      7414 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/PairwiseStatistics.pm
-rw-r--r-- root/root      8585 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/ProteinStatistics.pm
-rw-r--r-- root/root      2660 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/StatisticsI.pm
-rw-r--r-- root/root     18903 2021-02-03 05:04 ./usr/share/perl5/Bio/Align/Utilities.pm
-rw-r--r-- root/root     15593 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/AlignIO/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/AlignIO/Handler/
-rw-r--r-- root/root     24261 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/Handler/GenericAlignHandler.pm
-rw-r--r-- root/root      9087 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/arp.pm
-rw-r--r-- root/root      5754 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/bl2seq.pm
-rw-r--r-- root/root     10487 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/clustalw.pm
-rw-r--r-- root/root      6790 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/emboss.pm
-rw-r--r-- root/root      6775 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/fasta.pm
-rw-r--r-- root/root      5536 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/largemultifasta.pm
-rw-r--r-- root/root      4332 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/maf.pm
-rw-r--r-- root/root      3327 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/mase.pm
-rw-r--r-- root/root      6485 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/mega.pm
-rw-r--r-- root/root      7011 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/meme.pm
-rw-r--r-- root/root      5714 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/metafasta.pm
-rw-r--r-- root/root      6268 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/msf.pm
-rw-r--r-- root/root     14232 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/nexus.pm
-rw-r--r-- root/root      3712 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/pfam.pm
-rw-r--r-- root/root     19375 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/phylip.pm
-rw-r--r-- root/root      8993 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/po.pm
-rw-r--r-- root/root      8259 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/proda.pm
-rw-r--r-- root/root      3116 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/prodom.pm
-rw-r--r-- root/root      4061 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/psi.pm
-rw-r--r-- root/root      4524 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/selex.pm
-rw-r--r-- root/root      6601 2021-02-03 05:04 ./usr/share/perl5/Bio/AlignIO/xmfa.pm
-rw-r--r-- root/root     22893 2021-02-03 05:04 ./usr/share/perl5/Bio/AnalysisI.pm
-rw-r--r-- root/root      5104 2021-02-03 05:04 ./usr/share/perl5/Bio/AnalysisParserI.pm
-rw-r--r-- root/root      6541 2021-02-03 05:04 ./usr/share/perl5/Bio/AnalysisResultI.pm
-rw-r--r-- root/root      2888 2021-02-03 05:04 ./usr/share/perl5/Bio/AnnotatableI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Annotation/
-rw-r--r-- root/root      7391 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/AnnotationFactory.pm
-rw-r--r-- root/root     18814 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Collection.pm
-rw-r--r-- root/root      4663 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Comment.pm
-rw-r--r-- root/root     10653 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/DBLink.pm
-rw-r--r-- root/root     14672 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/OntologyTerm.pm
-rw-r--r-- root/root     12817 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Reference.pm
-rw-r--r-- root/root      7707 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Relation.pm
-rw-r--r-- root/root      6433 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/SimpleValue.pm
-rw-r--r-- root/root     10041 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/StructuredValue.pm
-rw-r--r-- root/root     19050 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/TagTree.pm
-rw-r--r-- root/root      4539 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Target.pm
-rw-r--r-- root/root      5669 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/Tree.pm
-rw-r--r-- root/root      3411 2021-02-03 05:04 ./usr/share/perl5/Bio/Annotation/TypeManager.pm
-rw-r--r-- root/root      6571 2021-02-03 05:04 ./usr/share/perl5/Bio/AnnotationCollectionI.pm
-rw-r--r-- root/root      5564 2021-02-03 05:04 ./usr/share/perl5/Bio/AnnotationI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/CodonUsage/
-rw-r--r-- root/root      5966 2021-02-03 05:04 ./usr/share/perl5/Bio/CodonUsage/IO.pm
-rw-r--r-- root/root     17806 2021-02-03 05:04 ./usr/share/perl5/Bio/CodonUsage/Table.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/
-rw-r--r-- root/root      9901 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/DBFetch.pm
-rw-r--r-- root/root      4126 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Failover.pm
-rw-r--r-- root/root     14656 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Fasta.pm
-rw-r--r-- root/root      7259 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/FileCache.pm
-rw-r--r-- root/root     17276 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/Flat/
-rw-r--r-- root/root     13522 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/Flat/BDB/
-rw-r--r-- root/root      2376 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/embl.pm
-rw-r--r-- root/root      2466 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/fasta.pm
-rw-r--r-- root/root      2506 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/genbank.pm
-rw-r--r-- root/root      2435 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BDB/swiss.pm
-rw-r--r-- root/root     45132 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Flat/BinarySearch.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/GFF/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/GFF/Util/
-rw-r--r-- root/root      2468 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/GFF/Util/Binning.pm
-rw-r--r-- root/root      2648 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/GFF/Util/Rearrange.pm
-rw-r--r-- root/root     10490 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/GenericWebAgent.pm
-rw-r--r-- root/root      6422 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/InMemoryCache.pm
-rw-r--r-- root/root     32565 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/IndexedBase.pm
-rw-r--r-- root/root      3936 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/LocationI.pm
-rw-r--r-- root/root     16529 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Qual.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/Query/
-rw-r--r-- root/root     10765 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Query/WebQuery.pm
-rw-r--r-- root/root      3967 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/QueryI.pm
-rw-r--r-- root/root      3096 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/RandomAccessI.pm
-rw-r--r-- root/root      3938 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/ReferenceI.pm
-rw-r--r-- root/root      8117 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Registry.pm
-rw-r--r-- root/root      4751 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/SeqI.pm
-rw-r--r-- root/root     10689 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/DB/Taxonomy/
-rw-r--r-- root/root     17959 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/flatfile.pm
-rw-r--r-- root/root      4799 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/greengenes.pm
-rw-r--r-- root/root     15933 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/list.pm
-rw-r--r-- root/root      4722 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/Taxonomy/silva.pm
-rw-r--r-- root/root      5863 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/UpdateableSeqI.pm
-rw-r--r-- root/root     25601 2021-02-03 05:04 ./usr/share/perl5/Bio/DB/WebDBSeqI.pm
-rw-r--r-- root/root      2868 2021-02-03 05:04 ./usr/share/perl5/Bio/DBLinkContainerI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Das/
-rw-r--r-- root/root     10626 2021-02-03 05:04 ./usr/share/perl5/Bio/Das/FeatureTypeI.pm
-rw-r--r-- root/root     12543 2021-02-03 05:04 ./usr/share/perl5/Bio/Das/SegmentI.pm
-rw-r--r-- root/root     13815 2021-02-03 05:04 ./usr/share/perl5/Bio/DasI.pm
-rw-r--r-- root/root      3041 2021-02-03 05:04 ./usr/share/perl5/Bio/DescribableI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Event/
-rw-r--r-- root/root      2313 2021-02-03 05:04 ./usr/share/perl5/Bio/Event/EventGeneratorI.pm
-rw-r--r-- root/root      9115 2021-02-03 05:04 ./usr/share/perl5/Bio/Event/EventHandlerI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Factory/
-rw-r--r-- root/root      4109 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/AnalysisI.pm
-rw-r--r-- root/root      2170 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ApplicationFactoryI.pm
-rw-r--r-- root/root      4738 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/DriverFactory.pm
-rw-r--r-- root/root     13105 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/FTLocationFactory.pm
-rw-r--r-- root/root      3388 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/LocationFactoryI.pm
-rw-r--r-- root/root      5746 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ObjectBuilderI.pm
-rw-r--r-- root/root      7315 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ObjectFactory.pm
-rw-r--r-- root/root      2732 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/ObjectFactoryI.pm
-rw-r--r-- root/root      7038 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SeqAnalysisParserFactory.pm
-rw-r--r-- root/root      3955 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SeqAnalysisParserFactoryI.pm
-rw-r--r-- root/root      2892 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SequenceFactoryI.pm
-rw-r--r-- root/root      6478 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SequenceProcessorI.pm
-rw-r--r-- root/root      3564 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/SequenceStreamI.pm
-rw-r--r-- root/root      2832 2021-02-03 05:04 ./usr/share/perl5/Bio/Factory/TreeFactoryI.pm
-rw-r--r-- root/root      7307 2021-02-03 05:04 ./usr/share/perl5/Bio/FeatureHolderI.pm
-rw-r--r-- root/root      7539 2021-02-03 05:04 ./usr/share/perl5/Bio/HandlerBaseI.pm
-rw-r--r-- root/root      2696 2021-02-03 05:04 ./usr/share/perl5/Bio/IdCollectionI.pm
-rw-r--r-- root/root      5199 2021-02-03 05:04 ./usr/share/perl5/Bio/IdentifiableI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Index/
-rw-r--r-- root/root     22075 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Abstract.pm
-rw-r--r-- root/root      7731 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/AbstractSeq.pm
-rw-r--r-- root/root     14617 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Blast.pm
-rw-r--r-- root/root     13216 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/BlastTable.pm
-rw-r--r-- root/root      5478 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/EMBL.pm
-rw-r--r-- root/root      6961 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Fasta.pm
-rw-r--r-- root/root      6151 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Fastq.pm
-rw-r--r-- root/root      6449 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/GenBank.pm
-rw-r--r-- root/root      6527 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Qual.pm
-rw-r--r-- root/root      5563 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/SwissPfam.pm
-rw-r--r-- root/root      6189 2021-02-03 05:04 ./usr/share/perl5/Bio/Index/Swissprot.pm
-rw-r--r-- root/root     20259 2021-02-03 05:04 ./usr/share/perl5/Bio/LocatableSeq.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Location/
-rw-r--r-- root/root     14359 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Atomic.pm
-rw-r--r-- root/root      3830 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/AvWithinCoordPolicy.pm
-rw-r--r-- root/root      3689 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/CoordinatePolicyI.pm
-rw-r--r-- root/root     19496 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Fuzzy.pm
-rw-r--r-- root/root      6012 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/FuzzyLocationI.pm
-rw-r--r-- root/root      3804 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/NarrowestCoordPolicy.pm
-rw-r--r-- root/root     11378 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Simple.pm
-rw-r--r-- root/root     27817 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/Split.pm
-rw-r--r-- root/root      6775 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/SplitLocationI.pm
-rw-r--r-- root/root      3798 2021-02-03 05:04 ./usr/share/perl5/Bio/Location/WidestCoordPolicy.pm
-rw-r--r-- root/root     12356 2021-02-03 05:04 ./usr/share/perl5/Bio/LocationI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Matrix/
-rw-r--r-- root/root     20881 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/Generic.pm
-rw-r--r-- root/root      6379 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Matrix/IO/
-rw-r--r-- root/root      4100 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO/mlagan.pm
-rw-r--r-- root/root      4636 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO/phylip.pm
-rw-r--r-- root/root      4549 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/IO/scoring.pm
-rw-r--r-- root/root      5598 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/MatrixI.pm
-rw-r--r-- root/root      4871 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/Mlagan.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Matrix/PSM/
-rw-r--r-- root/root      8196 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Matrix/PSM/IO/
-rw-r--r-- root/root      8922 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/mast.pm
-rw-r--r-- root/root      8477 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/masta.pm
-rw-r--r-- root/root      9662 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/meme.pm
-rw-r--r-- root/root      3786 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/psiblast.pm
-rw-r--r-- root/root      6999 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/IO/transfac.pm
-rw-r--r-- root/root      8070 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/InstanceSite.pm
-rw-r--r-- root/root      4219 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/InstanceSiteI.pm
-rw-r--r-- root/root     26641 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/ProtMatrix.pm
-rw-r--r-- root/root      8095 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/ProtPsm.pm
-rw-r--r-- root/root      7477 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/Psm.pm
-rw-r--r-- root/root      6992 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/PsmHeader.pm
-rw-r--r-- root/root      6525 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/PsmHeaderI.pm
-rw-r--r-- root/root      6544 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/PsmI.pm
-rw-r--r-- root/root     32831 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/SiteMatrix.pm
-rw-r--r-- root/root     12750 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PSM/SiteMatrixI.pm
-rw-r--r-- root/root     11115 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/PhylipDist.pm
-rw-r--r-- root/root      5985 2021-02-03 05:04 ./usr/share/perl5/Bio/Matrix/Scoring.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Ontology/
-rw-r--r-- root/root      4948 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/DocumentRegistry.pm
-rw-r--r-- root/root      9457 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/GOterm.pm
-rw-r--r-- root/root     15211 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/InterProTerm.pm
-rw-r--r-- root/root     28873 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OBOEngine.pm
-rw-r--r-- root/root      3149 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OBOterm.pm
-rw-r--r-- root/root     23503 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Ontology.pm
-rw-r--r-- root/root     14445 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OntologyEngineI.pm
-rw-r--r-- root/root     11171 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OntologyI.pm
-rw-r--r-- root/root     10269 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/OntologyStore.pm
-rw-r--r-- root/root      5236 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Path.pm
-rw-r--r-- root/root      4744 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/PathI.pm
-rw-r--r-- root/root     11066 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Relationship.pm
-rw-r--r-- root/root      3691 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/RelationshipFactory.pm
-rw-r--r-- root/root      5464 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/RelationshipI.pm
-rw-r--r-- root/root     11668 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/RelationshipType.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Ontology/SimpleGOEngine/
-rw-r--r-- root/root      7334 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
-rw-r--r-- root/root     28013 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/SimpleOntologyEngine.pm
-rw-r--r-- root/root     26114 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/Term.pm
-rw-r--r-- root/root      4204 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/TermFactory.pm
-rw-r--r-- root/root      9552 2021-02-03 05:04 ./usr/share/perl5/Bio/Ontology/TermI.pm
-rw-r--r-- root/root      9768 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/OntologyIO/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/OntologyIO/Handlers/
-rw-r--r-- root/root      5825 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/Handlers/BaseSAXHandler.pm
-rw-r--r-- root/root     22306 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/Handlers/InterProHandler.pm
-rw-r--r-- root/root     19570 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
-rw-r--r-- root/root      7250 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/InterProParser.pm
-rw-r--r-- root/root     26105 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/dagflat.pm
-rw-r--r-- root/root      5463 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/goflat.pm
-rw-r--r-- root/root     24424 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/obo.pm
-rw-r--r-- root/root     20093 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/simplehierarchy.pm
-rw-r--r-- root/root      5064 2021-02-03 05:04 ./usr/share/perl5/Bio/OntologyIO/soflat.pm
-rw-r--r-- root/root      7128 2021-02-03 05:04 ./usr/share/perl5/Bio/ParameterBaseI.pm
-rw-r--r-- root/root     31180 2021-02-03 05:04 ./usr/share/perl5/Bio/PrimarySeq.pm
-rw-r--r-- root/root     32342 2021-02-03 05:04 ./usr/share/perl5/Bio/PrimarySeqI.pm
-rw-r--r-- root/root     20061 2021-02-03 05:04 ./usr/share/perl5/Bio/PullParserI.pm
-rw-r--r-- root/root      8875 2021-02-03 05:04 ./usr/share/perl5/Bio/Range.pm
-rw-r--r-- root/root     19904 2021-02-03 05:04 ./usr/share/perl5/Bio/RangeI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Root/
-rw-r--r-- root/root     13362 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Exception.pm
-rw-r--r-- root/root     11962 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/HTTPget.pm
-rw-r--r-- root/root     36837 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/IO.pm
-rw-r--r-- root/root     17000 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Root.pm
-rw-r--r-- root/root     26600 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/RootI.pm
-rw-r--r-- root/root     15326 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Storable.pm
-rw-r--r-- root/root     18878 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Test.pm
-rw-r--r-- root/root      1797 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/TestObject.pm
-rw-r--r-- root/root     45487 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Utilities.pm
-rw-r--r-- root/root      1383 2021-02-03 05:04 ./usr/share/perl5/Bio/Root/Version.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Search/
-rw-r--r-- root/root      3156 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/BlastStatistics.pm
-rw-r--r-- root/root     19861 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/BlastUtils.pm
-rw-r--r-- root/root      3450 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/DatabaseI.pm
-rw-r--r-- root/root      4128 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/GenericDatabase.pm
-rw-r--r-- root/root      3229 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/GenericStatistics.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Search/HSP/
-rw-r--r-- root/root     55654 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/BlastHSP.pm
-rw-r--r-- root/root     16051 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/BlastPullHSP.pm
-rw-r--r-- root/root      5936 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/FastaHSP.pm
-rw-r--r-- root/root     57564 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/GenericHSP.pm
-rw-r--r-- root/root      3687 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/HSPFactory.pm
-rw-r--r-- root/root     22409 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/HSPI.pm
-rw-r--r-- root/root     18032 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/ModelHSP.pm
-rw-r--r-- root/root      3732 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/PSLHSP.pm
-rw-r--r-- root/root     57922 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/PsiBlastHSP.pm
-rw-r--r-- root/root     26165 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/PullHSPI.pm
-rw-r--r-- root/root      4311 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/HSP/WABAHSP.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Search/Hit/
-rw-r--r-- root/root      5162 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/BlastHit.pm
-rw-r--r-- root/root      9197 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/BlastPullHit.pm
-rw-r--r-- root/root      3256 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/Fasta.pm
-rw-r--r-- root/root     60429 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/GenericHit.pm
-rw-r--r-- root/root      3718 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/HitFactory.pm
-rw-r--r-- root/root     22189 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/HitI.pm
-rw-r--r-- root/root     20246 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/ModelHit.pm
-rw-r--r-- root/root     69661 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/PsiBlastHit.pm
-rw-r--r-- root/root     35845 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Hit/PullHitI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Search/Iteration/
-rw-r--r-- root/root     21576 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Iteration/GenericIteration.pm
-rw-r--r-- root/root     22097 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Iteration/IterationI.pm
-rw-r--r-- root/root      3050 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Processor.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Search/Result/
-rw-r--r-- root/root     11837 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/BlastPullResult.pm
-rw-r--r-- root/root     15261 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/BlastResult.pm
-rw-r--r-- root/root     13144 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/CrossMatchResult.pm
-rw-r--r-- root/root     22920 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/GenericResult.pm
-rw-r--r-- root/root      3180 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/INFERNALResult.pm
-rw-r--r-- root/root     14808 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/PullResultI.pm
-rw-r--r-- root/root      3809 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/ResultFactory.pm
-rw-r--r-- root/root     12882 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/ResultI.pm
-rw-r--r-- root/root      3387 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Result/WABAResult.pm
-rw-r--r-- root/root     31259 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/SearchUtils.pm
-rw-r--r-- root/root      2853 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/StatisticsI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Search/Tiling/
-rw-r--r-- root/root     21011 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Tiling/MapTileUtils.pm
-rw-r--r-- root/root     47411 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Tiling/MapTiling.pm
-rw-r--r-- root/root     10557 2021-02-03 05:04 ./usr/share/perl5/Bio/Search/Tiling/TilingI.pm
-rw-r--r-- root/root     22379 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SearchIO/
-rw-r--r-- root/root      5621 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/EventHandlerI.pm
-rw-r--r-- root/root      8117 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/FastHitEventBuilder.pm
-rw-r--r-- root/root     11926 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/IteratedSearchResultEventBuilder.pm
-rw-r--r-- root/root     21823 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/SearchResultEventBuilder.pm
-rw-r--r-- root/root      3472 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/SearchWriterI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SearchIO/Writer/
-rw-r--r-- root/root     16185 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/GbrowseGFF.pm
-rw-r--r-- root/root     12391 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/HSPTableWriter.pm
-rw-r--r-- root/root     30893 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/HTMLResultWriter.pm
-rw-r--r-- root/root     12896 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/HitTableWriter.pm
-rw-r--r-- root/root     13638 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/ResultTableWriter.pm
-rw-r--r-- root/root     24361 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/Writer/TextResultWriter.pm
-rw-r--r-- root/root     13007 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/axt.pm
-rw-r--r-- root/root     95057 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/blast.pm
-rw-r--r-- root/root      8869 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/blast_pull.pm
-rw-r--r-- root/root     18097 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/blasttable.pm
-rw-r--r-- root/root     10058 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/cross_match.pm
-rw-r--r-- root/root     19686 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/erpin.pm
-rw-r--r-- root/root     22677 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/exonerate.pm
-rw-r--r-- root/root     53335 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/fasta.pm
-rw-r--r-- root/root     12287 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/gmap_f9.pm
-rw-r--r-- root/root     54467 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/infernal.pm
-rw-r--r-- root/root     13388 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/megablast.pm
-rw-r--r-- root/root     18788 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/psl.pm
-rw-r--r-- root/root     24645 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/rnamotif.pm
-rw-r--r-- root/root     21857 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/sim4.pm
-rw-r--r-- root/root     13234 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/waba.pm
-rw-r--r-- root/root     12660 2021-02-03 05:04 ./usr/share/perl5/Bio/SearchIO/wise.pm
-rw-r--r-- root/root     41092 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Seq/
-rw-r--r-- root/root      8299 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/BaseSeqProcessor.pm
-rw-r--r-- root/root     21760 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/EncodedSeq.pm
-rw-r--r-- root/root      8455 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargeLocatableSeq.pm
-rw-r--r-- root/root      7847 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargePrimarySeq.pm
-rw-r--r-- root/root      3773 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargeSeq.pm
-rw-r--r-- root/root      2905 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/LargeSeqI.pm
-rw-r--r-- root/root     19982 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/Meta.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Seq/Meta/
-rw-r--r-- root/root     19353 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/Meta/Array.pm
-rw-r--r-- root/root     12085 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/MetaI.pm
-rw-r--r-- root/root     14100 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/PrimaryQual.pm
-rw-r--r-- root/root     14731 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/PrimedSeq.pm
-rw-r--r-- root/root     16512 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/QualI.pm
-rw-r--r-- root/root     19246 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/Quality.pm
-rw-r--r-- root/root     10577 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/RichSeq.pm
-rw-r--r-- root/root      5595 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/RichSeqI.pm
-rw-r--r-- root/root     17697 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SeqBuilder.pm
-rw-r--r-- root/root      4061 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SeqFactory.pm
-rw-r--r-- root/root      4010 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SeqFastaSpeedFactory.pm
-rw-r--r-- root/root     33849 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SequenceTrace.pm
-rw-r--r-- root/root     22638 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/SimulatedRead.pm
-rw-r--r-- root/root      7406 2021-02-03 05:04 ./usr/share/perl5/Bio/Seq/TraceI.pm
-rw-r--r-- root/root      3559 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqAnalysisParserI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqFeature/
-rw-r--r-- root/root      4953 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Amplicon.pm
-rw-r--r-- root/root     15697 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/AnnotationAdaptor.pm
-rw-r--r-- root/root     15553 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Collection.pm
-rw-r--r-- root/root      3860 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/CollectionI.pm
-rw-r--r-- root/root     15040 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Computation.pm
-rw-r--r-- root/root     13320 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/FeaturePair.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqFeature/Gene/
-rw-r--r-- root/root      6374 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Exon.pm
-rw-r--r-- root/root      2905 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/ExonI.pm
-rw-r--r-- root/root     10660 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/GeneStructure.pm
-rw-r--r-- root/root      4848 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/GeneStructureI.pm
-rw-r--r-- root/root      9169 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Intron.pm
-rw-r--r-- root/root      2700 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/NC_Feature.pm
-rw-r--r-- root/root      1988 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Poly_A_site.pm
-rw-r--r-- root/root      1962 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Promoter.pm
-rw-r--r-- root/root     22539 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/Transcript.pm
-rw-r--r-- root/root      5840 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/TranscriptI.pm
-rw-r--r-- root/root      3289 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Gene/UTR.pm
-rw-r--r-- root/root     31395 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Generic.pm
-rw-r--r-- root/root     24659 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Lite.pm
-rw-r--r-- root/root      9485 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/PositionProxy.pm
-rw-r--r-- root/root     12239 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Primer.pm
-rw-r--r-- root/root      4670 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Similarity.pm
-rw-r--r-- root/root      7295 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/SimilarityPair.pm
-rw-r--r-- root/root      6309 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/SubSeq.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqFeature/Tools/
-rw-r--r-- root/root      6256 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/FeatureNamer.pm
-rw-r--r-- root/root      7149 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/IDHandler.pm
-rw-r--r-- root/root     14449 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/TypeMapper.pm
-rw-r--r-- root/root     91336 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/Tools/Unflattener.pm
-rw-r--r-- root/root      3328 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeature/TypedSeqFeatureI.pm
-rw-r--r-- root/root     25329 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqFeatureI.pm
-rw-r--r-- root/root      6576 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqI.pm
-rw-r--r-- root/root     25083 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqIO/
-rw-r--r-- root/root      7634 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/FTHelper.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqIO/Handler/
-rw-r--r-- root/root     39055 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/Handler/GenericRichSeqHandler.pm
-rw-r--r-- root/root      4999 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/MultiFile.pm
-rw-r--r-- root/root      5456 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/ace.pm
-rw-r--r-- root/root      5630 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/asciitree.pm
-rw-r--r-- root/root     48677 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/bsml.pm
-rw-r--r-- root/root      8127 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/bsml_sax.pm
-rw-r--r-- root/root     51630 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/embl.pm
-rw-r--r-- root/root     10894 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/embldriver.pm
-rw-r--r-- root/root     12299 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/fasta.pm
-rw-r--r-- root/root     18244 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/fastq.pm
-rw-r--r-- root/root      4499 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqIO/game/
-rw-r--r-- root/root     22538 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/featHandler.pm
-rw-r--r-- root/root      5046 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/gameHandler.pm
-rw-r--r-- root/root     11586 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/gameSubs.pm
-rw-r--r-- root/root     34989 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/gameWriter.pm
-rw-r--r-- root/root     14369 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/game/seqHandler.pm
-rw-r--r-- root/root     16216 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/gbdriver.pm
-rw-r--r-- root/root     13213 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/gbxml.pm
-rw-r--r-- root/root      7980 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/gcg.pm
-rw-r--r-- root/root     72095 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/genbank.pm
-rw-r--r-- root/root      8408 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/kegg.pm
-rw-r--r-- root/root      4965 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/largefasta.pm
-rw-r--r-- root/root     15490 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/locuslink.pm
-rw-r--r-- root/root     21613 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/mbsout.pm
-rw-r--r-- root/root      6467 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/metafasta.pm
-rw-r--r-- root/root     25692 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/msout.pm
-rw-r--r-- root/root     12934 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/phd.pm
-rw-r--r-- root/root      4716 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/pir.pm
-rw-r--r-- root/root      8434 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/qual.pm
-rw-r--r-- root/root      5692 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/raw.pm
-rw-r--r-- root/root     46817 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/scf.pm
-rw-r--r-- root/root     29091 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/seqxml.pm
-rw-r--r-- root/root     52322 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/swiss.pm
-rw-r--r-- root/root      9003 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/swissdriver.pm
-rw-r--r-- root/root      4477 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tab.pm
-rw-r--r-- root/root     26593 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/table.pm
-rw-r--r-- root/root     33209 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tigr.pm
-rw-r--r-- root/root     17288 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tigrxml.pm
-rw-r--r-- root/root     11316 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tinyseq.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/SeqIO/tinyseq/
-rw-r--r-- root/root      6341 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqIO/tinyseq/tinyseqHandler.pm
-rw-r--r-- root/root     58335 2021-02-03 05:04 ./usr/share/perl5/Bio/SeqUtils.pm
-rw-r--r-- root/root     92964 2021-02-03 05:04 ./usr/share/perl5/Bio/SimpleAlign.pm
-rw-r--r-- root/root      7761 2021-02-03 05:04 ./usr/share/perl5/Bio/SimpleAnalysisI.pm
-rw-r--r-- root/root     19633 2021-02-03 05:04 ./usr/share/perl5/Bio/Species.pm
-rw-r--r-- root/root     24652 2021-02-03 05:04 ./usr/share/perl5/Bio/Taxon.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Alignment/
-rw-r--r-- root/root     64762 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Alignment/Consed.pm
-rw-r--r-- root/root     22317 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Alignment/Trim.pm
-rw-r--r-- root/root     16166 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/AmpliconSearch.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Analysis/
-rw-r--r-- root/root      7001 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Analysis/SimpleAnalysisBase.pm
-rw-r--r-- root/root      9630 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/AnalysisResult.pm
-rw-r--r-- root/root      6984 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Blat.pm
-rw-r--r-- root/root     29040 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/CodonTable.pm
-rw-r--r-- root/root      6413 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Coil.pm
-rw-r--r-- root/root     14361 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/ECnumber.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/EMBOSS/
-rw-r--r-- root/root      5562 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/EMBOSS/Palindrome.pm
-rw-r--r-- root/root      6433 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/EPCR.pm
-rw-r--r-- root/root     11199 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/ESTScan.pm
-rw-r--r-- root/root      7812 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Eponine.pm
-rw-r--r-- root/root     12071 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Est2Genome.pm
-rw-r--r-- root/root     15590 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Fgenesh.pm
-rw-r--r-- root/root      6647 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/FootPrinter.pm
-rw-r--r-- root/root     38214 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/GFF.pm
-rw-r--r-- root/root      9408 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Geneid.pm
-rw-r--r-- root/root     15046 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genemark.pm
-rw-r--r-- root/root      8992 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genewise.pm
-rw-r--r-- root/root      5391 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genomewise.pm
-rw-r--r-- root/root     13589 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Genscan.pm
-rw-r--r-- root/root     19019 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Glimmer.pm
-rw-r--r-- root/root      6381 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Grail.pm
-rw-r--r-- root/root     22639 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/GuessSeqFormat.pm
-rw-r--r-- root/root     14299 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/IUPAC.pm
-rw-r--r-- root/root     21683 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Lucy.pm
-rw-r--r-- root/root      9802 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/MZEF.pm
-rw-r--r-- root/root      5597 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Match.pm
-rw-r--r-- root/root     11728 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/OddCodes.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Phylo/
-rw-r--r-- root/root      4596 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Gerp.pm
-rw-r--r-- root/root      8471 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Molphy.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Phylo/Molphy/
-rw-r--r-- root/root      8852 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Molphy/Result.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Phylo/Phylip/
-rw-r--r-- root/root      3933 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Phylo/Phylip/ProtDist.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Prediction/
-rw-r--r-- root/root      5613 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Prediction/Exon.pm
-rw-r--r-- root/root      4774 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Prediction/Gene.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Primer/
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Primer/Assessor/
-rw-r--r-- root/root      2332 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/Assessor/Base.pm
-rw-r--r-- root/root      2113 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/AssessorI.pm
-rw-r--r-- root/root      3348 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/Feature.pm
-rw-r--r-- root/root      3340 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer/Pair.pm
-rw-r--r-- root/root     12663 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Primer3.pm
-rw-r--r-- root/root      6096 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Prints.pm
-rw-r--r-- root/root      4608 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Profile.pm
-rw-r--r-- root/root      7281 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Promoterwise.pm
-rw-r--r-- root/root      4869 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/PrositeScan.pm
-rw-r--r-- root/root      6516 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Pseudowise.pm
-rw-r--r-- root/root     12051 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/QRNA.pm
-rw-r--r-- root/root      5862 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/RandomDistFunctions.pm
-rw-r--r-- root/root      4223 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/RepeatMasker.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Run/
-rw-r--r-- root/root     24413 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/Analysis.pm
-rw-r--r-- root/root     10889 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/AnalysisFactory.pm
-rw-r--r-- root/root      3362 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/GenericParameters.pm
-rw-r--r-- root/root      2860 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/ParametersI.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Run/Phylo/
-rw-r--r-- root/root      8609 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/Phylo/PhyloBase.pm
-rw-r--r-- root/root     14176 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/WrapperBase.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Run/WrapperBase/
-rw-r--r-- root/root     41120 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Run/WrapperBase/CommandExts.pm
-rw-r--r-- root/root      3541 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Seg.pm
-rw-r--r-- root/root     26154 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqPattern.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/SeqPattern/
-rw-r--r-- root/root     22486 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqPattern/Backtranslate.pm
-rw-r--r-- root/root     28296 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqStats.pm
-rw-r--r-- root/root      9515 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/SeqWords.pm
-rw-r--r-- root/root     18404 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Sigcleave.pm
-rw-r--r-- root/root      7755 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Signalp.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Signalp/
-rw-r--r-- root/root     17373 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Signalp/ExtendedSignalp.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Sim4/
-rw-r--r-- root/root      5470 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Sim4/Exon.pm
-rw-r--r-- root/root     15247 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Sim4/Results.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tools/Spidey/
-rw-r--r-- root/root      6340 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Spidey/Exon.pm
-rw-r--r-- root/root     14640 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Spidey/Results.pm
-rw-r--r-- root/root      9265 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/TandemRepeatsFinder.pm
-rw-r--r-- root/root     12225 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/TargetP.pm
-rw-r--r-- root/root      3507 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/Tmhmm.pm
-rw-r--r-- root/root      7597 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/ipcress.pm
-rw-r--r-- root/root      6811 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/isPcr.pm
-rw-r--r-- root/root     10462 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/pICalculator.pm
-rw-r--r-- root/root      8405 2021-02-03 05:04 ./usr/share/perl5/Bio/Tools/tRNAscanSE.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/Tree/
-rw-r--r-- root/root      8378 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/AnnotatableNode.pm
-rw-r--r-- root/root     12844 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Compatible.pm
-rw-r--r-- root/root     16956 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/DistanceFactory.pm
-rw-r--r-- root/root     21958 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Node.pm
-rw-r--r-- root/root     11871 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/NodeI.pm
-rw-r--r-- root/root      4680 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/NodeNHX.pm
-rw-r--r-- root/root     14194 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/RandomFactory.pm
-rw-r--r-- root/root     29044 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Statistics.pm
-rw-r--r-- root/root     15063 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/Tree.pm
-rw-r--r-- root/root     35263 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/TreeFunctionsI.pm
-rw-r--r-- root/root      7137 2021-02-03 05:04 ./usr/share/perl5/Bio/Tree/TreeI.pm
-rw-r--r-- root/root      8440 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO.pm
drwxr-xr-x root/root         0 2021-08-15 12:56 ./usr/share/perl5/Bio/TreeIO/
-rw-r--r-- root/root      7886 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/NewickParser.pm
-rw-r--r-- root/root      8332 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/TreeEventBuilder.pm
-rw-r--r-- root/root      5406 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/cluster.pm
-rw-r--r-- root/root      6572 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/lintree.pm
-rw-r--r-- root/root      9121 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/newick.pm
-rw-r--r-- root/root     10727 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/nexus.pm
-rw-r--r-- root/root      2758 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/nhx.pm
-rw-r--r-- root/root      7065 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/pag.pm
-rw-r--r-- root/root     42868 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/phyloxml.pm
-rw-r--r-- root/root      3674 2021-02-03 05:04 ./usr/share/perl5/Bio/TreeIO/tabtree.pm
-rw-r--r-- root/root      3517 2021-02-03 05:04 ./usr/share/perl5/Bio/UpdateableSeqI.pm
-rw-r--r-- root/root      5190 2021-02-03 05:04 ./usr/share/perl5/Bio/WebAgent.pm
-rw-r--r-- root/root      7252 2021-02-03 05:04 ./usr/share/perl5/BioPerl.pm


+------------------------------------------------------------------------------+
| Post Build                                                                   |
+------------------------------------------------------------------------------+


+------------------------------------------------------------------------------+
| Cleanup                                                                      |
+------------------------------------------------------------------------------+

Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use

+------------------------------------------------------------------------------+
| Summary                                                                      |
+------------------------------------------------------------------------------+

Build Architecture: amd64
Build Type: full
Build-Space: 83436
Build-Time: 100
Distribution: perl-5.40-throwaway
Host Architecture: amd64
Install-Time: 24
Job: /srv/debomatic/incoming/bioperl_1.7.8-1.dsc
Machine Architecture: amd64
Package: bioperl
Package-Time: 128
Source-Version: 1.7.8-1
Space: 83436
Status: successful
Version: 1.7.8-1
--------------------------------------------------------------------------------
Finished at 2024-06-03T00:01:05Z
Build needed 00:02:08, 83436k disk space