sbuild (Debian sbuild) 0.85.10 (30 May 2024) on carme.larted.org.uk

+==============================================================================+
| bio-tradis 1.4.5+dfsg2-2 (amd64)             Sat, 03 Aug 2024 17:36:05 +0000 |
+==============================================================================+

Package: bio-tradis
Version: 1.4.5+dfsg2-2
Source Version: 1.4.5+dfsg2-2
Distribution: perl-5.40-throwaway
Machine Architecture: amd64
Host Architecture: amd64
Build Architecture: amd64
Build Type: full

I: NOTICE: Log filtering will replace 'var/run/schroot/mount/perl-5.40-amd64-debomatic-4d8ce4ec-0d28-45ff-9b24-d7b6a85720db' with '<<CHROOT>>'

+------------------------------------------------------------------------------+
| Chroot Setup Commands                                                        |
+------------------------------------------------------------------------------+


/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup bio-tradis_1.4.5+dfsg2-2 perl-5.40-throwaway amd64
-------------------------------------------------------------------------------------------------------------------------


I: Finished running '/usr/share/debomatic/sbuildcommands/chroot-setup-commands/dpkg-speedup bio-tradis_1.4.5+dfsg2-2 perl-5.40-throwaway amd64'.

Finished processing commands.
--------------------------------------------------------------------------------
I: NOTICE: Log filtering will replace 'build/bio-tradis-8WNhMW/resolver-FYtSZD' with '<<RESOLVERDIR>>'

+------------------------------------------------------------------------------+
| Update chroot                                                                |
+------------------------------------------------------------------------------+

Get:1 file:/srv/reprepro perl-5.40 InRelease [3042 B]
Hit:2 http://deb.debian.org/debian unstable InRelease
Get:1 file:/srv/reprepro perl-5.40 InRelease [3042 B]
Get:3 http://localhost:3142/debian sid InRelease [198 kB]
Get:4 http://localhost:3142/debian sid/main Sources.diff/Index [63.6 kB]
Get:5 http://localhost:3142/debian sid/main Sources T-2024-08-03-1406.14-F-2024-08-03-1406.14.pdiff [24.1 kB]
Get:5 http://localhost:3142/debian sid/main Sources T-2024-08-03-1406.14-F-2024-08-03-1406.14.pdiff [24.1 kB]
Fetched 286 kB in 6s (51.5 kB/s)
Reading package lists...
Reading package lists...
Building dependency tree...
Reading state information...
Calculating upgrade...
0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.

+------------------------------------------------------------------------------+
| Fetch source files                                                           |
+------------------------------------------------------------------------------+


Local sources
-------------

/srv/debomatic/incoming/bio-tradis_1.4.5+dfsg2-2.dsc exists in /srv/debomatic/incoming; copying to chroot
I: NOTICE: Log filtering will replace 'build/bio-tradis-8WNhMW/bio-tradis-1.4.5+dfsg2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/bio-tradis-8WNhMW' with '<<BUILDDIR>>'

+------------------------------------------------------------------------------+
| Install package build dependencies                                           |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: debhelper-compat (= 13), build-essential, fakeroot, libbio-perl-perl, libenv-path-perl, libexception-class-perl, libmoose-perl, libtest-exception-perl, libtest-files-perl, libtest-most-perl, libtest-simple-perl, libtext-csv-perl, libtry-tiny-perl, perl, samtools, smalt, tabix, bwa
Filtered Build-Depends: debhelper-compat (= 13), build-essential, fakeroot, libbio-perl-perl, libenv-path-perl, libexception-class-perl, libmoose-perl, libtest-exception-perl, libtest-files-perl, libtest-most-perl, libtest-simple-perl, libtext-csv-perl, libtry-tiny-perl, perl, samtools, smalt, tabix, bwa
dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<<RESOLVERDIR>>/apt_archive/sbuild-build-depends-main-dummy.deb'.
Ign:1 copy:/<<RESOLVERDIR>>/apt_archive ./ InRelease
Get:2 copy:/<<RESOLVERDIR>>/apt_archive ./ Release [609 B]
Ign:3 copy:/<<RESOLVERDIR>>/apt_archive ./ Release.gpg
Get:4 copy:/<<RESOLVERDIR>>/apt_archive ./ Sources [868 B]
Get:5 copy:/<<RESOLVERDIR>>/apt_archive ./ Packages [880 B]
Fetched 2357 B in 0s (0 B/s)
Reading package lists...
Reading package lists...

Install main build dependencies (apt-based resolver)
----------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
  autoconf automake autopoint autotools-dev bsdextrautils bwa debhelper
  dh-autoreconf dh-strip-nondeterminism dwz fakeroot file gettext gettext-base
  groff-base intltool-debian libalgorithm-c3-perl libalgorithm-diff-perl
  libarchive-zip-perl libb-hooks-op-check-perl libbambamc0 libbio-perl-perl
  libbrotli1 libcapture-tiny-perl libclass-c3-perl
  libclass-data-inheritable-perl libclass-load-perl libclass-load-xs-perl
  libclass-xsaccessor-perl libclone-perl libcom-err2 libconst-fast-perl
  libcurl3t64-gnutls libdata-compare-perl libdata-optlist-perl
  libdata-stag-perl libdebhelper-perl libdeflate0 libdevel-callchecker-perl
  libdevel-globaldestruction-perl libdevel-overloadinfo-perl
  libdevel-stacktrace-perl libdist-checkconflicts-perl
  libdynaloader-functions-perl libelf1t64 libenv-path-perl
  libeval-closure-perl libexception-class-perl libfakeroot libfile-chdir-perl
  libfile-find-rule-perl libfile-stripnondeterminism-perl libgssapi-krb5-2
  libhts3t64 libhtscodecs2 libicu72 libio-string-perl libk5crypto3
  libkeyutils1 libkrb5-3 libkrb5support0 libmagic-mgc libmagic1t64
  libmodule-implementation-perl libmodule-runtime-conflicts-perl
  libmodule-runtime-perl libmoose-perl libmro-compat-perl libncurses6
  libnghttp2-14 libnghttp3-9 libngtcp2-16 libngtcp2-crypto-gnutls8
  libnumber-compare-perl libpackage-deprecationmanager-perl
  libpackage-stash-perl libpackage-stash-xs-perl libpadwalker-perl
  libparams-classify-perl libparams-util-perl libpath-tiny-perl libpipeline1
  libpsl5t64 librtmp1 libssh2-1t64 libsub-exporter-perl
  libsub-exporter-progressive-perl libsub-install-perl libsub-uplevel-perl
  libtest-deep-perl libtest-differences-perl libtest-exception-perl
  libtest-files-perl libtest-most-perl libtest-warn-perl libtext-csv-perl
  libtext-diff-perl libtext-glob-perl libtool libtry-tiny-perl libuchardet0
  libxml2 m4 man-db po-debconf samtools sensible-utils smalt tabix
Suggested packages:
  autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc
  libasprintf-dev libgettextpo-dev groff bioperl libxml-sax-expatxs-perl
  libscalar-properties-perl krb5-doc krb5-user libscalar-number-perl
  libtool-doc gfortran | fortran95-compiler gcj-jdk libsub-name-perl m4-doc
  apparmor less www-browser libmail-box-perl cwltool
Recommended packages:
  curl | wget | lynx libalgorithm-diff-xs-perl bioperl-run
  | libbio-perl-run-perl libace-perl libalgorithm-munkres-perl
  libarray-compare-perl libbio-asn1-entrezgene-perl libconvert-binary-c-perl
  libdbd-sqlite3-perl libdbd-mysql-perl libdbd-pg-perl libgd-perl
  libgraph-perl libgraphviz-perl libhtml-parser-perl libhtml-tableextract-perl
  liblist-moreutils-perl libpostscript-perl libset-scalar-perl
  libsoap-lite-perl libsort-naturally-perl libspreadsheet-parseexcel-perl
  libspreadsheet-writeexcel-perl libsvg-perl libsvg-graph-perl liburi-perl
  libxml-dom-xpath-perl libxml-parser-perl libxml-sax-perl
  libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl
  libxml-writer-perl libxml-libxml-perl libwww-perl libclass-c3-xs-perl
  ca-certificates perl-tk libgd-gd2-perl | libgd-gd2-noxpm-perl
  libxml-libxslt-perl libmldbm-perl libxml-perl libdevel-lexalias-perl
  libarchive-cpio-perl krb5-locales libdevel-partialdump-perl libgpm2
  libunicode-utf8-perl publicsuffix libtext-csv-xs-perl libltdl-dev
  libmail-sendmail-perl
The following NEW packages will be installed:
  autoconf automake autopoint autotools-dev bsdextrautils bwa debhelper
  dh-autoreconf dh-strip-nondeterminism dwz fakeroot file gettext gettext-base
  groff-base intltool-debian libalgorithm-c3-perl libalgorithm-diff-perl
  libarchive-zip-perl libb-hooks-op-check-perl libbambamc0 libbio-perl-perl
  libbrotli1 libcapture-tiny-perl libclass-c3-perl
  libclass-data-inheritable-perl libclass-load-perl libclass-load-xs-perl
  libclass-xsaccessor-perl libclone-perl libcom-err2 libconst-fast-perl
  libcurl3t64-gnutls libdata-compare-perl libdata-optlist-perl
  libdata-stag-perl libdebhelper-perl libdeflate0 libdevel-callchecker-perl
  libdevel-globaldestruction-perl libdevel-overloadinfo-perl
  libdevel-stacktrace-perl libdist-checkconflicts-perl
  libdynaloader-functions-perl libelf1t64 libenv-path-perl
  libeval-closure-perl libexception-class-perl libfakeroot libfile-chdir-perl
  libfile-find-rule-perl libfile-stripnondeterminism-perl libgssapi-krb5-2
  libhts3t64 libhtscodecs2 libicu72 libio-string-perl libk5crypto3
  libkeyutils1 libkrb5-3 libkrb5support0 libmagic-mgc libmagic1t64
  libmodule-implementation-perl libmodule-runtime-conflicts-perl
  libmodule-runtime-perl libmoose-perl libmro-compat-perl libncurses6
  libnghttp2-14 libnghttp3-9 libngtcp2-16 libngtcp2-crypto-gnutls8
  libnumber-compare-perl libpackage-deprecationmanager-perl
  libpackage-stash-perl libpackage-stash-xs-perl libpadwalker-perl
  libparams-classify-perl libparams-util-perl libpath-tiny-perl libpipeline1
  libpsl5t64 librtmp1 libssh2-1t64 libsub-exporter-perl
  libsub-exporter-progressive-perl libsub-install-perl libsub-uplevel-perl
  libtest-deep-perl libtest-differences-perl libtest-exception-perl
  libtest-files-perl libtest-most-perl libtest-warn-perl libtext-csv-perl
  libtext-diff-perl libtext-glob-perl libtool libtry-tiny-perl libuchardet0
  libxml2 m4 man-db po-debconf samtools sbuild-build-depends-main-dummy
  sensible-utils smalt tabix
0 upgraded, 110 newly installed, 0 to remove and 0 not upgraded.
Need to get 27.8 MB/28.8 MB of archives.
After this operation, 102 MB of additional disk space will be used.
Get:1 copy:/<<RESOLVERDIR>>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [972 B]
Get:2 file:/srv/reprepro perl-5.40/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b2 [10.6 kB]
Get:3 file:/srv/reprepro perl-5.40/main amd64 libparams-util-perl amd64 1.102-3+b1 [24.3 kB]
Get:4 file:/srv/reprepro perl-5.40/main amd64 libdevel-callchecker-perl amd64 0.009-1+b1 [16.1 kB]
Get:5 file:/srv/reprepro perl-5.40/main amd64 libparams-classify-perl amd64 0.015-2+b4 [22.4 kB]
Get:6 http://deb.debian.org/debian unstable/main amd64 sensible-utils all 0.0.24 [24.8 kB]
Get:7 file:/srv/reprepro perl-5.40/main amd64 libclass-load-xs-perl amd64 0.10-2+b4 [14.1 kB]
Get:8 http://deb.debian.org/debian unstable/main amd64 libmagic-mgc amd64 1:5.45-3 [314 kB]
Get:9 file:/srv/reprepro perl-5.40/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b4 [36.1 kB]
Get:10 file:/srv/reprepro perl-5.40/main amd64 libclone-perl amd64 0.46-1+b3 [13.7 kB]
Get:11 http://deb.debian.org/debian unstable/main amd64 libmagic1t64 amd64 1:5.45-3 [105 kB]
Get:12 http://deb.debian.org/debian unstable/main amd64 file amd64 1:5.45-3 [42.9 kB]
Get:13 file:/srv/reprepro perl-5.40/main amd64 libpackage-stash-xs-perl amd64 0.30-1+b4 [20.7 kB]
Get:14 http://deb.debian.org/debian unstable/main amd64 gettext-base amd64 0.22.5-2 [200 kB]
Get:15 http://deb.debian.org/debian unstable/main amd64 libuchardet0 amd64 0.0.8-1+b1 [68.8 kB]
Get:16 http://deb.debian.org/debian unstable/main amd64 groff-base amd64 1.23.0-5 [1181 kB]
Get:17 file:/srv/reprepro perl-5.40/main amd64 libmoose-perl amd64 2.2207-1+b2 [766 kB]
Get:18 file:/srv/reprepro perl-5.40/main amd64 libpadwalker-perl amd64 2.5-1+b6 [18.6 kB]
Get:19 http://deb.debian.org/debian unstable/main amd64 bsdextrautils amd64 2.40.2-1 [96.1 kB]
Get:20 http://deb.debian.org/debian unstable/main amd64 libpipeline1 amd64 1.5.7-2 [38.0 kB]
Get:21 http://deb.debian.org/debian unstable/main amd64 man-db amd64 2.12.1-2 [1411 kB]
Get:22 http://deb.debian.org/debian unstable/main amd64 m4 amd64 1.4.19-4 [287 kB]
Get:23 http://deb.debian.org/debian unstable/main amd64 autoconf all 2.71-3 [332 kB]
Get:24 http://deb.debian.org/debian unstable/main amd64 autotools-dev all 20220109.1 [51.6 kB]
Get:25 http://deb.debian.org/debian unstable/main amd64 automake all 1:1.16.5-1.3 [823 kB]
Get:26 http://deb.debian.org/debian unstable/main amd64 autopoint all 0.22.5-2 [723 kB]
Get:27 http://deb.debian.org/debian unstable/main amd64 bwa amd64 0.7.17-7+b3 [212 kB]
Get:28 http://deb.debian.org/debian unstable/main amd64 libdebhelper-perl all 13.16 [88.6 kB]
Get:29 http://deb.debian.org/debian unstable/main amd64 libtool all 2.4.7-7 [517 kB]
Get:30 http://deb.debian.org/debian unstable/main amd64 dh-autoreconf all 20 [17.1 kB]
Get:31 http://deb.debian.org/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB]
Get:32 http://deb.debian.org/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB]
Get:33 http://deb.debian.org/debian unstable/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B]
Get:34 http://deb.debian.org/debian unstable/main amd64 libelf1t64 amd64 0.191-2 [188 kB]
Get:35 http://deb.debian.org/debian unstable/main amd64 dwz amd64 0.15-1+b1 [110 kB]
Get:36 http://deb.debian.org/debian unstable/main amd64 libicu72 amd64 72.1-5 [9396 kB]
Get:37 http://deb.debian.org/debian unstable/main amd64 libxml2 amd64 2.12.7+dfsg-3+b1 [671 kB]
Get:38 http://deb.debian.org/debian unstable/main amd64 gettext amd64 0.22.5-2 [1601 kB]
Get:39 http://deb.debian.org/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB]
Get:40 http://deb.debian.org/debian unstable/main amd64 po-debconf all 1.0.21+nmu1 [248 kB]
Get:41 http://deb.debian.org/debian unstable/main amd64 debhelper all 13.16 [891 kB]
Get:42 http://deb.debian.org/debian unstable/main amd64 libfakeroot amd64 1.35.1-1 [28.6 kB]
Get:43 http://deb.debian.org/debian unstable/main amd64 fakeroot amd64 1.35.1-1 [74.5 kB]
Get:44 http://deb.debian.org/debian unstable/main amd64 libalgorithm-c3-perl all 0.11-2 [10.8 kB]
Get:45 http://deb.debian.org/debian unstable/main amd64 libalgorithm-diff-perl all 1.201-1 [43.3 kB]
Get:46 http://deb.debian.org/debian unstable/main amd64 libbambamc0 amd64 0.0.50-6+b1 [39.1 kB]
Get:47 http://deb.debian.org/debian unstable/main amd64 libio-string-perl all 1.08-4 [12.1 kB]
Get:48 http://deb.debian.org/debian unstable/main amd64 libdata-stag-perl all 0.14-3 [448 kB]
Get:49 http://deb.debian.org/debian unstable/main amd64 libbio-perl-perl all 1.7.8-1 [2603 kB]
Get:50 http://deb.debian.org/debian unstable/main amd64 libbrotli1 amd64 1.1.0-2+b4 [300 kB]
Get:51 http://deb.debian.org/debian unstable/main amd64 libcapture-tiny-perl all 0.48-2 [24.6 kB]
Get:52 http://deb.debian.org/debian unstable/main amd64 libclass-c3-perl all 0.35-2 [21.0 kB]
Get:53 http://deb.debian.org/debian unstable/main amd64 libclass-data-inheritable-perl all 0.08-3 [8588 B]
Get:54 http://deb.debian.org/debian unstable/main amd64 libsub-install-perl all 0.929-1 [10.5 kB]
Get:55 http://deb.debian.org/debian unstable/main amd64 libdata-optlist-perl all 0.114-1 [10.6 kB]
Get:56 http://deb.debian.org/debian unstable/main amd64 libdynaloader-functions-perl all 0.004-1 [12.1 kB]
Get:57 http://deb.debian.org/debian unstable/main amd64 libmodule-runtime-perl all 0.016-2 [19.6 kB]
Get:58 http://deb.debian.org/debian unstable/main amd64 libtry-tiny-perl all 0.31-2 [22.6 kB]
Get:59 http://deb.debian.org/debian unstable/main amd64 libmodule-implementation-perl all 0.09-2 [12.6 kB]
Get:60 http://deb.debian.org/debian unstable/main amd64 libpackage-stash-perl all 0.40-1 [22.0 kB]
Get:61 http://deb.debian.org/debian unstable/main amd64 libclass-load-perl all 0.25-2 [15.3 kB]
Get:62 http://deb.debian.org/debian unstable/main amd64 libcom-err2 amd64 1.47.1-1 [22.9 kB]
Get:63 http://deb.debian.org/debian unstable/main amd64 libsub-exporter-perl all 0.990-1 [50.6 kB]
Get:64 http://deb.debian.org/debian unstable/main amd64 libsub-exporter-progressive-perl all 0.001013-3 [7496 B]
Get:65 http://deb.debian.org/debian unstable/main amd64 libconst-fast-perl all 0.014-2 [8792 B]
Get:66 http://deb.debian.org/debian unstable/main amd64 libkrb5support0 amd64 1.21.3-3 [32.5 kB]
Get:67 http://deb.debian.org/debian unstable/main amd64 libk5crypto3 amd64 1.21.3-3 [79.9 kB]
Get:68 http://deb.debian.org/debian unstable/main amd64 libkeyutils1 amd64 1.6.3-3 [8952 B]
Get:69 http://deb.debian.org/debian unstable/main amd64 libkrb5-3 amd64 1.21.3-3 [324 kB]
Get:70 http://deb.debian.org/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.21.3-3 [136 kB]
Get:71 http://deb.debian.org/debian unstable/main amd64 libnghttp2-14 amd64 1.62.1-2 [74.9 kB]
Get:72 http://deb.debian.org/debian unstable/main amd64 libnghttp3-9 amd64 1.4.0-1 [63.1 kB]
Get:73 http://deb.debian.org/debian unstable/main amd64 libngtcp2-16 amd64 1.6.0-1 [122 kB]
Get:74 http://deb.debian.org/debian unstable/main amd64 libngtcp2-crypto-gnutls8 amd64 1.6.0-1 [19.6 kB]
Get:75 http://deb.debian.org/debian unstable/main amd64 libpsl5t64 amd64 0.21.2-1.1 [56.8 kB]
Get:76 http://deb.debian.org/debian unstable/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b4 [58.5 kB]
Get:77 http://deb.debian.org/debian unstable/main amd64 libssh2-1t64 amd64 1.11.0-7 [216 kB]
Get:78 http://deb.debian.org/debian unstable/main amd64 libcurl3t64-gnutls amd64 8.9.1-1 [470 kB]
Get:79 http://deb.debian.org/debian unstable/main amd64 libnumber-compare-perl all 0.03-3 [6332 B]
Get:80 http://deb.debian.org/debian unstable/main amd64 libtext-glob-perl all 0.11-3 [7676 B]
Get:81 http://deb.debian.org/debian unstable/main amd64 libfile-find-rule-perl all 0.34-3 [26.6 kB]
Get:82 http://deb.debian.org/debian unstable/main amd64 libdata-compare-perl all 1.29-1 [19.6 kB]
Get:83 http://deb.debian.org/debian unstable/main amd64 libdeflate0 amd64 1.20-1 [46.0 kB]
Get:84 http://deb.debian.org/debian unstable/main amd64 libdevel-globaldestruction-perl all 0.14-4 [7144 B]
Get:85 http://deb.debian.org/debian unstable/main amd64 libmro-compat-perl all 0.15-2 [11.8 kB]
Get:86 http://deb.debian.org/debian unstable/main amd64 libdevel-overloadinfo-perl all 0.007-1 [7896 B]
Get:87 http://deb.debian.org/debian unstable/main amd64 libdevel-stacktrace-perl all 2.0500-1 [26.4 kB]
Get:88 http://deb.debian.org/debian unstable/main amd64 libdist-checkconflicts-perl all 0.11-2 [10.5 kB]
Get:89 http://deb.debian.org/debian unstable/main amd64 libenv-path-perl all 0.19-4 [19.1 kB]
Get:90 http://deb.debian.org/debian unstable/main amd64 libeval-closure-perl all 0.14-3 [11.2 kB]
Get:91 http://deb.debian.org/debian unstable/main amd64 libexception-class-perl all 1.45-1 [34.6 kB]
Get:92 http://deb.debian.org/debian unstable/main amd64 libfile-chdir-perl all 0.1008-1.2 [11.9 kB]
Get:93 http://deb.debian.org/debian unstable/main amd64 libhtscodecs2 amd64 1.6.0-1+b1 [93.0 kB]
Get:94 http://deb.debian.org/debian unstable/main amd64 libhts3t64 amd64 1.20+ds-1 [452 kB]
Get:95 http://deb.debian.org/debian unstable/main amd64 libmodule-runtime-conflicts-perl all 0.003-2 [7356 B]
Get:96 http://deb.debian.org/debian unstable/main amd64 libpackage-deprecationmanager-perl all 0.18-1 [17.6 kB]
Get:97 http://deb.debian.org/debian unstable/main amd64 libncurses6 amd64 6.5-2 [104 kB]
Get:98 http://deb.debian.org/debian unstable/main amd64 libpath-tiny-perl all 0.146-1 [56.2 kB]
Get:99 http://deb.debian.org/debian unstable/main amd64 libsub-uplevel-perl all 0.2800-3 [14.0 kB]
Get:100 http://deb.debian.org/debian unstable/main amd64 libtest-deep-perl all 1.204-1 [52.9 kB]
Get:101 http://deb.debian.org/debian unstable/main amd64 libtext-diff-perl all 1.45-2 [27.2 kB]
Get:102 http://deb.debian.org/debian unstable/main amd64 libtest-differences-perl all 0.71-1 [17.9 kB]
Get:103 http://deb.debian.org/debian unstable/main amd64 libtest-exception-perl all 0.43-3 [16.9 kB]
Get:104 http://deb.debian.org/debian unstable/main amd64 libtest-files-perl all 0.26-1 [21.6 kB]
Get:105 http://deb.debian.org/debian unstable/main amd64 libtest-warn-perl all 0.37-2 [14.5 kB]
Get:106 http://deb.debian.org/debian unstable/main amd64 libtest-most-perl all 0.38-1 [25.1 kB]
Get:107 http://deb.debian.org/debian unstable/main amd64 libtext-csv-perl all 2.04-1 [112 kB]
Get:108 http://deb.debian.org/debian unstable/main amd64 samtools amd64 1.20-3 [653 kB]
Get:109 http://deb.debian.org/debian unstable/main amd64 smalt amd64 0.7.6-13 [115 kB]
Get:110 http://deb.debian.org/debian unstable/main amd64 tabix amd64 1.20+ds-1 [483 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 27.8 MB in 0s (118 MB/s)
Selecting previously unselected package sensible-utils.
(Reading database ... 22966 files and directories currently installed.)
Preparing to unpack .../000-sensible-utils_0.0.24_all.deb ...
Unpacking sensible-utils (0.0.24) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../001-libmagic-mgc_1%3a5.45-3_amd64.deb ...
Unpacking libmagic-mgc (1:5.45-3) ...
Selecting previously unselected package libmagic1t64:amd64.
Preparing to unpack .../002-libmagic1t64_1%3a5.45-3_amd64.deb ...
Unpacking libmagic1t64:amd64 (1:5.45-3) ...
Selecting previously unselected package file.
Preparing to unpack .../003-file_1%3a5.45-3_amd64.deb ...
Unpacking file (1:5.45-3) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../004-gettext-base_0.22.5-2_amd64.deb ...
Unpacking gettext-base (0.22.5-2) ...
Selecting previously unselected package libuchardet0:amd64.
Preparing to unpack .../005-libuchardet0_0.0.8-1+b1_amd64.deb ...
Unpacking libuchardet0:amd64 (0.0.8-1+b1) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../006-groff-base_1.23.0-5_amd64.deb ...
Unpacking groff-base (1.23.0-5) ...
Selecting previously unselected package bsdextrautils.
Preparing to unpack .../007-bsdextrautils_2.40.2-1_amd64.deb ...
Unpacking bsdextrautils (2.40.2-1) ...
Selecting previously unselected package libpipeline1:amd64.
Preparing to unpack .../008-libpipeline1_1.5.7-2_amd64.deb ...
Unpacking libpipeline1:amd64 (1.5.7-2) ...
Selecting previously unselected package man-db.
Preparing to unpack .../009-man-db_2.12.1-2_amd64.deb ...
Unpacking man-db (2.12.1-2) ...
Selecting previously unselected package m4.
Preparing to unpack .../010-m4_1.4.19-4_amd64.deb ...
Unpacking m4 (1.4.19-4) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../011-autoconf_2.71-3_all.deb ...
Unpacking autoconf (2.71-3) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../012-autotools-dev_20220109.1_all.deb ...
Unpacking autotools-dev (20220109.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../013-automake_1%3a1.16.5-1.3_all.deb ...
Unpacking automake (1:1.16.5-1.3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../014-autopoint_0.22.5-2_all.deb ...
Unpacking autopoint (0.22.5-2) ...
Selecting previously unselected package bwa.
Preparing to unpack .../015-bwa_0.7.17-7+b3_amd64.deb ...
Unpacking bwa (0.7.17-7+b3) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../016-libdebhelper-perl_13.16_all.deb ...
Unpacking libdebhelper-perl (13.16) ...
Selecting previously unselected package libtool.
Preparing to unpack .../017-libtool_2.4.7-7_all.deb ...
Unpacking libtool (2.4.7-7) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../018-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../019-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../020-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../021-dh-strip-nondeterminism_1.14.0-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.14.0-1) ...
Selecting previously unselected package libelf1t64:amd64.
Preparing to unpack .../022-libelf1t64_0.191-2_amd64.deb ...
Unpacking libelf1t64:amd64 (0.191-2) ...
Selecting previously unselected package dwz.
Preparing to unpack .../023-dwz_0.15-1+b1_amd64.deb ...
Unpacking dwz (0.15-1+b1) ...
Selecting previously unselected package libicu72:amd64.
Preparing to unpack .../024-libicu72_72.1-5_amd64.deb ...
Unpacking libicu72:amd64 (72.1-5) ...
Selecting previously unselected package libxml2:amd64.
Preparing to unpack .../025-libxml2_2.12.7+dfsg-3+b1_amd64.deb ...
Unpacking libxml2:amd64 (2.12.7+dfsg-3+b1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../026-gettext_0.22.5-2_amd64.deb ...
Unpacking gettext (0.22.5-2) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../027-intltool-debian_0.35.0+20060710.6_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.6) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../028-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../029-debhelper_13.16_all.deb ...
Unpacking debhelper (13.16) ...
Selecting previously unselected package libfakeroot:amd64.
Preparing to unpack .../030-libfakeroot_1.35.1-1_amd64.deb ...
Unpacking libfakeroot:amd64 (1.35.1-1) ...
Selecting previously unselected package fakeroot.
Preparing to unpack .../031-fakeroot_1.35.1-1_amd64.deb ...
Unpacking fakeroot (1.35.1-1) ...
Selecting previously unselected package libalgorithm-c3-perl.
Preparing to unpack .../032-libalgorithm-c3-perl_0.11-2_all.deb ...
Unpacking libalgorithm-c3-perl (0.11-2) ...
Selecting previously unselected package libalgorithm-diff-perl.
Preparing to unpack .../033-libalgorithm-diff-perl_1.201-1_all.deb ...
Unpacking libalgorithm-diff-perl (1.201-1) ...
Selecting previously unselected package libb-hooks-op-check-perl:amd64.
Preparing to unpack .../034-libb-hooks-op-check-perl_0.22-3+b2_amd64.deb ...
Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b2) ...
Selecting previously unselected package libbambamc0:amd64.
Preparing to unpack .../035-libbambamc0_0.0.50-6+b1_amd64.deb ...
Unpacking libbambamc0:amd64 (0.0.50-6+b1) ...
Selecting previously unselected package libio-string-perl.
Preparing to unpack .../036-libio-string-perl_1.08-4_all.deb ...
Unpacking libio-string-perl (1.08-4) ...
Selecting previously unselected package libdata-stag-perl.
Preparing to unpack .../037-libdata-stag-perl_0.14-3_all.deb ...
Unpacking libdata-stag-perl (0.14-3) ...
Selecting previously unselected package libbio-perl-perl.
Preparing to unpack .../038-libbio-perl-perl_1.7.8-1_all.deb ...
Unpacking libbio-perl-perl (1.7.8-1) ...
Selecting previously unselected package libbrotli1:amd64.
Preparing to unpack .../039-libbrotli1_1.1.0-2+b4_amd64.deb ...
Unpacking libbrotli1:amd64 (1.1.0-2+b4) ...
Selecting previously unselected package libcapture-tiny-perl.
Preparing to unpack .../040-libcapture-tiny-perl_0.48-2_all.deb ...
Unpacking libcapture-tiny-perl (0.48-2) ...
Selecting previously unselected package libclass-c3-perl.
Preparing to unpack .../041-libclass-c3-perl_0.35-2_all.deb ...
Unpacking libclass-c3-perl (0.35-2) ...
Selecting previously unselected package libclass-data-inheritable-perl.
Preparing to unpack .../042-libclass-data-inheritable-perl_0.08-3_all.deb ...
Unpacking libclass-data-inheritable-perl (0.08-3) ...
Selecting previously unselected package libparams-util-perl.
Preparing to unpack .../043-libparams-util-perl_1.102-3+b1_amd64.deb ...
Unpacking libparams-util-perl (1.102-3+b1) ...
Selecting previously unselected package libsub-install-perl.
Preparing to unpack .../044-libsub-install-perl_0.929-1_all.deb ...
Unpacking libsub-install-perl (0.929-1) ...
Selecting previously unselected package libdata-optlist-perl.
Preparing to unpack .../045-libdata-optlist-perl_0.114-1_all.deb ...
Unpacking libdata-optlist-perl (0.114-1) ...
Selecting previously unselected package libdynaloader-functions-perl.
Preparing to unpack .../046-libdynaloader-functions-perl_0.004-1_all.deb ...
Unpacking libdynaloader-functions-perl (0.004-1) ...
Selecting previously unselected package libdevel-callchecker-perl:amd64.
Preparing to unpack .../047-libdevel-callchecker-perl_0.009-1+b1_amd64.deb ...
Unpacking libdevel-callchecker-perl:amd64 (0.009-1+b1) ...
Selecting previously unselected package libparams-classify-perl:amd64.
Preparing to unpack .../048-libparams-classify-perl_0.015-2+b4_amd64.deb ...
Unpacking libparams-classify-perl:amd64 (0.015-2+b4) ...
Selecting previously unselected package libmodule-runtime-perl.
Preparing to unpack .../049-libmodule-runtime-perl_0.016-2_all.deb ...
Unpacking libmodule-runtime-perl (0.016-2) ...
Selecting previously unselected package libtry-tiny-perl.
Preparing to unpack .../050-libtry-tiny-perl_0.31-2_all.deb ...
Unpacking libtry-tiny-perl (0.31-2) ...
Selecting previously unselected package libmodule-implementation-perl.
Preparing to unpack .../051-libmodule-implementation-perl_0.09-2_all.deb ...
Unpacking libmodule-implementation-perl (0.09-2) ...
Selecting previously unselected package libpackage-stash-perl.
Preparing to unpack .../052-libpackage-stash-perl_0.40-1_all.deb ...
Unpacking libpackage-stash-perl (0.40-1) ...
Selecting previously unselected package libclass-load-perl.
Preparing to unpack .../053-libclass-load-perl_0.25-2_all.deb ...
Unpacking libclass-load-perl (0.25-2) ...
Selecting previously unselected package libclass-load-xs-perl.
Preparing to unpack .../054-libclass-load-xs-perl_0.10-2+b4_amd64.deb ...
Unpacking libclass-load-xs-perl (0.10-2+b4) ...
Selecting previously unselected package libclass-xsaccessor-perl.
Preparing to unpack .../055-libclass-xsaccessor-perl_1.19-4+b4_amd64.deb ...
Unpacking libclass-xsaccessor-perl (1.19-4+b4) ...
Selecting previously unselected package libclone-perl:amd64.
Preparing to unpack .../056-libclone-perl_0.46-1+b3_amd64.deb ...
Unpacking libclone-perl:amd64 (0.46-1+b3) ...
Selecting previously unselected package libcom-err2:amd64.
Preparing to unpack .../057-libcom-err2_1.47.1-1_amd64.deb ...
Unpacking libcom-err2:amd64 (1.47.1-1) ...
Selecting previously unselected package libsub-exporter-perl.
Preparing to unpack .../058-libsub-exporter-perl_0.990-1_all.deb ...
Unpacking libsub-exporter-perl (0.990-1) ...
Selecting previously unselected package libsub-exporter-progressive-perl.
Preparing to unpack .../059-libsub-exporter-progressive-perl_0.001013-3_all.deb ...
Unpacking libsub-exporter-progressive-perl (0.001013-3) ...
Selecting previously unselected package libconst-fast-perl.
Preparing to unpack .../060-libconst-fast-perl_0.014-2_all.deb ...
Unpacking libconst-fast-perl (0.014-2) ...
Selecting previously unselected package libkrb5support0:amd64.
Preparing to unpack .../061-libkrb5support0_1.21.3-3_amd64.deb ...
Unpacking libkrb5support0:amd64 (1.21.3-3) ...
Selecting previously unselected package libk5crypto3:amd64.
Preparing to unpack .../062-libk5crypto3_1.21.3-3_amd64.deb ...
Unpacking libk5crypto3:amd64 (1.21.3-3) ...
Selecting previously unselected package libkeyutils1:amd64.
Preparing to unpack .../063-libkeyutils1_1.6.3-3_amd64.deb ...
Unpacking libkeyutils1:amd64 (1.6.3-3) ...
Selecting previously unselected package libkrb5-3:amd64.
Preparing to unpack .../064-libkrb5-3_1.21.3-3_amd64.deb ...
Unpacking libkrb5-3:amd64 (1.21.3-3) ...
Selecting previously unselected package libgssapi-krb5-2:amd64.
Preparing to unpack .../065-libgssapi-krb5-2_1.21.3-3_amd64.deb ...
Unpacking libgssapi-krb5-2:amd64 (1.21.3-3) ...
Selecting previously unselected package libnghttp2-14:amd64.
Preparing to unpack .../066-libnghttp2-14_1.62.1-2_amd64.deb ...
Unpacking libnghttp2-14:amd64 (1.62.1-2) ...
Selecting previously unselected package libnghttp3-9:amd64.
Preparing to unpack .../067-libnghttp3-9_1.4.0-1_amd64.deb ...
Unpacking libnghttp3-9:amd64 (1.4.0-1) ...
Selecting previously unselected package libngtcp2-16:amd64.
Preparing to unpack .../068-libngtcp2-16_1.6.0-1_amd64.deb ...
Unpacking libngtcp2-16:amd64 (1.6.0-1) ...
Selecting previously unselected package libngtcp2-crypto-gnutls8:amd64.
Preparing to unpack .../069-libngtcp2-crypto-gnutls8_1.6.0-1_amd64.deb ...
Unpacking libngtcp2-crypto-gnutls8:amd64 (1.6.0-1) ...
Selecting previously unselected package libpsl5t64:amd64.
Preparing to unpack .../070-libpsl5t64_0.21.2-1.1_amd64.deb ...
Unpacking libpsl5t64:amd64 (0.21.2-1.1) ...
Selecting previously unselected package librtmp1:amd64.
Preparing to unpack .../071-librtmp1_2.4+20151223.gitfa8646d.1-2+b4_amd64.deb ...
Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b4) ...
Selecting previously unselected package libssh2-1t64:amd64.
Preparing to unpack .../072-libssh2-1t64_1.11.0-7_amd64.deb ...
Unpacking libssh2-1t64:amd64 (1.11.0-7) ...
Selecting previously unselected package libcurl3t64-gnutls:amd64.
Preparing to unpack .../073-libcurl3t64-gnutls_8.9.1-1_amd64.deb ...
Unpacking libcurl3t64-gnutls:amd64 (8.9.1-1) ...
Selecting previously unselected package libnumber-compare-perl.
Preparing to unpack .../074-libnumber-compare-perl_0.03-3_all.deb ...
Unpacking libnumber-compare-perl (0.03-3) ...
Selecting previously unselected package libtext-glob-perl.
Preparing to unpack .../075-libtext-glob-perl_0.11-3_all.deb ...
Unpacking libtext-glob-perl (0.11-3) ...
Selecting previously unselected package libfile-find-rule-perl.
Preparing to unpack .../076-libfile-find-rule-perl_0.34-3_all.deb ...
Unpacking libfile-find-rule-perl (0.34-3) ...
Selecting previously unselected package libdata-compare-perl.
Preparing to unpack .../077-libdata-compare-perl_1.29-1_all.deb ...
Unpacking libdata-compare-perl (1.29-1) ...
Selecting previously unselected package libdeflate0:amd64.
Preparing to unpack .../078-libdeflate0_1.20-1_amd64.deb ...
Unpacking libdeflate0:amd64 (1.20-1) ...
Selecting previously unselected package libdevel-globaldestruction-perl.
Preparing to unpack .../079-libdevel-globaldestruction-perl_0.14-4_all.deb ...
Unpacking libdevel-globaldestruction-perl (0.14-4) ...
Selecting previously unselected package libmro-compat-perl.
Preparing to unpack .../080-libmro-compat-perl_0.15-2_all.deb ...
Unpacking libmro-compat-perl (0.15-2) ...
Selecting previously unselected package libdevel-overloadinfo-perl.
Preparing to unpack .../081-libdevel-overloadinfo-perl_0.007-1_all.deb ...
Unpacking libdevel-overloadinfo-perl (0.007-1) ...
Selecting previously unselected package libdevel-stacktrace-perl.
Preparing to unpack .../082-libdevel-stacktrace-perl_2.0500-1_all.deb ...
Unpacking libdevel-stacktrace-perl (2.0500-1) ...
Selecting previously unselected package libdist-checkconflicts-perl.
Preparing to unpack .../083-libdist-checkconflicts-perl_0.11-2_all.deb ...
Unpacking libdist-checkconflicts-perl (0.11-2) ...
Selecting previously unselected package libenv-path-perl.
Preparing to unpack .../084-libenv-path-perl_0.19-4_all.deb ...
Unpacking libenv-path-perl (0.19-4) ...
Selecting previously unselected package libeval-closure-perl.
Preparing to unpack .../085-libeval-closure-perl_0.14-3_all.deb ...
Unpacking libeval-closure-perl (0.14-3) ...
Selecting previously unselected package libexception-class-perl.
Preparing to unpack .../086-libexception-class-perl_1.45-1_all.deb ...
Unpacking libexception-class-perl (1.45-1) ...
Selecting previously unselected package libfile-chdir-perl.
Preparing to unpack .../087-libfile-chdir-perl_0.1008-1.2_all.deb ...
Unpacking libfile-chdir-perl (0.1008-1.2) ...
Selecting previously unselected package libhtscodecs2:amd64.
Preparing to unpack .../088-libhtscodecs2_1.6.0-1+b1_amd64.deb ...
Unpacking libhtscodecs2:amd64 (1.6.0-1+b1) ...
Selecting previously unselected package libhts3t64:amd64.
Preparing to unpack .../089-libhts3t64_1.20+ds-1_amd64.deb ...
Unpacking libhts3t64:amd64 (1.20+ds-1) ...
Selecting previously unselected package libmodule-runtime-conflicts-perl.
Preparing to unpack .../090-libmodule-runtime-conflicts-perl_0.003-2_all.deb ...
Unpacking libmodule-runtime-conflicts-perl (0.003-2) ...
Selecting previously unselected package libpackage-deprecationmanager-perl.
Preparing to unpack .../091-libpackage-deprecationmanager-perl_0.18-1_all.deb ...
Unpacking libpackage-deprecationmanager-perl (0.18-1) ...
Selecting previously unselected package libpackage-stash-xs-perl:amd64.
Preparing to unpack .../092-libpackage-stash-xs-perl_0.30-1+b4_amd64.deb ...
Unpacking libpackage-stash-xs-perl:amd64 (0.30-1+b4) ...
Selecting previously unselected package libmoose-perl:amd64.
Preparing to unpack .../093-libmoose-perl_2.2207-1+b2_amd64.deb ...
Unpacking libmoose-perl:amd64 (2.2207-1+b2) ...
Selecting previously unselected package libncurses6:amd64.
Preparing to unpack .../094-libncurses6_6.5-2_amd64.deb ...
Unpacking libncurses6:amd64 (6.5-2) ...
Selecting previously unselected package libpadwalker-perl.
Preparing to unpack .../095-libpadwalker-perl_2.5-1+b6_amd64.deb ...
Unpacking libpadwalker-perl (2.5-1+b6) ...
Selecting previously unselected package libpath-tiny-perl.
Preparing to unpack .../096-libpath-tiny-perl_0.146-1_all.deb ...
Unpacking libpath-tiny-perl (0.146-1) ...
Selecting previously unselected package libsub-uplevel-perl.
Preparing to unpack .../097-libsub-uplevel-perl_0.2800-3_all.deb ...
Unpacking libsub-uplevel-perl (0.2800-3) ...
Selecting previously unselected package libtest-deep-perl.
Preparing to unpack .../098-libtest-deep-perl_1.204-1_all.deb ...
Unpacking libtest-deep-perl (1.204-1) ...
Selecting previously unselected package libtext-diff-perl.
Preparing to unpack .../099-libtext-diff-perl_1.45-2_all.deb ...
Unpacking libtext-diff-perl (1.45-2) ...
Selecting previously unselected package libtest-differences-perl.
Preparing to unpack .../100-libtest-differences-perl_0.71-1_all.deb ...
Unpacking libtest-differences-perl (0.71-1) ...
Selecting previously unselected package libtest-exception-perl.
Preparing to unpack .../101-libtest-exception-perl_0.43-3_all.deb ...
Unpacking libtest-exception-perl (0.43-3) ...
Selecting previously unselected package libtest-files-perl.
Preparing to unpack .../102-libtest-files-perl_0.26-1_all.deb ...
Unpacking libtest-files-perl (0.26-1) ...
Selecting previously unselected package libtest-warn-perl.
Preparing to unpack .../103-libtest-warn-perl_0.37-2_all.deb ...
Unpacking libtest-warn-perl (0.37-2) ...
Selecting previously unselected package libtest-most-perl.
Preparing to unpack .../104-libtest-most-perl_0.38-1_all.deb ...
Unpacking libtest-most-perl (0.38-1) ...
Selecting previously unselected package libtext-csv-perl.
Preparing to unpack .../105-libtext-csv-perl_2.04-1_all.deb ...
Unpacking libtext-csv-perl (2.04-1) ...
Selecting previously unselected package samtools.
Preparing to unpack .../106-samtools_1.20-3_amd64.deb ...
Unpacking samtools (1.20-3) ...
Selecting previously unselected package smalt.
Preparing to unpack .../107-smalt_0.7.6-13_amd64.deb ...
Unpacking smalt (0.7.6-13) ...
Selecting previously unselected package tabix.
Preparing to unpack .../108-tabix_1.20+ds-1_amd64.deb ...
Unpacking tabix (1.20+ds-1) ...
Selecting previously unselected package sbuild-build-depends-main-dummy.
Preparing to unpack .../109-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ...
Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ...
Setting up libhtscodecs2:amd64 (1.6.0-1+b1) ...
Setting up libpipeline1:amd64 (1.5.7-2) ...
Setting up libkeyutils1:amd64 (1.6.3-3) ...
Setting up libicu72:amd64 (72.1-5) ...
Setting up bsdextrautils (2.40.2-1) ...
Setting up libdynaloader-functions-perl (0.004-1) ...
Setting up libtext-glob-perl (0.11-3) ...
Setting up libtest-deep-perl (1.204-1) ...
Setting up libmagic-mgc (1:5.45-3) ...
Setting up libclone-perl:amd64 (0.46-1+b3) ...
Setting up libalgorithm-diff-perl (1.201-1) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up bwa (0.7.17-7+b3) ...
Setting up libdebhelper-perl (13.16) ...
Setting up libbrotli1:amd64 (1.1.0-2+b4) ...
Setting up libmagic1t64:amd64 (1:5.45-3) ...
Setting up libtry-tiny-perl (0.31-2) ...
Setting up libpsl5t64:amd64 (0.21.2-1.1) ...
Setting up libnghttp2-14:amd64 (1.62.1-2) ...
Setting up libdeflate0:amd64 (1.20-1) ...
Setting up gettext-base (0.22.5-2) ...
Setting up m4 (1.4.19-4) ...
Setting up libpadwalker-perl (2.5-1+b6) ...
Setting up libcom-err2:amd64 (1.47.1-1) ...
Setting up file (1:5.45-3) ...
Setting up libfakeroot:amd64 (1.35.1-1) ...
Setting up libsub-install-perl (0.929-1) ...
Setting up libelf1t64:amd64 (0.191-2) ...
Setting up libkrb5support0:amd64 (1.21.3-3) ...
Setting up libnumber-compare-perl (0.03-3) ...
Setting up fakeroot (1.35.1-1) ...
update-alternatives: using /usr/bin/fakeroot-sysv to provide /usr/bin/fakeroot (fakeroot) in auto mode
Setting up libio-string-perl (1.08-4) ...
Setting up libpackage-stash-xs-perl:amd64 (0.30-1+b4) ...
Setting up autotools-dev (20220109.1) ...
Setting up libclass-data-inheritable-perl (0.08-3) ...
Setting up libalgorithm-c3-perl (0.11-2) ...
Setting up libtext-diff-perl (1.45-2) ...
Setting up libfile-find-rule-perl (0.34-3) ...
Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b4) ...
Setting up libncurses6:amd64 (6.5-2) ...
Setting up libenv-path-perl (0.19-4) ...
Setting up libbambamc0:amd64 (0.0.50-6+b1) ...
Setting up autopoint (0.22.5-2) ...
Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b2) ...
Setting up libk5crypto3:amd64 (1.21.3-3) ...
Setting up libparams-util-perl (1.102-3+b1) ...
Setting up autoconf (2.71-3) ...
Setting up libnghttp3-9:amd64 (1.4.0-1) ...
Setting up libsub-exporter-progressive-perl (0.001013-3) ...
Setting up libcapture-tiny-perl (0.48-2) ...
Setting up dwz (0.15-1+b1) ...
Setting up libdata-stag-perl (0.14-3) ...
Setting up libfile-chdir-perl (0.1008-1.2) ...
Setting up sensible-utils (0.0.24) ...
Setting up libpath-tiny-perl (0.146-1) ...
Setting up libuchardet0:amd64 (0.0.8-1+b1) ...
Setting up libsub-uplevel-perl (0.2800-3) ...
Setting up libdevel-globaldestruction-perl (0.14-4) ...
Setting up libngtcp2-16:amd64 (1.6.0-1) ...
Setting up libdevel-stacktrace-perl (2.0500-1) ...
Setting up libclass-xsaccessor-perl (1.19-4+b4) ...
Setting up libkrb5-3:amd64 (1.21.3-3) ...
Setting up libbio-perl-perl (1.7.8-1) ...
Setting up libssh2-1t64:amd64 (1.11.0-7) ...
Setting up tabix (1.20+ds-1) ...
Setting up libxml2:amd64 (2.12.7+dfsg-3+b1) ...
Setting up libngtcp2-crypto-gnutls8:amd64 (1.6.0-1) ...
Setting up libtext-csv-perl (2.04-1) ...
Setting up automake (1:1.16.5-1.3) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up libfile-stripnondeterminism-perl (1.14.0-1) ...
Setting up smalt (0.7.6-13) ...
Setting up gettext (0.22.5-2) ...
Setting up libtool (2.4.7-7) ...
Setting up libtest-warn-perl (0.37-2) ...
Setting up libtest-differences-perl (0.71-1) ...
Setting up libexception-class-perl (1.45-1) ...
Setting up libclass-c3-perl (0.35-2) ...
Setting up libdevel-callchecker-perl:amd64 (0.009-1+b1) ...
Setting up libdata-compare-perl (1.29-1) ...
Setting up intltool-debian (0.35.0+20060710.6) ...
Setting up dh-autoreconf (20) ...
Setting up libtest-exception-perl (0.43-3) ...
Setting up libgssapi-krb5-2:amd64 (1.21.3-3) ...
Setting up libdata-optlist-perl (0.114-1) ...
Setting up dh-strip-nondeterminism (1.14.0-1) ...
Setting up groff-base (1.23.0-5) ...
Setting up libmro-compat-perl (0.15-2) ...
Setting up libsub-exporter-perl (0.990-1) ...
Setting up libeval-closure-perl (0.14-3) ...
Setting up libtest-most-perl (0.38-1) ...
Setting up po-debconf (1.0.21+nmu1) ...
Setting up libparams-classify-perl:amd64 (0.015-2+b4) ...
Setting up libcurl3t64-gnutls:amd64 (8.9.1-1) ...
Setting up man-db (2.12.1-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libmodule-runtime-perl (0.016-2) ...
Setting up libdist-checkconflicts-perl (0.11-2) ...
Setting up libconst-fast-perl (0.014-2) ...
Setting up libhts3t64:amd64 (1.20+ds-1) ...
Setting up libmodule-implementation-perl (0.09-2) ...
Setting up libpackage-stash-perl (0.40-1) ...
Setting up debhelper (13.16) ...
Setting up libmodule-runtime-conflicts-perl (0.003-2) ...
Setting up libtest-files-perl (0.26-1) ...
Setting up libclass-load-perl (0.25-2) ...
Setting up samtools (1.20-3) ...
Setting up libpackage-deprecationmanager-perl (0.18-1) ...
Setting up libdevel-overloadinfo-perl (0.007-1) ...
Setting up libclass-load-xs-perl (0.10-2+b4) ...
Setting up libmoose-perl:amd64 (2.2207-1+b2) ...
Setting up sbuild-build-depends-main-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.39-6) ...

+------------------------------------------------------------------------------+
| Check architectures                                                          |
+------------------------------------------------------------------------------+

Arch check ok (amd64 included in all)

+------------------------------------------------------------------------------+
| Build environment                                                            |
+------------------------------------------------------------------------------+

Kernel: Linux 6.9.7-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.9.7-1 (2024-06-27) amd64 (x86_64)
Toolchain package versions: binutils_2.42.90.20240720-2 dpkg-dev_1.22.11 g++-13_13.3.0-4 g++-14_14.2.0-1 gcc-13_13.3.0-4 gcc-14_14.2.0-1 libc6-dev_2.39-6 libstdc++-13-dev_13.3.0-4 libstdc++-14-dev_14.2.0-1 libstdc++6_14.2.0-1 linux-libc-dev_6.9.12-1
Package versions: adduser_3.137 apt_2.9.7 autoconf_2.71-3 automake_1:1.16.5-1.3 autopoint_0.22.5-2 autotools-dev_20220109.1 base-files_13.4 base-passwd_3.6.4 bash_5.2.21-2.1 binutils_2.42.90.20240720-2 binutils-common_2.42.90.20240720-2 binutils-x86-64-linux-gnu_2.42.90.20240720-2 bsdextrautils_2.40.2-1 bsdutils_1:2.40.2-1 build-essential_12.10 bwa_0.7.17-7+b3 bzip2_1.0.8-5.1 coreutils_9.4-3.1 cpp_4:14.1.0-2 cpp-13_13.3.0-4 cpp-13-x86-64-linux-gnu_13.3.0-4 cpp-14_14.2.0-1 cpp-14-x86-64-linux-gnu_14.2.0-1 cpp-x86-64-linux-gnu_4:14.1.0-2 dash_0.5.12-9 debconf_1.5.87 debhelper_13.16 debian-archive-keyring_2023.4 debianutils_5.20 dh-autoreconf_20 dh-strip-nondeterminism_1.14.0-1 diffutils_1:3.10-1 dirmngr_2.2.43-8 dpkg_1.22.11 dpkg-dev_1.22.11 dwz_0.15-1+b1 eatmydata_131-2 fakeroot_1.35.1-1 file_1:5.45-3 findutils_4.10.0-2 g++_4:14.1.0-2 g++-13_13.3.0-4 g++-13-x86-64-linux-gnu_13.3.0-4 g++-14_14.2.0-1 g++-14-x86-64-linux-gnu_14.2.0-1 g++-x86-64-linux-gnu_4:14.1.0-2 gcc_4:14.1.0-2 gcc-13_13.3.0-4 gcc-13-base_13.3.0-4 gcc-13-x86-64-linux-gnu_13.3.0-4 gcc-14_14.2.0-1 gcc-14-base_14.2.0-1 gcc-14-x86-64-linux-gnu_14.2.0-1 gcc-x86-64-linux-gnu_4:14.1.0-2 gettext_0.22.5-2 gettext-base_0.22.5-2 gnupg_2.2.43-8 gnupg-l10n_2.2.43-8 gnupg-utils_2.2.43-8 gpg_2.2.43-8 gpg-agent_2.2.43-8 gpg-wks-client_2.2.43-8 gpgconf_2.2.43-8 gpgsm_2.2.43-8 gpgv_2.2.43-8 grep_3.11-4 groff-base_1.23.0-5 gzip_1.12-1.1 hostname_3.23+nmu2 init-system-helpers_1.66 intltool-debian_0.35.0+20060710.6 libacl1_2.3.2-2 libalgorithm-c3-perl_0.11-2 libalgorithm-diff-perl_1.201-1 libapt-pkg6.0t64_2.9.7 libarchive-zip-perl_1.68-1 libasan8_14.2.0-1 libassuan0_2.5.6-1+b1 libatomic1_14.2.0-1 libattr1_1:2.5.2-1 libaudit-common_1:3.1.2-4 libaudit1_1:3.1.2-4+b1 libb-hooks-op-check-perl_0.22-3+b2 libbambamc0_0.0.50-6+b1 libbinutils_2.42.90.20240720-2 libbio-perl-perl_1.7.8-1 libblkid1_2.40.2-1 libbrotli1_1.1.0-2+b4 libbsd0_0.12.2-1 libbz2-1.0_1.0.8-5.1 libc-bin_2.39-6 libc-dev-bin_2.39-6 libc-l10n_2.39-6 libc6_2.39-6 libc6-dev_2.39-6 libcap-ng0_0.8.5-1+b1 libcap2_1:2.66-5 libcapture-tiny-perl_0.48-2 libcc1-0_14.2.0-1 libclass-c3-perl_0.35-2 libclass-data-inheritable-perl_0.08-3 libclass-load-perl_0.25-2 libclass-load-xs-perl_0.10-2+b4 libclass-xsaccessor-perl_1.19-4+b4 libclone-perl_0.46-1+b3 libcom-err2_1.47.1-1 libconst-fast-perl_0.014-2 libcrypt-dev_1:4.4.36-4 libcrypt1_1:4.4.36-4 libctf-nobfd0_2.42.90.20240720-2 libctf0_2.42.90.20240720-2 libcurl3t64-gnutls_8.9.1-1 libdata-compare-perl_1.29-1 libdata-optlist-perl_0.114-1 libdata-stag-perl_0.14-3 libdb5.3t64_5.3.28+dfsg2-7 libdebconfclient0_0.272 libdebhelper-perl_13.16 libdeflate0_1.20-1 libdevel-callchecker-perl_0.009-1+b1 libdevel-globaldestruction-perl_0.14-4 libdevel-overloadinfo-perl_0.007-1 libdevel-stacktrace-perl_2.0500-1 libdist-checkconflicts-perl_0.11-2 libdpkg-perl_1.22.11 libdynaloader-functions-perl_0.004-1 libeatmydata1_131-2 libelf1t64_0.191-2 libenv-path-perl_0.19-4 libeval-closure-perl_0.14-3 libexception-class-perl_1.45-1 libfakeroot_1.35.1-1 libffi8_3.4.6-1 libfile-chdir-perl_0.1008-1.2 libfile-find-rule-perl_0.34-3 libfile-stripnondeterminism-perl_1.14.0-1 libgcc-13-dev_13.3.0-4 libgcc-14-dev_14.2.0-1 libgcc-s1_14.2.0-1 libgcrypt20_1.11.0-5 libgdbm-compat4t64_1.23-6 libgdbm6t64_1.23-6 libgmp10_2:6.3.0+dfsg-2+b1 libgnutls30t64_3.8.6-2 libgomp1_14.2.0-1 libgpg-error0_1.50-2 libgprofng0_2.42.90.20240720-2 libgssapi-krb5-2_1.21.3-3 libhogweed6t64_3.10-1 libhts3t64_1.20+ds-1 libhtscodecs2_1.6.0-1+b1 libhwasan0_14.2.0-1 libicu72_72.1-5 libidn2-0_2.3.7-2 libio-string-perl_1.08-4 libisl23_0.26-3+b2 libitm1_14.2.0-1 libjansson4_2.14-2+b2 libk5crypto3_1.21.3-3 libkeyutils1_1.6.3-3 libkrb5-3_1.21.3-3 libkrb5support0_1.21.3-3 libksba8_1.6.7-2 libldap-2.5-0_2.5.18+dfsg-2+b1 liblsan0_14.2.0-1 liblz4-1_1.9.4-3 liblzma5_5.6.2-2 libmagic-mgc_1:5.45-3 libmagic1t64_1:5.45-3 libmd0_1.1.0-2 libmodule-implementation-perl_0.09-2 libmodule-runtime-conflicts-perl_0.003-2 libmodule-runtime-perl_0.016-2 libmoose-perl_2.2207-1+b2 libmount1_2.40.2-1 libmpc3_1.3.1-1+b2 libmpfr6_4.2.1-1+b1 libmro-compat-perl_0.15-2 libncurses6_6.5-2 libncursesw6_6.5-2 libnettle8t64_3.10-1 libnghttp2-14_1.62.1-2 libnghttp3-9_1.4.0-1 libngtcp2-16_1.6.0-1 libngtcp2-crypto-gnutls8_1.6.0-1 libnpth0t64_1.6-3.1 libnumber-compare-perl_0.03-3 libp11-kit0_0.25.5-2 libpackage-deprecationmanager-perl_0.18-1 libpackage-stash-perl_0.40-1 libpackage-stash-xs-perl_0.30-1+b4 libpadwalker-perl_2.5-1+b6 libpam-modules_1.5.3-7 libpam-modules-bin_1.5.3-7 libpam-runtime_1.5.3-7 libpam0g_1.5.3-7 libparams-classify-perl_0.015-2+b4 libparams-util-perl_1.102-3+b1 libpath-tiny-perl_0.146-1 libpcre2-8-0_10.42-4+b1 libperl5.38t64_5.38.2-5 libperl5.40_5.40.0-1 libpipeline1_1.5.7-2 libpsl5t64_0.21.2-1.1 libquadmath0_14.2.0-1 libreadline8t64_8.2-4 librtmp1_2.4+20151223.gitfa8646d.1-2+b4 libsasl2-2_2.1.28+dfsg1-6 libsasl2-modules-db_2.1.28+dfsg1-6 libseccomp2_2.5.5-1+b1 libselinux1_3.5-2+b3 libsemanage-common_3.5-1 libsemanage2_3.5-1+b4 libsepol2_3.5-2+b1 libsframe1_2.42.90.20240720-2 libsmartcols1_2.40.2-1 libsqlite3-0_3.46.0-1 libssh2-1t64_1.11.0-7 libssl3t64_3.2.2-1 libstdc++-13-dev_13.3.0-4 libstdc++-14-dev_14.2.0-1 libstdc++6_14.2.0-1 libsub-exporter-perl_0.990-1 libsub-exporter-progressive-perl_0.001013-3 libsub-install-perl_0.929-1 libsub-uplevel-perl_0.2800-3 libsystemd0_256.4-2 libtasn1-6_4.19.0-3+b2 libtest-deep-perl_1.204-1 libtest-differences-perl_0.71-1 libtest-exception-perl_0.43-3 libtest-files-perl_0.26-1 libtest-most-perl_0.38-1 libtest-warn-perl_0.37-2 libtext-csv-perl_2.04-1 libtext-diff-perl_1.45-2 libtext-glob-perl_0.11-3 libtinfo6_6.5-2 libtool_2.4.7-7 libtry-tiny-perl_0.31-2 libtsan2_14.2.0-1 libubsan1_14.2.0-1 libuchardet0_0.0.8-1+b1 libudev1_256.4-2 libunistring5_1.2-1 libuuid1_2.40.2-1 libxml2_2.12.7+dfsg-3+b1 libxxhash0_0.8.2-2+b1 libzstd1_1.5.6+dfsg-1 linux-libc-dev_6.9.12-1 locales-all_2.39-6 login_1:4.15.3-3 m4_1.4.19-4 make_4.3-4.1 man-db_2.12.1-2 mawk_1.3.4.20240622-2 ncurses-base_6.5-2 ncurses-bin_6.5-2 passwd_1:4.15.3-3 patch_2.7.6-7 perl_5.40.0-1 perl-base_5.40.0-1 perl-modules-5.38_5.38.2-5 perl-modules-5.40_5.40.0-1 pinentry-curses_1.2.1-3+b2 po-debconf_1.0.21+nmu1 readline-common_8.2-4 rpcsvc-proto_1.4.3-1 samtools_1.20-3 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2 sensible-utils_0.0.24 smalt_0.7.6-13 sysvinit-utils_3.09-2 tabix_1.20+ds-1 tar_1.35+dfsg-3 usr-is-merged_39 util-linux_2.40.2-1 xz-utils_5.6.2-2 zlib1g_1:1.3.dfsg+really1.3.1-1

+------------------------------------------------------------------------------+
| Build                                                                        |
+------------------------------------------------------------------------------+


Unpack source
-------------

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA512

Format: 3.0 (quilt)
Source: bio-tradis
Binary: bio-tradis
Architecture: all
Version: 1.4.5+dfsg2-2
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Uploaders: Andreas Tille <tille@debian.org>
Homepage: https://github.com/sanger-pathogens/Bio-Tradis
Standards-Version: 4.6.2
Vcs-Browser: https://salsa.debian.org/med-team/bio-tradis
Vcs-Git: https://salsa.debian.org/med-team/bio-tradis.git
Build-Depends: debhelper-compat (= 13)
Build-Depends-Indep: libbio-perl-perl, libenv-path-perl, libexception-class-perl, libmoose-perl, libtest-exception-perl, libtest-files-perl, libtest-most-perl, libtest-simple-perl, libtext-csv-perl, libtry-tiny-perl, perl, samtools, smalt, tabix, bwa
Package-List:
 bio-tradis deb perl optional arch=all
Checksums-Sha1:
 8dc680ab6fafa5205030a15c0e8986fb0428f671 7876340 bio-tradis_1.4.5+dfsg2.orig.tar.xz
 2a1eadb27d76c6ec3c148df87ddbaa0d885d931a 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
Checksums-Sha256:
 2ae1058a077eb8753dea148079c82ac8335c1488886cfbf2a6fe534b7f7c076e 7876340 bio-tradis_1.4.5+dfsg2.orig.tar.xz
 32dd5c211c5e7a1180e8050b1da7c0d0b12c5531bd11c61eb2fc837e8f92265c 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
Files:
 c31ec74b7db82cd7bf39386caf70859f 7876340 bio-tradis_1.4.5+dfsg2.orig.tar.xz
 b60da3af535d0d1ca443981c7c214475 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz

-----BEGIN PGP SIGNATURE-----

iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmWyckMRHHRpbGxlQGRl
Ymlhbi5vcmcACgkQV4oElNHGRtEcCw//ZTk4IY8aNznJ3KYSWeiaR56je93jBfXP
4LNFWhU+Aff//+l+Z5t8QuwimuggzhW7zEdLVX+f/gFb/HvC0hhc8MnjBNKfOPqB
NgaTEr6FLxrMK4fEIlSQ99cHs6MutOVr2hDhLr2Mz4Ubftw7jDWerq7+t4kT0W+l
lYExwwtK6MFxYEC2mp5Isl+1nbN9rxA8vAX5viDJ/QAxb+0rQtc5wED+XUarAEmy
ySGjuNpyymyRwLwPWfSvxZXaeRLSzsKp6xjaNAU7ehVu3ZTe3o/xjqKBlKFDaBuR
lxox1OqDN76xb0l8hxwAviCCcy6pb9kd935trlr0/SSfeDE4Mhmq6xZvP9r0ZTzp
9WpDbaeQcBSlYGm5ONWfIIDCrJ0aT0OvC9uU6EJc0UD+/f9S/rFTfYSOv/SE9V2H
Bi6ryezTo7qoO59+iGUB+8j5tpjx7W/DQiJwxUKgxvGuNmBm5aOjlgg/h7a/EXAI
6eD27joS4hBPBrS1aW3KI9hW2W3alolO2rJUqYN5E8hEWQXzW74A4596ruMkduEe
HWwCLfWhFeo5Lqe8lsdTiv8gIRSIXguFirdTkt1i2e52brvN47e/Z2M6HIjfbNBp
bra2Ja2ufnXb9Sln8ellb8nOQs2txDsl8wFxvnA9foY9YkKILL7dE4B0tSJgvqh0
QkVSpHZ33Q0=
=JKCT
-----END PGP SIGNATURE-----

gpgv: Signature made Thu Jan 25 14:37:55 2024 UTC
gpgv:                using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
gpgv:                issuer "tille@debian.org"
gpgv: Can't check signature: No public key
dpkg-source: warning: cannot verify inline signature for ./bio-tradis_1.4.5+dfsg2-2.dsc: no acceptable signature found
dpkg-source: info: extracting bio-tradis in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking bio-tradis_1.4.5+dfsg2.orig.tar.xz
dpkg-source: info: unpacking bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying samtools1.10

Check disk space
----------------

Sufficient free space for build

+------------------------------------------------------------------------------+
| Starting Timed Build Commands                                                |
+------------------------------------------------------------------------------+


/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network bio-tradis_1.4.5+dfsg2-2 perl-5.40-throwaway amd64
-------------------------------------------------------------------------------------------------------------------------


I: Finished running '/usr/share/debomatic/sbuildcommands/starting-build-commands/no-network bio-tradis_1.4.5+dfsg2-2 perl-5.40-throwaway amd64'.

Finished processing commands.
--------------------------------------------------------------------------------

User Environment
----------------

APT_CONFIG=/var/lib/sbuild/apt.conf
HOME=/sbuild-nonexistent
LANG=en_GB.UTF-8
LANGUAGE=en_GB:en
LC_ALL=C.UTF-8
LD_LIBRARY_PATH=/usr/lib/libeatmydata
LD_PRELOAD=libeatmydata.so
LOGNAME=debomatic
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
PWD=/<<PKGBUILDDIR>>
SCHROOT_ALIAS_NAME=perl-5.40-throwaway-amd64-debomatic
SCHROOT_CHROOT_NAME=perl-5.40-amd64-debomatic
SCHROOT_COMMAND=env
SCHROOT_GID=110
SCHROOT_GROUP=sbuild
SCHROOT_SESSION_ID=perl-5.40-amd64-debomatic-4d8ce4ec-0d28-45ff-9b24-d7b6a85720db
SCHROOT_UID=1002
SCHROOT_USER=debomatic
SHELL=/bin/sh
USER=debomatic

dpkg-buildpackage
-----------------

Command: dpkg-buildpackage --sanitize-env -us -uc -rfakeroot -Zxz
dpkg-buildpackage: info: source package bio-tradis
dpkg-buildpackage: info: source version 1.4.5+dfsg2-2
dpkg-buildpackage: info: source distribution unstable
dpkg-buildpackage: info: source changed by Andreas Tille <tille@debian.org>
 dpkg-source -Zxz --before-build .
dpkg-buildpackage: info: host architecture amd64
 debian/rules clean
dh clean
   dh_clean
 dpkg-source -Zxz -b .
dpkg-source: info: using source format '3.0 (quilt)'
dpkg-source: info: building bio-tradis using existing ./bio-tradis_1.4.5+dfsg2.orig.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: building bio-tradis in bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
dpkg-source: info: building bio-tradis in bio-tradis_1.4.5+dfsg2-2.dsc
 debian/rules binary
dh binary
   dh_update_autotools_config
   dh_autoreconf
   dh_auto_configure
	/usr/bin/perl Makefile.PL INSTALLDIRS=vendor "OPTIMIZE=-g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2" "LD=x86_64-linux-gnu-gcc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wl,-z,relro"
Checking if your kit is complete...
Warning: the following files are missing in your kit:
	BioTraDISTutorial.pdf
Please inform the author.
Generating a Unix-style Makefile
Writing Makefile for Bio::Tradis
Writing MYMETA.yml and MYMETA.json
   dh_auto_build
	make -j2
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp lib/Bio/Tradis/Map.pm blib/lib/Bio/Tradis/Map.pm
cp lib/Bio/Tradis/AddTagsToSeq.pm blib/lib/Bio/Tradis/AddTagsToSeq.pm
cp lib/Bio/Tradis/CommandLine/TradisBam.pm blib/lib/Bio/Tradis/CommandLine/TradisBam.pm
cp lib/Bio/Tradis/CommandLine/PlotCombine.pm blib/lib/Bio/Tradis/CommandLine/PlotCombine.pm
cp lib/Bio/Tradis/Exception.pm blib/lib/Bio/Tradis/Exception.pm
cp lib/Bio/Tradis/CommandLine/RemoveFastqTags.pm blib/lib/Bio/Tradis/CommandLine/RemoveFastqTags.pm
cp lib/Bio/Tradis/CommandLine/TradisAnalysis.pm blib/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm
cp lib/Bio/Tradis/Analysis/InsertSite.pm blib/lib/Bio/Tradis/Analysis/InsertSite.pm
cp lib/Bio/Tradis/FilterTags.pm blib/lib/Bio/Tradis/FilterTags.pm
cp lib/Bio/Tradis/CommandLine/FilterFastqTags.pm blib/lib/Bio/Tradis/CommandLine/FilterFastqTags.pm
cp lib/Bio/Tradis.pm blib/lib/Bio/Tradis.pm
cp lib/Bio/Tradis/CombinePlots.pm blib/lib/Bio/Tradis/CombinePlots.pm
cp lib/Bio/Tradis/RemoveTags.pm blib/lib/Bio/Tradis/RemoveTags.pm
cp lib/Bio/Tradis/Parser/Cigar.pm blib/lib/Bio/Tradis/Parser/Cigar.pm
cp lib/Bio/Tradis/Parser/Fastq.pm blib/lib/Bio/Tradis/Parser/Fastq.pm
cp lib/Bio/Tradis/Analysis/Exceptions.pm blib/lib/Bio/Tradis/Analysis/Exceptions.pm
cp lib/Bio/Tradis/CommandLine/PlotTradis.pm blib/lib/Bio/Tradis/CommandLine/PlotTradis.pm
cp lib/Bio/Tradis/TradisPlot.pm blib/lib/Bio/Tradis/TradisPlot.pm
cp lib/Bio/Tradis/Parser/Bam.pm blib/lib/Bio/Tradis/Parser/Bam.pm
cp lib/Bio/Tradis/CommandLine/RunMapping.pm blib/lib/Bio/Tradis/CommandLine/RunMapping.pm
cp lib/Bio/Tradis/DetectTags.pm blib/lib/Bio/Tradis/DetectTags.pm
cp lib/Bio/Tradis/Samtools.pm blib/lib/Bio/Tradis/Samtools.pm
cp lib/Bio/Tradis/CommandLine/AddTags.pm blib/lib/Bio/Tradis/CommandLine/AddTags.pm
cp lib/Bio/Tradis/CommandLine/CheckTags.pm blib/lib/Bio/Tradis/CommandLine/CheckTags.pm
cp lib/Bio/Tradis/RunTradis.pm blib/lib/Bio/Tradis/RunTradis.pm
cp bin/add_tradis_tags blib/script/add_tradis_tags
cp bin/bacteria_tradis blib/script/bacteria_tradis
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/add_tradis_tags
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bacteria_tradis
cp bin/check_tradis_tags blib/script/check_tradis_tags
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/check_tradis_tags
cp bin/combine_tradis_plots blib/script/combine_tradis_plots
cp bin/filter_tradis_tags blib/script/filter_tradis_tags
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/combine_tradis_plots
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/filter_tradis_tags
cp bin/remove_tradis_tags blib/script/remove_tradis_tags
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/remove_tradis_tags
cp bin/tradis_comparison.R blib/script/tradis_comparison.R
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_comparison.R
cp bin/tradis_essentiality.R blib/script/tradis_essentiality.R
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_essentiality.R
cp bin/tradis_gene_insert_sites blib/script/tradis_gene_insert_sites
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_gene_insert_sites
cp bin/tradis_merge_plots blib/script/tradis_merge_plots
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_merge_plots
cp bin/tradis_plot blib/script/tradis_plot
"/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_plot
Manifying 9 pod documents
Manifying 25 pod documents
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_test || true
	make -j2 test TEST_VERBOSE=1
make[2]: Entering directory '/<<PKGBUILDDIR>>'
PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Tradis/*.t t/Bio/Tradis/Analysis/*.t t/Bio/Tradis/CommandLine/*.t t/Bio/Tradis/Parser/*.t
# 
# Versions for all modules listed in MYMETA.json (including optional ones):
# 
# === Configure Requires ===
# 
#     Module              Want Have
#     ------------------- ---- ----
#     ExtUtils::MakeMaker  any 7.70
# 
# === Build Requires ===
# 
#     Module              Want Have
#     ------------------- ---- ----
#     ExtUtils::MakeMaker  any 7.70
# 
# === Test Requires ===
# 
#     Module              Want     Have
#     ------------------- ---- --------
#     Env::Path           0.18     0.19
#     ExtUtils::MakeMaker  any     7.70
#     File::Spec           any     3.90
#     Test::Exception      any     0.43
#     Test::Files          any     0.26
#     Test::More           any 1.302199
#     Test::Most           any     0.38
# 
# === Test Recommends ===
# 
#     Module         Want     Have
#     ---------- -------- --------
#     CPAN::Meta 2.120900 2.150010
# 
# === Runtime Requires ===
# 
#     Module           Want   Have
#     ---------------- ---- ------
#     Bio::Seq          any  1.7.8
#     Bio::SeqIO        any  1.7.8
#     Cwd               any   3.90
#     Data::Dumper      any  2.189
#     Exception::Class  any   1.45
#     File::Basename    any   2.86
#     File::Path        any   2.18
#     File::Spec        any   3.90
#     File::Temp        any 0.2311
#     FindBin           any   1.54
#     Getopt::Long      any   2.57
#     Moose             any 2.2207
#     Text::CSV         any   2.04
#     Try::Tiny         any   0.31
#     strict            any   1.13
#     warnings          any   1.70
# 
t/00-report-prereqs.t ...................... 
1..1
ok 1
ok

#   Failed test 'checking file contents'
#   at /usr/share/perl5/Test/Files.pm line 376.
# --- t/data/output.sam
# +++ t/data/AddTags/expected_tradis.sam
# @@ -15,9 +15,7 @@
#  @PG	ID:picard_markduplicates	PN:Picard	PP:samtools_sort	VN:1.72(1230)	CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'
#  @PG	ID:ChangeBamHeader	PN:ChangeBamHeader	PP:picard_markduplicates	DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. 	VN:V1.10	CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0    QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
#  @PG	ID:BamTagStripper	PN:BamTagStripper	PP:ChangeBamHeader	DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip	VN:V1.10	CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true    QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000
# -@PG	ID:samtools	PN:samtools	PP:BamTagStripper	VN:1.20	CL:samtools view -H t/data/AddTags/sample_sm_tr.bam
# -@PG	ID:samtools.1	PN:samtools	PP:samtools	VN:1.20	CL:samtools view -h -S -b -o t/data/output.bam tmp.20240803173622.sam
# -@PG	ID:samtools.2	PN:samtools	PP:samtools.1	VN:1.20	CL:samtools view -h -o t/data/output.sam t/data/output.bam
# +@PG	ID:samtools	PN:samtools	PP:BamTagStripper	VN:1.20	CL:samtools view -h -o t/data/AddTags/expected_tradis.sam t/data/AddTags/expected_tradis.bam
#  MS5_9521:1:1101:10072:14269#14	16	ENA|AE004091|AE004091.2	5	37	60M	*	0	0	AAGAGACCGGCGATTCTAGTGAAATCGAACGGGCAGGTCAATTTCCAACCCTGACTCTTA	HHHGGGGGGGHHHHHHHHHHHGHHHGHHGGGGGGGGGGFFFBFFCBAABAFFFFFBBCCC	X0:i:1	X1:i:0	BC:Z:TCTCGGTT	MD:Z:50	RG:Z:1#14	XG:i:0	NM:i:0	XM:i:0	XO:i:0	QT:Z:BBCDECBC	XT:A:U	tq:Z:CCCBBFFFFF	tr:Z:TAAGAGTCAG
#  MS5_9521:1:1103:26809:18585#14	1040	ENA|AE004091|AE004091.2	23	37	60M	*	0	0	GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA	5FGGHHGEGHFEHHHHHGFHHGHGGHGFGGFCGEGBBAFC?DFFFBBBB3FFFFFCCCCB	X0:i:1	X1:i:0	BC:Z:TCTCGGTT	MD:Z:50	RG:Z:1#14	XG:i:0	NM:i:0	XM:i:0	XO:i:0	QT:Z:CCCCCCCC	XT:A:U	tq:Z:BCCCCFFFFF	tr:Z:TAAGAGTCAG
#  MS5_9521:1:2101:3627:15042#14	16	ENA|AE004091|AE004091.2	23	37	60M	*	0	0	GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA	HHHGHHHGHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFFCFFFFBBBAAFFFFFCBAAA	X0:i:1	X1:i:0	BC:Z:TCTCGGTT	MD:Z:50	RG:Z:1#14	XG:i:0	NM:i:0	XM:i:0	XO:i:0	QT:Z:AAA>AAAA	XT:A:U	tq:Z:AAABCFFFFF	tr:Z:TAAGAGTCAG

#   Failed test 'checking file contents'
#   at /usr/share/perl5/Test/Files.pm line 376.
# --- t/data/AddTags/sample_sm_no_tr.sam
# +++ t/data/output.sam
# @@ -15,7 +15,9 @@
#  @PG	ID:picard_markduplicates	PN:Picard	PP:samtools_sort	VN:1.72(1230)	CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'
#  @PG	ID:ChangeBamHeader	PN:ChangeBamHeader	PP:picard_markduplicates	DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. 	VN:V1.10	CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0    QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
#  @PG	ID:BamTagStripper	PN:BamTagStripper	PP:ChangeBamHeader	DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip	VN:V1.10	CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true    QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000
# -@PG	ID:samtools	PN:samtools	PP:BamTagStripper	VN:1.20	CL:samtools view -h -o t/data/AddTags/sample_sm_no_tr.sam t/data/AddTags/sample_sm_no_tr.bam
# +@PG	ID:samtools	PN:samtools	PP:BamTagStripper	VN:1.20	CL:samtools view -H t/data/AddTags/sample_sm_tr.bam
# +@PG	ID:samtools.1	PN:samtools	PP:samtools	VN:1.20	CL:samtools view -h -S -b -o t/data/output.bam tmp.20240803173622.sam
# +@PG	ID:samtools.2	PN:samtools	PP:samtools.1	VN:1.20	CL:samtools view -h -o t/data/output.sam t/data/output.bam
#  MS5_9521:1:1101:10072:14269#14	16	ENA|AE004091|AE004091.2	5	37	60M	*	0	0	AAGAGACCGGCGATTCTAGTGAAATCGAACGGGCAGGTCAATTTCCAACCCTGACTCTTA	HHHGGGGGGGHHHHHHHHHHHGHHHGHHGGGGGGGGGGFFFBFFCBAABAFFFFFBBCCC	X0:i:1	X1:i:0	BC:Z:TCTCGGTT	MD:Z:50	RG:Z:1#14	XG:i:0	NM:i:0	XM:i:0	XO:i:0	QT:Z:BBCDECBC	XT:A:U	tq:Z:CCCBBFFFFF	tr:Z:TAAGAGTCAG
#  MS5_9521:1:1103:26809:18585#14	1040	ENA|AE004091|AE004091.2	23	37	60M	*	0	0	GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA	5FGGHHGEGHFEHHHHHGFHHGHGGHGFGGFCGEGBBAFC?DFFFBBBB3FFFFFCCCCB	X0:i:1	X1:i:0	BC:Z:TCTCGGTT	MD:Z:50	RG:Z:1#14	XG:i:0	NM:i:0	XM:i:0	XO:i:0	QT:Z:CCCCCCCC	XT:A:U	tq:Z:BCCCCFFFFF	tr:Z:TAAGAGTCAG
#  MS5_9521:1:2101:3627:15042#14	16	ENA|AE004091|AE004091.2	23	37	60M	*	0	0	GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA	HHHGHHHGHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFFCFFFFBBBAAFFFFFCBAAA	X0:i:1	X1:i:0	BC:Z:TCTCGGTT	MD:Z:50	RG:Z:1#14	XG:i:0	NM:i:0	XM:i:0	XO:i:0	QT:Z:AAA>AAAA	XT:A:U	tq:Z:AAABCFFFFF	tr:Z:TAAGAGTCAG
[E::easy_errno] Libcurl reported error 77 (Problem with the SSL CA cert (path? access rights?))
[W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Input/output error
[E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory
[E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta'
[W::cram_get_ref] Failed to populate reference for id 0
[E::cram_decode_slice] Unable to fetch reference #0:5-193

[E::cram_next_slice] Failure to decode slice
samtools view: error reading file "t/data/AddTags/sample_sm_tr.cram": No such file or directory
[E::easy_errno] Libcurl reported error 77 (Problem with the SSL CA cert (path? access rights?))
[W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Input/output error
[E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory
[E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta'
[W::cram_get_ref] Failed to populate reference for id 0
[E::cram_decode_slice] Unable to fetch reference #0:5-193

[E::cram_next_slice] Failure to decode slice
samtools view: error reading file "t/data/AddTags/sample_sm_tr.cram": No such file or directory
[E::easy_errno] Libcurl reported error 77 (Problem with the SSL CA cert (path? access rights?))
[W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Input/output error
[E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory
[E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta'
[W::cram_get_ref] Failed to populate reference for id 0
[E::cram_decode_slice] Unable to fetch reference #0:5-203

[E::cram_next_slice] Failure to decode slice
samtools view: error reading file "t/data/AddTags/expected_tradis.cram": No such file or directory

#   Failed test 'checking file contents'
#   at /usr/share/perl5/Test/Files.pm line 376.
# --- t/data/output.sam
# +++ t/data/AddTags/expected_tradis.sam
# @@ -1,4 +1,6 @@
#  @HD	VN:1.4	SO:coordinate
# +@RG	ID:1#14	PL:ILLUMINA	PU:130320_MS5_9521_A_MS0205701-050V2_1#14	LB:6982965	DS:ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/	DT:2013-03-20T00:00:00+0000	SM:ERS222909	CN:SC
# +@SQ	SN:ENA|AE004091|AE004091.2	LN:6264404	UR:file:/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta	AS:PAO1	M5:7f8b730b8a08ebf1eeb7f0de561f0a91	SP:Pseudomonas aeruginosa
#  @PG	ID:SCS	PN:MiSeq Control Software	DS:Controlling software on instrument	VN:2.2.0
#  @PG	ID:basecalling	PN:RTA	PP:SCS	DS:Basecalling Package	VN:1.17.28.0
#  @PG	ID:Illumina2bam	PN:Illumina2bam	PP:basecalling	DS:Convert Illumina BCL to BAM or SAM file	VN:V1.10	CL:uk.ac.sanger.npg.illumina.Illumina2bam INTENSITY_DIR=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities BASECALLS_DIR=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BaseCalls LANE=1 OUTPUT=/dev/stdout SAMPLE_ALIAS=ERS222824,ERS222825,ERS222825,ERS222824,ERS222909,ERS222910 LIBRARY_NAME=6983166 STUDY_NAME=ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ BARCODE_SEQUENCE_TAG_NAME=tr BARCODE_QUALITY_TAG_NAME=tq SECOND_BARCODE_SEQUENCE_TAG_NAME=BC SECOND_BARCODE_QUALITY_TAG_NAME=QT COMPRESSION_LEVEL=0 CREATE_MD5_FILE=true    GENERATE_SECONDARY_BASE_CALLS=false PF_FILTER=true READ_GROUP_ID=1 SEQUENCING_CENTER=SC PLATFORM=ILLUMINA VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false
# @@ -13,8 +15,4 @@
#  @PG	ID:picard_markduplicates	PN:Picard	PP:samtools_sort	VN:1.72(1230)	CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'
#  @PG	ID:ChangeBamHeader	PN:ChangeBamHeader	PP:picard_markduplicates	DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. 	VN:V1.10	CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0    QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
#  @PG	ID:BamTagStripper	PN:BamTagStripper	PP:ChangeBamHeader	DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip	VN:V1.10	CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true    QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000
# -@PG	ID:samtools	PN:samtools	PP:BamTagStripper	VN:1.20	CL:samtools view -H t/data/AddTags/sample_sm_tr.cram
# +@PG	ID:samtools	PN:samtools	PP:BamTagStripper	VN:1.20	CL:samtools view -h -o t/data/AddTags/expected_tradis.sam t/data/AddTags/expected_tradis.cram
# -@PG	ID:samtools.1	PN:samtools	PP:samtools	VN:1.20	CL:samtools view -h -S -C -o t/data/output.cram tmp.20240803173623.sam
# -@PG	ID:samtools.2	PN:samtools	PP:samtools.1	VN:1.20	CL:samtools view -h -o t/data/output.sam t/data/output.cram
# -@SQ	SN:ENA|AE004091|AE004091.2	LN:6264404	UR:file:/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta	AS:PAO1	M5:7f8b730b8a08ebf1eeb7f0de561f0a91	SP:Pseudomonas aeruginosa
# -@RG	ID:1#14	PL:ILLUMINA	PU:130320_MS5_9521_A_MS0205701-050V2_1#14	LB:6982965	DS:ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/	DT:2013-03-20T00:00:00+0000	SM:ERS222909	CN:SC
# Looks like you failed 3 tests of 15.
t/Bio/Tradis/AddTagsToSeq.t ................ 
ok 1 - use Bio::Tradis::AddTagsToSeq;
ok 2 - creating object
ok 3 - correctly select the bam output switch
ok 4 - testing output
ok 5 - checking file existence
not ok 6 - checking file contents
ok 7 - creating object
ok 8 - checking file existence
not ok 9 - checking file contents
ok 10 - number of reads as expected
ok 11 - creating object with cram file
ok 12 - correctly select the cram output switch
ok 13 - testing output
ok 14 - checking file existence
not ok 15 - checking file contents
1..15
Dubious, test returned 3 (wstat 768, 0x300)
Failed 3/15 subtests 
t/Bio/Tradis/Analysis/InsertSite.t ......... 
ok 1 - use Bio::Tradis::Analysis::InsertSite;
ok 2
ok 3
ok 4 - check main sequence insert_site values first value
ok 5 - check main sequence insert_site value before site
ok 6 - check main sequence insert_site values for reverse reads only
ok 7 - various values
ok 8 - various values
ok 9 - various values
ok 10 - various values
ok 11 - various values
ok 12 - check empty plasmid insert_site values first value
ok 13 - check empty plasmid insert_site values last value
ok 14 - check plasmid with 1 read insert_site values first value
ok 15 - check plasmid with 1 read insert_site values first base of read
ok 16 - check plasmid with 1 read insert_site values after last base of read
ok 17 - check plasmid with 1 read insert_site values last value
ok 18 - check another empty plasmid insert_site values first value
ok 19 - check another empty plasmid insert_site values last value
ok 20
ok 21
ok 22 - check forward read
ok 23 - check reverse read
1..23
ok
[W::tbx_parse1] Coordinate <= 0 detected. Did you forget to use the -0 option?
[W::tbx_parse1] Coordinate <= 0 detected. Did you forget to use the -0 option?
[tabix] the index file exists. Please use '-f' to overwrite.
t/Bio/Tradis/CombinePlots.t ................ 
ok 1 - use Bio::Tradis::CombinePlots;
ok 2 - creating object
ok 3 - combining plots
ok 4 - checking first combined plot file exists
ok 5 - checking second combined plot file exists
ok 6 - checking stats file exists
ok 7 - checking first file contents
ok 8 - checking second file contents
ok 9 - checking stats file contents
ok 10 - creating object
ok 11 - combining plots
ok 12 - checking first combined plot file exists
ok 13 - checking tabix sorted combined plot file exists
ok 14 - checking tabix index file exists
ok 15 - checking zipped file contents
ok 16 - checking stats file contents
ok 17 - creating object
ok 18 - combining plots
ok 19 - checking directory exists
ok 20 - checking first combined plot file exists
ok 21 - checking second combined plot file exists
1..21
ok
Attribute (_stats_handle) does not pass the type constraint because: Validation failed for 'FileHandle' with value GLOB(0x5632e5f10b18) at reader Bio::Tradis::CommandLine::TradisAnalysis::_stats_handle (defined at lib/Bio/Tradis/CommandLine/TradisAnalysis.pm line 43) line 15
	Bio::Tradis::CommandLine::TradisAnalysis::_stats_handle('Bio::Tradis::CommandLine::TradisAnalysis=HASH(0x5632e41450c8)') called at lib/Bio/Tradis/CommandLine/TradisAnalysis.pm line 146
	Bio::Tradis::CommandLine::TradisAnalysis::run('Bio::Tradis::CommandLine::TradisAnalysis=HASH(0x5632e41450c8)') called at t/Bio/Tradis/CommandLine/TradisAnalysis.t line 33
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 255 just after 2.
t/Bio/Tradis/CommandLine/TradisAnalysis.t .. 
ok 1 - use Bio::Tradis::CommandLine::TradisAnalysis;
ok 2 - creating object
Dubious, test returned 255 (wstat 65280, 0xff00)
All 2 subtests passed 
Attempt to call undefined import method with arguments ("") via package "Bio::Tradis::Parser::Bam" (Perhaps you forgot to load the package?) at lib/Bio/Tradis/DetectTags.pm line 9.
[E::easy_errno] Libcurl reported error 77 (Problem with the SSL CA cert (path? access rights?))
[W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Input/output error
t/Bio/Tradis/DetectTags.t .................. 
ok 1 - use Bio::Tradis::DetectTags;
ok 2 - testing tag checker - tradis
ok 3 - testing output
ok 4 - testing tag checker for cram- tradis
ok 5 - testing output cram
ok 6 - testing tag checker - no tradis
ok 7 - testing output
1..7
ok
t/Bio/Tradis/FilterTags.t .................. 
ok 1 - use Bio::Tradis::FilterTags;
ok 2 - creating object
ok 3 - testing output
ok 4 - checking file existence
ok 5 - checking file contents
ok 6 - creating object
ok 7 - testing output
ok 8 - checking file existence
ok 9 - checking file contents
ok 10 - creating object
ok 11 - testing output
ok 12 - checking file existence
ok 13 - checking file contents
ok 14 - creating object
ok 15 - testing output
ok 16 - checking file existence
ok 17 - checking file contents
1..17
ok
t/Bio/Tradis/Map.t ......................... 
ok 1 - use Bio::Tradis::Map;
ok 2 - creating object
ok 3 - testing reference indexing
ok 4 - checking index file existence
ok 5 - checking index file existence
ok 6 - testing smalt mapping
ok 7 - checking index file existence
ok 8 - checking file contents
ok 9 - creating object
ok 10 - testing reference indexing
ok 11 - checking index file existence
ok 12 - checking index file existence
ok 13 - checking index file existence
ok 14 - checking index file existence
ok 15 - checking index file existence
ok 16 - testing bwa mapping
ok 17 - checking index file existence
ok 18 - checking file contents
ok 19 - creating object
ok 20 - indexing args correct
ok 21 - mapping args correct
1..21
ok
t/Bio/Tradis/Parser/Bam.t .................. 
ok 1 - use Bio::Tradis::Parser::Bam;
ok 2 - creating object
ok 3 - An object of class 'Bio::Tradis::Parser::Bam' isa 'Bio::Tradis::Parser::Bam'
ok 4 - seq_info returns a hash
ok 5 - first result detected
ok 6 - read_info contains correct info for first line
ok 7 - testing flag parsing - mapped
ok 8 - testing flag parsing - reverse complement
ok 9 - last result detected
ok 10 - read_info contains correct info for last line
ok 11 - EOF detected
1..11
ok
t/Bio/Tradis/Parser/Cigar.t ................ 
ok 1 - use Bio::Tradis::Parser::Cigar;
ok 2 - initialise obj -all matching
ok 3 - read start -all matching
ok 4 - read end -all matching
ok 5 - initialise obj -nothing matching
ok 6 - read start -nothing matching
ok 7 - read end -nothing matching
ok 8 - initialise obj -soft clipping at start
ok 9 - read start -soft clipping at start
ok 10 - read end -soft clipping at start
ok 11 - initialise obj -soft clipping at end
ok 12 - read start -soft clipping at end
ok 13 - read end -soft clipping at end
ok 14 - initialise obj -soft clipping at both ends
ok 15 - read start -soft clipping at both ends
ok 16 - read end -soft clipping at both ends
ok 17 - initialise obj -deletion in middle
ok 18 - read start -deletion in middle
ok 19 - read end -deletion in middle
ok 20 - initialise obj -insertions and deletions
ok 21 - read start -insertions and deletions
ok 22 - read end -insertions and deletions
ok 23 - initialise obj -insertions in the middle
ok 24 - read start -insertions in the middle
ok 25 - read end -insertions in the middle
1..25
ok
t/Bio/Tradis/Parser/Fastq.t ................ 
ok 1 - use Bio::Tradis::Parser::Fastq;
ok 2 - creating object
ok 3 - An object of class 'Bio::Tradis::Parser::Fastq' isa 'Bio::Tradis::Parser::Fastq'
ok 4 - first result detected
ok 5 - read_info contains correct info for first line
ok 6 - last result detected
ok 7 - read_info contains correct info for last line
ok 8 - EOF detected
1..8
ok
t/Bio/Tradis/RemoveTags.t .................. 
ok 1 - use Bio::Tradis::RemoveTags;
ok 2 - creating object
ok 3 - testing output
ok 4 - checking file existence
ok 5 - checking file contents
ok 6 - creating object
ok 7 - testing output
ok 8 - checking file existence
ok 9 - checking file contents
ok 10 - creating object
ok 11 - testing output
ok 12 - checking file existence
ok 13 - checking file contents
1..13
ok
t/Bio/Tradis/RunTradisBWA.t ................ 
ok 1 - use Bio::Tradis::RunTradis;
ok 2 - creating object - Normal files, no mismatch
ok 3 - testing filtering step
ok 4 - checking filtered file existence - Normal files, no mismatch
ok 5 - checking filtered file contents - Normal files, no mismatch
ok 6 - testing check filtering step
ok 7 - complain if no filtered reads
ok 8 - complain if filtered reads are empty
ok 9 - complain if filtered reads has less than 4 lines
ok 10 - complain if filtered reads do not look like a fastq
ok 11 - complain if filtered reads are too short
ok 12 - check very basic filtered reads validation
ok 13 - testing tag removal
ok 14 - checking de-tagged file existence - Normal files, no mismatch
ok 15 - checking de-tagged file contents - Normal files, no mismatch
ok 16 - testing mapping
ok 17 - checking SAM existence
ok 18 - checking mapped file contents
ok 19 - testing SAM/BAM conversion
ok 20 - checking BAM existence
ok 21 - testing BAM sorting
ok 22 - checking sorted BAM existence - Normal files, no mismatch
ok 23 - checking indexed BAM existence - Normal files, no mismatch
ok 24 - testing bamcheck
ok 25 - checking bamcheck file existence - Normal files, no mismatch
ok 26 - testing plotting
ok 27 - checking plot file existence - Normal files, no mismatch
ok 28 - checking plot file contents - Normal files, no mismatch
ok 29 - testing complete analysis - Normal files, no mismatch
ok 30 - checking plot file existence - Normal files, no mismatch
ok 31 - checking completed pipeline file contents - Normal files, no mismatch
ok 32 - creating object - Normal files one mismatch
ok 33 - testing complete analysis with mismatch
ok 34 - checking plot file existence - Normal files one mismatch
ok 35 - checking completed pipeline with mismatch file contents - Normal files one mismatch
ok 36 - creating object with gzipped data - Normal files one mismatch
ok 37 - testing complete analysis with gzipped data
ok 38 - checking plot file existence (gzipped data) - Normal files one mismatch
ok 39 - checking mapped bam existence - Normal files one mismatch
ok 40 - checking indexed bam file - Normal files one mismatch
ok 41 - checking completed pipeline with gzipped data file contents - Normal files one mismatch
ok 42 - creating object with custom smalt parameters
ok 43 - mapping with custom parameters fine
ok 44 - creating object
ok 45 - correct error thrown
1..45
ok
t/Bio/Tradis/RunTradisSmalt.t .............. 
ok 1 - use Bio::Tradis::RunTradis;
ok 2 - creating object - Normal files, no mismatch
ok 3 - testing filtering step
ok 4 - checking filtered file existence - Normal files, no mismatch
ok 5 - checking filtered file contents - Normal files, no mismatch
ok 6 - testing check filtering step
ok 7 - complain if no filtered reads
ok 8 - complain if filtered reads are empty
ok 9 - complain if filtered reads has less than 4 lines
ok 10 - complain if filtered reads do not look like a fastq
ok 11 - complain if filtered reads are too short
ok 12 - check very basic filtered reads validation
ok 13 - testing tag removal
ok 14 - checking de-tagged file existence - Normal files, no mismatch
ok 15 - checking de-tagged file contents - Normal files, no mismatch
ok 16 - testing mapping
ok 17 - checking SAM existence
ok 18 - checking mapped file contents
ok 19 - testing SAM/BAM conversion
ok 20 - checking BAM existence
ok 21 - testing BAM sorting
ok 22 - checking sorted BAM existence - Normal files, no mismatch
ok 23 - checking indexed BAM existence - Normal files, no mismatch
ok 24 - testing bamcheck
ok 25 - checking bamcheck file existence - Normal files, no mismatch
ok 26 - testing plotting
ok 27 - checking plot file existence - Normal files, no mismatch
ok 28 - checking plot file contents - Normal files, no mismatch
ok 29 - testing complete analysis - Normal files, no mismatch
ok 30 - checking plot file existence - Normal files, no mismatch
ok 31 - checking completed pipeline file contents - Normal files, no mismatch
ok 32 - creating object - Normal files one mismatch
ok 33 - testing complete analysis with mismatch
ok 34 - checking plot file existence - Normal files one mismatch
ok 35 - checking completed pipeline with mismatch file contents - Normal files one mismatch
ok 36 - creating object with gzipped data - Normal files one mismatch
ok 37 - testing complete analysis with gzipped data
ok 38 - checking plot file existence (gzipped data) - Normal files one mismatch
ok 39 - checking mapped bam existence - Normal files one mismatch
ok 40 - checking indexed bam file - Normal files one mismatch
ok 41 - checking completed pipeline with gzipped data file contents - Normal files one mismatch
ok 42 - creating object with custom smalt parameters
ok 43 - mapping with custom parameters fine
ok 44 - creating object with custom smalt parameters
ok 45 - correct error thrown
1..45
ok
t/Bio/Tradis/RunTradisTaglessBwa.t ......... 
ok 1 - use Bio::Tradis::RunTradis;
ok 2 - creating object - Normal files, no mismatch
ok 3 - testing mapping
ok 4 - checking SAM existence
ok 5 - checking mapped file contents
ok 6 - testing SAM/BAM conversion
ok 7 - checking BAM existence
ok 8 - testing BAM sorting
ok 9 - checking sorted BAM existence - Normal files, no mismatch
ok 10 - checking indexed BAM existence - Normal files, no mismatch
ok 11 - testing bamcheck
ok 12 - checking bamcheck file existence - Normal files, no mismatch
ok 13 - testing plotting
ok 14 - checking plot file existence - Normal files, no mismatch
ok 15 - checking plot file contents - Normal files, no mismatch
ok 16 - testing complete analysis - Normal files, no mismatch
ok 17 - checking plot file existence - Normal files, no mismatch
ok 18 - checking completed pipeline file contents - Normal files, no mismatch
ok 19 - creating object with custom smalt parameters
ok 20 - mapping with custom parameters fine
ok 21 - creating object
ok 22 - correct error thrown
1..22
ok
t/Bio/Tradis/RunTradisTaglessSmalt.t ....... 
ok 1 - use Bio::Tradis::RunTradis;
ok 2 - creating object - Normal files, no mismatch
ok 3 - testing mapping
ok 4 - checking SAM existence
ok 5 - checking mapped file contents
ok 6 - testing SAM/BAM conversion
ok 7 - checking BAM existence
ok 8 - testing BAM sorting
ok 9 - checking sorted BAM existence - Normal files, no mismatch
ok 10 - checking indexed BAM existence - Normal files, no mismatch
ok 11 - testing bamcheck
ok 12 - checking bamcheck file existence - Normal files, no mismatch
ok 13 - testing plotting
ok 14 - checking plot file existence - Normal files, no mismatch
ok 15 - checking plot file contents - Normal files, no mismatch
ok 16 - testing complete analysis - Normal files, no mismatch
ok 17 - checking plot file existence - Normal files, no mismatch
ok 18 - checking completed pipeline file contents - Normal files, no mismatch
ok 19 - creating object with custom smalt parameters
ok 20 - mapping with custom parameters fine
ok 21 - creating object with custom smalt parameters
ok 22 - correct error thrown
1..22
ok
t/Bio/Tradis/TradisPlot.t .................. 
ok 1 - use Bio::Tradis::TradisPlot;
ok 2 - creating object
ok 3 - testing plotting
ok 4 - checking plot file existence
ok 5 - checking file contents
1..5
ok
t/requires_external.t ...................... 
1..6
ok 1 - awk in PATH
ok 2 - samtools in PATH
ok 3 - gunzip in PATH
ok 4 - gzip in PATH
ok 5 - smalt in PATH
ok 6 - tabix in PATH
ok

Test Summary Report
-------------------
t/Bio/Tradis/AddTagsToSeq.t              (Wstat: 768 (exited 3) Tests: 15 Failed: 3)
  Failed tests:  6, 9, 15
  Non-zero exit status: 3
t/Bio/Tradis/CommandLine/TradisAnalysis.t (Wstat: 65280 (exited 255) Tests: 2 Failed: 0)
  Non-zero exit status: 255
  Parse errors: No plan found in TAP output
Files=18, Tests=309,  6 wallclock secs ( 0.06 usr  0.02 sys +  4.89 cusr  1.25 csys =  6.22 CPU)
Result: FAIL
Failed 2/18 test programs. 3/309 subtests failed.
make[2]: *** [Makefile:1077: test_dynamic] Error 255
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
dh_auto_test: error: make -j2 test TEST_VERBOSE=1 returned exit code 2
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   create-stamp debian/debhelper-build-stamp
   dh_prep
   dh_auto_install --destdir=debian/bio-tradis/
	make -j2 install DESTDIR=/<<BUILDDIR>>/bio-tradis-1.4.5\+dfsg2/debian/bio-tradis AM_UPDATE_INFO_DIR=no PREFIX=/usr
make[1]: Entering directory '/<<PKGBUILDDIR>>'
Manifying 9 pod documents
Manifying 25 pod documents
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Exception.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Samtools.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/FilterTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CombinePlots.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/RemoveTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/AddTagsToSeq.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/TradisPlot.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/RunTradis.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Map.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/DetectTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Cigar.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Bam.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Fastq.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Analysis/InsertSite.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Analysis/Exceptions.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/RunMapping.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/PlotCombine.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/AddTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/PlotTradis.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/CheckTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/TradisAnalysis.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/FilterFastqTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/RemoveFastqTags.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/TradisBam.pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/tradis_merge_plots.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/bacteria_tradis.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/tradis_plot.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/tradis_gene_insert_sites.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/add_tradis_tags.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/combine_tradis_plots.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/filter_tradis_tags.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/check_tradis_tags.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man1/remove_tradis_tags.1p
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::DetectTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Cigar.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CombinePlots.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::FilterFastqTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::AddTagsToSeq.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Samtools.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::FilterTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::PlotCombine.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Analysis::InsertSite.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::RunMapping.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::AddTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::TradisPlot.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::TradisBam.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Fastq.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::RunTradis.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::TradisAnalysis.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::RemoveTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::CheckTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Map.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::PlotTradis.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Exception.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::RemoveFastqTags.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Analysis::Exceptions.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Bam.3pm
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/tradis_comparison.R
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/combine_tradis_plots
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/add_tradis_tags
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/filter_tradis_tags
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/tradis_plot
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/tradis_merge_plots
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/bacteria_tradis
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/remove_tradis_tags
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/check_tradis_tags
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/tradis_gene_insert_sites
Installing /<<PKGBUILDDIR>>/debian/bio-tradis/usr/bin/tradis_essentiality.R
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   debian/rules override_dh_install
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_install
for pl in `grep -Rl '#!/usr/bin/env[[:space:]]\+perl' debian/*/usr/*` ; do \
    sed -i '1s?^#!/usr/bin/env[[:space:]]\+perl?#!/usr/bin/perl?' ${pl} ; \
done
mv debian/bio-tradis/usr/bin/tradis_comparison.R debian/bio-tradis/usr/bin/tradis_comparison
mv debian/bio-tradis/usr/bin/tradis_essentiality.R debian/bio-tradis/usr/bin/tradis_essentiality
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_installdocs
   dh_installchangelogs
   debian/rules override_dh_installman
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_installman
rm debian/bio-tradis/usr/share/man/man1/tradis_merge_plots.1p*
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_perl
   dh_link
   dh_strip_nondeterminism
   dh_compress
   dh_fixperms
   dh_missing
   dh_installdeb
   dh_gencontrol
   dh_md5sums
   dh_builddeb
dpkg-deb: building package 'bio-tradis' in '../bio-tradis_1.4.5+dfsg2-2_all.deb'.
 dpkg-genbuildinfo -O../bio-tradis_1.4.5+dfsg2-2_amd64.buildinfo
 dpkg-genchanges -O../bio-tradis_1.4.5+dfsg2-2_amd64.changes
dpkg-genchanges: info: not including original source code in upload
 dpkg-source -Zxz --after-build .
dpkg-buildpackage: info: binary and diff upload (original source NOT included)
--------------------------------------------------------------------------------
Build finished at 2024-08-03T17:36:30Z

Finished
--------

I: Built successfully

+------------------------------------------------------------------------------+
| Changes                                                                      |
+------------------------------------------------------------------------------+


bio-tradis_1.4.5+dfsg2-2_amd64.changes:
---------------------------------------

Format: 1.8
Date: Thu, 25 Jan 2024 15:34:52 +0100
Source: bio-tradis
Binary: bio-tradis
Architecture: source all
Version: 1.4.5+dfsg2-2
Distribution: perl-5.40-throwaway
Urgency: medium
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
 bio-tradis - analyse the output from TraDIS analyses of genomic sequences
Closes: 1043774
Changes:
 bio-tradis (1.4.5+dfsg2-2) unstable; urgency=medium
 .
   * Fix watch file
   * Fix clean target
     Closes: #1043774
   * Standards-Version: 4.6.2 (routine-update)
   * debhelper-compat 13 (routine-update)
   * Add salsa-ci file (routine-update)
   * Rules-Requires-Root: no (routine-update)
   * Set upstream metadata fields: Bug-Database, Bug-Submit.
   * dh_install now works even without debian/install
   * r-bioc-edger is back in Debian thus move it to Recommends and
     drop the outdated debian/NEWS
   * artemis is available now thus move it to Recommends
Checksums-Sha1:
 dbc9f9a23d3f70275eb4e53875c66df2047b33eb 1355 bio-tradis_1.4.5+dfsg2-2.dsc
 2a1eadb27d76c6ec3c148df87ddbaa0d885d931a 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
 860f6b38a5e8b37008c47f5b8d44517b6053e3dc 80060 bio-tradis_1.4.5+dfsg2-2_all.deb
 d1f097f657bc6e3ea7e6e1f4fc75f9ce3632d15d 8015 bio-tradis_1.4.5+dfsg2-2_amd64.buildinfo
Checksums-Sha256:
 785672e52f7de35eca6b82e7e69ee05de89b760f0775c1c82ed05f612ab23042 1355 bio-tradis_1.4.5+dfsg2-2.dsc
 32dd5c211c5e7a1180e8050b1da7c0d0b12c5531bd11c61eb2fc837e8f92265c 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
 9b9d3087be8d4d8137fb3b1db0d1fad49d7a8be9da10d7cd74e1d15046344334 80060 bio-tradis_1.4.5+dfsg2-2_all.deb
 dfa9e00dd379f6ee190b7e219e50dee106d93640438ff0429dc56d924f0b5278 8015 bio-tradis_1.4.5+dfsg2-2_amd64.buildinfo
Files:
 91aa1ef09c7199a95de913fa60ea63f1 1355 perl optional bio-tradis_1.4.5+dfsg2-2.dsc
 b60da3af535d0d1ca443981c7c214475 6096 perl optional bio-tradis_1.4.5+dfsg2-2.debian.tar.xz
 cf7462e2f84f8868a4d88bcadc64f80a 80060 perl optional bio-tradis_1.4.5+dfsg2-2_all.deb
 2728492171348d8e79990015b3b07d7d 8015 perl optional bio-tradis_1.4.5+dfsg2-2_amd64.buildinfo

+------------------------------------------------------------------------------+
| Buildinfo                                                                    |
+------------------------------------------------------------------------------+

Format: 1.0
Source: bio-tradis
Binary: bio-tradis
Architecture: all source
Version: 1.4.5+dfsg2-2
Checksums-Md5:
 91aa1ef09c7199a95de913fa60ea63f1 1355 bio-tradis_1.4.5+dfsg2-2.dsc
 cf7462e2f84f8868a4d88bcadc64f80a 80060 bio-tradis_1.4.5+dfsg2-2_all.deb
Checksums-Sha1:
 dbc9f9a23d3f70275eb4e53875c66df2047b33eb 1355 bio-tradis_1.4.5+dfsg2-2.dsc
 860f6b38a5e8b37008c47f5b8d44517b6053e3dc 80060 bio-tradis_1.4.5+dfsg2-2_all.deb
Checksums-Sha256:
 785672e52f7de35eca6b82e7e69ee05de89b760f0775c1c82ed05f612ab23042 1355 bio-tradis_1.4.5+dfsg2-2.dsc
 9b9d3087be8d4d8137fb3b1db0d1fad49d7a8be9da10d7cd74e1d15046344334 80060 bio-tradis_1.4.5+dfsg2-2_all.deb
Build-Origin: Debian
Build-Architecture: amd64
Build-Date: Sat, 03 Aug 2024 17:36:30 +0000
Build-Path: /<<PKGBUILDDIR>>
Build-Tainted-By:
 merged-usr-via-aliased-dirs
 usr-local-has-programs
Installed-Build-Depends:
 autoconf (= 2.71-3),
 automake (= 1:1.16.5-1.3),
 autopoint (= 0.22.5-2),
 autotools-dev (= 20220109.1),
 base-files (= 13.4),
 base-passwd (= 3.6.4),
 bash (= 5.2.21-2.1),
 binutils (= 2.42.90.20240720-2),
 binutils-common (= 2.42.90.20240720-2),
 binutils-x86-64-linux-gnu (= 2.42.90.20240720-2),
 bsdextrautils (= 2.40.2-1),
 bsdutils (= 1:2.40.2-1),
 build-essential (= 12.10),
 bwa (= 0.7.17-7+b3),
 bzip2 (= 1.0.8-5.1),
 coreutils (= 9.4-3.1),
 cpp (= 4:14.1.0-2),
 cpp-13 (= 13.3.0-4),
 cpp-13-x86-64-linux-gnu (= 13.3.0-4),
 cpp-14 (= 14.2.0-1),
 cpp-14-x86-64-linux-gnu (= 14.2.0-1),
 cpp-x86-64-linux-gnu (= 4:14.1.0-2),
 dash (= 0.5.12-9),
 debconf (= 1.5.87),
 debhelper (= 13.16),
 debianutils (= 5.20),
 dh-autoreconf (= 20),
 dh-strip-nondeterminism (= 1.14.0-1),
 diffutils (= 1:3.10-1),
 dpkg (= 1.22.11),
 dpkg-dev (= 1.22.11),
 dwz (= 0.15-1+b1),
 file (= 1:5.45-3),
 findutils (= 4.10.0-2),
 g++ (= 4:14.1.0-2),
 g++-14 (= 14.2.0-1),
 g++-14-x86-64-linux-gnu (= 14.2.0-1),
 g++-x86-64-linux-gnu (= 4:14.1.0-2),
 gcc (= 4:14.1.0-2),
 gcc-13 (= 13.3.0-4),
 gcc-13-base (= 13.3.0-4),
 gcc-13-x86-64-linux-gnu (= 13.3.0-4),
 gcc-14 (= 14.2.0-1),
 gcc-14-base (= 14.2.0-1),
 gcc-14-x86-64-linux-gnu (= 14.2.0-1),
 gcc-x86-64-linux-gnu (= 4:14.1.0-2),
 gettext (= 0.22.5-2),
 gettext-base (= 0.22.5-2),
 grep (= 3.11-4),
 groff-base (= 1.23.0-5),
 gzip (= 1.12-1.1),
 hostname (= 3.23+nmu2),
 init-system-helpers (= 1.66),
 intltool-debian (= 0.35.0+20060710.6),
 libacl1 (= 2.3.2-2),
 libalgorithm-c3-perl (= 0.11-2),
 libalgorithm-diff-perl (= 1.201-1),
 libarchive-zip-perl (= 1.68-1),
 libasan8 (= 14.2.0-1),
 libatomic1 (= 14.2.0-1),
 libattr1 (= 1:2.5.2-1),
 libaudit-common (= 1:3.1.2-4),
 libaudit1 (= 1:3.1.2-4+b1),
 libb-hooks-op-check-perl (= 0.22-3+b2),
 libbambamc0 (= 0.0.50-6+b1),
 libbinutils (= 2.42.90.20240720-2),
 libbio-perl-perl (= 1.7.8-1),
 libblkid1 (= 2.40.2-1),
 libbrotli1 (= 1.1.0-2+b4),
 libbz2-1.0 (= 1.0.8-5.1),
 libc-bin (= 2.39-6),
 libc-dev-bin (= 2.39-6),
 libc6 (= 2.39-6),
 libc6-dev (= 2.39-6),
 libcap-ng0 (= 0.8.5-1+b1),
 libcap2 (= 1:2.66-5),
 libcapture-tiny-perl (= 0.48-2),
 libcc1-0 (= 14.2.0-1),
 libclass-c3-perl (= 0.35-2),
 libclass-data-inheritable-perl (= 0.08-3),
 libclass-load-perl (= 0.25-2),
 libclass-load-xs-perl (= 0.10-2+b4),
 libclass-xsaccessor-perl (= 1.19-4+b4),
 libclone-perl (= 0.46-1+b3),
 libcom-err2 (= 1.47.1-1),
 libconst-fast-perl (= 0.014-2),
 libcrypt-dev (= 1:4.4.36-4),
 libcrypt1 (= 1:4.4.36-4),
 libctf-nobfd0 (= 2.42.90.20240720-2),
 libctf0 (= 2.42.90.20240720-2),
 libcurl3t64-gnutls (= 8.9.1-1),
 libdata-compare-perl (= 1.29-1),
 libdata-optlist-perl (= 0.114-1),
 libdata-stag-perl (= 0.14-3),
 libdb5.3t64 (= 5.3.28+dfsg2-7),
 libdebconfclient0 (= 0.272),
 libdebhelper-perl (= 13.16),
 libdeflate0 (= 1.20-1),
 libdevel-callchecker-perl (= 0.009-1+b1),
 libdevel-globaldestruction-perl (= 0.14-4),
 libdevel-overloadinfo-perl (= 0.007-1),
 libdevel-stacktrace-perl (= 2.0500-1),
 libdist-checkconflicts-perl (= 0.11-2),
 libdpkg-perl (= 1.22.11),
 libdynaloader-functions-perl (= 0.004-1),
 libelf1t64 (= 0.191-2),
 libenv-path-perl (= 0.19-4),
 libeval-closure-perl (= 0.14-3),
 libexception-class-perl (= 1.45-1),
 libffi8 (= 3.4.6-1),
 libfile-chdir-perl (= 0.1008-1.2),
 libfile-find-rule-perl (= 0.34-3),
 libfile-stripnondeterminism-perl (= 1.14.0-1),
 libgcc-13-dev (= 13.3.0-4),
 libgcc-14-dev (= 14.2.0-1),
 libgcc-s1 (= 14.2.0-1),
 libgdbm-compat4t64 (= 1.23-6),
 libgdbm6t64 (= 1.23-6),
 libgmp10 (= 2:6.3.0+dfsg-2+b1),
 libgnutls30t64 (= 3.8.6-2),
 libgomp1 (= 14.2.0-1),
 libgprofng0 (= 2.42.90.20240720-2),
 libgssapi-krb5-2 (= 1.21.3-3),
 libhogweed6t64 (= 3.10-1),
 libhts3t64 (= 1.20+ds-1),
 libhtscodecs2 (= 1.6.0-1+b1),
 libhwasan0 (= 14.2.0-1),
 libicu72 (= 72.1-5),
 libidn2-0 (= 2.3.7-2),
 libio-string-perl (= 1.08-4),
 libisl23 (= 0.26-3+b2),
 libitm1 (= 14.2.0-1),
 libjansson4 (= 2.14-2+b2),
 libk5crypto3 (= 1.21.3-3),
 libkeyutils1 (= 1.6.3-3),
 libkrb5-3 (= 1.21.3-3),
 libkrb5support0 (= 1.21.3-3),
 libldap-2.5-0 (= 2.5.18+dfsg-2+b1),
 liblsan0 (= 14.2.0-1),
 liblzma5 (= 5.6.2-2),
 libmagic-mgc (= 1:5.45-3),
 libmagic1t64 (= 1:5.45-3),
 libmd0 (= 1.1.0-2),
 libmodule-implementation-perl (= 0.09-2),
 libmodule-runtime-conflicts-perl (= 0.003-2),
 libmodule-runtime-perl (= 0.016-2),
 libmoose-perl (= 2.2207-1+b2),
 libmount1 (= 2.40.2-1),
 libmpc3 (= 1.3.1-1+b2),
 libmpfr6 (= 4.2.1-1+b1),
 libmro-compat-perl (= 0.15-2),
 libncurses6 (= 6.5-2),
 libnettle8t64 (= 3.10-1),
 libnghttp2-14 (= 1.62.1-2),
 libnghttp3-9 (= 1.4.0-1),
 libngtcp2-16 (= 1.6.0-1),
 libngtcp2-crypto-gnutls8 (= 1.6.0-1),
 libnumber-compare-perl (= 0.03-3),
 libp11-kit0 (= 0.25.5-2),
 libpackage-deprecationmanager-perl (= 0.18-1),
 libpackage-stash-perl (= 0.40-1),
 libpackage-stash-xs-perl (= 0.30-1+b4),
 libpadwalker-perl (= 2.5-1+b6),
 libpam-modules (= 1.5.3-7),
 libpam-modules-bin (= 1.5.3-7),
 libpam-runtime (= 1.5.3-7),
 libpam0g (= 1.5.3-7),
 libparams-classify-perl (= 0.015-2+b4),
 libparams-util-perl (= 1.102-3+b1),
 libpath-tiny-perl (= 0.146-1),
 libpcre2-8-0 (= 10.42-4+b1),
 libperl5.40 (= 5.40.0-1),
 libpipeline1 (= 1.5.7-2),
 libpsl5t64 (= 0.21.2-1.1),
 libquadmath0 (= 14.2.0-1),
 librtmp1 (= 2.4+20151223.gitfa8646d.1-2+b4),
 libsasl2-2 (= 2.1.28+dfsg1-6),
 libsasl2-modules-db (= 2.1.28+dfsg1-6),
 libseccomp2 (= 2.5.5-1+b1),
 libselinux1 (= 3.5-2+b3),
 libsframe1 (= 2.42.90.20240720-2),
 libsmartcols1 (= 2.40.2-1),
 libssh2-1t64 (= 1.11.0-7),
 libssl3t64 (= 3.2.2-1),
 libstdc++-14-dev (= 14.2.0-1),
 libstdc++6 (= 14.2.0-1),
 libsub-exporter-perl (= 0.990-1),
 libsub-exporter-progressive-perl (= 0.001013-3),
 libsub-install-perl (= 0.929-1),
 libsub-uplevel-perl (= 0.2800-3),
 libsystemd0 (= 256.4-2),
 libtasn1-6 (= 4.19.0-3+b2),
 libtest-deep-perl (= 1.204-1),
 libtest-differences-perl (= 0.71-1),
 libtest-exception-perl (= 0.43-3),
 libtest-files-perl (= 0.26-1),
 libtest-most-perl (= 0.38-1),
 libtest-warn-perl (= 0.37-2),
 libtext-csv-perl (= 2.04-1),
 libtext-diff-perl (= 1.45-2),
 libtext-glob-perl (= 0.11-3),
 libtinfo6 (= 6.5-2),
 libtool (= 2.4.7-7),
 libtry-tiny-perl (= 0.31-2),
 libtsan2 (= 14.2.0-1),
 libubsan1 (= 14.2.0-1),
 libuchardet0 (= 0.0.8-1+b1),
 libudev1 (= 256.4-2),
 libunistring5 (= 1.2-1),
 libuuid1 (= 2.40.2-1),
 libxml2 (= 2.12.7+dfsg-3+b1),
 libzstd1 (= 1.5.6+dfsg-1),
 linux-libc-dev (= 6.9.12-1),
 m4 (= 1.4.19-4),
 make (= 4.3-4.1),
 man-db (= 2.12.1-2),
 mawk (= 1.3.4.20240622-2),
 ncurses-base (= 6.5-2),
 ncurses-bin (= 6.5-2),
 patch (= 2.7.6-7),
 perl (= 5.40.0-1),
 perl-base (= 5.40.0-1),
 perl-modules-5.40 (= 5.40.0-1),
 po-debconf (= 1.0.21+nmu1),
 rpcsvc-proto (= 1.4.3-1),
 samtools (= 1.20-3),
 sed (= 4.9-2),
 sensible-utils (= 0.0.24),
 smalt (= 0.7.6-13),
 sysvinit-utils (= 3.09-2),
 tabix (= 1.20+ds-1),
 tar (= 1.35+dfsg-3),
 usr-is-merged (= 39),
 util-linux (= 2.40.2-1),
 xz-utils (= 5.6.2-2),
 zlib1g (= 1:1.3.dfsg+really1.3.1-1)
Environment:
 DEB_BUILD_OPTIONS="parallel=2"
 LANG="C.UTF-8"
 LC_COLLATE="C.UTF-8"
 LC_CTYPE="C.UTF-8"
 LD_LIBRARY_PATH="/usr/lib/libeatmydata"
 SOURCE_DATE_EPOCH="1706193292"


+------------------------------------------------------------------------------+
| Package contents                                                             |
+------------------------------------------------------------------------------+


bio-tradis_1.4.5+dfsg2-2_all.deb
--------------------------------

 new Debian package, version 2.0.
 size 80060 bytes: control archive=2844 bytes.
     978 bytes,    21 lines      control
    6111 bytes,    77 lines      md5sums
 Package: bio-tradis
 Version: 1.4.5+dfsg2-2
 Architecture: all
 Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
 Installed-Size: 244
 Depends: perl:any, libbio-perl-perl, libexception-class-perl, libmoose-perl, libtext-csv-perl, libtry-tiny-perl, smalt, samtools, tabix, r-base-core, r-cran-getopt, r-cran-mass
 Recommends: artemis, r-bioc-edger
 Section: perl
 Priority: optional
 Homepage: https://github.com/sanger-pathogens/Bio-Tradis
 Description: analyse the output from TraDIS analyses of genomic sequences
  Bio-Tradis contains a set of tools to analyse the output from
  TraDIS analyses.
  .
  The Bio-Tradis analysis pipeline is implemented as an extensible Perl
  library which can either be used as is, or as a basis for the
  development of more advanced analysis tools.
  .
  Please note: You need to manually install BioConductor Edger which can
  not be distributed by Debian in recent version since it is using
  non-distributable code locfit.

drwxr-xr-x root/root         0 2024-01-25 14:34 ./
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/bin/
-rwxr-xr-x root/root       944 2024-01-25 14:34 ./usr/bin/add_tradis_tags
-rwxr-xr-x root/root       994 2024-01-25 14:34 ./usr/bin/bacteria_tradis
-rwxr-xr-x root/root       948 2024-01-25 14:34 ./usr/bin/check_tradis_tags
-rwxr-xr-x root/root      1267 2024-01-25 14:34 ./usr/bin/combine_tradis_plots
-rwxr-xr-x root/root      1045 2024-01-25 14:34 ./usr/bin/filter_tradis_tags
-rwxr-xr-x root/root      1037 2024-01-25 14:34 ./usr/bin/remove_tradis_tags
-rwxr-xr-x root/root      4510 2024-01-25 14:34 ./usr/bin/tradis_comparison
-rwxr-xr-x root/root      3639 2024-01-25 14:34 ./usr/bin/tradis_essentiality
-rwxr-xr-x root/root      9483 2024-01-25 14:34 ./usr/bin/tradis_gene_insert_sites
-rwxr-xr-x root/root      2946 2024-01-25 14:34 ./usr/bin/tradis_merge_plots
-rwxr-xr-x root/root      1022 2024-01-25 14:34 ./usr/bin/tradis_plot
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/doc/
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/doc/bio-tradis/
-rw-r--r-- root/root       590 2024-01-25 14:34 ./usr/share/doc/bio-tradis/README.Debian
-rw-r--r-- root/root      4392 2019-12-04 14:40 ./usr/share/doc/bio-tradis/README.md.gz
-rw-r--r-- root/root       877 2024-01-25 14:34 ./usr/share/doc/bio-tradis/changelog.Debian.gz
-rw-r--r-- root/root      2784 2019-12-04 14:40 ./usr/share/doc/bio-tradis/changelog.gz
-rw-r--r-- root/root      1022 2024-01-25 14:34 ./usr/share/doc/bio-tradis/copyright
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/man/
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/man/man1/
-rw-r--r-- root/root      1112 2024-01-25 14:34 ./usr/share/man/man1/add_tradis_tags.1p.gz
-rw-r--r-- root/root      1130 2024-01-25 14:34 ./usr/share/man/man1/bacteria_tradis.1p.gz
-rw-r--r-- root/root      1115 2024-01-25 14:34 ./usr/share/man/man1/check_tradis_tags.1p.gz
-rw-r--r-- root/root      1236 2024-01-25 14:34 ./usr/share/man/man1/combine_tradis_plots.1p.gz
-rw-r--r-- root/root      1144 2024-01-25 14:34 ./usr/share/man/man1/filter_tradis_tags.1p.gz
-rw-r--r-- root/root      1134 2024-01-25 14:34 ./usr/share/man/man1/remove_tradis_tags.1p.gz
-rw-r--r-- root/root       668 2024-01-25 14:34 ./usr/share/man/man1/tradis_comparison.1.gz
-rw-r--r-- root/root       670 2024-01-25 14:34 ./usr/share/man/man1/tradis_essentiality.1.gz
-rw-r--r-- root/root      1316 2024-01-25 14:34 ./usr/share/man/man1/tradis_gene_insert_sites.1p.gz
-rw-r--r-- root/root       450 2024-01-25 14:34 ./usr/share/man/man1/tradis_merge_plots.1.gz
-rw-r--r-- root/root      1135 2024-01-25 14:34 ./usr/share/man/man1/tradis_plot.1p.gz
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/man/man3/
-rw-r--r-- root/root      1382 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis.3pm.gz
-rw-r--r-- root/root      1646 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::AddTagsToSeq.3pm.gz
-rw-r--r-- root/root      1091 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Analysis::Exceptions.3pm.gz
-rw-r--r-- root/root      1233 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Analysis::InsertSite.3pm.gz
-rw-r--r-- root/root      1458 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CombinePlots.3pm.gz
-rw-r--r-- root/root      1106 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::AddTags.3pm.gz
-rw-r--r-- root/root      1102 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::CheckTags.3pm.gz
-rw-r--r-- root/root      1129 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::FilterFastqTags.3pm.gz
-rw-r--r-- root/root      1422 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::PlotCombine.3pm.gz
-rw-r--r-- root/root      1148 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::PlotTradis.3pm.gz
-rw-r--r-- root/root      1125 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::RemoveFastqTags.3pm.gz
-rw-r--r-- root/root      1129 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::RunMapping.3pm.gz
-rw-r--r-- root/root      1140 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::TradisAnalysis.3pm.gz
-rw-r--r-- root/root      1147 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::CommandLine::TradisBam.3pm.gz
-rw-r--r-- root/root      1290 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::DetectTags.3pm.gz
-rw-r--r-- root/root      1078 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Exception.3pm.gz
-rw-r--r-- root/root      1533 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::FilterTags.3pm.gz
-rw-r--r-- root/root      1645 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Map.3pm.gz
-rw-r--r-- root/root      1562 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Parser::Bam.3pm.gz
-rw-r--r-- root/root      1189 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Parser::Cigar.3pm.gz
-rw-r--r-- root/root      1255 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Parser::Fastq.3pm.gz
-rw-r--r-- root/root      1467 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::RemoveTags.3pm.gz
-rw-r--r-- root/root      1718 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::RunTradis.3pm.gz
-rw-r--r-- root/root      1163 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::Samtools.3pm.gz
-rw-r--r-- root/root      1448 2024-01-25 14:34 ./usr/share/man/man3/Bio::Tradis::TradisPlot.3pm.gz
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/perl5/
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/perl5/Bio/
-rw-r--r-- root/root      1350 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis.pm
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/perl5/Bio/Tradis/
-rw-r--r-- root/root      7008 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/AddTagsToSeq.pm
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/perl5/Bio/Tradis/Analysis/
-rw-r--r-- root/root      1480 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Analysis/Exceptions.pm
-rw-r--r-- root/root      7210 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Analysis/InsertSite.pm
-rw-r--r-- root/root      9094 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CombinePlots.pm
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/perl5/Bio/Tradis/CommandLine/
-rw-r--r-- root/root      2782 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/AddTags.pm
-rw-r--r-- root/root      2205 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/CheckTags.pm
-rw-r--r-- root/root      2908 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/FilterFastqTags.pm
-rw-r--r-- root/root      3438 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/PlotCombine.pm
-rw-r--r-- root/root      2680 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/PlotTradis.pm
-rw-r--r-- root/root      2865 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/RemoveFastqTags.pm
-rw-r--r-- root/root      4865 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/RunMapping.pm
-rw-r--r-- root/root     10482 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/TradisAnalysis.pm
-rw-r--r-- root/root      3232 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/CommandLine/TradisBam.pm
-rw-r--r-- root/root      1512 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/DetectTags.pm
-rw-r--r-- root/root       784 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Exception.pm
-rw-r--r-- root/root      4246 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/FilterTags.pm
-rw-r--r-- root/root      5058 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Map.pm
drwxr-xr-x root/root         0 2024-01-25 14:34 ./usr/share/perl5/Bio/Tradis/Parser/
-rw-r--r-- root/root      4852 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Parser/Bam.pm
-rw-r--r-- root/root      2072 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Parser/Cigar.pm
-rw-r--r-- root/root      2194 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/Parser/Fastq.pm
-rw-r--r-- root/root      3372 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/RemoveTags.pm
-rw-r--r-- root/root     17044 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/RunTradis.pm
-rw-r--r-- root/root      1502 2024-01-25 14:34 ./usr/share/perl5/Bio/Tradis/Samtools.pm
-rw-r--r-- root/root      1869 2019-12-04 14:40 ./usr/share/perl5/Bio/Tradis/TradisPlot.pm


+------------------------------------------------------------------------------+
| Post Build                                                                   |
+------------------------------------------------------------------------------+


+------------------------------------------------------------------------------+
| Cleanup                                                                      |
+------------------------------------------------------------------------------+

Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use

+------------------------------------------------------------------------------+
| Summary                                                                      |
+------------------------------------------------------------------------------+

Build Architecture: amd64
Build Type: full
Build-Space: 15004
Build-Time: 10
Distribution: perl-5.40-throwaway
Host Architecture: amd64
Install-Time: 6
Job: /srv/debomatic/incoming/bio-tradis_1.4.5+dfsg2-2.dsc
Machine Architecture: amd64
Package: bio-tradis
Package-Time: 25
Source-Version: 1.4.5+dfsg2-2
Space: 15004
Status: successful
Version: 1.4.5+dfsg2-2
--------------------------------------------------------------------------------
Finished at 2024-08-03T17:36:30Z
Build needed 00:00:25, 15004k disk space